>Feature sequence01 1569 439 gene locus_tag LOCUS_00010 1569 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_00010 2686 1808 gene locus_tag LOCUS_00020 2686 1808 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 protein_id gnl|my_center|LOCUS_00020 3306 2755 gene locus_tag LOCUS_00030 3306 2755 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_00030 3632 4867 gene locus_tag LOCUS_00040 3632 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5049 6152 gene locus_tag LOCUS_00050 5049 6152 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_00050 6172 8280 gene locus_tag LOCUS_00060 6172 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_00060 9623 8658 gene locus_tag LOCUS_00070 9623 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10723 9671 gene locus_tag LOCUS_00080 10723 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12360 11098 gene locus_tag LOCUS_00090 12360 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_00090 13079 13777 gene locus_tag LOCUS_00100 13079 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13872 14537 gene locus_tag LOCUS_00110 13872 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_00110 15290 14700 gene locus_tag LOCUS_00120 15290 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16421 17995 gene locus_tag LOCUS_00130 16421 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18255 19082 gene locus_tag LOCUS_00140 18255 19082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_00140 19146 19556 gene locus_tag LOCUS_00150 19146 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_00150 19920 21560 gene locus_tag LOCUS_00160 19920 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21738 23534 gene locus_tag LOCUS_00170 21738 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23762 24136 gene locus_tag LOCUS_00180 23762 24136 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_00180 24129 25550 gene locus_tag LOCUS_00190 24129 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25971 28244 gene locus_tag LOCUS_00200 gene katG 25971 28244 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_00200 29634 28630 gene locus_tag LOCUS_00210 29634 28630 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_00210 30198 31085 gene locus_tag LOCUS_00220 30198 31085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 31286 33625 gene locus_tag LOCUS_00230 31286 33625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 33628 34569 gene locus_tag LOCUS_00240 33628 34569 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967365.1 protein_id gnl|my_center|LOCUS_00240 34837 36036 gene locus_tag LOCUS_00250 34837 36036 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_00250 36241 37104 gene locus_tag LOCUS_00260 36241 37104 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_00260 37194 37922 gene locus_tag LOCUS_00270 37194 37922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 38166 38987 gene locus_tag LOCUS_00280 38166 38987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38984 39931 gene locus_tag LOCUS_00290 38984 39931 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199865.1 protein_id gnl|my_center|LOCUS_00290 39984 40916 gene locus_tag LOCUS_00300 39984 40916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40906 41682 gene locus_tag LOCUS_00310 40906 41682 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_00310 41663 42481 gene locus_tag LOCUS_00320 41663 42481 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_00320 42515 42904 gene locus_tag LOCUS_00330 42515 42904 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_00330 42901 43989 gene locus_tag LOCUS_00340 42901 43989 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_00340 44019 45383 gene locus_tag LOCUS_00350 44019 45383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_00350 45409 46062 gene locus_tag LOCUS_00360 45409 46062 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_00360 47491 46145 gene locus_tag LOCUS_00370 47491 46145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48309 47512 gene locus_tag LOCUS_00380 48309 47512 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_00380 49508 48261 gene locus_tag LOCUS_00390 49508 48261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49560 50336 gene locus_tag LOCUS_00400 49560 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 53375 50400 gene locus_tag LOCUS_00410 53375 50400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_00410 53788 54978 gene locus_tag LOCUS_00420 53788 54978 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257098.1 protein_id gnl|my_center|LOCUS_00420 55218 56420 gene locus_tag LOCUS_00430 55218 56420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 56631 57113 gene locus_tag LOCUS_00440 56631 57113 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948219.1 protein_id gnl|my_center|LOCUS_00440 57171 57710 gene locus_tag LOCUS_00450 57171 57710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 57723 59093 gene locus_tag LOCUS_00460 gene norM 57723 59093 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_00460 59248 59979 gene locus_tag LOCUS_00470 gene yueD 59248 59979 CDS product benzil reductase ((S)-benzoin forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32099 protein_id gnl|my_center|LOCUS_00470 60469 59966 gene locus_tag LOCUS_00480 gene sixA 60469 59966 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121948.1 protein_id gnl|my_center|LOCUS_00480 60686 62779 gene locus_tag LOCUS_00490 60686 62779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 64244 62784 gene locus_tag LOCUS_00500 64244 62784 CDS product PhoPQ-regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_00500 65296 64310 gene locus_tag LOCUS_00510 65296 64310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 67261 65876 gene locus_tag LOCUS_00520 67261 65876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_00520 69364 67424 gene locus_tag LOCUS_00530 69364 67424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 70840 69959 gene locus_tag LOCUS_00540 gene sucD 70840 69959 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_00540 71379 72659 gene locus_tag LOCUS_00550 71379 72659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 72701 73879 gene locus_tag LOCUS_00560 72701 73879 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_00560 73886 74524 gene locus_tag LOCUS_00570 73886 74524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_00570 74521 75741 gene locus_tag LOCUS_00580 74521 75741 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_00580 75752 76174 gene locus_tag LOCUS_00590 75752 76174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 76324 76740 gene locus_tag LOCUS_00600 76324 76740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 77181 76741 gene locus_tag LOCUS_00610 77181 76741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 77827 77162 gene locus_tag LOCUS_00620 77827 77162 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_00620 78396 77860 gene locus_tag LOCUS_00630 78396 77860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_00630 78446 78853 gene locus_tag LOCUS_00640 78446 78853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 80308 78884 gene locus_tag LOCUS_00650 gene dnaA 80308 78884 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_00650 80778 82652 gene locus_tag LOCUS_00660 80778 82652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 82847 83284 gene locus_tag LOCUS_00670 82847 83284 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340074.1 protein_id gnl|my_center|LOCUS_00670 83441 84001 gene locus_tag LOCUS_00680 83441 84001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 86204 84303 gene locus_tag LOCUS_00690 86204 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 87202 86345 gene locus_tag LOCUS_00700 87202 86345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 87920 89530 gene locus_tag LOCUS_00710 87920 89530 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101381.1 protein_id gnl|my_center|LOCUS_00710 89567 90160 gene locus_tag LOCUS_00720 89567 90160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 90162 91067 gene locus_tag LOCUS_00730 gene cysD 90162 91067 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_00730 91218 92477 gene locus_tag LOCUS_00740 gene cysN 91218 92477 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_00740 92624 93382 gene locus_tag LOCUS_00750 92624 93382 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_00750 94247 95650 gene locus_tag LOCUS_00760 gene ugd 94247 95650 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_00760 96325 95960 gene locus_tag LOCUS_00770 96325 95960 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_00770 97184 96624 gene locus_tag LOCUS_00780 97184 96624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 97559 98170 gene locus_tag LOCUS_00790 97559 98170 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_00790 98301 99350 gene locus_tag LOCUS_00800 98301 99350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 99456 102767 gene locus_tag LOCUS_00810 99456 102767 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_00810 102789 104303 gene locus_tag LOCUS_00820 102789 104303 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_00820 106207 104882 gene locus_tag LOCUS_00830 106207 104882 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_00830 106392 107057 gene locus_tag LOCUS_00840 106392 107057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 107060 108382 gene locus_tag LOCUS_00850 107060 108382 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_00850 109462 108392 gene locus_tag LOCUS_00860 109462 108392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 109796 111385 gene locus_tag LOCUS_00870 109796 111385 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_00870 111854 112303 gene locus_tag LOCUS_00880 111854 112303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 112303 112986 gene locus_tag LOCUS_00890 112303 112986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 113673 113212 gene locus_tag LOCUS_00900 113673 113212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 114250 115893 gene locus_tag LOCUS_00910 114250 115893 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_00910 115914 117404 gene locus_tag LOCUS_00920 115914 117404 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_00920 117444 118757 gene locus_tag LOCUS_00930 gene xylA 117444 118757 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_00930 120434 119019 gene locus_tag LOCUS_00940 gene uxaB 120434 119019 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_00940 121140 122546 gene locus_tag LOCUS_00950 121140 122546 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_00950 122575 123843 gene locus_tag LOCUS_00960 122575 123843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 123928 125052 gene locus_tag LOCUS_00970 123928 125052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 125063 125950 gene locus_tag LOCUS_00980 125063 125950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 126136 128232 gene locus_tag LOCUS_00990 126136 128232 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_00990 128532 128221 gene locus_tag LOCUS_01000 128532 128221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 130165 129098 gene locus_tag LOCUS_01010 gene fbaA 130165 129098 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_01010 130365 131228 gene locus_tag LOCUS_01020 130365 131228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_01020 132125 131334 gene locus_tag LOCUS_01030 132125 131334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_01030 132302 133249 gene locus_tag LOCUS_01040 132302 133249 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_01040 133519 133926 gene locus_tag LOCUS_01050 133519 133926 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_01050 133919 135124 gene locus_tag LOCUS_01060 133919 135124 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_01060 136467 135241 gene locus_tag LOCUS_01070 136467 135241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 136601 137782 gene locus_tag LOCUS_01080 136601 137782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 139130 137796 gene locus_tag LOCUS_01090 gene exoT 139130 137796 CDS product succinoglycan biosynthesis transport protein ExoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33699 protein_id gnl|my_center|LOCUS_01090 140260 139127 gene locus_tag LOCUS_01100 140260 139127 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_01100 141181 140273 gene locus_tag LOCUS_01110 141181 140273 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_01110 142601 141174 gene locus_tag LOCUS_01120 142601 141174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 protein_id gnl|my_center|LOCUS_01120 144761 142620 gene locus_tag LOCUS_01130 144761 142620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_01130 145521 144763 gene locus_tag LOCUS_01140 145521 144763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 145674 146336 gene locus_tag LOCUS_01150 145674 146336 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257512.1 protein_id gnl|my_center|LOCUS_01150 146383 147084 gene locus_tag LOCUS_01160 146383 147084 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_01160 151388 147261 gene locus_tag LOCUS_01170 151388 147261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 151597 152763 gene locus_tag LOCUS_01180 151597 152763 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_01180 153042 153791 gene locus_tag LOCUS_01190 153042 153791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 153931 154518 gene locus_tag LOCUS_01200 153931 154518 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_01200 154666 155658 gene locus_tag LOCUS_01210 154666 155658 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_01210 155828 159076 gene locus_tag LOCUS_01220 155828 159076 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_01220 159063 160769 gene locus_tag LOCUS_01230 159063 160769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_01230 161266 162747 gene locus_tag LOCUS_01240 161266 162747 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_01240 162833 164545 gene locus_tag LOCUS_01250 162833 164545 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_01250 164886 166568 gene locus_tag LOCUS_01260 164886 166568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 166742 168469 gene locus_tag LOCUS_01270 gene atsA 166742 168469 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_01270 168532 170502 gene locus_tag LOCUS_01280 168532 170502 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_01280 170994 171800 gene locus_tag LOCUS_01290 170994 171800 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_01290 171797 172927 gene locus_tag LOCUS_01300 171797 172927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 173786 173370 gene locus_tag LOCUS_01310 173786 173370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395634.1 protein_id gnl|my_center|LOCUS_01310 174426 173818 gene locus_tag LOCUS_01320 174426 173818 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_01320 175536 174592 gene locus_tag LOCUS_01330 175536 174592 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_01330 177070 175616 gene locus_tag LOCUS_01340 177070 175616 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_01340 178101 177610 gene locus_tag LOCUS_01350 178101 177610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 178566 178135 gene locus_tag LOCUS_01360 178566 178135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 179062 178547 gene locus_tag LOCUS_01370 179062 178547 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_01370 179600 180178 gene locus_tag LOCUS_01380 179600 180178 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_01380 180224 181219 gene locus_tag LOCUS_01390 180224 181219 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_01390 181414 185034 gene locus_tag LOCUS_01400 181414 185034 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_01400 185021 186724 gene locus_tag LOCUS_01410 185021 186724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_01410 188473 187088 gene locus_tag LOCUS_01420 188473 187088 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_01420 191735 188508 gene locus_tag LOCUS_01430 191735 188508 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_01430 192846 191761 gene locus_tag LOCUS_01440 192846 191761 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_01440 193411 192974 gene locus_tag LOCUS_01450 193411 192974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 194686 193787 gene locus_tag LOCUS_01460 194686 193787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_01460 195179 194922 gene locus_tag LOCUS_01470 195179 194922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 196318 195242 gene locus_tag LOCUS_01480 196318 195242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 198564 196573 gene locus_tag LOCUS_01490 198564 196573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 200493 198652 gene locus_tag LOCUS_01500 200493 198652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 200903 202120 gene locus_tag LOCUS_01510 200903 202120 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_01510 202675 202857 gene locus_tag LOCUS_01520 202675 202857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 203507 204094 gene locus_tag LOCUS_01530 203507 204094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 204084 204530 gene locus_tag LOCUS_01540 204084 204530 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_01540 204961 205989 gene locus_tag LOCUS_01550 204961 205989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 206159 206662 gene locus_tag LOCUS_01560 206159 206662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 206975 207424 gene locus_tag LOCUS_01570 206975 207424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 207551 210085 gene locus_tag LOCUS_01580 207551 210085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 210620 211078 gene locus_tag LOCUS_01590 210620 211078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 211658 211137 gene locus_tag LOCUS_01600 211658 211137 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_01600 212388 213263 gene locus_tag LOCUS_01610 212388 213263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_01610 214299 213286 gene locus_tag LOCUS_01620 214299 213286 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_01620 214886 217015 gene locus_tag LOCUS_01630 214886 217015 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR9 protein_id gnl|my_center|LOCUS_01630 217274 217200 gene locus_tag LOCUS_t00010 217274 217200 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 217672 217598 gene locus_tag LOCUS_t00020 217672 217598 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 218098 218823 gene locus_tag LOCUS_01640 218098 218823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_01640 220081 219197 gene locus_tag LOCUS_01650 220081 219197 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_01650 221332 220157 gene locus_tag LOCUS_01660 221332 220157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 222920 221340 gene locus_tag LOCUS_01670 gene pckA2 222920 221340 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_01670 224019 223159 gene locus_tag LOCUS_01680 gene menB 224019 223159 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_01680 224109 225170 gene locus_tag LOCUS_01690 gene menE 224109 225170 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_01690 225167 225595 gene locus_tag LOCUS_01700 225167 225595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_01700 227545 225818 gene locus_tag LOCUS_01710 227545 225818 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_01710 227748 228170 gene locus_tag LOCUS_01720 227748 228170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 229335 228361 gene locus_tag LOCUS_01730 gene trpS 229335 228361 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_01730 229446 230504 gene locus_tag LOCUS_01740 229446 230504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 230682 231653 gene locus_tag LOCUS_01750 230682 231653 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_01750 231657 233231 gene locus_tag LOCUS_01760 231657 233231 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_01760 233268 233645 gene locus_tag LOCUS_01770 233268 233645 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_01770 234085 236046 gene locus_tag LOCUS_01780 gene gyrB 234085 236046 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 protein_id gnl|my_center|LOCUS_01780 236157 238280 gene locus_tag LOCUS_01790 236157 238280 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_01790 238610 238401 gene locus_tag LOCUS_01800 238610 238401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 238963 238688 gene locus_tag LOCUS_01810 238963 238688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 239086 240000 gene locus_tag LOCUS_01820 239086 240000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_01820 240655 241551 gene locus_tag LOCUS_01830 240655 241551 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_01830 241705 243087 gene locus_tag LOCUS_01840 241705 243087 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_01840 243084 243914 gene locus_tag LOCUS_01850 243084 243914 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_01850 243927 245069 gene locus_tag LOCUS_01860 243927 245069 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067533.1 protein_id gnl|my_center|LOCUS_01860 245082 245852 gene locus_tag LOCUS_01870 245082 245852 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_01870 245966 246193 gene locus_tag LOCUS_01880 245966 246193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 246190 247611 gene locus_tag LOCUS_01890 246190 247611 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208498.1 protein_id gnl|my_center|LOCUS_01890 248841 247837 gene locus_tag LOCUS_01900 gene socC 248841 247837 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_01900 249335 249721 gene locus_tag LOCUS_01910 249335 249721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 250024 250209 gene locus_tag LOCUS_01920 250024 250209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 250379 253183 gene locus_tag LOCUS_01930 250379 253183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 253180 254667 gene locus_tag LOCUS_01940 253180 254667 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_01940 254673 256124 gene locus_tag LOCUS_01950 254673 256124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 257189 256233 gene locus_tag LOCUS_01960 257189 256233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 258452 257481 gene locus_tag LOCUS_01970 258452 257481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 261739 258779 gene locus_tag LOCUS_01980 261739 258779 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_01980 262053 262238 gene locus_tag LOCUS_01990 262053 262238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 262973 262341 gene locus_tag LOCUS_02000 262973 262341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 263510 263965 gene locus_tag LOCUS_02010 263510 263965 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_02010 264326 264505 gene locus_tag LOCUS_02020 264326 264505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 265277 265915 gene locus_tag LOCUS_02030 265277 265915 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_02030 265933 266514 gene locus_tag LOCUS_02040 265933 266514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_02040 266612 266977 gene locus_tag LOCUS_02050 266612 266977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_02050 267090 267827 gene locus_tag LOCUS_02060 267090 267827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 268186 269013 gene locus_tag LOCUS_02070 268186 269013 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109398.1 protein_id gnl|my_center|LOCUS_02070 269990 269208 gene locus_tag LOCUS_02080 269990 269208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 271010 270150 gene locus_tag LOCUS_02090 271010 270150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 271228 271680 gene locus_tag LOCUS_02100 271228 271680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 271909 272649 gene locus_tag LOCUS_02110 271909 272649 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_02110 274865 273039 gene locus_tag LOCUS_02120 274865 273039 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_02120 277949 274884 gene locus_tag LOCUS_02130 277949 274884 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_02130 278713 279342 gene locus_tag LOCUS_02140 278713 279342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 279406 281859 gene locus_tag LOCUS_02150 gene ccoI 279406 281859 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_02150 281850 282032 gene locus_tag LOCUS_02160 281850 282032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 282034 284166 gene locus_tag LOCUS_02170 gene ccoN/ccoO 282034 284166 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_02170 284178 284369 gene locus_tag LOCUS_02180 284178 284369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 284401 285282 gene locus_tag LOCUS_02190 284401 285282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 285341 286756 gene locus_tag LOCUS_02200 gene ccoG 285341 286756 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_02200 286778 287203 gene locus_tag LOCUS_02210 286778 287203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 287204 287917 gene locus_tag LOCUS_02220 287204 287917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_02220 288470 287925 gene locus_tag LOCUS_02230 288470 287925 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389208.1 protein_id gnl|my_center|LOCUS_02230 288785 289357 gene locus_tag LOCUS_02240 288785 289357 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_02240 289471 290802 gene locus_tag LOCUS_02250 289471 290802 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_02250 291609 290827 gene locus_tag LOCUS_02260 291609 290827 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_02260 292711 291620 gene locus_tag LOCUS_02270 292711 291620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 295242 292717 gene locus_tag LOCUS_02280 295242 292717 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368537.1 protein_id gnl|my_center|LOCUS_02280 297190 295961 gene locus_tag LOCUS_02290 297190 295961 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_02290 297655 300849 gene locus_tag LOCUS_02300 297655 300849 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_02300 300877 302652 gene locus_tag LOCUS_02310 300877 302652 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_02310 302989 303411 gene locus_tag LOCUS_02320 302989 303411 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_02320 303923 305008 gene locus_tag LOCUS_02330 303923 305008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 305092 305904 gene locus_tag LOCUS_02340 305092 305904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 305907 308354 gene locus_tag LOCUS_02350 gene wzc 305907 308354 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_02350 308540 309586 gene locus_tag LOCUS_02360 gene rmlB 308540 309586 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_02360 309598 310392 gene locus_tag LOCUS_02370 gene thyA 309598 310392 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_02370 311221 310424 gene locus_tag LOCUS_02380 311221 310424 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 protein_id gnl|my_center|LOCUS_02380 311461 312801 gene locus_tag LOCUS_02390 311461 312801 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_02390 312814 314121 gene locus_tag LOCUS_02400 312814 314121 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02400 315377 314202 gene locus_tag LOCUS_02410 gene metZ 315377 314202 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_02410 316494 315844 gene locus_tag LOCUS_02420 316494 315844 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974692.1 protein_id gnl|my_center|LOCUS_02420 316807 317880 gene locus_tag LOCUS_02430 316807 317880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_02430 318009 319481 gene locus_tag LOCUS_02440 318009 319481 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_02440 321149 319509 gene locus_tag LOCUS_02450 321149 319509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 322299 321142 gene locus_tag LOCUS_02460 322299 321142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 325061 322299 gene locus_tag LOCUS_02470 325061 322299 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_02470 325759 325058 gene locus_tag LOCUS_02480 325759 325058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 326188 327474 gene locus_tag LOCUS_02490 326188 327474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 328456 327656 gene locus_tag LOCUS_02500 328456 327656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_02500 329790 328567 gene locus_tag LOCUS_02510 gene queA 329790 328567 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_02510 329996 331099 gene locus_tag LOCUS_02520 329996 331099 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 protein_id gnl|my_center|LOCUS_02520 331143 332567 gene locus_tag LOCUS_02530 331143 332567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_02530 332564 333721 gene locus_tag LOCUS_02540 332564 333721 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_02540 333824 335551 gene locus_tag LOCUS_02550 333824 335551 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_02550 337128 335845 gene locus_tag LOCUS_02560 337128 335845 CDS product cephalosporin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108337.1 protein_id gnl|my_center|LOCUS_02560 337539 337285 gene locus_tag LOCUS_02570 337539 337285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 337641 338099 gene locus_tag LOCUS_02580 337641 338099 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_02580 338961 338434 gene locus_tag LOCUS_02590 gene yorS 338961 338434 CDS product 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68522 protein_id gnl|my_center|LOCUS_02590 339560 338958 gene locus_tag LOCUS_02600 339560 338958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 340955 339774 gene locus_tag LOCUS_02610 gene argD 340955 339774 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_02610 341221 341982 gene locus_tag LOCUS_02620 341221 341982 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_02620 342011 343354 gene locus_tag LOCUS_02630 342011 343354 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_02630 343872 343429 gene locus_tag LOCUS_02640 343872 343429 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_02640 344058 344849 gene locus_tag LOCUS_02650 344058 344849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 protein_id gnl|my_center|LOCUS_02650 344912 346393 gene locus_tag LOCUS_02660 344912 346393 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_02660 346383 347015 gene locus_tag LOCUS_02670 gene pncA 346383 347015 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 protein_id gnl|my_center|LOCUS_02670 347751 347203 gene locus_tag LOCUS_02680 gene ftnA 347751 347203 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_02680 349735 347918 gene locus_tag LOCUS_02690 gene gaa 349735 347918 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_02690 349968 350702 gene locus_tag LOCUS_02700 gene kdsB 349968 350702 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_02700 351434 350724 gene locus_tag LOCUS_02710 351434 350724 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_02710 351545 352006 gene locus_tag LOCUS_02720 351545 352006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 353289 352129 gene locus_tag LOCUS_02730 gene nagX 353289 352129 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_02730 353740 354492 gene locus_tag LOCUS_02740 gene nagB 353740 354492 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_02740 355390 354794 gene locus_tag LOCUS_02750 355390 354794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 protein_id gnl|my_center|LOCUS_02750 356862 355396 gene locus_tag LOCUS_02760 356862 355396 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_02760 359766 356875 gene locus_tag LOCUS_02770 359766 356875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_02770 360533 360192 gene locus_tag LOCUS_02780 gene gldC 360533 360192 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_02780 361259 360591 gene locus_tag LOCUS_02790 gene liuG 361259 360591 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_02790 361961 361266 gene locus_tag LOCUS_02800 gene atoD 361961 361266 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_02800 362904 361951 gene locus_tag LOCUS_02810 gene ribF 362904 361951 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_02810 363580 362891 gene locus_tag LOCUS_02820 gene truB 363580 362891 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_02820 364374 363580 gene locus_tag LOCUS_02830 gene uppP 364374 363580 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_02830 364584 364381 gene locus_tag LOCUS_02840 364584 364381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 365480 364590 gene locus_tag LOCUS_02850 365480 364590 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_02850 366206 365523 gene locus_tag LOCUS_02860 366206 365523 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_02860 366578 367204 gene locus_tag LOCUS_02870 366578 367204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 370914 367201 gene locus_tag LOCUS_02880 370914 367201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 371412 372248 gene locus_tag LOCUS_02890 371412 372248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 372915 372403 gene locus_tag LOCUS_02900 372915 372403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 373675 373217 gene locus_tag LOCUS_02910 373675 373217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 374394 373813 gene locus_tag LOCUS_02920 374394 373813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 375263 374448 gene locus_tag LOCUS_02930 375263 374448 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_02930 375994 375452 gene locus_tag LOCUS_02940 375994 375452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_02940 376901 376305 gene locus_tag LOCUS_02950 gene ydeI 376901 376305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_02950 378599 377202 gene locus_tag LOCUS_02960 378599 377202 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_02960 380236 378596 gene locus_tag LOCUS_02970 380236 378596 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_02970 381294 380323 gene locus_tag LOCUS_02980 381294 380323 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_02980 382661 381312 gene locus_tag LOCUS_02990 gene cht1 382661 381312 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_02990 384311 382833 gene locus_tag LOCUS_03000 gene gbsA 384311 382833 CDS product betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71016 protein_id gnl|my_center|LOCUS_03000 385978 384308 gene locus_tag LOCUS_03010 gene betA 385978 384308 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_03010 387198 386071 gene locus_tag LOCUS_03020 387198 386071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_03020 389727 387283 gene locus_tag LOCUS_03030 gene helX 389727 387283 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118436.1 protein_id gnl|my_center|LOCUS_03030 390583 390242 gene locus_tag LOCUS_03040 gene phnA 390583 390242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914988.1 protein_id gnl|my_center|LOCUS_03040 392131 391025 gene locus_tag LOCUS_03050 392131 391025 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_03050 393319 392318 gene locus_tag LOCUS_03060 393319 392318 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_03060 393739 393512 gene locus_tag LOCUS_03070 393739 393512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 393621 394367 gene locus_tag LOCUS_03080 393621 394367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 394386 394949 gene locus_tag LOCUS_03090 394386 394949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 395249 395770 gene locus_tag LOCUS_03100 395249 395770 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764987.1 protein_id gnl|my_center|LOCUS_03100 395897 396844 gene locus_tag LOCUS_03110 395897 396844 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_03110 397038 400421 gene locus_tag LOCUS_03120 397038 400421 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_03120 400503 401945 gene locus_tag LOCUS_03130 400503 401945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_03130 402029 403309 gene locus_tag LOCUS_03140 gene GALNS 402029 403309 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_03140 403482 403865 gene locus_tag LOCUS_03150 403482 403865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 404150 403899 gene locus_tag LOCUS_03160 404150 403899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 405742 404153 gene locus_tag LOCUS_03170 405742 404153 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_03170 405933 406553 gene locus_tag LOCUS_03180 405933 406553 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_03180 406830 407888 gene locus_tag LOCUS_03190 406830 407888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 408040 411483 gene locus_tag LOCUS_03200 408040 411483 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_03200 411502 413154 gene locus_tag LOCUS_03210 411502 413154 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_03210 413431 414756 gene locus_tag LOCUS_03220 413431 414756 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_03220 415254 414877 gene locus_tag LOCUS_03230 415254 414877 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_03230 416521 415247 gene locus_tag LOCUS_03240 416521 415247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 416745 417005 gene locus_tag LOCUS_03250 416745 417005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 418150 417746 gene locus_tag LOCUS_03260 418150 417746 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_03260 420113 418143 gene locus_tag LOCUS_03270 420113 418143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 422314 420845 gene locus_tag LOCUS_03280 422314 420845 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_03280 423717 422605 gene locus_tag LOCUS_03290 423717 422605 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_03290 424618 423758 gene locus_tag LOCUS_03300 424618 423758 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_03300 428137 424640 gene locus_tag LOCUS_03310 428137 424640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 428291 429169 gene locus_tag LOCUS_03320 gene mtlR 428291 429169 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_03320 429654 429253 gene locus_tag LOCUS_03330 429654 429253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_03330 430746 429772 gene locus_tag LOCUS_03340 430746 429772 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_03340 432393 431437 gene locus_tag LOCUS_03350 432393 431437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 432293 432493 gene locus_tag LOCUS_03360 432293 432493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 434742 432487 gene locus_tag LOCUS_03370 434742 432487 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_03370 435174 434962 gene locus_tag LOCUS_03380 435174 434962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_03380 435618 435187 gene locus_tag LOCUS_03390 435618 435187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_03390 435924 437204 gene locus_tag LOCUS_03400 435924 437204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_03400 438874 437546 gene locus_tag LOCUS_03410 gene argH 438874 437546 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_03410 439956 438871 gene locus_tag LOCUS_03420 439956 438871 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_03420 440784 439999 gene locus_tag LOCUS_03430 gene argB 440784 439999 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_03430 441738 440797 gene locus_tag LOCUS_03440 441738 440797 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_03440 442891 441746 gene locus_tag LOCUS_03450 gene argD 442891 441746 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_03450 443906 442944 gene locus_tag LOCUS_03460 gene argC 443906 442944 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_03460 445104 443899 gene locus_tag LOCUS_03470 445104 443899 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_03470 445877 445161 gene locus_tag LOCUS_03480 445877 445161 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_03480 446430 447629 gene locus_tag LOCUS_03490 446430 447629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 447629 449632 gene locus_tag LOCUS_03500 447629 449632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 449626 450783 gene locus_tag LOCUS_03510 449626 450783 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYG9 protein_id gnl|my_center|LOCUS_03510 452409 450802 gene locus_tag LOCUS_03520 452409 450802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 453123 452410 gene locus_tag LOCUS_03530 453123 452410 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107316.1 protein_id gnl|my_center|LOCUS_03530 453718 453326 gene locus_tag LOCUS_03540 453718 453326 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974224.1 protein_id gnl|my_center|LOCUS_03540 454792 453737 gene locus_tag LOCUS_03550 gene metX 454792 453737 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK89 protein_id gnl|my_center|LOCUS_03550 456107 454803 gene locus_tag LOCUS_03560 gene MET17 456107 454803 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 protein_id gnl|my_center|LOCUS_03560 456743 458548 gene locus_tag LOCUS_03570 456743 458548 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_03570 458571 459725 gene locus_tag LOCUS_03580 gene iscS 458571 459725 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_03580 459735 460220 gene locus_tag LOCUS_03590 gene moaC 459735 460220 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_03590 460255 461382 gene locus_tag LOCUS_03600 460255 461382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 461441 462631 gene locus_tag LOCUS_03610 gene rlmL 461441 462631 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_03610 465016 462911 gene locus_tag LOCUS_03620 465016 462911 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_03620 466151 465024 gene locus_tag LOCUS_03630 466151 465024 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_03630 467486 466254 gene locus_tag LOCUS_03640 467486 466254 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_03640 468965 467595 gene locus_tag LOCUS_03650 468965 467595 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_03650 470640 468958 gene locus_tag LOCUS_03660 470640 468958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 470910 471455 gene locus_tag LOCUS_03670 470910 471455 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_03670 471493 472551 gene locus_tag LOCUS_03680 471493 472551 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266300.1 protein_id gnl|my_center|LOCUS_03680 472529 472819 gene locus_tag LOCUS_03690 472529 472819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 472959 474629 gene locus_tag LOCUS_03700 472959 474629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_03700 475333 474626 gene locus_tag LOCUS_03710 475333 474626 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_03710 476690 475470 gene locus_tag LOCUS_03720 476690 475470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_03720 478080 477103 gene locus_tag LOCUS_03730 478080 477103 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_03730 478469 478894 gene locus_tag LOCUS_03740 gene phnB 478469 478894 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_03740 479644 480513 gene locus_tag LOCUS_03750 479644 480513 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L4R7 protein_id gnl|my_center|LOCUS_03750 480893 480732 gene locus_tag LOCUS_03760 480893 480732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 481015 481539 gene locus_tag LOCUS_03770 481015 481539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 481786 482109 gene locus_tag LOCUS_03780 481786 482109 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_03780 484268 482394 gene locus_tag LOCUS_03790 gene kefB 484268 482394 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_03790 484857 484273 gene locus_tag LOCUS_03800 484857 484273 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_03800 485681 486277 gene locus_tag LOCUS_03810 485681 486277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 486280 487137 gene locus_tag LOCUS_03820 486280 487137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 487149 489122 gene locus_tag LOCUS_03830 487149 489122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 489157 489585 gene locus_tag LOCUS_03840 489157 489585 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_03840 489588 490028 gene locus_tag LOCUS_03850 489588 490028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 490028 490177 gene locus_tag LOCUS_03860 490028 490177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 490183 490881 gene locus_tag LOCUS_03870 490183 490881 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_03870 490891 492612 gene locus_tag LOCUS_03880 490891 492612 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_03880 492620 492913 gene locus_tag LOCUS_03890 492620 492913 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_03890 492928 493338 gene locus_tag LOCUS_03900 492928 493338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974730.1 protein_id gnl|my_center|LOCUS_03900 493344 496535 gene locus_tag LOCUS_03910 493344 496535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 496539 499223 gene locus_tag LOCUS_03920 496539 499223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 499235 501871 gene locus_tag LOCUS_03930 499235 501871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 502135 503610 gene locus_tag LOCUS_03940 502135 503610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 503621 505468 gene locus_tag LOCUS_03950 503621 505468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 505533 509000 gene locus_tag LOCUS_03960 505533 509000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 509001 509888 gene locus_tag LOCUS_03970 509001 509888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 509914 511218 gene locus_tag LOCUS_03980 509914 511218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 511265 512047 gene locus_tag LOCUS_03990 511265 512047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337191.1 protein_id gnl|my_center|LOCUS_03990 512375 512719 gene locus_tag LOCUS_04000 512375 512719 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_04000 512731 514083 gene locus_tag LOCUS_04010 512731 514083 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_04010 514109 515350 gene locus_tag LOCUS_04020 514109 515350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_04020 517239 515497 gene locus_tag LOCUS_04030 517239 515497 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_04030 517531 517998 gene locus_tag LOCUS_04040 517531 517998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_04040 518320 518514 gene locus_tag LOCUS_04050 518320 518514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04050 518515 518736 gene locus_tag LOCUS_04060 518515 518736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 519882 518842 gene locus_tag LOCUS_04070 gene ilvE 519882 518842 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_04070 520088 521566 gene locus_tag LOCUS_04080 520088 521566 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_04080 524053 521594 gene locus_tag LOCUS_04090 524053 521594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405046.1 protein_id gnl|my_center|LOCUS_04090 524953 524132 gene locus_tag LOCUS_04100 gene hpaA 524953 524132 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 protein_id gnl|my_center|LOCUS_04100 525361 525975 gene locus_tag LOCUS_04110 525361 525975 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_04110 526161 527123 gene locus_tag LOCUS_04120 526161 527123 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_04120 527243 530455 gene locus_tag LOCUS_04130 527243 530455 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_04130 530553 532088 gene locus_tag LOCUS_04140 530553 532088 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_04140 536304 532366 gene locus_tag LOCUS_04150 536304 532366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 536816 538093 gene locus_tag LOCUS_04160 536816 538093 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_04160 538694 539695 gene locus_tag LOCUS_04170 538694 539695 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_04170 539711 540742 gene locus_tag LOCUS_04180 539711 540742 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_04180 541221 548870 gene locus_tag LOCUS_04190 541221 548870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 550636 549167 gene locus_tag LOCUS_04200 550636 549167 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_04200 551388 550978 gene locus_tag LOCUS_04210 551388 550978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 552116 551385 gene locus_tag LOCUS_04220 552116 551385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 553228 552521 gene locus_tag LOCUS_04230 553228 552521 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_04230 553523 553302 gene locus_tag LOCUS_04240 553523 553302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 553417 554346 gene locus_tag LOCUS_04250 gene panE 553417 554346 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZX7 protein_id gnl|my_center|LOCUS_04250 555023 554385 gene locus_tag LOCUS_04260 555023 554385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 protein_id gnl|my_center|LOCUS_04260 557001 555304 gene locus_tag LOCUS_04270 557001 555304 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_04270 558549 557263 gene locus_tag LOCUS_04280 gene gltA 558549 557263 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_04280 559261 558845 gene locus_tag LOCUS_04290 gene yqiW 559261 558845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_04290 559635 559285 gene locus_tag LOCUS_04300 559635 559285 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_04300 560059 559628 gene locus_tag LOCUS_04310 560059 559628 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_04310 561315 560059 gene locus_tag LOCUS_04320 561315 560059 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_04320 562597 561290 gene locus_tag LOCUS_04330 gene sufD 562597 561290 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_04330 563384 562623 gene locus_tag LOCUS_04340 gene sufC 563384 562623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_04340 564842 563397 gene locus_tag LOCUS_04350 gene sufB 564842 563397 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_04350 565569 565096 gene locus_tag LOCUS_04360 565569 565096 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_04360 565986 568766 gene locus_tag LOCUS_04370 565986 568766 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_04370 569845 568820 gene locus_tag LOCUS_04380 gene ccpA 569845 568820 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_04380 570213 571460 gene locus_tag LOCUS_04390 570213 571460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 571498 572370 gene locus_tag LOCUS_04400 571498 572370 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385614.1 protein_id gnl|my_center|LOCUS_04400 572427 573848 gene locus_tag LOCUS_04410 572427 573848 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_04410 573868 575022 gene locus_tag LOCUS_04420 gene uxuA 573868 575022 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_04420 575420 576334 gene locus_tag LOCUS_04430 575420 576334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 576643 577209 gene locus_tag LOCUS_04440 576643 577209 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_04440 577371 578339 gene locus_tag LOCUS_04450 577371 578339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 578542 581985 gene locus_tag LOCUS_04460 578542 581985 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791968.1 protein_id gnl|my_center|LOCUS_04460 581998 583995 gene locus_tag LOCUS_04470 581998 583995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_04470 584808 587831 gene locus_tag LOCUS_04480 584808 587831 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_04480 587831 589561 gene locus_tag LOCUS_04490 587831 589561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 589861 591342 gene locus_tag LOCUS_04500 589861 591342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 591505 592893 gene locus_tag LOCUS_04510 gene phoD 591505 592893 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_04510 593185 596253 gene locus_tag LOCUS_04520 593185 596253 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_04520 596266 597903 gene locus_tag LOCUS_04530 596266 597903 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_04530 598432 599895 gene locus_tag LOCUS_04540 598432 599895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 599973 600560 gene locus_tag LOCUS_04550 599973 600560 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_04550 600673 601659 gene locus_tag LOCUS_04560 600673 601659 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_04560 601792 605124 gene locus_tag LOCUS_04570 601792 605124 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_04570 605143 606726 gene locus_tag LOCUS_04580 605143 606726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_04580 607005 608438 gene locus_tag LOCUS_04590 gene GALNS 607005 608438 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_04590 608515 609912 gene locus_tag LOCUS_04600 608515 609912 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_04600 609925 611466 gene locus_tag LOCUS_04610 609925 611466 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_04610 612822 611476 gene locus_tag LOCUS_04620 612822 611476 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP3 protein_id gnl|my_center|LOCUS_04620 613203 614702 gene locus_tag LOCUS_04630 613203 614702 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_04630 614795 617488 gene locus_tag LOCUS_04640 614795 617488 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_04640 617531 619729 gene locus_tag LOCUS_04650 617531 619729 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_04650 619840 621561 gene locus_tag LOCUS_04660 619840 621561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 621644 623464 gene locus_tag LOCUS_04670 621644 623464 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_04670 623573 624709 gene locus_tag LOCUS_04680 623573 624709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_04680 624720 626297 gene locus_tag LOCUS_04690 624720 626297 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_04690 626297 627742 gene locus_tag LOCUS_04700 626297 627742 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_04700 627752 630124 gene locus_tag LOCUS_04710 627752 630124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 630134 631549 gene locus_tag LOCUS_04720 630134 631549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 632275 632598 gene locus_tag LOCUS_04730 632275 632598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 632897 634324 gene locus_tag LOCUS_04740 632897 634324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_04740 634806 636698 gene locus_tag LOCUS_04750 634806 636698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 637171 640260 gene locus_tag LOCUS_04760 637171 640260 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_04760 640274 641815 gene locus_tag LOCUS_04770 640274 641815 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_04770 641839 642924 gene locus_tag LOCUS_04780 641839 642924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 643082 644950 gene locus_tag LOCUS_04790 643082 644950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 644986 646572 gene locus_tag LOCUS_04800 644986 646572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_04800 648396 647875 gene locus_tag LOCUS_04810 648396 647875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 649554 650951 gene locus_tag LOCUS_04820 gene opuD 649554 650951 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 protein_id gnl|my_center|LOCUS_04820 650938 651987 gene locus_tag LOCUS_04830 650938 651987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_04830 652805 652020 gene locus_tag LOCUS_04840 652805 652020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 654070 652802 gene locus_tag LOCUS_04850 654070 652802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_04850 655804 654284 gene locus_tag LOCUS_04860 655804 654284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_04860 656253 656663 gene locus_tag LOCUS_04870 656253 656663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 657387 656755 gene locus_tag LOCUS_04880 657387 656755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 658708 657689 gene locus_tag LOCUS_04890 658708 657689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 659600 658689 gene locus_tag LOCUS_04900 659600 658689 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_04900 659873 660877 gene locus_tag LOCUS_04910 659873 660877 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQJ8 protein_id gnl|my_center|LOCUS_04910 661384 660929 gene locus_tag LOCUS_04920 661384 660929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_04920 662979 661399 gene locus_tag LOCUS_04930 662979 661399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 664282 663149 gene locus_tag LOCUS_04940 gene uxuA 664282 663149 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_04940 665444 664275 gene locus_tag LOCUS_04950 665444 664275 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_04950 667947 665605 gene locus_tag LOCUS_04960 667947 665605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 668578 668997 gene locus_tag LOCUS_04970 668578 668997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 669523 669449 gene locus_tag LOCUS_t00030 669523 669449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 670774 669560 gene locus_tag LOCUS_04980 gene sucC 670774 669560 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_04980 671027 671680 gene locus_tag LOCUS_04990 gene lolD 671027 671680 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_04990 671769 672716 gene locus_tag LOCUS_05000 gene accA 671769 672716 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_05000 672778 673575 gene locus_tag LOCUS_05010 672778 673575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_05010 673579 674136 gene locus_tag LOCUS_05020 673579 674136 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_05020 674565 675518 gene locus_tag LOCUS_05030 674565 675518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 676683 675916 gene locus_tag LOCUS_05040 676683 675916 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_05040 677164 676949 gene locus_tag LOCUS_05050 677164 676949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 677964 677266 gene locus_tag LOCUS_05060 677964 677266 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393814.1 protein_id gnl|my_center|LOCUS_05060 679297 678008 gene locus_tag LOCUS_05070 gene tyrS 679297 678008 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_05070 680223 679474 gene locus_tag LOCUS_05080 680223 679474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 681180 680824 gene locus_tag LOCUS_05090 681180 680824 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_05090 681412 682794 gene locus_tag LOCUS_05100 681412 682794 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_05100 683010 686432 gene locus_tag LOCUS_05110 gene gdhP 683010 686432 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_05110 686483 689920 gene locus_tag LOCUS_05120 gene gdhP 686483 689920 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_05120 691109 690009 gene locus_tag LOCUS_05130 gene hisB 691109 690009 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_05130 692192 691122 gene locus_tag LOCUS_05140 gene hisC 692192 691122 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 protein_id gnl|my_center|LOCUS_05140 693488 692196 gene locus_tag LOCUS_05150 gene hisD 693488 692196 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_05150 694438 693578 gene locus_tag LOCUS_05160 gene hisG 694438 693578 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_05160 696290 695046 gene locus_tag LOCUS_05170 696290 695046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 696873 696517 gene locus_tag LOCUS_05180 696873 696517 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_05180 697736 696885 gene locus_tag LOCUS_05190 gene uspA 697736 696885 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_05190 698586 697816 gene locus_tag LOCUS_05200 gene menA 698586 697816 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T22 protein_id gnl|my_center|LOCUS_05200 699373 698813 gene locus_tag LOCUS_05210 699373 698813 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PF3 protein_id gnl|my_center|LOCUS_05210 701220 699430 gene locus_tag LOCUS_05220 gene argS 701220 699430 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_05220 701649 702254 gene locus_tag LOCUS_05230 701649 702254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 702251 702913 gene locus_tag LOCUS_05240 702251 702913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 703165 703881 gene locus_tag LOCUS_05250 703165 703881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_05250 704095 703862 gene locus_tag LOCUS_05260 704095 703862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 704277 704612 gene locus_tag LOCUS_05270 704277 704612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 705664 704717 gene locus_tag LOCUS_05280 705664 704717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 706982 706014 gene locus_tag LOCUS_05290 gene tktC 706982 706014 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_05290 707867 707016 gene locus_tag LOCUS_05300 gene tktA 707867 707016 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_05300 708327 707878 gene locus_tag LOCUS_05310 708327 707878 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_05310 710121 708382 gene locus_tag LOCUS_05320 710121 708382 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_05320 710848 710237 gene locus_tag LOCUS_05330 710848 710237 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_05330 711197 711286 gene locus_tag LOCUS_t00040 711197 711286 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 711773 711546 gene locus_tag LOCUS_05340 711773 711546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 711919 712200 gene locus_tag LOCUS_05350 711919 712200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 712315 713520 gene locus_tag LOCUS_05360 712315 713520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_05360 713729 714604 gene locus_tag LOCUS_05370 713729 714604 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310189.1 protein_id gnl|my_center|LOCUS_05370 715198 715761 gene locus_tag LOCUS_05380 715198 715761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 715768 716694 gene locus_tag LOCUS_05390 715768 716694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 717423 717983 gene locus_tag LOCUS_05400 717423 717983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 717997 719268 gene locus_tag LOCUS_05410 717997 719268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 719829 720161 gene locus_tag LOCUS_05420 719829 720161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence02 253 1227 gene locus_tag LOCUS_05430 253 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267262.1 protein_id gnl|my_center|LOCUS_05430 2619 1513 gene locus_tag LOCUS_05440 2619 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3873 3256 gene locus_tag LOCUS_05450 3873 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4338 3907 gene locus_tag LOCUS_05460 4338 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5652 5930 gene locus_tag LOCUS_05470 5652 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6339 6163 gene locus_tag LOCUS_05480 6339 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6847 9846 gene locus_tag LOCUS_05490 6847 9846 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_05490 10018 11634 gene locus_tag LOCUS_05500 10018 11634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_05500 11718 13154 gene locus_tag LOCUS_05510 11718 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13608 15008 gene locus_tag LOCUS_05520 13608 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 15368 17224 gene locus_tag LOCUS_05530 15368 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 18329 17427 gene locus_tag LOCUS_05540 18329 17427 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_05540 18541 20196 gene locus_tag LOCUS_05550 18541 20196 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_05550 20214 21617 gene locus_tag LOCUS_05560 gene uxaC 20214 21617 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FH3 protein_id gnl|my_center|LOCUS_05560 21622 22470 gene locus_tag LOCUS_05570 gene uxuB 21622 22470 CDS product putative oxidoreductase UxuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34896 protein_id gnl|my_center|LOCUS_05570 22657 23400 gene locus_tag LOCUS_05580 22657 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 23432 24427 gene locus_tag LOCUS_05590 gene uxuA 23432 24427 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_05590 26098 24719 gene locus_tag LOCUS_05600 26098 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 27758 26340 gene locus_tag LOCUS_05610 27758 26340 CDS product glycosyl hydrolase family 109 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS1 protein_id gnl|my_center|LOCUS_05610 30108 28099 gene locus_tag LOCUS_05620 30108 28099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_05620 31438 30173 gene locus_tag LOCUS_05630 31438 30173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 31750 31562 gene locus_tag LOCUS_05640 31750 31562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 31865 33454 gene locus_tag LOCUS_05650 31865 33454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_05650 33560 35098 gene locus_tag LOCUS_05660 33560 35098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 35148 36620 gene locus_tag LOCUS_05670 35148 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 36645 38144 gene locus_tag LOCUS_05680 36645 38144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_05680 38195 41221 gene locus_tag LOCUS_05690 38195 41221 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_05690 41259 42107 gene locus_tag LOCUS_05700 41259 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 42133 43047 gene locus_tag LOCUS_05710 42133 43047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 43088 44551 gene locus_tag LOCUS_05720 43088 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_05720 44873 45337 gene locus_tag LOCUS_05730 44873 45337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 45609 45830 gene locus_tag LOCUS_05740 45609 45830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 46660 46169 gene locus_tag LOCUS_05750 46660 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 47287 46877 gene locus_tag LOCUS_05760 47287 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 47631 47816 gene locus_tag LOCUS_05770 47631 47816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 49255 48308 gene locus_tag LOCUS_05780 49255 48308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 49908 52673 gene locus_tag LOCUS_05790 49908 52673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_05790 53920 52772 gene locus_tag LOCUS_05800 53920 52772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 54582 56609 gene locus_tag LOCUS_05810 54582 56609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 56880 57590 gene locus_tag LOCUS_05820 56880 57590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 58821 57781 gene locus_tag LOCUS_05830 58821 57781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 59506 60441 gene locus_tag LOCUS_05840 59506 60441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 60453 62837 gene locus_tag LOCUS_05850 60453 62837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 62844 63254 gene locus_tag LOCUS_05860 62844 63254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 64130 65500 gene locus_tag LOCUS_05870 64130 65500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_05870 65934 66746 gene locus_tag LOCUS_05880 65934 66746 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_05880 67205 67759 gene locus_tag LOCUS_05890 67205 67759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05890 68005 68649 gene locus_tag LOCUS_05900 68005 68649 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_05900 68789 69898 gene locus_tag LOCUS_05910 68789 69898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 70135 73491 gene locus_tag LOCUS_05920 70135 73491 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_05920 73519 74976 gene locus_tag LOCUS_05930 73519 74976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_05930 75474 77153 gene locus_tag LOCUS_05940 75474 77153 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05940 77317 77964 gene locus_tag LOCUS_05950 77317 77964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 78023 79549 gene locus_tag LOCUS_05960 78023 79549 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_05960 80124 80702 gene locus_tag LOCUS_05970 80124 80702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 80722 82008 gene locus_tag LOCUS_05980 80722 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 82028 82555 gene locus_tag LOCUS_05990 82028 82555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 82831 83787 gene locus_tag LOCUS_06000 82831 83787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 84026 86380 gene locus_tag LOCUS_06010 84026 86380 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_06010 87689 86487 gene locus_tag LOCUS_06020 87689 86487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 87824 90688 gene locus_tag LOCUS_06030 87824 90688 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_06030 90745 91902 gene locus_tag LOCUS_06040 90745 91902 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_06040 93140 92055 gene locus_tag LOCUS_06050 93140 92055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_06050 93322 93531 gene locus_tag LOCUS_06060 93322 93531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 95448 93607 gene locus_tag LOCUS_06070 95448 93607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 95696 95974 gene locus_tag LOCUS_06080 95696 95974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 96040 96762 gene locus_tag LOCUS_06090 96040 96762 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_06090 97134 98174 gene locus_tag LOCUS_06100 97134 98174 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_06100 98187 99530 gene locus_tag LOCUS_06110 98187 99530 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06110 99610 101076 gene locus_tag LOCUS_06120 99610 101076 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_06120 102051 101212 gene locus_tag LOCUS_06130 102051 101212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 102258 103049 gene locus_tag LOCUS_06140 102258 103049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 104464 103046 gene locus_tag LOCUS_06150 104464 103046 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_06150 104776 105903 gene locus_tag LOCUS_06160 104776 105903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 107957 106944 gene locus_tag LOCUS_06170 107957 106944 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_06170 108230 111280 gene locus_tag LOCUS_06180 108230 111280 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_06180 111293 112981 gene locus_tag LOCUS_06190 111293 112981 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_06190 113095 114489 gene locus_tag LOCUS_06200 113095 114489 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_06200 114517 117006 gene locus_tag LOCUS_06210 114517 117006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 117045 118127 gene locus_tag LOCUS_06220 117045 118127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 118139 119965 gene locus_tag LOCUS_06230 118139 119965 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748760.1 protein_id gnl|my_center|LOCUS_06230 119980 121422 gene locus_tag LOCUS_06240 119980 121422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 121560 123230 gene locus_tag LOCUS_06250 121560 123230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 123255 125540 gene locus_tag LOCUS_06260 123255 125540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 125663 127858 gene locus_tag LOCUS_06270 125663 127858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 128103 129326 gene locus_tag LOCUS_06280 128103 129326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 130031 130693 gene locus_tag LOCUS_06290 130031 130693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 131280 132485 gene locus_tag LOCUS_06300 131280 132485 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_06300 133100 132636 gene locus_tag LOCUS_06310 133100 132636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 133910 135148 gene locus_tag LOCUS_06320 133910 135148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 135216 135980 gene locus_tag LOCUS_06330 gene mapB 135216 135980 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_06330 136073 137053 gene locus_tag LOCUS_06340 136073 137053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 137149 137874 gene locus_tag LOCUS_06350 137149 137874 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_06350 138469 138753 gene locus_tag LOCUS_06360 138469 138753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 138704 139072 gene locus_tag LOCUS_06370 138704 139072 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_06370 139098 139574 gene locus_tag LOCUS_06380 139098 139574 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_06380 139952 140704 gene locus_tag LOCUS_06390 139952 140704 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930648.1 protein_id gnl|my_center|LOCUS_06390 143965 140705 gene locus_tag LOCUS_06400 143965 140705 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_06400 144089 145498 gene locus_tag LOCUS_06410 144089 145498 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_06410 147146 145788 gene locus_tag LOCUS_06420 147146 145788 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06420 148387 147194 gene locus_tag LOCUS_06430 gene uxuA 148387 147194 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_06430 149199 148384 gene locus_tag LOCUS_06440 149199 148384 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_06440 150872 149226 gene locus_tag LOCUS_06450 150872 149226 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_06450 151297 152250 gene locus_tag LOCUS_06460 151297 152250 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_06460 152254 152742 gene locus_tag LOCUS_06470 152254 152742 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_06470 152746 154044 gene locus_tag LOCUS_06480 152746 154044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_06480 154572 154372 gene locus_tag LOCUS_06490 154572 154372 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_06490 154976 154569 gene locus_tag LOCUS_06500 154976 154569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 155296 158253 gene locus_tag LOCUS_06510 155296 158253 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120738.1 protein_id gnl|my_center|LOCUS_06510 158348 159697 gene locus_tag LOCUS_06520 158348 159697 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_06520 159873 161066 gene locus_tag LOCUS_06530 159873 161066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 161824 164730 gene locus_tag LOCUS_06540 161824 164730 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_06540 164741 166342 gene locus_tag LOCUS_06550 164741 166342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_06550 166522 166929 gene locus_tag LOCUS_06560 166522 166929 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027506.1 protein_id gnl|my_center|LOCUS_06560 167755 170808 gene locus_tag LOCUS_06570 167755 170808 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_06570 170826 172382 gene locus_tag LOCUS_06580 170826 172382 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_06580 173488 173814 gene locus_tag LOCUS_06590 173488 173814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 174350 175162 gene locus_tag LOCUS_06600 174350 175162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 175548 175829 gene locus_tag LOCUS_06610 175548 175829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 176086 177582 gene locus_tag LOCUS_06620 176086 177582 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_06620 177872 180211 gene locus_tag LOCUS_06630 177872 180211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 180354 181385 gene locus_tag LOCUS_06640 180354 181385 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_06640 181398 182417 gene locus_tag LOCUS_06650 181398 182417 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_06650 182619 184544 gene locus_tag LOCUS_06660 182619 184544 CDS product retaining alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L0 protein_id gnl|my_center|LOCUS_06660 184887 185273 gene locus_tag LOCUS_06670 gene ywkD 184887 185273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_06670 185270 185875 gene locus_tag LOCUS_06680 185270 185875 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_06680 185945 186583 gene locus_tag LOCUS_06690 185945 186583 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_06690 186677 187264 gene locus_tag LOCUS_06700 186677 187264 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_06700 187356 188075 gene locus_tag LOCUS_06710 187356 188075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 190437 189556 gene locus_tag LOCUS_06720 190437 189556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_06720 191704 190481 gene locus_tag LOCUS_06730 191704 190481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 192707 191736 gene locus_tag LOCUS_06740 192707 191736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 192840 195785 gene locus_tag LOCUS_06750 192840 195785 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_06750 196120 196725 gene locus_tag LOCUS_06760 196120 196725 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_06760 196980 200099 gene locus_tag LOCUS_06770 196980 200099 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_06770 200113 201822 gene locus_tag LOCUS_06780 200113 201822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 201833 203515 gene locus_tag LOCUS_06790 201833 203515 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_06790 205974 204445 gene locus_tag LOCUS_06800 205974 204445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_06800 208644 205999 gene locus_tag LOCUS_06810 208644 205999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 210199 208757 gene locus_tag LOCUS_06820 210199 208757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_06820 213180 210217 gene locus_tag LOCUS_06830 213180 210217 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_06830 214739 213684 gene locus_tag LOCUS_06840 214739 213684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 215409 214798 gene locus_tag LOCUS_06850 215409 214798 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_06850 215889 216983 gene locus_tag LOCUS_06860 215889 216983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 217210 220434 gene locus_tag LOCUS_06870 217210 220434 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_06870 220476 221924 gene locus_tag LOCUS_06880 220476 221924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_06880 222063 223433 gene locus_tag LOCUS_06890 222063 223433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_06890 223450 224577 gene locus_tag LOCUS_06900 223450 224577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 226506 224641 gene locus_tag LOCUS_06910 226506 224641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 227272 226664 gene locus_tag LOCUS_06920 227272 226664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_06920 227734 229230 gene locus_tag LOCUS_06930 227734 229230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 229618 232896 gene locus_tag LOCUS_06940 229618 232896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 234831 233161 gene locus_tag LOCUS_06950 234831 233161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_06950 237838 234851 gene locus_tag LOCUS_06960 237838 234851 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_06960 238433 239680 gene locus_tag LOCUS_06970 238433 239680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 239829 241172 gene locus_tag LOCUS_06980 239829 241172 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_06980 241479 242195 gene locus_tag LOCUS_06990 241479 242195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_06990 243014 242202 gene locus_tag LOCUS_07000 243014 242202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 243842 245092 gene locus_tag LOCUS_07010 243842 245092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058301.1 protein_id gnl|my_center|LOCUS_07010 245224 246204 gene locus_tag LOCUS_07020 245224 246204 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_07020 246243 247667 gene locus_tag LOCUS_07030 246243 247667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 247713 249713 gene locus_tag LOCUS_07040 gene glgB 247713 249713 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L3 protein_id gnl|my_center|LOCUS_07040 249828 251174 gene locus_tag LOCUS_07050 249828 251174 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_07050 251177 252628 gene locus_tag LOCUS_07060 251177 252628 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_07060 252645 253412 gene locus_tag LOCUS_07070 252645 253412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817333.1 protein_id gnl|my_center|LOCUS_07070 253716 254540 gene locus_tag LOCUS_07080 253716 254540 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496896.1 protein_id gnl|my_center|LOCUS_07080 254543 255745 gene locus_tag LOCUS_07090 254543 255745 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_07090 255735 256778 gene locus_tag LOCUS_07100 gene argC 255735 256778 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GH7 protein_id gnl|my_center|LOCUS_07100 256792 258003 gene locus_tag LOCUS_07110 gene argJ 256792 258003 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG63 protein_id gnl|my_center|LOCUS_07110 258713 258174 gene locus_tag LOCUS_07120 258713 258174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 258944 260698 gene locus_tag LOCUS_07130 258944 260698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 262809 261421 gene locus_tag LOCUS_07140 gene speA 262809 261421 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_07140 265117 263042 gene locus_tag LOCUS_07150 265117 263042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 266045 265434 gene locus_tag LOCUS_07160 266045 265434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 266250 269471 gene locus_tag LOCUS_07170 266250 269471 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_07170 269485 271281 gene locus_tag LOCUS_07180 269485 271281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_07180 271378 272610 gene locus_tag LOCUS_07190 271378 272610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 272713 274923 gene locus_tag LOCUS_07200 272713 274923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 277579 275270 gene locus_tag LOCUS_07210 277579 275270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 279099 278167 gene locus_tag LOCUS_07220 279099 278167 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_07220 279281 280807 gene locus_tag LOCUS_07230 279281 280807 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_07230 280823 281269 gene locus_tag LOCUS_07240 280823 281269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_07240 282967 281321 gene locus_tag LOCUS_07250 282967 281321 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_07250 283424 283107 gene locus_tag LOCUS_07260 gene yqjZ 283424 283107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_07260 283701 285083 gene locus_tag LOCUS_07270 gene cydA 283701 285083 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_07270 285090 286127 gene locus_tag LOCUS_07280 gene cydB 285090 286127 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_07280 286239 287150 gene locus_tag LOCUS_07290 286239 287150 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 protein_id gnl|my_center|LOCUS_07290 287161 288426 gene locus_tag LOCUS_07300 287161 288426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 288648 290108 gene locus_tag LOCUS_07310 288648 290108 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_07310 290136 291725 gene locus_tag LOCUS_07320 290136 291725 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_07320 293735 291966 gene locus_tag LOCUS_07330 293735 291966 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_07330 296039 293742 gene locus_tag LOCUS_07340 296039 293742 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_07340 297665 296361 gene locus_tag LOCUS_07350 gene yrbD 297665 296361 CDS product putative sodium/proton-dependent alanine carrier protein YrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32060 protein_id gnl|my_center|LOCUS_07350 298377 299204 gene locus_tag LOCUS_07360 298377 299204 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_07360 299383 300306 gene locus_tag LOCUS_07370 299383 300306 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_07370 300646 300296 gene locus_tag LOCUS_07380 300646 300296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 303034 300779 gene locus_tag LOCUS_07390 303034 300779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 303341 303934 gene locus_tag LOCUS_07400 303341 303934 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_07400 303978 305090 gene locus_tag LOCUS_07410 303978 305090 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_07410 305097 308237 gene locus_tag LOCUS_07420 305097 308237 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_07420 308243 309634 gene locus_tag LOCUS_07430 308243 309634 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_07430 312609 310237 gene locus_tag LOCUS_07440 312609 310237 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_07440 312808 313842 gene locus_tag LOCUS_07450 312808 313842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 313844 314548 gene locus_tag LOCUS_07460 313844 314548 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_07460 315387 314554 gene locus_tag LOCUS_07470 315387 314554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_07470 317661 315427 gene locus_tag LOCUS_07480 gene ychM 317661 315427 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067022.1 protein_id gnl|my_center|LOCUS_07480 317902 319200 gene locus_tag LOCUS_07490 317902 319200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 319251 319769 gene locus_tag LOCUS_07500 319251 319769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 320266 322113 gene locus_tag LOCUS_07510 320266 322113 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_07510 322321 322249 gene locus_tag LOCUS_t00050 322321 322249 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 322552 323187 gene locus_tag LOCUS_07520 322552 323187 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_07520 323552 324637 gene locus_tag LOCUS_07530 gene fabH1 323552 324637 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_07530 324655 325488 gene locus_tag LOCUS_07540 324655 325488 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 protein_id gnl|my_center|LOCUS_07540 325504 325833 gene locus_tag LOCUS_07550 325504 325833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_07550 327918 326020 gene locus_tag LOCUS_07560 327918 326020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 329834 327915 gene locus_tag LOCUS_07570 329834 327915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 330098 330721 gene locus_tag LOCUS_07580 330098 330721 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_07580 332188 330818 gene locus_tag LOCUS_07590 gene pntB 332188 330818 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZW9 protein_id gnl|my_center|LOCUS_07590 332508 332191 gene locus_tag LOCUS_07600 332508 332191 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_07600 333622 332510 gene locus_tag LOCUS_07610 gene pntA 333622 332510 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_07610 334176 335432 gene locus_tag LOCUS_07620 334176 335432 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_07620 336659 335592 gene locus_tag LOCUS_07630 336659 335592 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_07630 337781 337101 gene locus_tag LOCUS_07640 337781 337101 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_07640 338705 337788 gene locus_tag LOCUS_07650 338705 337788 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_07650 339856 338861 gene locus_tag LOCUS_07660 339856 338861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 340546 340115 gene locus_tag LOCUS_07670 340546 340115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 341121 340543 gene locus_tag LOCUS_07680 341121 340543 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_07680 341709 341290 gene locus_tag LOCUS_07690 341709 341290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_07690 342184 341720 gene locus_tag LOCUS_07700 342184 341720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 342949 342218 gene locus_tag LOCUS_07710 342949 342218 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_07710 343140 344039 gene locus_tag LOCUS_07720 343140 344039 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 protein_id gnl|my_center|LOCUS_07720 346338 344119 gene locus_tag LOCUS_07730 gene nicT 346338 344119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_07730 347586 346636 gene locus_tag LOCUS_07740 gene rlmF 347586 346636 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_07740 348048 347590 gene locus_tag LOCUS_07750 gene cspR 348048 347590 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNR4 protein_id gnl|my_center|LOCUS_07750 348701 348312 gene locus_tag LOCUS_07760 348701 348312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 349013 348702 gene locus_tag LOCUS_07770 349013 348702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 349740 349294 gene locus_tag LOCUS_07780 349740 349294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 350335 349748 gene locus_tag LOCUS_07790 350335 349748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 351520 350345 gene locus_tag LOCUS_07800 351520 350345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 355411 351650 gene locus_tag LOCUS_07810 355411 351650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 356305 355634 gene locus_tag LOCUS_07820 356305 355634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence03 263 189 gene locus_tag LOCUS_t00060 263 189 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 452 1186 gene locus_tag LOCUS_07830 452 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 1872 1249 gene locus_tag LOCUS_07840 1872 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3326 1872 gene locus_tag LOCUS_07850 gene rpoN 3326 1872 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_07850 3504 4955 gene locus_tag LOCUS_07860 gene asnS 3504 4955 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_07860 5299 6816 gene locus_tag LOCUS_07870 5299 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6942 7394 gene locus_tag LOCUS_07880 6942 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9118 7628 gene locus_tag LOCUS_07890 9118 7628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_07890 10424 9111 gene locus_tag LOCUS_07900 10424 9111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_07900 11792 10479 gene locus_tag LOCUS_07910 11792 10479 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_07910 12022 11858 gene locus_tag LOCUS_07920 12022 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 12209 12754 gene locus_tag LOCUS_07930 12209 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 13879 12782 gene locus_tag LOCUS_07940 13879 12782 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_07940 14841 14089 gene locus_tag LOCUS_07950 gene yaaA 14841 14089 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_07950 19857 14845 gene locus_tag LOCUS_07960 19857 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 20061 21065 gene locus_tag LOCUS_07970 20061 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 21078 22307 gene locus_tag LOCUS_07980 21078 22307 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_07980 22374 23144 gene locus_tag LOCUS_07990 22374 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 24002 23208 gene locus_tag LOCUS_08000 24002 23208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 24897 24088 gene locus_tag LOCUS_08010 24897 24088 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120356.1 protein_id gnl|my_center|LOCUS_08010 26142 25075 gene locus_tag LOCUS_08020 gene gpsA 26142 25075 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_08020 27808 26114 gene locus_tag LOCUS_08030 27808 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 27927 28901 gene locus_tag LOCUS_08040 27927 28901 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_08040 29379 29678 gene locus_tag LOCUS_08050 29379 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 29701 30576 gene locus_tag LOCUS_08060 gene rsmH 29701 30576 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_08060 30579 30959 gene locus_tag LOCUS_08070 30579 30959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 30956 33064 gene locus_tag LOCUS_08080 gene ftsI 30956 33064 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_08080 33121 34527 gene locus_tag LOCUS_08090 gene murE 33121 34527 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_08090 34529 35740 gene locus_tag LOCUS_08100 gene mraY 34529 35740 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_08100 35741 37084 gene locus_tag LOCUS_08110 gene murD 35741 37084 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_08110 37087 38256 gene locus_tag LOCUS_08120 gene ftsW 37087 38256 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_08120 38261 39373 gene locus_tag LOCUS_08130 gene murG 38261 39373 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_08130 39370 40770 gene locus_tag LOCUS_08140 39370 40770 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A259 protein_id gnl|my_center|LOCUS_08140 40799 41524 gene locus_tag LOCUS_08150 40799 41524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 41536 42852 gene locus_tag LOCUS_08160 gene ftsA 41536 42852 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_08160 42891 44504 gene locus_tag LOCUS_08170 42891 44504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 45032 44508 gene locus_tag LOCUS_08180 45032 44508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 45490 46329 gene locus_tag LOCUS_08190 45490 46329 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_08190 46527 47192 gene locus_tag LOCUS_08200 46527 47192 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_08200 47272 48441 gene locus_tag LOCUS_08210 47272 48441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 48490 49530 gene locus_tag LOCUS_08220 48490 49530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_08220 50092 49592 gene locus_tag LOCUS_08230 gene greB 50092 49592 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_08230 50275 50496 gene locus_tag LOCUS_08240 50275 50496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 51610 50729 gene locus_tag LOCUS_08250 51610 50729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_08250 51898 53832 gene locus_tag LOCUS_08260 gene sdhA 51898 53832 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_08260 53832 54560 gene locus_tag LOCUS_08270 gene sdhB 53832 54560 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_08270 54557 56089 gene locus_tag LOCUS_08280 gene ppx 54557 56089 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140513.1 protein_id gnl|my_center|LOCUS_08280 56601 56242 gene locus_tag LOCUS_08290 56601 56242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 57647 56784 gene locus_tag LOCUS_08300 gene rfbA 57647 56784 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_08300 57887 58663 gene locus_tag LOCUS_08310 57887 58663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 59087 59833 gene locus_tag LOCUS_08320 59087 59833 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_08320 60126 60722 gene locus_tag LOCUS_08330 60126 60722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 60888 61715 gene locus_tag LOCUS_08340 gene uspA 60888 61715 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_08340 62131 63516 gene locus_tag LOCUS_08350 62131 63516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_08350 64539 63643 gene locus_tag LOCUS_08360 64539 63643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 64779 66206 gene locus_tag LOCUS_08370 gene uxaC 64779 66206 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_08370 67646 66432 gene locus_tag LOCUS_08380 67646 66432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_08380 68789 67755 gene locus_tag LOCUS_08390 gene fucO 68789 67755 CDS product L-fucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120627.1 protein_id gnl|my_center|LOCUS_08390 69773 68820 gene locus_tag LOCUS_08400 69773 68820 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_08400 70600 69779 gene locus_tag LOCUS_08410 70600 69779 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_08410 70884 71720 gene locus_tag LOCUS_08420 70884 71720 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_08420 72627 71791 gene locus_tag LOCUS_08430 72627 71791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 74964 72631 gene locus_tag LOCUS_08440 74964 72631 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_08440 75623 76450 gene locus_tag LOCUS_08450 gene batB 75623 76450 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_08450 76474 77127 gene locus_tag LOCUS_08460 76474 77127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 77111 77746 gene locus_tag LOCUS_08470 77111 77746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 77761 78960 gene locus_tag LOCUS_08480 77761 78960 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_08480 78983 79783 gene locus_tag LOCUS_08490 78983 79783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 79917 80852 gene locus_tag LOCUS_08500 gene purC 79917 80852 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_08500 80975 81358 gene locus_tag LOCUS_08510 80975 81358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 81372 82286 gene locus_tag LOCUS_08520 gene rnz 81372 82286 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 protein_id gnl|my_center|LOCUS_08520 82289 83089 gene locus_tag LOCUS_08530 82289 83089 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_08530 84208 83219 gene locus_tag LOCUS_08540 84208 83219 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 protein_id gnl|my_center|LOCUS_08540 85688 84672 gene locus_tag LOCUS_08550 85688 84672 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_08550 87311 85749 gene locus_tag LOCUS_08560 87311 85749 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_08560 88842 87451 gene locus_tag LOCUS_08570 88842 87451 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_08570 90114 89146 gene locus_tag LOCUS_08580 90114 89146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 91413 90505 gene locus_tag LOCUS_08590 91413 90505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 91901 91620 gene locus_tag LOCUS_08600 91901 91620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_108210.2 protein_id gnl|my_center|LOCUS_08600 92231 93100 gene locus_tag LOCUS_08610 92231 93100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 93093 94649 gene locus_tag LOCUS_08620 93093 94649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 96033 94684 gene locus_tag LOCUS_08630 96033 94684 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_08630 97036 96149 gene locus_tag LOCUS_08640 97036 96149 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602530.1 protein_id gnl|my_center|LOCUS_08640 98328 97438 gene locus_tag LOCUS_08650 98328 97438 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_08650 101975 98475 gene locus_tag LOCUS_08660 101975 98475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 103191 102235 gene locus_tag LOCUS_08670 gene ftsY 103191 102235 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_08670 103433 103281 gene locus_tag LOCUS_08680 103433 103281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 103647 103465 gene locus_tag LOCUS_08690 gene rpmG 103647 103465 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_08690 103924 103682 gene locus_tag LOCUS_08700 gene rpmB 103924 103682 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_08700 104146 105429 gene locus_tag LOCUS_08710 gene rocD 104146 105429 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_08710 105432 106088 gene locus_tag LOCUS_08720 105432 106088 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_08720 106155 107123 gene locus_tag LOCUS_08730 gene hemB 106155 107123 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_08730 107621 108919 gene locus_tag LOCUS_08740 107621 108919 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_08740 109037 110206 gene locus_tag LOCUS_08750 109037 110206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 112910 110304 gene locus_tag LOCUS_08760 112910 110304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 113643 113269 gene locus_tag LOCUS_08770 gene groES-2 113643 113269 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_08770 115826 113907 gene locus_tag LOCUS_08780 gene dnaK 115826 113907 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_08780 116022 116816 gene locus_tag LOCUS_08790 116022 116816 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_08790 117178 116849 gene locus_tag LOCUS_08800 117178 116849 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_08800 118690 117185 gene locus_tag LOCUS_08810 118690 117185 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_08810 119228 118776 gene locus_tag LOCUS_08820 gene dtd 119228 118776 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_08820 119947 119225 gene locus_tag LOCUS_08830 119947 119225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 120360 119944 gene locus_tag LOCUS_08840 120360 119944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933873.1 protein_id gnl|my_center|LOCUS_08840 120908 120387 gene locus_tag LOCUS_08850 120908 120387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 121021 121338 gene locus_tag LOCUS_08860 121021 121338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 121838 121377 gene locus_tag LOCUS_08870 121838 121377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 122217 121852 gene locus_tag LOCUS_08880 gene folB 122217 121852 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28823 protein_id gnl|my_center|LOCUS_08880 123059 122217 gene locus_tag LOCUS_08890 123059 122217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 124007 123093 gene locus_tag LOCUS_08900 124007 123093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 124051 124680 gene locus_tag LOCUS_08910 124051 124680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 124740 125294 gene locus_tag LOCUS_08920 124740 125294 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_08920 126127 125291 gene locus_tag LOCUS_08930 126127 125291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 127053 126253 gene locus_tag LOCUS_08940 127053 126253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 127153 129885 gene locus_tag LOCUS_08950 127153 129885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403549.1 protein_id gnl|my_center|LOCUS_08950 131125 129911 gene locus_tag LOCUS_08960 gene arcA 131125 129911 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HP29 protein_id gnl|my_center|LOCUS_08960 132031 131183 gene locus_tag LOCUS_08970 gene tyrA 132031 131183 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_08970 133188 132037 gene locus_tag LOCUS_08980 gene aspC3 133188 132037 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_08980 134003 133188 gene locus_tag LOCUS_08990 gene pheA 134003 133188 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_08990 135344 134115 gene locus_tag LOCUS_09000 gene aroA 135344 134115 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_09000 136352 135402 gene locus_tag LOCUS_09010 gene aroB 136352 135402 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_09010 137776 136670 gene locus_tag LOCUS_09020 137776 136670 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_09020 139545 138187 gene locus_tag LOCUS_09030 139545 138187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 140516 139542 gene locus_tag LOCUS_09040 140516 139542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 140823 142013 gene locus_tag LOCUS_09050 gene putA 140823 142013 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_09050 142027 143748 gene locus_tag LOCUS_09060 gene lysS 142027 143748 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_09060 144579 143968 gene locus_tag LOCUS_09070 144579 143968 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_09070 144604 145563 gene locus_tag LOCUS_09080 144604 145563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 145959 145585 gene locus_tag LOCUS_09090 145959 145585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 147083 146052 gene locus_tag LOCUS_09100 147083 146052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 147444 148712 gene locus_tag LOCUS_09110 147444 148712 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_09110 150055 148781 gene locus_tag LOCUS_09120 150055 148781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 151079 150201 gene locus_tag LOCUS_09130 gene cysM 151079 150201 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_09130 151825 151091 gene locus_tag LOCUS_09140 151825 151091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 152512 151943 gene locus_tag LOCUS_09150 152512 151943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 152714 152493 gene locus_tag LOCUS_09160 152714 152493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 154373 153096 gene locus_tag LOCUS_09170 gene eno2 154373 153096 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_09170 155486 154395 gene locus_tag LOCUS_09180 gene carA 155486 154395 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_09180 156111 155620 gene locus_tag LOCUS_09190 gene rplQ 156111 155620 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN6 protein_id gnl|my_center|LOCUS_09190 157176 156187 gene locus_tag LOCUS_09200 gene rpoA 157176 156187 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_09200 157814 157209 gene locus_tag LOCUS_09210 gene rpsD 157814 157209 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_09210 158230 157832 gene locus_tag LOCUS_09220 gene rpsK 158230 157832 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_09220 158623 158246 gene locus_tag LOCUS_09230 gene rpsM 158623 158246 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_09230 159010 158792 gene locus_tag LOCUS_09240 gene infA 159010 158792 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_09240 159786 159013 gene locus_tag LOCUS_09250 gene map 159786 159013 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_09250 161105 159789 gene locus_tag LOCUS_09260 gene secY 161105 159789 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_09260 161555 161109 gene locus_tag LOCUS_09270 gene rplO 161555 161109 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_09270 161790 161611 gene locus_tag LOCUS_09280 gene rpmD 161790 161611 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839E6 protein_id gnl|my_center|LOCUS_09280 162313 161795 gene locus_tag LOCUS_09290 gene rpsE 162313 161795 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_09290 162669 162319 gene locus_tag LOCUS_09300 gene rplR 162669 162319 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSX0 protein_id gnl|my_center|LOCUS_09300 163234 162677 gene locus_tag LOCUS_09310 gene rplF 163234 162677 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_09310 163639 163244 gene locus_tag LOCUS_09320 gene rpsH 163639 163244 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_09320 163992 163723 gene locus_tag LOCUS_09330 gene rpsN 163992 163723 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_09330 164555 163995 gene locus_tag LOCUS_09340 gene rplE 164555 163995 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_09340 164892 164548 gene locus_tag LOCUS_09350 gene rplX 164892 164548 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_09350 165263 164895 gene locus_tag LOCUS_09360 gene rplN 165263 164895 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_09360 165530 165267 gene locus_tag LOCUS_09370 gene rpsQ 165530 165267 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_09370 165733 165539 gene locus_tag LOCUS_09380 gene rpmC 165733 165539 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A484 protein_id gnl|my_center|LOCUS_09380 166160 165738 gene locus_tag LOCUS_09390 gene rplP 166160 165738 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_09390 166918 166181 gene locus_tag LOCUS_09400 gene rpsC 166918 166181 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_09400 167311 166922 gene locus_tag LOCUS_09410 gene rplV 167311 166922 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_09410 167592 167314 gene locus_tag LOCUS_09420 gene rpsS 167592 167314 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_09420 168419 167595 gene locus_tag LOCUS_09430 gene rplB 168419 167595 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_09430 168720 168433 gene locus_tag LOCUS_09440 gene rplW 168720 168433 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_09440 169354 168725 gene locus_tag LOCUS_09450 gene rplD 169354 168725 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_09450 169991 169359 gene locus_tag LOCUS_09460 gene rplC 169991 169359 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_09460 170544 170239 gene locus_tag LOCUS_09470 gene rpsJ 170544 170239 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_09470 172703 170556 gene locus_tag LOCUS_09480 gene fusA 172703 170556 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_09480 173177 172710 gene locus_tag LOCUS_09490 gene rpsG 173177 172710 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_09490 173583 173200 gene locus_tag LOCUS_09500 gene rpsL 173583 173200 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_09500 174063 173734 gene locus_tag LOCUS_09510 174063 173734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_09510 178444 174134 gene locus_tag LOCUS_09520 gene rpoC 178444 174134 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_09520 182368 178493 gene locus_tag LOCUS_09530 gene rpoB 182368 178493 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_09530 182906 182526 gene locus_tag LOCUS_09540 gene rplL 182906 182526 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_09540 183498 182956 gene locus_tag LOCUS_09550 183498 182956 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_09550 184200 183502 gene locus_tag LOCUS_09560 gene rplA 184200 183502 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_09560 184654 184211 gene locus_tag LOCUS_09570 gene rplK 184654 184211 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_09570 185215 184658 gene locus_tag LOCUS_09580 gene nusG 185215 184658 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_09580 185421 185233 gene locus_tag LOCUS_09590 185421 185233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 185617 185546 gene locus_tag LOCUS_t00070 185617 185546 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 186919 185732 gene locus_tag LOCUS_09600 gene tuf 186919 185732 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_09600 187050 186978 gene locus_tag LOCUS_t00080 187050 186978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 187156 187083 gene locus_tag LOCUS_t00090 187156 187083 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 187389 187306 gene locus_tag LOCUS_t00100 187389 187306 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 190064 187548 gene locus_tag LOCUS_09610 190064 187548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 190818 191528 gene locus_tag LOCUS_09620 gene pyrH 190818 191528 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_09620 191537 192097 gene locus_tag LOCUS_09630 gene frr 191537 192097 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_09630 192985 196161 gene locus_tag LOCUS_09640 192985 196161 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_09640 196179 198041 gene locus_tag LOCUS_09650 196179 198041 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108583.1 protein_id gnl|my_center|LOCUS_09650 198288 201620 gene locus_tag LOCUS_09660 198288 201620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 201625 202983 gene locus_tag LOCUS_09670 201625 202983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 203019 204374 gene locus_tag LOCUS_09680 203019 204374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 205155 204589 gene locus_tag LOCUS_09690 gene nadD 205155 204589 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_09690 205733 205161 gene locus_tag LOCUS_09700 gene gmk 205733 205161 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_09700 206011 205739 gene locus_tag LOCUS_09710 206011 205739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 206625 206035 gene locus_tag LOCUS_09720 206625 206035 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_09720 206851 207585 gene locus_tag LOCUS_09730 206851 207585 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_09730 207791 210037 gene locus_tag LOCUS_09740 gene uvrD 207791 210037 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_09740 210133 210807 gene locus_tag LOCUS_09750 210133 210807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 210807 212114 gene locus_tag LOCUS_09760 gene murA 210807 212114 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_09760 212866 212237 gene locus_tag LOCUS_09770 212866 212237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_09770 213872 215029 gene locus_tag LOCUS_09780 213872 215029 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_09780 216210 215215 gene locus_tag LOCUS_09790 216210 215215 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_09790 216288 216959 gene locus_tag LOCUS_09800 216288 216959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 219502 217082 gene locus_tag LOCUS_09810 219502 217082 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_09810 219854 220975 gene locus_tag LOCUS_09820 219854 220975 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7H0 protein_id gnl|my_center|LOCUS_09820 221098 222435 gene locus_tag LOCUS_09830 gene hemN 221098 222435 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_09830 222466 223281 gene locus_tag LOCUS_09840 222466 223281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 protein_id gnl|my_center|LOCUS_09840 223961 223278 gene locus_tag LOCUS_09850 223961 223278 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_09850 224250 224621 gene locus_tag LOCUS_09860 224250 224621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 225290 224625 gene locus_tag LOCUS_09870 225290 224625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 226011 225562 gene locus_tag LOCUS_09880 226011 225562 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_09880 228615 226096 gene locus_tag LOCUS_09890 228615 226096 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_09890 229285 228608 gene locus_tag LOCUS_09900 229285 228608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_09900 229411 230067 gene locus_tag LOCUS_09910 229411 230067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 230173 231912 gene locus_tag LOCUS_09920 230173 231912 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_09920 231918 232634 gene locus_tag LOCUS_09930 231918 232634 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_09930 232729 233418 gene locus_tag LOCUS_09940 232729 233418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 234251 233463 gene locus_tag LOCUS_09950 234251 233463 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_09950 234751 234269 gene locus_tag LOCUS_09960 234751 234269 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_09960 235516 234806 gene locus_tag LOCUS_09970 235516 234806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 235700 236983 gene locus_tag LOCUS_09980 gene hemA 235700 236983 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_09980 237096 238679 gene locus_tag LOCUS_09990 237096 238679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 239706 238693 gene locus_tag LOCUS_10000 239706 238693 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_10000 240171 239710 gene locus_tag LOCUS_10010 240171 239710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 241993 240512 gene locus_tag LOCUS_10020 gene proS 241993 240512 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_10020 242153 243466 gene locus_tag LOCUS_10030 242153 243466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 243741 245210 gene locus_tag LOCUS_10040 243741 245210 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_10040 245726 245193 gene locus_tag LOCUS_10050 gene aroK 245726 245193 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 protein_id gnl|my_center|LOCUS_10050 246832 245726 gene locus_tag LOCUS_10060 246832 245726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_10060 247370 246822 gene locus_tag LOCUS_10070 247370 246822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10070 247385 248269 gene locus_tag LOCUS_10080 gene folP 247385 248269 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_10080 248266 249132 gene locus_tag LOCUS_10090 248266 249132 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_10090 250334 249138 gene locus_tag LOCUS_10100 gene kbl 250334 249138 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_10100 250477 251430 gene locus_tag LOCUS_10110 gene ltd 250477 251430 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_10110 251435 251923 gene locus_tag LOCUS_10120 251435 251923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 251973 252653 gene locus_tag LOCUS_10130 251973 252653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 253041 255635 gene locus_tag LOCUS_10140 253041 255635 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_10140 255800 256282 gene locus_tag LOCUS_10150 255800 256282 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103491.1 protein_id gnl|my_center|LOCUS_10150 256440 257780 gene locus_tag LOCUS_10160 256440 257780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 260630 258015 gene locus_tag LOCUS_10170 gene clpB 260630 258015 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 protein_id gnl|my_center|LOCUS_10170 260870 262306 gene locus_tag LOCUS_10180 260870 262306 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_10180 262445 263494 gene locus_tag LOCUS_10190 gene rlmN 262445 263494 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_10190 263684 264298 gene locus_tag LOCUS_10200 263684 264298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 265240 264314 gene locus_tag LOCUS_10210 265240 264314 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_10210 266042 265251 gene locus_tag LOCUS_10220 266042 265251 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_10220 267912 266059 gene locus_tag LOCUS_10230 gene mutL 267912 266059 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_10230 268321 267905 gene locus_tag LOCUS_10240 268321 267905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 268611 271538 gene locus_tag LOCUS_10250 268611 271538 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_10250 271602 272744 gene locus_tag LOCUS_10260 271602 272744 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_10260 272893 273516 gene locus_tag LOCUS_10270 272893 273516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 273750 274571 gene locus_tag LOCUS_10280 273750 274571 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_10280 274891 277683 gene locus_tag LOCUS_10290 gene sucA 274891 277683 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_10290 277771 279333 gene locus_tag LOCUS_10300 gene sucB 277771 279333 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_10300 279397 280794 gene locus_tag LOCUS_10310 gene lpdA1 279397 280794 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_10310 281405 280923 gene locus_tag LOCUS_10320 281405 280923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_10320 282744 281749 gene locus_tag LOCUS_10330 282744 281749 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886873.1 protein_id gnl|my_center|LOCUS_10330 283392 283144 gene locus_tag LOCUS_10340 283392 283144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 283683 283507 gene locus_tag LOCUS_10350 283683 283507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 285184 283853 gene locus_tag LOCUS_10360 285184 283853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 285975 285280 gene locus_tag LOCUS_10370 285975 285280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 287520 286264 gene locus_tag LOCUS_10380 287520 286264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_10380 289648 287750 gene locus_tag LOCUS_10390 289648 287750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 290400 289681 gene locus_tag LOCUS_10400 290400 289681 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_10400 293779 290981 gene locus_tag LOCUS_10410 gene acnB 293779 290981 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_10410 294840 294115 gene locus_tag LOCUS_10420 294840 294115 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_10420 295428 296558 gene locus_tag LOCUS_10430 295428 296558 CDS product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_10430 297619 296966 gene locus_tag LOCUS_10440 gene folE1 297619 296966 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_10440 298016 297612 gene locus_tag LOCUS_10450 298016 297612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 298721 298446 gene locus_tag LOCUS_10460 298721 298446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 300599 299211 gene locus_tag LOCUS_10470 300599 299211 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_10470 301338 300871 gene locus_tag LOCUS_10480 301338 300871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991273.1 protein_id gnl|my_center|LOCUS_10480 302991 301699 gene locus_tag LOCUS_10490 gene murF 302991 301699 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_10490 303229 305307 gene locus_tag LOCUS_10500 303229 305307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 306321 305530 gene locus_tag LOCUS_10510 306321 305530 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_10510 306906 306358 gene locus_tag LOCUS_10520 gene def 306906 306358 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_10520 307316 306903 gene locus_tag LOCUS_10530 307316 306903 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_10530 308074 307316 gene locus_tag LOCUS_10540 308074 307316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 308297 309880 gene locus_tag LOCUS_10550 308297 309880 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_10550 310003 310404 gene locus_tag LOCUS_10560 310003 310404 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145269.1 protein_id gnl|my_center|LOCUS_10560 312382 310472 gene locus_tag LOCUS_10570 312382 310472 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_10570 312671 314497 gene locus_tag LOCUS_10580 312671 314497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 315739 314519 gene locus_tag LOCUS_10590 315739 314519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 317567 315939 gene locus_tag LOCUS_10600 317567 315939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 319040 317580 gene locus_tag LOCUS_10610 gene arsA 319040 317580 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_10610 320534 319101 gene locus_tag LOCUS_10620 320534 319101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_10620 324021 320605 gene locus_tag LOCUS_10630 324021 320605 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_10630 324981 324076 gene locus_tag LOCUS_10640 324981 324076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 325692 325096 gene locus_tag LOCUS_10650 325692 325096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence04 1403 1609 gene locus_tag LOCUS_10660 1403 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1809 2957 gene locus_tag LOCUS_10670 1809 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_10670 3231 3389 gene locus_tag LOCUS_10680 3231 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4736 4023 gene locus_tag LOCUS_10690 4736 4023 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_10690 5879 4806 gene locus_tag LOCUS_10700 gene phoR 5879 4806 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_10700 6562 5876 gene locus_tag LOCUS_10710 gene phoP 6562 5876 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_10710 7513 6719 gene locus_tag LOCUS_10720 7513 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_10720 7694 8743 gene locus_tag LOCUS_10730 gene recA 7694 8743 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_10730 9985 8783 gene locus_tag LOCUS_10740 9985 8783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_10740 10143 11192 gene locus_tag LOCUS_10750 gene queA 10143 11192 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_10750 13373 11358 gene locus_tag LOCUS_10760 13373 11358 CDS product potassium transporter KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_10760 14321 15811 gene locus_tag LOCUS_10770 14321 15811 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_10770 15808 16410 gene locus_tag LOCUS_10780 15808 16410 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_10780 16999 16403 gene locus_tag LOCUS_10790 16999 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_10790 17064 18059 gene locus_tag LOCUS_10800 17064 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 19346 18069 gene locus_tag LOCUS_10810 19346 18069 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_10810 20557 19343 gene locus_tag LOCUS_10820 gene porV 20557 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_10820 23805 20554 gene locus_tag LOCUS_10830 gene porU 23805 20554 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_10830 24436 23789 gene locus_tag LOCUS_10840 gene pssA 24436 23789 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_10840 25143 24490 gene locus_tag LOCUS_10850 25143 24490 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_10850 25200 26255 gene locus_tag LOCUS_10860 gene fjo30 25200 26255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_10860 26286 29702 gene locus_tag LOCUS_10870 26286 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 29720 30598 gene locus_tag LOCUS_10880 29720 30598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_10880 31983 30607 gene locus_tag LOCUS_10890 gene aldH 31983 30607 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Z3 protein_id gnl|my_center|LOCUS_10890 34616 32202 gene locus_tag LOCUS_10900 34616 32202 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_10900 35127 36464 gene locus_tag LOCUS_10910 gene hemL 35127 36464 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_10910 37000 39921 gene locus_tag LOCUS_10920 37000 39921 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_10920 39995 41335 gene locus_tag LOCUS_10930 39995 41335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_10930 41351 42592 gene locus_tag LOCUS_10940 41351 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 43156 43716 gene locus_tag LOCUS_10950 43156 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 44113 43799 gene locus_tag LOCUS_10960 44113 43799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 44233 44745 gene locus_tag LOCUS_10970 44233 44745 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071263.1 protein_id gnl|my_center|LOCUS_10970 45910 44849 gene locus_tag LOCUS_10980 45910 44849 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107469.1 protein_id gnl|my_center|LOCUS_10980 46594 47787 gene locus_tag LOCUS_10990 46594 47787 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_10990 48239 49705 gene locus_tag LOCUS_11000 48239 49705 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_11000 49715 51592 gene locus_tag LOCUS_11010 49715 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 51895 52326 gene locus_tag LOCUS_11020 51895 52326 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_11020 52686 52375 gene locus_tag LOCUS_11030 52686 52375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020650.1 protein_id gnl|my_center|LOCUS_11030 53496 52822 gene locus_tag LOCUS_11040 53496 52822 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_11040 53910 53572 gene locus_tag LOCUS_11050 53910 53572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 54336 53959 gene locus_tag LOCUS_11060 gene gcvH 54336 53959 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_11060 61282 54389 gene locus_tag LOCUS_11070 gene sprA 61282 54389 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_11070 61335 61511 gene locus_tag LOCUS_11080 61335 61511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 62174 61572 gene locus_tag LOCUS_11090 gene ruvA 62174 61572 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_11090 64435 62171 gene locus_tag LOCUS_11100 gene maeB 64435 62171 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_11100 65521 64460 gene locus_tag LOCUS_11110 65521 64460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 67036 65645 gene locus_tag LOCUS_11120 67036 65645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 68473 67040 gene locus_tag LOCUS_11130 gene gatA 68473 67040 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_11130 68687 68478 gene locus_tag LOCUS_11140 gene tatA 68687 68478 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC14 protein_id gnl|my_center|LOCUS_11140 70003 68801 gene locus_tag LOCUS_11150 70003 68801 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_11150 70799 70056 gene locus_tag LOCUS_11160 70799 70056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 72537 70792 gene locus_tag LOCUS_11170 72537 70792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_11170 73181 72750 gene locus_tag LOCUS_11180 gene dut 73181 72750 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_11180 74700 73183 gene locus_tag LOCUS_11190 74700 73183 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_11190 75498 74713 gene locus_tag LOCUS_11200 gene crt 75498 74713 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_11200 75921 77387 gene locus_tag LOCUS_11210 gene leuB 75921 77387 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_11210 77436 78722 gene locus_tag LOCUS_11220 77436 78722 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_11220 79052 79564 gene locus_tag LOCUS_11230 gene rfaY 79052 79564 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_11230 79561 80151 gene locus_tag LOCUS_11240 79561 80151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 81764 80277 gene locus_tag LOCUS_11250 81764 80277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_11250 81966 84923 gene locus_tag LOCUS_11260 81966 84923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 85772 84924 gene locus_tag LOCUS_11270 85772 84924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 86834 85788 gene locus_tag LOCUS_11280 86834 85788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 89265 86827 gene locus_tag LOCUS_11290 89265 86827 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_11290 90199 89504 gene locus_tag LOCUS_11300 90199 89504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 90671 92395 gene locus_tag LOCUS_11310 90671 92395 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_11310 93639 92665 gene locus_tag LOCUS_11320 gene porP 93639 92665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_11320 97920 93643 gene locus_tag LOCUS_11330 97920 93643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 98932 98438 gene locus_tag LOCUS_11340 98932 98438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 99181 100542 gene locus_tag LOCUS_11350 gene ffh 99181 100542 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_11350 101668 100688 gene locus_tag LOCUS_11360 gene pdhB 101668 100688 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_11360 101970 102470 gene locus_tag LOCUS_11370 101970 102470 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_11370 102655 102506 gene locus_tag LOCUS_11380 102655 102506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 102822 104198 gene locus_tag LOCUS_11390 gene hisS 102822 104198 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_11390 104321 104653 gene locus_tag LOCUS_11400 104321 104653 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNB8 protein_id gnl|my_center|LOCUS_11400 104653 105663 gene locus_tag LOCUS_11410 104653 105663 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_11410 105948 107486 gene locus_tag LOCUS_11420 105948 107486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 107488 108360 gene locus_tag LOCUS_11430 107488 108360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 108431 108943 gene locus_tag LOCUS_11440 108431 108943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 109793 110857 gene locus_tag LOCUS_11450 109793 110857 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_11450 111357 111052 gene locus_tag LOCUS_11460 111357 111052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 112394 111594 gene locus_tag LOCUS_11470 112394 111594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 113102 113668 gene locus_tag LOCUS_11480 113102 113668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 114946 118173 gene locus_tag LOCUS_11490 114946 118173 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_11490 118202 119959 gene locus_tag LOCUS_11500 118202 119959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 120327 121667 gene locus_tag LOCUS_11510 120327 121667 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_11510 121664 123040 gene locus_tag LOCUS_11520 121664 123040 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_11520 123092 125749 gene locus_tag LOCUS_11530 123092 125749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 125831 126739 gene locus_tag LOCUS_11540 125831 126739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 126726 127511 gene locus_tag LOCUS_11550 126726 127511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 127854 128117 gene locus_tag LOCUS_11560 127854 128117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 128249 129541 gene locus_tag LOCUS_11570 gene pepP 128249 129541 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_11570 129572 130024 gene locus_tag LOCUS_11580 129572 130024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 131225 132040 gene locus_tag LOCUS_11590 131225 132040 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_11590 132112 132606 gene locus_tag LOCUS_11600 132112 132606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 134385 132970 gene locus_tag LOCUS_11610 134385 132970 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_11610 137549 134397 gene locus_tag LOCUS_11620 137549 134397 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_11620 138754 137567 gene locus_tag LOCUS_11630 138754 137567 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108070.1 protein_id gnl|my_center|LOCUS_11630 140199 138745 gene locus_tag LOCUS_11640 140199 138745 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_11640 140328 141221 gene locus_tag LOCUS_11650 140328 141221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 141430 142104 gene locus_tag LOCUS_11660 141430 142104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 142105 143325 gene locus_tag LOCUS_11670 142105 143325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 148233 143377 gene locus_tag LOCUS_11680 148233 143377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_11680 149260 148472 gene locus_tag LOCUS_11690 149260 148472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 150892 149549 gene locus_tag LOCUS_11700 150892 149549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 151292 151726 gene locus_tag LOCUS_11710 151292 151726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 151916 152599 gene locus_tag LOCUS_11720 151916 152599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 153202 152663 gene locus_tag LOCUS_11730 153202 152663 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_11730 153474 153725 gene locus_tag LOCUS_11740 153474 153725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_11740 153891 155363 gene locus_tag LOCUS_11750 153891 155363 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_11750 156605 155496 gene locus_tag LOCUS_11760 156605 155496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 157969 156602 gene locus_tag LOCUS_11770 157969 156602 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_11770 158224 158057 gene locus_tag LOCUS_11780 158224 158057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 158200 159294 gene locus_tag LOCUS_11790 158200 159294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 159299 160531 gene locus_tag LOCUS_11800 159299 160531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 160663 162258 gene locus_tag LOCUS_11810 gene fucI 160663 162258 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 protein_id gnl|my_center|LOCUS_11810 162260 163429 gene locus_tag LOCUS_11820 162260 163429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_11820 163490 164422 gene locus_tag LOCUS_11830 163490 164422 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_11830 164537 166018 gene locus_tag LOCUS_11840 164537 166018 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_11840 166665 166024 gene locus_tag LOCUS_11850 166665 166024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 169024 166964 gene locus_tag LOCUS_11860 169024 166964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 169763 171409 gene locus_tag LOCUS_11870 gene pgi 169763 171409 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_11870 172813 171683 gene locus_tag LOCUS_11880 172813 171683 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_11880 172973 173824 gene locus_tag LOCUS_11890 172973 173824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 175456 173825 gene locus_tag LOCUS_11900 175456 173825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 175793 176464 gene locus_tag LOCUS_11910 175793 176464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 176914 176522 gene locus_tag LOCUS_11920 176914 176522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_11920 178558 177914 gene locus_tag LOCUS_11930 gene yplQ 178558 177914 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54175 protein_id gnl|my_center|LOCUS_11930 179025 180335 gene locus_tag LOCUS_11940 gene rimO 179025 180335 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_11940 180395 181558 gene locus_tag LOCUS_11950 180395 181558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_11950 185219 181644 gene locus_tag LOCUS_11960 185219 181644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 185528 185454 gene locus_tag LOCUS_t00110 185528 185454 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 186191 185571 gene locus_tag LOCUS_11970 gene recR 186191 185571 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UM9 protein_id gnl|my_center|LOCUS_11970 186491 186204 gene locus_tag LOCUS_11980 186491 186204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 186689 187999 gene locus_tag LOCUS_11990 186689 187999 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_11990 188507 188100 gene locus_tag LOCUS_12000 188507 188100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 189444 189109 gene locus_tag LOCUS_12010 gene ogt2 189444 189109 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_12010 190315 189431 gene locus_tag LOCUS_12020 190315 189431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 190401 191081 gene locus_tag LOCUS_12030 190401 191081 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405482.1 protein_id gnl|my_center|LOCUS_12030 191102 191785 gene locus_tag LOCUS_12040 191102 191785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 192353 194800 gene locus_tag LOCUS_12050 192353 194800 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_12050 194802 195746 gene locus_tag LOCUS_12060 gene thrB 194802 195746 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_12060 195772 197064 gene locus_tag LOCUS_12070 195772 197064 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_12070 197755 197072 gene locus_tag LOCUS_12080 197755 197072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 198086 199051 gene locus_tag LOCUS_12090 gene kel 198086 199051 CDS product ring canal kelch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119438.1 protein_id gnl|my_center|LOCUS_12090 199105 200016 gene locus_tag LOCUS_12100 gene ilvE2 199105 200016 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_12100 200085 200747 gene locus_tag LOCUS_12110 200085 200747 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_12110 201132 202178 gene locus_tag LOCUS_12120 201132 202178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 202453 203022 gene locus_tag LOCUS_12130 202453 203022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759723.1 protein_id gnl|my_center|LOCUS_12130 204400 203024 gene locus_tag LOCUS_12140 204400 203024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 205690 204755 gene locus_tag LOCUS_12150 205690 204755 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_12150 208141 205814 gene locus_tag LOCUS_12160 208141 205814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 209412 208168 gene locus_tag LOCUS_12170 209412 208168 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_12170 209693 210685 gene locus_tag LOCUS_12180 gene aspG 209693 210685 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_12180 210700 211449 gene locus_tag LOCUS_12190 gene cutC 210700 211449 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_12190 211714 212172 gene locus_tag LOCUS_12200 211714 212172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 212967 212191 gene locus_tag LOCUS_12210 212967 212191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_12210 213133 216345 gene locus_tag LOCUS_12220 213133 216345 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8W3 protein_id gnl|my_center|LOCUS_12220 216346 219219 gene locus_tag LOCUS_12230 216346 219219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_12230 219700 220071 gene locus_tag LOCUS_12240 219700 220071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_12240 220125 220922 gene locus_tag LOCUS_12250 220125 220922 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_12250 220924 221676 gene locus_tag LOCUS_12260 220924 221676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_12260 221673 222647 gene locus_tag LOCUS_12270 221673 222647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 222785 225565 gene locus_tag LOCUS_12280 gene acoA 222785 225565 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMF6 protein_id gnl|my_center|LOCUS_12280 226479 225973 gene locus_tag LOCUS_12290 226479 225973 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_12290 228052 226703 gene locus_tag LOCUS_12300 228052 226703 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence05 270 2261 gene locus_tag LOCUS_12310 270 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4136 2460 gene locus_tag LOCUS_12320 4136 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7445 4155 gene locus_tag LOCUS_12330 7445 4155 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_12330 10094 8418 gene locus_tag LOCUS_12340 10094 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_12340 13409 10113 gene locus_tag LOCUS_12350 13409 10113 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_12350 14194 15240 gene locus_tag LOCUS_12360 14194 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15624 17426 gene locus_tag LOCUS_12370 15624 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17548 18315 gene locus_tag LOCUS_12380 17548 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 19815 18361 gene locus_tag LOCUS_12390 19815 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_12390 20611 19886 gene locus_tag LOCUS_12400 gene truC 20611 19886 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_12400 21827 20613 gene locus_tag LOCUS_12410 gene mnmA 21827 20613 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_12410 21947 23845 gene locus_tag LOCUS_12420 21947 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 25488 24175 gene locus_tag LOCUS_12430 25488 24175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080345.1 protein_id gnl|my_center|LOCUS_12430 27996 25540 gene locus_tag LOCUS_12440 27996 25540 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141907.1 protein_id gnl|my_center|LOCUS_12440 28382 28843 gene locus_tag LOCUS_12450 28382 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 28918 30279 gene locus_tag LOCUS_12460 28918 30279 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_12460 30319 31368 gene locus_tag LOCUS_12470 30319 31368 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105748.1 protein_id gnl|my_center|LOCUS_12470 31377 34532 gene locus_tag LOCUS_12480 31377 34532 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_12480 34625 34864 gene locus_tag LOCUS_12490 34625 34864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 36762 35092 gene locus_tag LOCUS_12500 36762 35092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_12500 39807 36787 gene locus_tag LOCUS_12510 39807 36787 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_12510 41589 40282 gene locus_tag LOCUS_12520 gene arsA 41589 40282 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_12520 43813 41633 gene locus_tag LOCUS_12530 43813 41633 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 protein_id gnl|my_center|LOCUS_12530 44426 45442 gene locus_tag LOCUS_12540 44426 45442 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081533.1 protein_id gnl|my_center|LOCUS_12540 45534 46022 gene locus_tag LOCUS_12550 45534 46022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 46054 46242 gene locus_tag LOCUS_12560 46054 46242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 46233 47147 gene locus_tag LOCUS_12570 46233 47147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 47744 48307 gene locus_tag LOCUS_12580 47744 48307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 48304 49437 gene locus_tag LOCUS_12590 48304 49437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 49448 50152 gene locus_tag LOCUS_12600 49448 50152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_12600 50149 51306 gene locus_tag LOCUS_12610 50149 51306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 51303 52577 gene locus_tag LOCUS_12620 51303 52577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 52595 53356 gene locus_tag LOCUS_12630 52595 53356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 53402 54559 gene locus_tag LOCUS_12640 53402 54559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 55310 57016 gene locus_tag LOCUS_12650 55310 57016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 57009 57641 gene locus_tag LOCUS_12660 57009 57641 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175643.1 protein_id gnl|my_center|LOCUS_12660 57665 58081 gene locus_tag LOCUS_12670 57665 58081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 58781 59569 gene locus_tag LOCUS_12680 58781 59569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 59955 61301 gene locus_tag LOCUS_12690 gene ibeB 59955 61301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_12690 61298 62461 gene locus_tag LOCUS_12700 61298 62461 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_12700 62472 65582 gene locus_tag LOCUS_12710 gene czcA 62472 65582 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_12710 66121 66444 gene locus_tag LOCUS_12720 66121 66444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 66509 67987 gene locus_tag LOCUS_12730 66509 67987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 69099 68425 gene locus_tag LOCUS_12740 69099 68425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053861.1 protein_id gnl|my_center|LOCUS_12740 69295 70620 gene locus_tag LOCUS_12750 69295 70620 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_12750 70632 71834 gene locus_tag LOCUS_12760 70632 71834 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_12760 71842 72585 gene locus_tag LOCUS_12770 71842 72585 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_12770 72588 73808 gene locus_tag LOCUS_12780 72588 73808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_12780 73814 74851 gene locus_tag LOCUS_12790 73814 74851 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_12790 74857 75594 gene locus_tag LOCUS_12800 74857 75594 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_12800 77344 76319 gene locus_tag LOCUS_12810 77344 76319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 78004 77453 gene locus_tag LOCUS_12820 78004 77453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 79011 80237 gene locus_tag LOCUS_12830 gene yciC 79011 80237 CDS product putative metal chaperone YciC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94400 protein_id gnl|my_center|LOCUS_12830 80376 82643 gene locus_tag LOCUS_12840 80376 82643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_12840 82648 83721 gene locus_tag LOCUS_12850 82648 83721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 83784 88490 gene locus_tag LOCUS_12860 83784 88490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 88492 89184 gene locus_tag LOCUS_12870 88492 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 89172 89771 gene locus_tag LOCUS_12880 89172 89771 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_12880 89752 90084 gene locus_tag LOCUS_12890 89752 90084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778408.1 protein_id gnl|my_center|LOCUS_12890 90502 92817 gene locus_tag LOCUS_12900 90502 92817 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_12900 92819 94060 gene locus_tag LOCUS_12910 92819 94060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 94094 94747 gene locus_tag LOCUS_12920 94094 94747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 94817 95938 gene locus_tag LOCUS_12930 94817 95938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_12930 98577 96355 gene locus_tag LOCUS_12940 98577 96355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 100444 98642 gene locus_tag LOCUS_12950 100444 98642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 100984 101955 gene locus_tag LOCUS_12960 100984 101955 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_12960 101956 102831 gene locus_tag LOCUS_12970 101956 102831 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_12970 102979 102818 gene locus_tag LOCUS_12980 102979 102818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 104188 103028 gene locus_tag LOCUS_12990 104188 103028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 105195 104251 gene locus_tag LOCUS_13000 105195 104251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 105905 105234 gene locus_tag LOCUS_13010 105905 105234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 107170 105917 gene locus_tag LOCUS_13020 107170 105917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 107649 109232 gene locus_tag LOCUS_13030 107649 109232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 109277 110515 gene locus_tag LOCUS_13040 109277 110515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 111847 110759 gene locus_tag LOCUS_13050 111847 110759 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_13050 112122 113264 gene locus_tag LOCUS_13060 112122 113264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 113313 114026 gene locus_tag LOCUS_13070 113313 114026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 114195 114845 gene locus_tag LOCUS_13080 114195 114845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 114901 115119 gene locus_tag LOCUS_13090 114901 115119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 115351 115575 gene locus_tag LOCUS_13100 115351 115575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 116601 117335 gene locus_tag LOCUS_13110 116601 117335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_13110 117473 118111 gene locus_tag LOCUS_13120 117473 118111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 118473 119657 gene locus_tag LOCUS_13130 118473 119657 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_13130 120628 120449 gene locus_tag LOCUS_13140 120628 120449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 120997 122412 gene locus_tag LOCUS_13150 120997 122412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 122444 123103 gene locus_tag LOCUS_13160 122444 123103 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_13160 123192 123482 gene locus_tag LOCUS_13170 123192 123482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 127028 123813 gene locus_tag LOCUS_13180 127028 123813 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122060.1 protein_id gnl|my_center|LOCUS_13180 127294 128754 gene locus_tag LOCUS_13190 127294 128754 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_13190 130414 129203 gene locus_tag LOCUS_13200 130414 129203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 133000 130448 gene locus_tag LOCUS_13210 gene gyrA 133000 130448 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_13210 134164 133166 gene locus_tag LOCUS_13220 134164 133166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 134772 134260 gene locus_tag LOCUS_13230 134772 134260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 135545 134892 gene locus_tag LOCUS_13240 gene rpe 135545 134892 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_13240 137240 135615 gene locus_tag LOCUS_13250 137240 135615 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_13250 137868 137227 gene locus_tag LOCUS_13260 137868 137227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 137969 138598 gene locus_tag LOCUS_13270 137969 138598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 139260 138595 gene locus_tag LOCUS_13280 gene trmB 139260 138595 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_13280 140570 139263 gene locus_tag LOCUS_13290 140570 139263 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_13290 141533 140580 gene locus_tag LOCUS_13300 141533 140580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 141929 141537 gene locus_tag LOCUS_13310 141929 141537 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_13310 142632 141931 gene locus_tag LOCUS_13320 142632 141931 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_13320 143290 142634 gene locus_tag LOCUS_13330 143290 142634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 145104 143428 gene locus_tag LOCUS_13340 145104 143428 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_13340 148106 145104 gene locus_tag LOCUS_13350 148106 145104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_13350 149146 148121 gene locus_tag LOCUS_13360 gene holA 149146 148121 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_13360 149268 149975 gene locus_tag LOCUS_13370 149268 149975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 150798 149962 gene locus_tag LOCUS_13380 150798 149962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 151746 150820 gene locus_tag LOCUS_13390 151746 150820 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_13390 152033 152827 gene locus_tag LOCUS_13400 152033 152827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_13400 154996 153266 gene locus_tag LOCUS_13410 154996 153266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 157585 155093 gene locus_tag LOCUS_13420 157585 155093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 157853 158797 gene locus_tag LOCUS_13430 157853 158797 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_13430 160960 158810 gene locus_tag LOCUS_13440 160960 158810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 162357 161164 gene locus_tag LOCUS_13450 162357 161164 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706325.1 protein_id gnl|my_center|LOCUS_13450 162590 163270 gene locus_tag LOCUS_13460 162590 163270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 163385 164584 gene locus_tag LOCUS_13470 163385 164584 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_13470 165388 165038 gene locus_tag LOCUS_13480 165388 165038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 166766 165543 gene locus_tag LOCUS_13490 166766 165543 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_13490 168319 166787 gene locus_tag LOCUS_13500 168319 166787 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_13500 168938 168531 gene locus_tag LOCUS_13510 168938 168531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 169423 168971 gene locus_tag LOCUS_13520 169423 168971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 170272 170862 gene locus_tag LOCUS_13530 170272 170862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 172584 171982 gene locus_tag LOCUS_13540 172584 171982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 173414 172599 gene locus_tag LOCUS_13550 gene dapD 173414 172599 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_13550 173511 174578 gene locus_tag LOCUS_13560 173511 174578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 174830 175501 gene locus_tag LOCUS_13570 gene sirR 174830 175501 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_13570 175661 176113 gene locus_tag LOCUS_13580 175661 176113 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_13580 176113 177495 gene locus_tag LOCUS_13590 gene mnmE 176113 177495 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_13590 177737 178090 gene locus_tag LOCUS_13600 177737 178090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 178087 179181 gene locus_tag LOCUS_13610 178087 179181 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_13610 179178 180203 gene locus_tag LOCUS_13620 179178 180203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 180402 180701 gene locus_tag LOCUS_13630 180402 180701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 180698 180994 gene locus_tag LOCUS_13640 180698 180994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 180981 181901 gene locus_tag LOCUS_13650 180981 181901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 181905 183722 gene locus_tag LOCUS_13660 181905 183722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107945.1 protein_id gnl|my_center|LOCUS_13660 183916 184206 gene locus_tag LOCUS_13670 183916 184206 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963681.1 protein_id gnl|my_center|LOCUS_13670 184221 184445 gene locus_tag LOCUS_13680 184221 184445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 184460 186517 gene locus_tag LOCUS_13690 184460 186517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 186704 187387 gene locus_tag LOCUS_13700 186704 187387 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_13700 187384 188667 gene locus_tag LOCUS_13710 187384 188667 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_13710 188745 189482 gene locus_tag LOCUS_13720 188745 189482 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I446 protein_id gnl|my_center|LOCUS_13720 189562 190908 gene locus_tag LOCUS_13730 189562 190908 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 protein_id gnl|my_center|LOCUS_13730 191122 192495 gene locus_tag LOCUS_13740 191122 192495 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_13740 192498 195632 gene locus_tag LOCUS_13750 192498 195632 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_13750 195707 196750 gene locus_tag LOCUS_13760 gene ragD 195707 196750 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_13760 196762 198918 gene locus_tag LOCUS_13770 196762 198918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 199052 199363 gene locus_tag LOCUS_13780 199052 199363 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 protein_id gnl|my_center|LOCUS_13780 199410 200417 gene locus_tag LOCUS_13790 199410 200417 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_13790 200435 201958 gene locus_tag LOCUS_13800 200435 201958 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016345.1 protein_id gnl|my_center|LOCUS_13800 201951 202667 gene locus_tag LOCUS_13810 201951 202667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 202679 203419 gene locus_tag LOCUS_13820 202679 203419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090287.1 protein_id gnl|my_center|LOCUS_13820 203456 204430 gene locus_tag LOCUS_13830 203456 204430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 204644 204393 gene locus_tag LOCUS_13840 204644 204393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence06 1046 2050 gene locus_tag LOCUS_13850 1046 2050 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_13850 2044 3864 gene locus_tag LOCUS_13860 2044 3864 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387211.1 protein_id gnl|my_center|LOCUS_13860 3854 5305 gene locus_tag LOCUS_13870 3854 5305 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_13870 5932 6234 gene locus_tag LOCUS_13880 5932 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6549 7823 gene locus_tag LOCUS_13890 6549 7823 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941221.1 protein_id gnl|my_center|LOCUS_13890 7804 9366 gene locus_tag LOCUS_13900 7804 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55385 protein_id gnl|my_center|LOCUS_13900 9750 9929 gene locus_tag LOCUS_13910 9750 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 10307 10116 gene locus_tag LOCUS_13920 10307 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 11188 10883 gene locus_tag LOCUS_13930 11188 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13930 12065 12598 gene locus_tag LOCUS_13940 12065 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13074 13487 gene locus_tag LOCUS_13950 13074 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 14917 15447 gene locus_tag LOCUS_13960 gene folA2 14917 15447 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 protein_id gnl|my_center|LOCUS_13960 15551 16051 gene locus_tag LOCUS_13970 15551 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 16535 17533 gene locus_tag LOCUS_13980 16535 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 17563 18168 gene locus_tag LOCUS_13990 17563 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 18471 18202 gene locus_tag LOCUS_14000 18471 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 18971 19825 gene locus_tag LOCUS_14010 18971 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 19918 20319 gene locus_tag LOCUS_14020 19918 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 20325 20828 gene locus_tag LOCUS_14030 20325 20828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976336.1 protein_id gnl|my_center|LOCUS_14030 20847 21689 gene locus_tag LOCUS_14040 20847 21689 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_14040 22468 23724 gene locus_tag LOCUS_14050 22468 23724 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_14050 23731 24660 gene locus_tag LOCUS_14060 23731 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 24727 25410 gene locus_tag LOCUS_14070 24727 25410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_14070 25632 26510 gene locus_tag LOCUS_14080 25632 26510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798133.1 protein_id gnl|my_center|LOCUS_14080 27364 26507 gene locus_tag LOCUS_14090 27364 26507 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365532.1 protein_id gnl|my_center|LOCUS_14090 28158 27457 gene locus_tag LOCUS_14100 28158 27457 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_14100 29068 28481 gene locus_tag LOCUS_14110 29068 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 31516 29429 gene locus_tag LOCUS_14120 31516 29429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 34370 31548 gene locus_tag LOCUS_14130 34370 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 36899 34461 gene locus_tag LOCUS_14140 36899 34461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 38632 37040 gene locus_tag LOCUS_14150 38632 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_14150 40949 39183 gene locus_tag LOCUS_14160 40949 39183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_14160 44345 40968 gene locus_tag LOCUS_14170 44345 40968 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_14170 45600 44569 gene locus_tag LOCUS_14180 45600 44569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 46374 45757 gene locus_tag LOCUS_14190 46374 45757 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_14190 46624 48261 gene locus_tag LOCUS_14200 46624 48261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 50400 48469 gene locus_tag LOCUS_14210 50400 48469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_14210 50938 51810 gene locus_tag LOCUS_14220 50938 51810 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_14220 51807 52862 gene locus_tag LOCUS_14230 51807 52862 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_14230 52869 53672 gene locus_tag LOCUS_14240 gene hmuV 52869 53672 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56993 protein_id gnl|my_center|LOCUS_14240 53723 54772 gene locus_tag LOCUS_14250 gene hmuS 53723 54772 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_14250 54819 57116 gene locus_tag LOCUS_14260 54819 57116 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_14260 57136 57747 gene locus_tag LOCUS_14270 57136 57747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_14270 57918 57751 gene locus_tag LOCUS_14280 57918 57751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 58519 57944 gene locus_tag LOCUS_14290 58519 57944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 59329 58583 gene locus_tag LOCUS_14300 59329 58583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 60231 62078 gene locus_tag LOCUS_14310 60231 62078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 protein_id gnl|my_center|LOCUS_14310 62085 62981 gene locus_tag LOCUS_14320 62085 62981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_14320 64059 63064 gene locus_tag LOCUS_14330 64059 63064 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_14330 64730 64353 gene locus_tag LOCUS_14340 64730 64353 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_14340 64890 65735 gene locus_tag LOCUS_14350 64890 65735 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_14350 66942 65947 gene locus_tag LOCUS_14360 gene ydjJ 66942 65947 CDS product putative membrane protein YdjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34733 protein_id gnl|my_center|LOCUS_14360 68095 67343 gene locus_tag LOCUS_14370 68095 67343 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_14370 69069 68104 gene locus_tag LOCUS_14380 69069 68104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206832.1 protein_id gnl|my_center|LOCUS_14380 70447 69086 gene locus_tag LOCUS_14390 gene gntP 70447 69086 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_14390 70619 71341 gene locus_tag LOCUS_14400 70619 71341 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_14400 71397 72287 gene locus_tag LOCUS_14410 71397 72287 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_14410 72348 74015 gene locus_tag LOCUS_14420 72348 74015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 74270 77116 gene locus_tag LOCUS_14430 74270 77116 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_14430 77504 79006 gene locus_tag LOCUS_14440 77504 79006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 79103 81979 gene locus_tag LOCUS_14450 79103 81979 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_14450 82144 82905 gene locus_tag LOCUS_14460 82144 82905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 84662 83244 gene locus_tag LOCUS_14470 84662 83244 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_14470 85458 84655 gene locus_tag LOCUS_14480 85458 84655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 87523 85514 gene locus_tag LOCUS_14490 87523 85514 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_14490 88029 87613 gene locus_tag LOCUS_14500 88029 87613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 88363 88019 gene locus_tag LOCUS_14510 88363 88019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 90401 88395 gene locus_tag LOCUS_14520 90401 88395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 92072 90840 gene locus_tag LOCUS_14530 92072 90840 CDS product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_14530 92238 92909 gene locus_tag LOCUS_14540 92238 92909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263627.1 protein_id gnl|my_center|LOCUS_14540 94238 92934 gene locus_tag LOCUS_14550 gene phrB1 94238 92934 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_14550 98816 94278 gene locus_tag LOCUS_14560 98816 94278 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_14560 98890 99906 gene locus_tag LOCUS_14570 gene tsaD 98890 99906 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_14570 99899 100363 gene locus_tag LOCUS_14580 gene smpB 99899 100363 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_14580 100329 101144 gene locus_tag LOCUS_14590 100329 101144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 101144 101662 gene locus_tag LOCUS_14600 101144 101662 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_14600 101844 103625 gene locus_tag LOCUS_14610 101844 103625 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_14610 104179 106476 gene locus_tag LOCUS_14620 104179 106476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_14620 106476 106955 gene locus_tag LOCUS_14630 106476 106955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 107428 107355 gene locus_tag LOCUS_t00120 107428 107355 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 107796 109064 gene locus_tag LOCUS_14640 gene actA 107796 109064 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_14640 109097 112195 gene locus_tag LOCUS_14650 gene actB 109097 112195 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_14650 112215 113579 gene locus_tag LOCUS_14660 gene actC 112215 113579 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_14660 113582 114112 gene locus_tag LOCUS_14670 gene actD 113582 114112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_14670 114127 114753 gene locus_tag LOCUS_14680 114127 114753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 114753 116036 gene locus_tag LOCUS_14690 114753 116036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 116061 117092 gene locus_tag LOCUS_14700 116061 117092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 117118 119010 gene locus_tag LOCUS_14710 gene ctaD 117118 119010 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_14710 118991 120076 gene locus_tag LOCUS_14720 gene ctaA 118991 120076 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_14720 120079 120981 gene locus_tag LOCUS_14730 gene ctaB 120079 120981 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_14730 120983 121564 gene locus_tag LOCUS_14740 120983 121564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 121587 122357 gene locus_tag LOCUS_14750 gene coxP 121587 122357 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_14750 122377 122703 gene locus_tag LOCUS_14760 122377 122703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 122776 123444 gene locus_tag LOCUS_14770 122776 123444 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_14770 123431 123985 gene locus_tag LOCUS_14780 gene yozB 123431 123985 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_14780 124049 124297 gene locus_tag LOCUS_14790 124049 124297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 124582 128217 gene locus_tag LOCUS_14800 124582 128217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 128302 131742 gene locus_tag LOCUS_14810 128302 131742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_14810 131820 132524 gene locus_tag LOCUS_14820 131820 132524 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_14820 132528 134519 gene locus_tag LOCUS_14830 gene ispG 132528 134519 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4T0 protein_id gnl|my_center|LOCUS_14830 134550 134738 gene locus_tag LOCUS_14840 134550 134738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 134738 135088 gene locus_tag LOCUS_14850 134738 135088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_14850 135085 136053 gene locus_tag LOCUS_14860 135085 136053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 protein_id gnl|my_center|LOCUS_14860 136565 136068 gene locus_tag LOCUS_14870 136565 136068 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLE7 protein_id gnl|my_center|LOCUS_14870 136774 137085 gene locus_tag LOCUS_14880 gene rhaU 136774 137085 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZK3 protein_id gnl|my_center|LOCUS_14880 137179 139914 gene locus_tag LOCUS_14890 137179 139914 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_14890 140028 141077 gene locus_tag LOCUS_14900 140028 141077 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_14900 141205 142593 gene locus_tag LOCUS_14910 141205 142593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_14910 142590 142775 gene locus_tag LOCUS_14920 142590 142775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 142981 146931 gene locus_tag LOCUS_14930 142981 146931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 147193 147795 gene locus_tag LOCUS_14940 147193 147795 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_14940 147821 148003 gene locus_tag LOCUS_14950 147821 148003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 148474 149163 gene locus_tag LOCUS_14960 gene nth 148474 149163 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_14960 149163 150968 gene locus_tag LOCUS_14970 gene asnB 149163 150968 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14970 150965 152140 gene locus_tag LOCUS_14980 150965 152140 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_14980 153247 152222 gene locus_tag LOCUS_14990 153247 152222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 153659 154501 gene locus_tag LOCUS_15000 153659 154501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 154892 157447 gene locus_tag LOCUS_15010 154892 157447 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_15010 157450 158532 gene locus_tag LOCUS_15020 157450 158532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 158662 159861 gene locus_tag LOCUS_15030 158662 159861 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_15030 159830 160735 gene locus_tag LOCUS_15040 159830 160735 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_15040 160732 162156 gene locus_tag LOCUS_15050 160732 162156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 162153 163286 gene locus_tag LOCUS_15060 162153 163286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 163279 163980 gene locus_tag LOCUS_15070 163279 163980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 164193 165314 gene locus_tag LOCUS_15080 gene csp2G 164193 165314 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_15080 165333 166490 gene locus_tag LOCUS_15090 165333 166490 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_15090 167061 168428 gene locus_tag LOCUS_15100 gene wcaJ 167061 168428 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_15100 169406 168495 gene locus_tag LOCUS_15110 169406 168495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 169666 170217 gene locus_tag LOCUS_15120 169666 170217 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_15120 170785 173709 gene locus_tag LOCUS_15130 170785 173709 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_15130 173722 175149 gene locus_tag LOCUS_15140 173722 175149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769373.1 protein_id gnl|my_center|LOCUS_15140 175691 175200 gene locus_tag LOCUS_15150 175691 175200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 175784 176365 gene locus_tag LOCUS_15160 175784 176365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_15160 176476 178803 gene locus_tag LOCUS_15170 gene pepN 176476 178803 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_15170 180428 179196 gene locus_tag LOCUS_15180 180428 179196 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_15180 180822 180484 gene locus_tag LOCUS_15190 180822 180484 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813552.1 protein_id gnl|my_center|LOCUS_15190 181202 182101 gene locus_tag LOCUS_15200 181202 182101 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_15200 182270 182689 gene locus_tag LOCUS_15210 182270 182689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_15210 183798 182692 gene locus_tag LOCUS_15220 gene recF 183798 182692 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_15220 183903 184925 gene locus_tag LOCUS_15230 gene pdhA 183903 184925 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_15230 185658 185107 gene locus_tag LOCUS_15240 185658 185107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 185881 187020 gene locus_tag LOCUS_15250 185881 187020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 187272 187856 gene locus_tag LOCUS_15260 187272 187856 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_15260 187860 188837 gene locus_tag LOCUS_15270 187860 188837 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_15270 188905 190638 gene locus_tag LOCUS_15280 188905 190638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 190838 191608 gene locus_tag LOCUS_15290 190838 191608 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_15290 191860 193089 gene locus_tag LOCUS_15300 191860 193089 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918872.1 protein_id gnl|my_center|LOCUS_15300 193175 194668 gene locus_tag LOCUS_15310 193175 194668 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U88 protein_id gnl|my_center|LOCUS_15310 194964 196292 gene locus_tag LOCUS_15320 194964 196292 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_15320 196425 199301 gene locus_tag LOCUS_15330 196425 199301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 201658 199367 gene locus_tag LOCUS_15340 201658 199367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15340 203034 202069 gene locus_tag LOCUS_15350 203034 202069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 203745 204122 gene locus_tag LOCUS_15360 203745 204122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence07 1383 580 gene locus_tag LOCUS_15370 1383 580 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_15370 2022 3608 gene locus_tag LOCUS_15380 gene dnaB 2022 3608 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_15380 3937 3605 gene locus_tag LOCUS_15390 3937 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3990 4721 gene locus_tag LOCUS_15400 gene etfB 3990 4721 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_15400 4733 5698 gene locus_tag LOCUS_15410 gene etfA 4733 5698 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_15410 5705 6319 gene locus_tag LOCUS_15420 5705 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_15420 6491 7774 gene locus_tag LOCUS_15430 6491 7774 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_15430 8243 7809 gene locus_tag LOCUS_15440 gene ppi 8243 7809 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_15440 8358 9956 gene locus_tag LOCUS_15450 8358 9956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_15450 10849 10676 gene locus_tag LOCUS_15460 10849 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 11405 11025 gene locus_tag LOCUS_15470 11405 11025 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_15470 11906 12400 gene locus_tag LOCUS_15480 11906 12400 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_15480 13437 12397 gene locus_tag LOCUS_15490 gene murB 13437 12397 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_15490 13594 14544 gene locus_tag LOCUS_15500 13594 14544 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_15500 15457 14630 gene locus_tag LOCUS_15510 15457 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 15564 16433 gene locus_tag LOCUS_15520 gene ykuF 15564 16433 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_15520 17130 16606 gene locus_tag LOCUS_15530 17130 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 17383 17198 gene locus_tag LOCUS_15540 17383 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 18377 17664 gene locus_tag LOCUS_15550 gene ftsE 18377 17664 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_15550 18582 18379 gene locus_tag LOCUS_15560 18582 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 19322 18666 gene locus_tag LOCUS_15570 gene tal 19322 18666 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_15570 19697 19996 gene locus_tag LOCUS_15580 19697 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 20219 21565 gene locus_tag LOCUS_15590 20219 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 21588 22193 gene locus_tag LOCUS_15600 21588 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 22357 23496 gene locus_tag LOCUS_15610 22357 23496 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_15610 24395 23652 gene locus_tag LOCUS_15620 24395 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 25245 24562 gene locus_tag LOCUS_15630 25245 24562 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_15630 26399 25242 gene locus_tag LOCUS_15640 26399 25242 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_15640 27542 26469 gene locus_tag LOCUS_15650 gene adh 27542 26469 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_15650 28139 27555 gene locus_tag LOCUS_15660 28139 27555 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104095.1 protein_id gnl|my_center|LOCUS_15660 28362 29630 gene locus_tag LOCUS_15670 28362 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_15670 30686 29859 gene locus_tag LOCUS_15680 30686 29859 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_15680 32487 31249 gene locus_tag LOCUS_15690 32487 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_15690 32985 32650 gene locus_tag LOCUS_15700 32985 32650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 34130 33531 gene locus_tag LOCUS_15710 34130 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15710 34891 34289 gene locus_tag LOCUS_15720 34891 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15720 35652 35050 gene locus_tag LOCUS_15730 35652 35050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15730 36197 35880 gene locus_tag LOCUS_15740 36197 35880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 37141 37323 gene locus_tag LOCUS_15750 37141 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 37447 38304 gene locus_tag LOCUS_15760 37447 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 38312 39280 gene locus_tag LOCUS_15770 38312 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 39277 40281 gene locus_tag LOCUS_15780 39277 40281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_15780 41243 43378 gene locus_tag LOCUS_15790 41243 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 44278 45069 gene locus_tag LOCUS_15800 44278 45069 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_15800 45276 45094 gene locus_tag LOCUS_15810 45276 45094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 45778 45251 gene locus_tag LOCUS_15820 45778 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 45970 46632 gene locus_tag LOCUS_15830 45970 46632 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_15830 46639 47223 gene locus_tag LOCUS_15840 46639 47223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_15840 47220 49346 gene locus_tag LOCUS_15850 47220 49346 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_15850 49343 50662 gene locus_tag LOCUS_15860 49343 50662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_15860 50671 51732 gene locus_tag LOCUS_15870 50671 51732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_15870 51785 52303 gene locus_tag LOCUS_15880 51785 52303 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_15880 52364 52669 gene locus_tag LOCUS_15890 52364 52669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 52754 53758 gene locus_tag LOCUS_15900 gene cas1 52754 53758 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_15900 53861 54124 gene locus_tag LOCUS_15910 gene cas2 53861 54124 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_15910 54335 55421 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctttaatcgcaccaatctggaattgaaac 57513 55915 gene locus_tag LOCUS_15920 57513 55915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403050.1 protein_id gnl|my_center|LOCUS_15920 58073 58000 gene locus_tag LOCUS_t00130 58073 58000 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 58439 61189 gene locus_tag LOCUS_15930 58439 61189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 61878 61249 gene locus_tag LOCUS_15940 61878 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 62418 61927 gene locus_tag LOCUS_15950 62418 61927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 62724 63293 gene locus_tag LOCUS_15960 62724 63293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_15960 63427 64794 gene locus_tag LOCUS_15970 63427 64794 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_15970 64949 66712 gene locus_tag LOCUS_15980 64949 66712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 66894 67088 gene locus_tag LOCUS_15990 66894 67088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 67095 67520 gene locus_tag LOCUS_16000 67095 67520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 67587 68249 gene locus_tag LOCUS_16010 67587 68249 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_16010 68578 69579 gene locus_tag LOCUS_16020 68578 69579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 protein_id gnl|my_center|LOCUS_16020 69903 70385 gene locus_tag LOCUS_16030 69903 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 70395 70835 gene locus_tag LOCUS_16040 70395 70835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 70854 71252 gene locus_tag LOCUS_16050 70854 71252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 71934 71647 gene locus_tag LOCUS_16060 71934 71647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 72952 73539 gene locus_tag LOCUS_16070 72952 73539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 74798 73590 gene locus_tag LOCUS_16080 74798 73590 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_16080 75788 74808 gene locus_tag LOCUS_16090 75788 74808 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_16090 76016 76783 gene locus_tag LOCUS_16100 76016 76783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 77486 76800 gene locus_tag LOCUS_16110 77486 76800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 78076 77498 gene locus_tag LOCUS_16120 gene tdk 78076 77498 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_16120 78510 79577 gene locus_tag LOCUS_16130 78510 79577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 79577 80260 gene locus_tag LOCUS_16140 79577 80260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 82059 80290 gene locus_tag LOCUS_16150 82059 80290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 83083 82160 gene locus_tag LOCUS_16160 83083 82160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_16160 83334 85946 gene locus_tag LOCUS_16170 gene chb 83334 85946 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_16170 86417 86944 gene locus_tag LOCUS_16180 86417 86944 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761425.1 protein_id gnl|my_center|LOCUS_16180 87375 88796 gene locus_tag LOCUS_16190 87375 88796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 88798 90240 gene locus_tag LOCUS_16200 88798 90240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 90617 93760 gene locus_tag LOCUS_16210 90617 93760 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_16210 93778 95259 gene locus_tag LOCUS_16220 93778 95259 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_16220 95353 96864 gene locus_tag LOCUS_16230 95353 96864 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_16230 96935 97918 gene locus_tag LOCUS_16240 96935 97918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123831.1 protein_id gnl|my_center|LOCUS_16240 97961 99148 gene locus_tag LOCUS_16250 97961 99148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 100360 99485 gene locus_tag LOCUS_16260 100360 99485 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_16260 100847 100467 gene locus_tag LOCUS_16270 100847 100467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 101007 102323 gene locus_tag LOCUS_16280 gene amaA 101007 102323 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_16280 102802 104292 gene locus_tag LOCUS_16290 102802 104292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_16290 104348 105883 gene locus_tag LOCUS_16300 104348 105883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_16300 105940 107430 gene locus_tag LOCUS_16310 105940 107430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_16310 108888 107566 gene locus_tag LOCUS_16320 108888 107566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 109874 108996 gene locus_tag LOCUS_16330 109874 108996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 110947 109907 gene locus_tag LOCUS_16340 110947 109907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 112412 111069 gene locus_tag LOCUS_16350 112412 111069 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_16350 114543 112522 gene locus_tag LOCUS_16360 114543 112522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 117769 114593 gene locus_tag LOCUS_16370 117769 114593 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_16370 119410 118646 gene locus_tag LOCUS_16380 119410 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 120095 119430 gene locus_tag LOCUS_16390 120095 119430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 120622 120092 gene locus_tag LOCUS_16400 120622 120092 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_16400 121288 124293 gene locus_tag LOCUS_16410 121288 124293 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_16410 124321 125796 gene locus_tag LOCUS_16420 124321 125796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_16420 126109 127029 gene locus_tag LOCUS_16430 126109 127029 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_16430 127016 127822 gene locus_tag LOCUS_16440 127016 127822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 127935 129275 gene locus_tag LOCUS_16450 127935 129275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 129315 130256 gene locus_tag LOCUS_16460 129315 130256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 130293 131174 gene locus_tag LOCUS_16470 130293 131174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 131200 132594 gene locus_tag LOCUS_16480 gene GALNS 131200 132594 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_16480 132610 133734 gene locus_tag LOCUS_16490 132610 133734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 133734 135251 gene locus_tag LOCUS_16500 133734 135251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_16500 136321 136521 gene locus_tag LOCUS_16510 136321 136521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 136511 136840 gene locus_tag LOCUS_16520 136511 136840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 137170 138105 gene locus_tag LOCUS_16530 137170 138105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 138092 140488 gene locus_tag LOCUS_16540 138092 140488 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_16540 140494 140937 gene locus_tag LOCUS_16550 140494 140937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 142105 145176 gene locus_tag LOCUS_16560 142105 145176 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_16560 145201 146610 gene locus_tag LOCUS_16570 145201 146610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_16570 146694 149015 gene locus_tag LOCUS_16580 146694 149015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 149825 149355 gene locus_tag LOCUS_16590 149825 149355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 152429 150114 gene locus_tag LOCUS_16600 152429 150114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 155051 152553 gene locus_tag LOCUS_16610 155051 152553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 155788 155057 gene locus_tag LOCUS_16620 155788 155057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 156730 155813 gene locus_tag LOCUS_16630 156730 155813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 158033 156720 gene locus_tag LOCUS_16640 158033 156720 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_16640 159003 158038 gene locus_tag LOCUS_16650 159003 158038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 159683 159495 gene locus_tag LOCUS_16660 159683 159495 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_16660 159925 160869 gene locus_tag LOCUS_16670 159925 160869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 162292 161276 gene locus_tag LOCUS_16680 162292 161276 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_16680 162509 162856 gene locus_tag LOCUS_16690 gene fdx1 162509 162856 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_16690 163034 163387 gene locus_tag LOCUS_16700 163034 163387 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_16700 163521 164612 gene locus_tag LOCUS_16710 163521 164612 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_16710 164618 165715 gene locus_tag LOCUS_16720 gene ychF 164618 165715 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_16720 165827 166714 gene locus_tag LOCUS_16730 165827 166714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 168358 167084 gene locus_tag LOCUS_16740 168358 167084 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_16740 170375 168456 gene locus_tag LOCUS_16750 170375 168456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_16750 171347 170454 gene locus_tag LOCUS_16760 171347 170454 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 protein_id gnl|my_center|LOCUS_16760 171519 171437 gene locus_tag LOCUS_t00140 171519 171437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 172213 171668 gene locus_tag LOCUS_16770 172213 171668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 172690 172220 gene locus_tag LOCUS_16780 172690 172220 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_16780 173568 173086 gene locus_tag LOCUS_16790 173568 173086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 174104 173619 gene locus_tag LOCUS_16800 174104 173619 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBF1 protein_id gnl|my_center|LOCUS_16800 174538 174377 gene locus_tag LOCUS_16810 174538 174377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 175206 174511 gene locus_tag LOCUS_16820 175206 174511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 175326 176516 gene locus_tag LOCUS_16830 gene dinB 175326 176516 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_16830 177007 176831 gene locus_tag LOCUS_16840 177007 176831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 177715 177251 gene locus_tag LOCUS_16850 177715 177251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 179238 178012 gene locus_tag LOCUS_16860 179238 178012 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_16860 180909 179857 gene locus_tag LOCUS_16870 180909 179857 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_16870 182749 180884 gene locus_tag LOCUS_16880 182749 180884 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_16880 184527 182746 gene locus_tag LOCUS_16890 184527 182746 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence08 465 1577 gene locus_tag LOCUS_16900 465 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2255 1626 gene locus_tag LOCUS_16910 2255 1626 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_16910 2717 2304 gene locus_tag LOCUS_16920 gene furR1 2717 2304 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_16920 2887 3378 gene locus_tag LOCUS_16930 gene amsI 2887 3378 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 protein_id gnl|my_center|LOCUS_16930 4691 3423 gene locus_tag LOCUS_16940 gene lysC 4691 3423 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_16940 4746 5762 gene locus_tag LOCUS_16950 gene fbp 4746 5762 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_16950 6117 5797 gene locus_tag LOCUS_16960 6117 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6560 6123 gene locus_tag LOCUS_16970 6560 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_16970 7104 6619 gene locus_tag LOCUS_16980 gene engB 7104 6619 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_16980 7341 8063 gene locus_tag LOCUS_16990 gene menG 7341 8063 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_16990 8102 8791 gene locus_tag LOCUS_17000 gene porT 8102 8791 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_17000 8852 9610 gene locus_tag LOCUS_17010 8852 9610 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_17010 9634 10383 gene locus_tag LOCUS_17020 9634 10383 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MM7 protein_id gnl|my_center|LOCUS_17020 10423 11193 gene locus_tag LOCUS_17030 10423 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12485 11970 gene locus_tag LOCUS_17040 12485 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 14523 12661 gene locus_tag LOCUS_17050 14523 12661 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_17050 15106 14645 gene locus_tag LOCUS_17060 15106 14645 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_17060 15694 15191 gene locus_tag LOCUS_17070 15694 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 17887 17381 gene locus_tag LOCUS_17080 17887 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 19705 17897 gene locus_tag LOCUS_17090 19705 17897 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_17090 20950 19778 gene locus_tag LOCUS_17100 20950 19778 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_17100 23443 21038 gene locus_tag LOCUS_17110 23443 21038 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_17110 23860 23486 gene locus_tag LOCUS_17120 23860 23486 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_17120 26526 24772 gene locus_tag LOCUS_17130 26526 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 27410 26523 gene locus_tag LOCUS_17140 27410 26523 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_17140 29277 27412 gene locus_tag LOCUS_17150 gene mnmG 29277 27412 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_17150 29780 29331 gene locus_tag LOCUS_17160 gene ybeY 29780 29331 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650C1 protein_id gnl|my_center|LOCUS_17160 30186 29782 gene locus_tag LOCUS_17170 gene spoIIAB 30186 29782 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_17170 30983 30225 gene locus_tag LOCUS_17180 30983 30225 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_17180 31348 30980 gene locus_tag LOCUS_17190 31348 30980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_17190 31487 32179 gene locus_tag LOCUS_17200 31487 32179 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_17200 32952 32182 gene locus_tag LOCUS_17210 32952 32182 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_17210 34159 32972 gene locus_tag LOCUS_17220 34159 32972 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_17220 34685 34146 gene locus_tag LOCUS_17230 34685 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 38077 34697 gene locus_tag LOCUS_17240 gene secA 38077 34697 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_17240 38914 38108 gene locus_tag LOCUS_17250 gene dapF 38914 38108 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_17250 39502 40260 gene locus_tag LOCUS_17260 39502 40260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 40416 41405 gene locus_tag LOCUS_17270 40416 41405 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_17270 41561 42733 gene locus_tag LOCUS_17280 41561 42733 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_17280 46175 42789 gene locus_tag LOCUS_17290 46175 42789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 47165 46350 gene locus_tag LOCUS_17300 47165 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 47381 48385 gene locus_tag LOCUS_17310 47381 48385 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_17310 48382 49089 gene locus_tag LOCUS_17320 48382 49089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_17320 49139 50002 gene locus_tag LOCUS_17330 49139 50002 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_17330 50939 50142 gene locus_tag LOCUS_17340 50939 50142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 51479 53860 gene locus_tag LOCUS_17350 51479 53860 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_17350 53860 55032 gene locus_tag LOCUS_17360 53860 55032 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_17360 55389 57761 gene locus_tag LOCUS_17370 55389 57761 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_17370 57776 59008 gene locus_tag LOCUS_17380 57776 59008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 59346 59600 gene locus_tag LOCUS_17390 59346 59600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 59661 60299 gene locus_tag LOCUS_17400 59661 60299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 60396 60824 gene locus_tag LOCUS_17410 60396 60824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 61131 62738 gene locus_tag LOCUS_17420 61131 62738 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_17420 63164 64942 gene locus_tag LOCUS_17430 63164 64942 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_17430 65382 66521 gene locus_tag LOCUS_17440 gene purK 65382 66521 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_17440 66518 67039 gene locus_tag LOCUS_17450 gene purE 66518 67039 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_17450 67519 67166 gene locus_tag LOCUS_17460 67519 67166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_17460 67899 69044 gene locus_tag LOCUS_17470 67899 69044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_17470 69249 71048 gene locus_tag LOCUS_17480 69249 71048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 71478 71077 gene locus_tag LOCUS_17490 71478 71077 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_17490 71978 71478 gene locus_tag LOCUS_17500 71978 71478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723340.1 protein_id gnl|my_center|LOCUS_17500 72221 74110 gene locus_tag LOCUS_17510 gene mscS1 72221 74110 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_17510 74493 76292 gene locus_tag LOCUS_17520 74493 76292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 77060 76563 gene locus_tag LOCUS_17530 gene msrA 77060 76563 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6A2 protein_id gnl|my_center|LOCUS_17530 78404 77184 gene locus_tag LOCUS_17540 78404 77184 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_17540 80591 79119 gene locus_tag LOCUS_17550 gene gltD 80591 79119 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_17550 85086 80593 gene locus_tag LOCUS_17560 gene gltB 85086 80593 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_17560 86805 85456 gene locus_tag LOCUS_17570 86805 85456 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_17570 87329 86862 gene locus_tag LOCUS_17580 gene ssb 87329 86862 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAQ8 protein_id gnl|my_center|LOCUS_17580 88458 87376 gene locus_tag LOCUS_17590 gene mutY 88458 87376 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_17590 88618 88926 gene locus_tag LOCUS_17600 88618 88926 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_17600 88947 89768 gene locus_tag LOCUS_17610 88947 89768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 89946 91517 gene locus_tag LOCUS_17620 gene cafA 89946 91517 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_17620 91838 92224 gene locus_tag LOCUS_17630 91838 92224 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_17630 92529 93317 gene locus_tag LOCUS_17640 92529 93317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_17640 94319 93405 gene locus_tag LOCUS_17650 94319 93405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 95219 94557 gene locus_tag LOCUS_17660 95219 94557 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 protein_id gnl|my_center|LOCUS_17660 96810 95401 gene locus_tag LOCUS_17670 96810 95401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 97850 97305 gene locus_tag LOCUS_17680 gene mip 97850 97305 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_17680 98622 98092 gene locus_tag LOCUS_17690 98622 98092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 99029 98954 gene locus_tag LOCUS_t00150 99029 98954 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 99724 99143 gene locus_tag LOCUS_17700 99724 99143 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_17700 100795 99734 gene locus_tag LOCUS_17710 gene sgaA 100795 99734 CDS product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968118.1 protein_id gnl|my_center|LOCUS_17710 101229 100795 gene locus_tag LOCUS_17720 gene aroQ 101229 100795 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_17720 101358 102257 gene locus_tag LOCUS_17730 gene xerD 101358 102257 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_17730 102494 102925 gene locus_tag LOCUS_17740 102494 102925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 103013 103477 gene locus_tag LOCUS_17750 gene maoC 103013 103477 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_17750 106104 103675 gene locus_tag LOCUS_17760 106104 103675 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_17760 106920 106315 gene locus_tag LOCUS_17770 gene sodA 106920 106315 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_17770 107509 107039 gene locus_tag LOCUS_17780 gene tadA 107509 107039 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_17780 108623 107493 gene locus_tag LOCUS_17790 108623 107493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_17790 108938 110140 gene locus_tag LOCUS_17800 gene nptA 108938 110140 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_17800 110771 110106 gene locus_tag LOCUS_17810 gene deoC 110771 110106 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFM7 protein_id gnl|my_center|LOCUS_17810 110786 111391 gene locus_tag LOCUS_17820 110786 111391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_17820 112943 111597 gene locus_tag LOCUS_17830 112943 111597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817129.1 protein_id gnl|my_center|LOCUS_17830 113665 112940 gene locus_tag LOCUS_17840 113665 112940 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_17840 113826 114392 gene locus_tag LOCUS_17850 113826 114392 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_17850 115449 114415 gene locus_tag LOCUS_17860 gene hemH 115449 114415 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_17860 116235 115651 gene locus_tag LOCUS_17870 116235 115651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_17870 118500 116527 gene locus_tag LOCUS_17880 gene dsbD 118500 116527 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_17880 119985 118591 gene locus_tag LOCUS_17890 119985 118591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_17890 121090 120155 gene locus_tag LOCUS_17900 121090 120155 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_17900 121363 122388 gene locus_tag LOCUS_17910 121363 122388 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262595.1 protein_id gnl|my_center|LOCUS_17910 122668 123231 gene locus_tag LOCUS_17920 122668 123231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 123951 125195 gene locus_tag LOCUS_17930 123951 125195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 125549 125253 gene locus_tag LOCUS_17940 125549 125253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 125724 126218 gene locus_tag LOCUS_17950 125724 126218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 126710 126246 gene locus_tag LOCUS_17960 126710 126246 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989488.1 protein_id gnl|my_center|LOCUS_17960 127334 126723 gene locus_tag LOCUS_17970 127334 126723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_17970 128003 127632 gene locus_tag LOCUS_17980 128003 127632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 129423 128101 gene locus_tag LOCUS_17990 129423 128101 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_17990 129477 129674 gene locus_tag LOCUS_18000 129477 129674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 129650 130303 gene locus_tag LOCUS_18010 129650 130303 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_18010 130334 130903 gene locus_tag LOCUS_18020 130334 130903 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_18020 130990 131304 gene locus_tag LOCUS_18030 130990 131304 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_18030 131285 131545 gene locus_tag LOCUS_18040 131285 131545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_18040 132804 131758 gene locus_tag LOCUS_18050 132804 131758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 132828 133724 gene locus_tag LOCUS_18060 132828 133724 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_18060 135449 133740 gene locus_tag LOCUS_18070 135449 133740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 136136 135456 gene locus_tag LOCUS_18080 136136 135456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 138701 136230 gene locus_tag LOCUS_18090 138701 136230 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202184.1 protein_id gnl|my_center|LOCUS_18090 138918 139280 gene locus_tag LOCUS_18100 138918 139280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 139430 140209 gene locus_tag LOCUS_18110 139430 140209 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_18110 140230 140697 gene locus_tag LOCUS_18120 140230 140697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 141367 140804 gene locus_tag LOCUS_18130 141367 140804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 142217 141843 gene locus_tag LOCUS_18140 142217 141843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 143362 142583 gene locus_tag LOCUS_18150 143362 142583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 144201 143362 gene locus_tag LOCUS_18160 144201 143362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 145348 144308 gene locus_tag LOCUS_18170 gene pheS 145348 144308 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_18170 145640 145939 gene locus_tag LOCUS_18180 145640 145939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 145947 146192 gene locus_tag LOCUS_18190 145947 146192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 146122 146517 gene locus_tag LOCUS_18200 146122 146517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 151216 146882 gene locus_tag LOCUS_18210 151216 146882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 152741 151707 gene locus_tag LOCUS_18220 152741 151707 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_18220 152794 153717 gene locus_tag LOCUS_18230 gene dcyD 152794 153717 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_18230 155071 153719 gene locus_tag LOCUS_18240 gene kmo 155071 153719 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_18240 156377 155097 gene locus_tag LOCUS_18250 gene kynU 156377 155097 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_18250 156949 156437 gene locus_tag LOCUS_18260 gene nbaC 156949 156437 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_18260 157242 157850 gene locus_tag LOCUS_18270 157242 157850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 158771 157926 gene locus_tag LOCUS_18280 gene prmC 158771 157926 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D7 protein_id gnl|my_center|LOCUS_18280 159465 159145 gene locus_tag LOCUS_18290 159465 159145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 159538 160728 gene locus_tag LOCUS_18300 gene rsmB 159538 160728 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_18300 160728 161384 gene locus_tag LOCUS_18310 160728 161384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117860.1 protein_id gnl|my_center|LOCUS_18310 161518 162996 gene locus_tag LOCUS_18320 gene guaB 161518 162996 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_18320 163672 163112 gene locus_tag LOCUS_18330 163672 163112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 164233 163688 gene locus_tag LOCUS_18340 164233 163688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 165210 164281 gene locus_tag LOCUS_18350 165210 164281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 166243 165194 gene locus_tag LOCUS_18360 gene fjo19 166243 165194 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_18360 166425 166841 gene locus_tag LOCUS_18370 gene ndk 166425 166841 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_18370 166987 168357 gene locus_tag LOCUS_18380 166987 168357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_18380 169432 168377 gene locus_tag LOCUS_18390 169432 168377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_18390 170184 169429 gene locus_tag LOCUS_18400 gene scpA 170184 169429 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_18400 170369 172294 gene locus_tag LOCUS_18410 gene dxs 170369 172294 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_18410 172530 173543 gene locus_tag LOCUS_18420 172530 173543 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_18420 173536 174306 gene locus_tag LOCUS_18430 173536 174306 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_18430 175066 174308 gene locus_tag LOCUS_18440 175066 174308 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_18440 175623 175970 gene locus_tag LOCUS_18450 175623 175970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 176231 176815 gene locus_tag LOCUS_18460 176231 176815 CDS product putative RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45215 protein_id gnl|my_center|LOCUS_18460 176825 177091 gene locus_tag LOCUS_18470 176825 177091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 177226 177969 gene locus_tag LOCUS_18480 177226 177969 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_18480 178031 178741 gene locus_tag LOCUS_18490 178031 178741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 178768 179307 gene locus_tag LOCUS_18500 178768 179307 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ95 protein_id gnl|my_center|LOCUS_18500 179458 180507 gene locus_tag LOCUS_18510 179458 180507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 180767 181141 gene locus_tag LOCUS_18520 180767 181141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18520 181132 181536 gene locus_tag LOCUS_18530 181132 181536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18530 >Feature sequence09 312 686 gene locus_tag LOCUS_18540 312 686 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_18540 1859 819 gene locus_tag LOCUS_18550 1859 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3331 1856 gene locus_tag LOCUS_18560 3331 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140023.1 protein_id gnl|my_center|LOCUS_18560 4608 3253 gene locus_tag LOCUS_18570 4608 3253 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_18570 6328 4613 gene locus_tag LOCUS_18580 6328 4613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_18580 6987 6325 gene locus_tag LOCUS_18590 6987 6325 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_18590 7511 7116 gene locus_tag LOCUS_18600 7511 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963066.1 protein_id gnl|my_center|LOCUS_18600 7726 7523 gene locus_tag LOCUS_18610 7726 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7986 9878 gene locus_tag LOCUS_18620 7986 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 10351 11274 gene locus_tag LOCUS_18630 10351 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 11356 12315 gene locus_tag LOCUS_18640 11356 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12341 12844 gene locus_tag LOCUS_18650 12341 12844 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_18650 12937 14202 gene locus_tag LOCUS_18660 12937 14202 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_18660 14280 15545 gene locus_tag LOCUS_18670 gene bfmBB 14280 15545 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_18670 18438 15538 gene locus_tag LOCUS_18680 18438 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 18730 18518 gene locus_tag LOCUS_18690 18730 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 19286 19047 gene locus_tag LOCUS_18700 19286 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 19699 19283 gene locus_tag LOCUS_18710 19699 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212298.1 protein_id gnl|my_center|LOCUS_18710 20195 21496 gene locus_tag LOCUS_18720 20195 21496 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_18720 23444 21558 gene locus_tag LOCUS_18730 23444 21558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 25050 23797 gene locus_tag LOCUS_18740 25050 23797 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640098.1 protein_id gnl|my_center|LOCUS_18740 25878 25450 gene locus_tag LOCUS_18750 25878 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26828 25884 gene locus_tag LOCUS_18760 26828 25884 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_18760 27905 26859 gene locus_tag LOCUS_18770 27905 26859 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_18770 28842 28039 gene locus_tag LOCUS_18780 28842 28039 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119732.1 protein_id gnl|my_center|LOCUS_18780 29342 33340 gene locus_tag LOCUS_18790 29342 33340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 33468 34394 gene locus_tag LOCUS_18800 gene prsA 33468 34394 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_18800 34424 35014 gene locus_tag LOCUS_18810 gene rplY 34424 35014 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_18810 35295 35855 gene locus_tag LOCUS_18820 gene pth 35295 35855 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_18820 35860 36153 gene locus_tag LOCUS_18830 35860 36153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 protein_id gnl|my_center|LOCUS_18830 36707 36285 gene locus_tag LOCUS_18840 36707 36285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 37158 37565 gene locus_tag LOCUS_18850 37158 37565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 40772 37755 gene locus_tag LOCUS_18860 40772 37755 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_18860 40888 42324 gene locus_tag LOCUS_18870 40888 42324 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_18870 44065 42716 gene locus_tag LOCUS_18880 gene aslA 44065 42716 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_18880 44428 44820 gene locus_tag LOCUS_18890 44428 44820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 45115 47589 gene locus_tag LOCUS_18900 45115 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 47944 48816 gene locus_tag LOCUS_18910 gene xynB 47944 48816 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_18910 49324 50670 gene locus_tag LOCUS_18920 49324 50670 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_18920 54289 51209 gene locus_tag LOCUS_18930 54289 51209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 54519 54692 gene locus_tag LOCUS_18940 54519 54692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 57943 55400 gene locus_tag LOCUS_18950 57943 55400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 58878 58492 gene locus_tag LOCUS_18960 58878 58492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 59569 60465 gene locus_tag LOCUS_18970 59569 60465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 61462 60968 gene locus_tag LOCUS_18980 61462 60968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 66136 61463 gene locus_tag LOCUS_18990 66136 61463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 66591 66133 gene locus_tag LOCUS_19000 66591 66133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 70037 66603 gene locus_tag LOCUS_19010 70037 66603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 72335 70299 gene locus_tag LOCUS_19020 72335 70299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 74090 72639 gene locus_tag LOCUS_19030 gene aslA 74090 72639 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_19030 74572 74192 gene locus_tag LOCUS_19040 74572 74192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_19040 76624 74927 gene locus_tag LOCUS_19050 76624 74927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 78418 77057 gene locus_tag LOCUS_19060 78418 77057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 80369 78570 gene locus_tag LOCUS_19070 80369 78570 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_19070 81550 80480 gene locus_tag LOCUS_19080 81550 80480 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_19080 82214 81663 gene locus_tag LOCUS_19090 82214 81663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_19090 84219 82459 gene locus_tag LOCUS_19100 84219 82459 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_19100 86228 84600 gene locus_tag LOCUS_19110 86228 84600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_19110 89608 86228 gene locus_tag LOCUS_19120 89608 86228 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_19120 90945 89911 gene locus_tag LOCUS_19130 90945 89911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 91786 91091 gene locus_tag LOCUS_19140 91786 91091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 92512 93549 gene locus_tag LOCUS_19150 92512 93549 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_19150 94427 93681 gene locus_tag LOCUS_19160 gene nagB 94427 93681 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_19160 95926 94580 gene locus_tag LOCUS_19170 95926 94580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 97328 95985 gene locus_tag LOCUS_19180 97328 95985 CDS product 4,5-dihydroxyphthalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_19180 99440 97368 gene locus_tag LOCUS_19190 99440 97368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 100900 99470 gene locus_tag LOCUS_19200 100900 99470 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C863 protein_id gnl|my_center|LOCUS_19200 102630 100993 gene locus_tag LOCUS_19210 102630 100993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_19210 105707 102717 gene locus_tag LOCUS_19220 105707 102717 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_19220 106585 107466 gene locus_tag LOCUS_19230 106585 107466 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_19230 107598 108434 gene locus_tag LOCUS_19240 107598 108434 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_19240 108458 108901 gene locus_tag LOCUS_19250 108458 108901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 108903 109091 gene locus_tag LOCUS_19260 108903 109091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 109359 109931 gene locus_tag LOCUS_19270 109359 109931 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_19270 110067 110927 gene locus_tag LOCUS_19280 110067 110927 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229550.1 protein_id gnl|my_center|LOCUS_19280 111503 112489 gene locus_tag LOCUS_19290 111503 112489 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_19290 112501 113364 gene locus_tag LOCUS_19300 112501 113364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 113367 114164 gene locus_tag LOCUS_19310 113367 114164 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_19310 114161 115114 gene locus_tag LOCUS_19320 114161 115114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 115952 116158 gene locus_tag LOCUS_19330 115952 116158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19330 116388 117341 gene locus_tag LOCUS_19340 116388 117341 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_19340 117758 118447 gene locus_tag LOCUS_19350 117758 118447 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_19350 118533 119477 gene locus_tag LOCUS_19360 gene ephA 118533 119477 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_19360 119846 122227 gene locus_tag LOCUS_19370 119846 122227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_19370 122428 122889 gene locus_tag LOCUS_19380 122428 122889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 123090 123242 gene locus_tag LOCUS_19390 123090 123242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 123485 123853 gene locus_tag LOCUS_19400 123485 123853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 123850 125349 gene locus_tag LOCUS_19410 123850 125349 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_19410 126774 125542 gene locus_tag LOCUS_19420 126774 125542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 128142 126901 gene locus_tag LOCUS_19430 128142 126901 CDS product Mn transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_19430 129498 128209 gene locus_tag LOCUS_19440 129498 128209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 130221 130619 gene locus_tag LOCUS_19450 130221 130619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 131008 131451 gene locus_tag LOCUS_19460 gene rplM 131008 131451 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_19460 131464 131850 gene locus_tag LOCUS_19470 gene rpsI 131464 131850 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_19470 131895 132656 gene locus_tag LOCUS_19480 gene rpsB 131895 132656 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_19480 132765 133595 gene locus_tag LOCUS_19490 gene tsf 132765 133595 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_19490 133871 134509 gene locus_tag LOCUS_19500 133871 134509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 135442 134693 gene locus_tag LOCUS_19510 135442 134693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_19510 136475 135522 gene locus_tag LOCUS_19520 136475 135522 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_19520 136803 137273 gene locus_tag LOCUS_19530 136803 137273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19530 137288 137899 gene locus_tag LOCUS_19540 137288 137899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 138190 139842 gene locus_tag LOCUS_19550 138190 139842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 140206 139901 gene locus_tag LOCUS_19560 140206 139901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_19560 141122 140238 gene locus_tag LOCUS_19570 gene xerC 141122 140238 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_19570 141374 141180 gene locus_tag LOCUS_19580 gene rpsU 141374 141180 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_19580 141778 142797 gene locus_tag LOCUS_19590 141778 142797 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_19590 142806 145088 gene locus_tag LOCUS_19600 142806 145088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 146433 145129 gene locus_tag LOCUS_19610 146433 145129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 147799 146453 gene locus_tag LOCUS_19620 147799 146453 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_19620 148921 147992 gene locus_tag LOCUS_19630 148921 147992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_19630 151651 149126 gene locus_tag LOCUS_19640 gene clpC 151651 149126 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_19640 152371 151742 gene locus_tag LOCUS_19650 152371 151742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_19650 153064 152435 gene locus_tag LOCUS_19660 153064 152435 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_19660 153284 154333 gene locus_tag LOCUS_19670 153284 154333 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_19670 154334 154750 gene locus_tag LOCUS_19680 154334 154750 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_19680 154747 155703 gene locus_tag LOCUS_19690 gene yfkH 154747 155703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_19690 155867 155952 gene locus_tag LOCUS_t00160 155867 155952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 156636 156433 gene locus_tag LOCUS_19700 156636 156433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 156986 156819 gene locus_tag LOCUS_19710 156986 156819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 157423 157680 gene locus_tag LOCUS_19720 157423 157680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 159230 161044 gene locus_tag LOCUS_19730 159230 161044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 161130 161792 gene locus_tag LOCUS_19740 161130 161792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_19740 162015 162329 gene locus_tag LOCUS_19750 162015 162329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 162295 163212 gene locus_tag LOCUS_19760 162295 163212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 163721 165619 gene locus_tag LOCUS_19770 163721 165619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 166089 165919 gene locus_tag LOCUS_19780 166089 165919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 167355 166654 gene locus_tag LOCUS_19790 167355 166654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 167790 167464 gene locus_tag LOCUS_19800 167790 167464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 168043 167774 gene locus_tag LOCUS_19810 168043 167774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 168264 168040 gene locus_tag LOCUS_19820 168264 168040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 169177 168812 gene locus_tag LOCUS_19830 169177 168812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 169785 169366 gene locus_tag LOCUS_19840 169785 169366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_19840 170298 170852 gene locus_tag LOCUS_19850 170298 170852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 171666 171085 gene locus_tag LOCUS_19860 171666 171085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 173153 172380 gene locus_tag LOCUS_19870 173153 172380 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_19870 174416 173154 gene locus_tag LOCUS_19880 174416 173154 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_19880 176227 175064 gene locus_tag LOCUS_19890 176227 175064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 176686 177855 gene locus_tag LOCUS_19900 176686 177855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence10 1650 244 gene locus_tag LOCUS_19910 1650 244 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_19910 2076 1906 gene locus_tag LOCUS_19920 2076 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2009 4936 gene locus_tag LOCUS_19930 2009 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6588 5152 gene locus_tag LOCUS_19940 6588 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_19940 8113 6704 gene locus_tag LOCUS_19950 8113 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_19950 11529 8134 gene locus_tag LOCUS_19960 11529 8134 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_19960 12775 11669 gene locus_tag LOCUS_19970 12775 11669 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203131.1 protein_id gnl|my_center|LOCUS_19970 13667 13065 gene locus_tag LOCUS_19980 13667 13065 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_19980 15148 13757 gene locus_tag LOCUS_19990 15148 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_19990 16589 15150 gene locus_tag LOCUS_20000 16589 15150 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_20000 17971 16601 gene locus_tag LOCUS_20010 17971 16601 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_20010 19702 18710 gene locus_tag LOCUS_20020 19702 18710 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_20020 20588 19893 gene locus_tag LOCUS_20030 20588 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 21528 20572 gene locus_tag LOCUS_20040 21528 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 22355 21549 gene locus_tag LOCUS_20050 22355 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_20050 23399 24625 gene locus_tag LOCUS_20060 gene crnA 23399 24625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_20060 24770 28291 gene locus_tag LOCUS_20070 24770 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 28512 29942 gene locus_tag LOCUS_20080 28512 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 31052 30288 gene locus_tag LOCUS_20090 31052 30288 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_20090 31208 33703 gene locus_tag LOCUS_20100 31208 33703 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369394.1 protein_id gnl|my_center|LOCUS_20100 33753 34136 gene locus_tag LOCUS_20110 gene nirD-2 33753 34136 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_20110 34352 36169 gene locus_tag LOCUS_20120 34352 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 36187 36864 gene locus_tag LOCUS_20130 36187 36864 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_20130 38319 36997 gene locus_tag LOCUS_20140 38319 36997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_20140 39306 38332 gene locus_tag LOCUS_20150 39306 38332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 40062 39382 gene locus_tag LOCUS_20160 40062 39382 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_20160 41587 40121 gene locus_tag LOCUS_20170 41587 40121 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_20170 43134 41590 gene locus_tag LOCUS_20180 43134 41590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 44477 43140 gene locus_tag LOCUS_20190 44477 43140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 45720 44647 gene locus_tag LOCUS_20200 45720 44647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 47498 45948 gene locus_tag LOCUS_20210 47498 45948 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_20210 48344 47901 gene locus_tag LOCUS_20220 48344 47901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 48785 49858 gene locus_tag LOCUS_20230 48785 49858 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_20230 50084 49905 gene locus_tag LOCUS_20240 50084 49905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 50760 50035 gene locus_tag LOCUS_20250 50760 50035 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_20250 51830 50757 gene locus_tag LOCUS_20260 51830 50757 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_20260 52124 54634 gene locus_tag LOCUS_20270 52124 54634 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_20270 56161 54752 gene locus_tag LOCUS_20280 56161 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 57143 56172 gene locus_tag LOCUS_20290 57143 56172 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_20290 57921 57298 gene locus_tag LOCUS_20300 57921 57298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 58930 58091 gene locus_tag LOCUS_20310 58930 58091 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_20310 59733 59173 gene locus_tag LOCUS_20320 59733 59173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 60401 60033 gene locus_tag LOCUS_20330 60401 60033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 61982 60516 gene locus_tag LOCUS_20340 61982 60516 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_20340 63210 62218 gene locus_tag LOCUS_20350 gene pfkA 63210 62218 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_20350 63598 63236 gene locus_tag LOCUS_20360 gene mgsA 63598 63236 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ00 protein_id gnl|my_center|LOCUS_20360 63983 63684 gene locus_tag LOCUS_20370 63983 63684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_20370 65177 64209 gene locus_tag LOCUS_20380 65177 64209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_20380 66340 65174 gene locus_tag LOCUS_20390 66340 65174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 67537 66344 gene locus_tag LOCUS_20400 67537 66344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 68559 67579 gene locus_tag LOCUS_20410 68559 67579 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_20410 69912 68677 gene locus_tag LOCUS_20420 69912 68677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 71042 69924 gene locus_tag LOCUS_20430 71042 69924 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_20430 72162 71029 gene locus_tag LOCUS_20440 72162 71029 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203514.1 protein_id gnl|my_center|LOCUS_20440 73274 72159 gene locus_tag LOCUS_20450 73274 72159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 74080 73274 gene locus_tag LOCUS_20460 74080 73274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 74997 74077 gene locus_tag LOCUS_20470 74997 74077 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 protein_id gnl|my_center|LOCUS_20470 75899 75015 gene locus_tag LOCUS_20480 75899 75015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 76516 75896 gene locus_tag LOCUS_20490 gene perB 76516 75896 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_20490 77198 76524 gene locus_tag LOCUS_20500 77198 76524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 79065 77272 gene locus_tag LOCUS_20510 gene msbA 79065 77272 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_20510 80326 79088 gene locus_tag LOCUS_20520 80326 79088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 81250 80330 gene locus_tag LOCUS_20530 81250 80330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 82217 81255 gene locus_tag LOCUS_20540 82217 81255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_20540 82976 82245 gene locus_tag LOCUS_20550 82976 82245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 83925 82978 gene locus_tag LOCUS_20560 gene ykcC 83925 82978 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_20560 84427 83900 gene locus_tag LOCUS_20570 84427 83900 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_20570 84770 85915 gene locus_tag LOCUS_20580 84770 85915 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_20580 86164 86628 gene locus_tag LOCUS_20590 86164 86628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 86782 89250 gene locus_tag LOCUS_20600 86782 89250 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_20600 90744 92306 gene locus_tag LOCUS_20610 90744 92306 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_20610 94532 92388 gene locus_tag LOCUS_20620 94532 92388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 96030 94534 gene locus_tag LOCUS_20630 96030 94534 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_20630 97540 96044 gene locus_tag LOCUS_20640 97540 96044 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_20640 97807 100092 gene locus_tag LOCUS_20650 97807 100092 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_20650 100076 100945 gene locus_tag LOCUS_20660 gene fdhD 100076 100945 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_20660 101587 101396 gene locus_tag LOCUS_20670 101587 101396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 101840 101640 gene locus_tag LOCUS_20680 101840 101640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 101939 104356 gene locus_tag LOCUS_20690 gene ladS 101939 104356 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_20690 104729 107149 gene locus_tag LOCUS_20700 gene ladS 104729 107149 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_20700 108068 107253 gene locus_tag LOCUS_20710 108068 107253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071596.1 protein_id gnl|my_center|LOCUS_20710 109084 108176 gene locus_tag LOCUS_20720 109084 108176 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_20720 110177 109566 gene locus_tag LOCUS_20730 110177 109566 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765266.1 protein_id gnl|my_center|LOCUS_20730 111069 111485 gene locus_tag LOCUS_20740 111069 111485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 111531 111968 gene locus_tag LOCUS_20750 111531 111968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 111958 113805 gene locus_tag LOCUS_20760 111958 113805 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203640.1 protein_id gnl|my_center|LOCUS_20760 113817 114839 gene locus_tag LOCUS_20770 113817 114839 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_20770 115246 115923 gene locus_tag LOCUS_20780 115246 115923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 116475 117065 gene locus_tag LOCUS_20790 116475 117065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_20790 117078 117512 gene locus_tag LOCUS_20800 117078 117512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 117519 118316 gene locus_tag LOCUS_20810 117519 118316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 119755 118499 gene locus_tag LOCUS_20820 119755 118499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_20820 120358 120008 gene locus_tag LOCUS_20830 120358 120008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 121346 120474 gene locus_tag LOCUS_20840 121346 120474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_20840 124515 121621 gene locus_tag LOCUS_20850 124515 121621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 125551 124742 gene locus_tag LOCUS_20860 125551 124742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 127341 126010 gene locus_tag LOCUS_20870 127341 126010 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887900.1 protein_id gnl|my_center|LOCUS_20870 127576 131022 gene locus_tag LOCUS_20880 127576 131022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 131494 131093 gene locus_tag LOCUS_20890 131494 131093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 132927 131494 gene locus_tag LOCUS_20900 132927 131494 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_20900 135944 132936 gene locus_tag LOCUS_20910 135944 132936 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_20910 138975 137203 gene locus_tag LOCUS_20920 138975 137203 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_20920 140449 139004 gene locus_tag LOCUS_20930 gene arsA 140449 139004 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_20930 141850 140486 gene locus_tag LOCUS_20940 141850 140486 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_20940 143236 141875 gene locus_tag LOCUS_20950 143236 141875 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_20950 144561 143305 gene locus_tag LOCUS_20960 gene GALNS 144561 143305 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_20960 146283 144721 gene locus_tag LOCUS_20970 146283 144721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_20970 149464 146288 gene locus_tag LOCUS_20980 149464 146288 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_20980 152590 150245 gene locus_tag LOCUS_20990 152590 150245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 154333 152798 gene locus_tag LOCUS_21000 154333 152798 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_21000 157010 154401 gene locus_tag LOCUS_21010 157010 154401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 157541 158023 gene locus_tag LOCUS_21020 157541 158023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 158206 158877 gene locus_tag LOCUS_21030 158206 158877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 160176 160985 gene locus_tag LOCUS_21040 160176 160985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 160995 162011 gene locus_tag LOCUS_21050 160995 162011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 162480 162268 gene locus_tag LOCUS_21060 162480 162268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 162914 163144 gene locus_tag LOCUS_21070 162914 163144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 163255 164307 gene locus_tag LOCUS_21080 163255 164307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 164519 164740 gene locus_tag LOCUS_21090 164519 164740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 164958 164806 gene locus_tag LOCUS_21100 164958 164806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 164912 165979 gene locus_tag LOCUS_21110 164912 165979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 165987 166784 gene locus_tag LOCUS_21120 165987 166784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 166777 167841 gene locus_tag LOCUS_21130 166777 167841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 167834 168616 gene locus_tag LOCUS_21140 167834 168616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797451.1 protein_id gnl|my_center|LOCUS_21140 168601 169380 gene locus_tag LOCUS_21150 168601 169380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 169384 170625 gene locus_tag LOCUS_21160 169384 170625 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_21160 170997 171206 gene locus_tag LOCUS_21170 170997 171206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 171184 172083 gene locus_tag LOCUS_21180 171184 172083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 172283 172504 gene locus_tag LOCUS_21190 172283 172504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 172568 173656 gene locus_tag LOCUS_21200 172568 173656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 174310 175338 gene locus_tag LOCUS_21210 174310 175338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence11 705 100 gene locus_tag LOCUS_21220 705 100 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_21220 1051 4743 gene locus_tag LOCUS_21230 gene purL 1051 4743 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Z2 protein_id gnl|my_center|LOCUS_21230 4927 5097 gene locus_tag LOCUS_21240 4927 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5138 6229 gene locus_tag LOCUS_21250 5138 6229 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_21250 6471 7475 gene locus_tag LOCUS_21260 6471 7475 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_21260 7775 8290 gene locus_tag LOCUS_21270 7775 8290 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_21270 8292 8948 gene locus_tag LOCUS_21280 8292 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 9380 11083 gene locus_tag LOCUS_21290 9380 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 11751 12896 gene locus_tag LOCUS_21300 11751 12896 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_21300 12942 16097 gene locus_tag LOCUS_21310 12942 16097 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_21310 16111 17589 gene locus_tag LOCUS_21320 16111 17589 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_21320 19874 17763 gene locus_tag LOCUS_21330 gene feoB 19874 17763 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_21330 20129 19878 gene locus_tag LOCUS_21340 20129 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 20687 22069 gene locus_tag LOCUS_21350 20687 22069 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_21350 22241 23746 gene locus_tag LOCUS_21360 22241 23746 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ33 protein_id gnl|my_center|LOCUS_21360 23868 26726 gene locus_tag LOCUS_21370 gene ramA 23868 26726 CDS product alfa-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118030.1 protein_id gnl|my_center|LOCUS_21370 27930 26914 gene locus_tag LOCUS_21380 gene dlgD 27930 26914 CDS product 2,3-diketo-L-gulonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NP75 protein_id gnl|my_center|LOCUS_21380 28280 30109 gene locus_tag LOCUS_21390 28280 30109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 30114 32084 gene locus_tag LOCUS_21400 30114 32084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 32206 33213 gene locus_tag LOCUS_21410 32206 33213 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_21410 33313 33783 gene locus_tag LOCUS_21420 33313 33783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 36082 33920 gene locus_tag LOCUS_21430 gene glnA 36082 33920 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_21430 36385 37635 gene locus_tag LOCUS_21440 36385 37635 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_21440 37769 39154 gene locus_tag LOCUS_21450 37769 39154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 39160 39834 gene locus_tag LOCUS_21460 39160 39834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 39862 41250 gene locus_tag LOCUS_21470 39862 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_21470 41275 41985 gene locus_tag LOCUS_21480 41275 41985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 44370 42235 gene locus_tag LOCUS_21490 44370 42235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 44566 46314 gene locus_tag LOCUS_21500 44566 46314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 47380 46319 gene locus_tag LOCUS_21510 47380 46319 CDS product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_21510 48407 47391 gene locus_tag LOCUS_21520 48407 47391 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_21520 49686 48490 gene locus_tag LOCUS_21530 49686 48490 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_21530 50242 49736 gene locus_tag LOCUS_21540 50242 49736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 50532 51065 gene locus_tag LOCUS_21550 50532 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 51654 51193 gene locus_tag LOCUS_21560 51654 51193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 52152 55712 gene locus_tag LOCUS_21570 gene smc 52152 55712 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_21570 56438 55947 gene locus_tag LOCUS_21580 56438 55947 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_21580 57046 56465 gene locus_tag LOCUS_21590 57046 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_21590 58679 57258 gene locus_tag LOCUS_21600 58679 57258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_21600 59427 58966 gene locus_tag LOCUS_21610 59427 58966 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_21610 60067 59429 gene locus_tag LOCUS_21620 60067 59429 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_21620 60398 60069 gene locus_tag LOCUS_21630 60398 60069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 61294 60458 gene locus_tag LOCUS_21640 61294 60458 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_21640 62120 63031 gene locus_tag LOCUS_21650 62120 63031 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705418.1 protein_id gnl|my_center|LOCUS_21650 63271 64443 gene locus_tag LOCUS_21660 63271 64443 CDS product protein up-regulated by thyroid hormone- PQQ-dependent glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122629.1 protein_id gnl|my_center|LOCUS_21660 65065 64697 gene locus_tag LOCUS_21670 65065 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 65948 65861 gene locus_tag LOCUS_t00170 65948 65861 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67186 66110 gene locus_tag LOCUS_21680 gene ansA 67186 66110 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_21680 67958 67176 gene locus_tag LOCUS_21690 67958 67176 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_21690 69055 67955 gene locus_tag LOCUS_21700 69055 67955 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249713.1 protein_id gnl|my_center|LOCUS_21700 69685 69059 gene locus_tag LOCUS_21710 69685 69059 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_21710 70904 69687 gene locus_tag LOCUS_21720 70904 69687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 71157 70906 gene locus_tag LOCUS_21730 71157 70906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 72319 71201 gene locus_tag LOCUS_21740 72319 71201 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_21740 72358 72933 gene locus_tag LOCUS_21750 gene ruvC 72358 72933 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_21750 73005 73421 gene locus_tag LOCUS_21760 73005 73421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 73559 74836 gene locus_tag LOCUS_21770 73559 74836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 74840 75436 gene locus_tag LOCUS_21780 74840 75436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 76816 75773 gene locus_tag LOCUS_21790 76816 75773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_21790 78672 76813 gene locus_tag LOCUS_21800 78672 76813 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_21800 78832 79086 gene locus_tag LOCUS_21810 78832 79086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 79204 80337 gene locus_tag LOCUS_21820 79204 80337 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_21820 80381 81364 gene locus_tag LOCUS_21830 80381 81364 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_21830 81376 82392 gene locus_tag LOCUS_21840 81376 82392 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_21840 82521 83501 gene locus_tag LOCUS_21850 82521 83501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 84281 83496 gene locus_tag LOCUS_21860 84281 83496 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_21860 84450 84884 gene locus_tag LOCUS_21870 84450 84884 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_21870 84979 85983 gene locus_tag LOCUS_21880 84979 85983 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_21880 85999 86319 gene locus_tag LOCUS_21890 85999 86319 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_21890 89019 86380 gene locus_tag LOCUS_21900 89019 86380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 91475 89445 gene locus_tag LOCUS_21910 91475 89445 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_21910 92770 91664 gene locus_tag LOCUS_21920 gene glxK 92770 91664 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068173.1 protein_id gnl|my_center|LOCUS_21920 94044 92767 gene locus_tag LOCUS_21930 94044 92767 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_21930 94458 95549 gene locus_tag LOCUS_21940 gene proB 94458 95549 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 protein_id gnl|my_center|LOCUS_21940 95579 96829 gene locus_tag LOCUS_21950 gene proA 95579 96829 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_21950 97502 98092 gene locus_tag LOCUS_21960 97502 98092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_21960 98538 99206 gene locus_tag LOCUS_21970 98538 99206 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_21970 99203 100594 gene locus_tag LOCUS_21980 99203 100594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 100794 105128 gene locus_tag LOCUS_21990 100794 105128 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_21990 105143 106294 gene locus_tag LOCUS_22000 105143 106294 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_22000 107027 106455 gene locus_tag LOCUS_22010 107027 106455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 107142 107585 gene locus_tag LOCUS_22020 107142 107585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 108853 107591 gene locus_tag LOCUS_22030 108853 107591 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_22030 109930 108896 gene locus_tag LOCUS_22040 gene ltaE 109930 108896 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_22040 110385 109927 gene locus_tag LOCUS_22050 110385 109927 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_22050 111456 110614 gene locus_tag LOCUS_22060 111456 110614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 111989 111456 gene locus_tag LOCUS_22070 111989 111456 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_22070 113440 112043 gene locus_tag LOCUS_22080 gene lpdA2 113440 112043 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_22080 113659 114405 gene locus_tag LOCUS_22090 113659 114405 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_22090 114501 115334 gene locus_tag LOCUS_22100 114501 115334 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103137.1 protein_id gnl|my_center|LOCUS_22100 115528 117042 gene locus_tag LOCUS_22110 115528 117042 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_22110 117223 117903 gene locus_tag LOCUS_22120 117223 117903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 119350 118403 gene locus_tag LOCUS_22130 119350 118403 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_22130 120493 119492 gene locus_tag LOCUS_22140 120493 119492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_22140 121451 120540 gene locus_tag LOCUS_22150 gene rbsK 121451 120540 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4V3 protein_id gnl|my_center|LOCUS_22150 123290 121686 gene locus_tag LOCUS_22160 123290 121686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 123689 123844 gene locus_tag LOCUS_22170 123689 123844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 123971 123804 gene locus_tag LOCUS_22180 123971 123804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 124199 126115 gene locus_tag LOCUS_22190 124199 126115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 126618 126358 gene locus_tag LOCUS_22200 126618 126358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 127154 128578 gene locus_tag LOCUS_22210 127154 128578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 129151 128732 gene locus_tag LOCUS_22220 129151 128732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 134350 129218 gene locus_tag LOCUS_22230 134350 129218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 134933 135733 gene locus_tag LOCUS_22240 134933 135733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 136793 135849 gene locus_tag LOCUS_22250 136793 135849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 139219 136820 gene locus_tag LOCUS_22260 139219 136820 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_22260 140210 139566 gene locus_tag LOCUS_22270 gene satA 140210 139566 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_22270 142108 140309 gene locus_tag LOCUS_22280 142108 140309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 144360 142771 gene locus_tag LOCUS_22290 144360 142771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 146187 144499 gene locus_tag LOCUS_22300 146187 144499 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_22300 147443 146199 gene locus_tag LOCUS_22310 147443 146199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_22310 148284 147673 gene locus_tag LOCUS_22320 gene miaE 148284 147673 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_22320 150252 148294 gene locus_tag LOCUS_22330 150252 148294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_22330 151303 150233 gene locus_tag LOCUS_22340 gene lpxK 151303 150233 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_22340 151348 152448 gene locus_tag LOCUS_22350 151348 152448 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_22350 152452 153219 gene locus_tag LOCUS_22360 152452 153219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_22360 153320 153730 gene locus_tag LOCUS_22370 153320 153730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 154348 153725 gene locus_tag LOCUS_22380 gene gpm 154348 153725 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_22380 154402 154821 gene locus_tag LOCUS_22390 gene menI 154402 154821 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83KW0 protein_id gnl|my_center|LOCUS_22390 154827 156035 gene locus_tag LOCUS_22400 154827 156035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_22400 156038 157717 gene locus_tag LOCUS_22410 gene menD 156038 157717 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_22410 158163 159044 gene locus_tag LOCUS_22420 158163 159044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 159115 160689 gene locus_tag LOCUS_22430 gene yidK 159115 160689 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_22430 160943 161311 gene locus_tag LOCUS_22440 160943 161311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 161476 162699 gene locus_tag LOCUS_22450 161476 162699 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_22450 162719 165889 gene locus_tag LOCUS_22460 162719 165889 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_22460 165946 167400 gene locus_tag LOCUS_22470 165946 167400 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_22470 167845 168420 gene locus_tag LOCUS_22480 167845 168420 CDS product pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_22480 168547 169236 gene locus_tag LOCUS_22490 168547 169236 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814431.1 protein_id gnl|my_center|LOCUS_22490 170635 169307 gene locus_tag LOCUS_22500 170635 169307 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635937.2 protein_id gnl|my_center|LOCUS_22500 172076 170871 gene locus_tag LOCUS_22510 172076 170871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence12 321 566 gene locus_tag LOCUS_22520 321 566 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_22520 563 853 gene locus_tag LOCUS_22530 563 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3872 1806 gene locus_tag LOCUS_22540 gene pepO 3872 1806 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_22540 4172 5896 gene locus_tag LOCUS_22550 4172 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 6092 8284 gene locus_tag LOCUS_22560 6092 8284 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_22560 9703 8453 gene locus_tag LOCUS_22570 9703 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_22570 10789 9719 gene locus_tag LOCUS_22580 10789 9719 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_22580 11830 10865 gene locus_tag LOCUS_22590 11830 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 12403 12903 gene locus_tag LOCUS_22600 12403 12903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704785.1 protein_id gnl|my_center|LOCUS_22600 13292 14227 gene locus_tag LOCUS_22610 13292 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 14945 15355 gene locus_tag LOCUS_22620 14945 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 15361 16149 gene locus_tag LOCUS_22630 15361 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22630 16195 16479 gene locus_tag LOCUS_22640 16195 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 16536 19697 gene locus_tag LOCUS_22650 16536 19697 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_22650 19690 21054 gene locus_tag LOCUS_22660 19690 21054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_22660 22716 21280 gene locus_tag LOCUS_22670 22716 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_22670 25981 22727 gene locus_tag LOCUS_22680 25981 22727 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_22680 26586 27293 gene locus_tag LOCUS_22690 26586 27293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22690 27294 27863 gene locus_tag LOCUS_22700 27294 27863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 29407 28217 gene locus_tag LOCUS_22710 gene ycaQ 29407 28217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_22710 30889 29471 gene locus_tag LOCUS_22720 30889 29471 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_22720 31264 32376 gene locus_tag LOCUS_22730 31264 32376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 32604 33095 gene locus_tag LOCUS_22740 32604 33095 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_22740 33079 33738 gene locus_tag LOCUS_22750 33079 33738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 33794 34258 gene locus_tag LOCUS_22760 33794 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 36490 34409 gene locus_tag LOCUS_22770 36490 34409 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_22770 38095 36719 gene locus_tag LOCUS_22780 38095 36719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_22780 38708 41206 gene locus_tag LOCUS_22790 38708 41206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 43056 41356 gene locus_tag LOCUS_22800 43056 41356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 43398 44555 gene locus_tag LOCUS_22810 43398 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 44733 45032 gene locus_tag LOCUS_22820 44733 45032 CDS product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727587.1 protein_id gnl|my_center|LOCUS_22820 45131 45484 gene locus_tag LOCUS_22830 45131 45484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 45549 46676 gene locus_tag LOCUS_22840 45549 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 47772 46711 gene locus_tag LOCUS_22850 47772 46711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 48090 49157 gene locus_tag LOCUS_22860 48090 49157 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_22860 49228 50208 gene locus_tag LOCUS_22870 49228 50208 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120895.1 protein_id gnl|my_center|LOCUS_22870 51112 50216 gene locus_tag LOCUS_22880 51112 50216 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937390.1 protein_id gnl|my_center|LOCUS_22880 51236 51886 gene locus_tag LOCUS_22890 gene sirR 51236 51886 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_22890 51893 52594 gene locus_tag LOCUS_22900 gene ispD 51893 52594 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_22900 52702 53439 gene locus_tag LOCUS_22910 52702 53439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_22910 53453 54496 gene locus_tag LOCUS_22920 53453 54496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 54493 55224 gene locus_tag LOCUS_22930 54493 55224 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_22930 55487 55266 gene locus_tag LOCUS_22940 55487 55266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_22940 56814 55564 gene locus_tag LOCUS_22950 56814 55564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 56944 58623 gene locus_tag LOCUS_22960 56944 58623 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_22960 58785 60119 gene locus_tag LOCUS_22970 58785 60119 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_22970 60954 60010 gene locus_tag LOCUS_22980 60954 60010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 61243 61494 gene locus_tag LOCUS_22990 gene rpsT 61243 61494 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_22990 61569 62366 gene locus_tag LOCUS_23000 gene radC 61569 62366 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_23000 62373 62990 gene locus_tag LOCUS_23010 62373 62990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 63045 65456 gene locus_tag LOCUS_23020 gene pheT 63045 65456 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_23020 65458 65745 gene locus_tag LOCUS_23030 65458 65745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 65747 66031 gene locus_tag LOCUS_23040 65747 66031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 66103 67668 gene locus_tag LOCUS_23050 gene rny 66103 67668 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_23050 68323 71424 gene locus_tag LOCUS_23060 68323 71424 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_23060 71583 72782 gene locus_tag LOCUS_23070 71583 72782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 73331 73909 gene locus_tag LOCUS_23080 73331 73909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 74137 74685 gene locus_tag LOCUS_23090 74137 74685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 75243 74677 gene locus_tag LOCUS_23100 75243 74677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 75619 76647 gene locus_tag LOCUS_23110 75619 76647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405151.1 protein_id gnl|my_center|LOCUS_23110 76652 77212 gene locus_tag LOCUS_23120 76652 77212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 78787 77396 gene locus_tag LOCUS_23130 78787 77396 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_23130 79776 78829 gene locus_tag LOCUS_23140 79776 78829 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_23140 80602 79751 gene locus_tag LOCUS_23150 80602 79751 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_23150 81533 80595 gene locus_tag LOCUS_23160 gene hemC 81533 80595 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ26 protein_id gnl|my_center|LOCUS_23160 82441 81533 gene locus_tag LOCUS_23170 gene rimK 82441 81533 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_23170 82866 82438 gene locus_tag LOCUS_23180 gene rimK2 82866 82438 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_23180 84044 82923 gene locus_tag LOCUS_23190 84044 82923 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_23190 85260 84055 gene locus_tag LOCUS_23200 85260 84055 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_23200 85578 85333 gene locus_tag LOCUS_23210 gene rpmE2 85578 85333 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_23210 85791 87461 gene locus_tag LOCUS_23220 85791 87461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 87723 89555 gene locus_tag LOCUS_23230 87723 89555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_23230 89589 89942 gene locus_tag LOCUS_23240 89589 89942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 89992 91530 gene locus_tag LOCUS_23250 89992 91530 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_23250 91664 92125 gene locus_tag LOCUS_23260 91664 92125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 93243 92128 gene locus_tag LOCUS_23270 gene metB 93243 92128 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_23270 93728 93297 gene locus_tag LOCUS_23280 93728 93297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 93800 94633 gene locus_tag LOCUS_23290 gene truA 93800 94633 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_23290 94645 96420 gene locus_tag LOCUS_23300 94645 96420 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_23300 96651 97214 gene locus_tag LOCUS_23310 96651 97214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 97214 97732 gene locus_tag LOCUS_23320 97214 97732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 97857 98393 gene locus_tag LOCUS_23330 97857 98393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 98536 99084 gene locus_tag LOCUS_23340 98536 99084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 99200 100237 gene locus_tag LOCUS_23350 gene hemE 99200 100237 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_23350 100450 101142 gene locus_tag LOCUS_23360 100450 101142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 101453 102160 gene locus_tag LOCUS_23370 101453 102160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 102603 103403 gene locus_tag LOCUS_23380 102603 103403 CDS product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_23380 103463 105838 gene locus_tag LOCUS_23390 103463 105838 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_23390 105875 107251 gene locus_tag LOCUS_23400 105875 107251 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_23400 107239 108528 gene locus_tag LOCUS_23410 107239 108528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 108534 109799 gene locus_tag LOCUS_23420 108534 109799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 109835 110872 gene locus_tag LOCUS_23430 109835 110872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 110916 112247 gene locus_tag LOCUS_23440 110916 112247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 112249 113256 gene locus_tag LOCUS_23450 112249 113256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 113284 115446 gene locus_tag LOCUS_23460 113284 115446 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_23460 115710 116798 gene locus_tag LOCUS_23470 115710 116798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 117018 118268 gene locus_tag LOCUS_23480 117018 118268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_23480 118367 119128 gene locus_tag LOCUS_23490 118367 119128 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_23490 119198 120253 gene locus_tag LOCUS_23500 119198 120253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 120324 121286 gene locus_tag LOCUS_23510 120324 121286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 121300 122415 gene locus_tag LOCUS_23520 121300 122415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 127208 122544 gene locus_tag LOCUS_23530 127208 122544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 132761 128181 gene locus_tag LOCUS_23540 132761 128181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 134692 133577 gene locus_tag LOCUS_23550 134692 133577 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 protein_id gnl|my_center|LOCUS_23550 136257 135028 gene locus_tag LOCUS_23560 136257 135028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 136678 137466 gene locus_tag LOCUS_23570 136678 137466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_23570 137469 137951 gene locus_tag LOCUS_23580 137469 137951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 137957 138130 gene locus_tag LOCUS_23590 137957 138130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 138277 138819 gene locus_tag LOCUS_23600 138277 138819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 138898 140955 gene locus_tag LOCUS_23610 138898 140955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 142649 141303 gene locus_tag LOCUS_23620 142649 141303 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_23620 143522 142782 gene locus_tag LOCUS_23630 143522 142782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 143726 144823 gene locus_tag LOCUS_23640 gene paaE 143726 144823 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_23640 144823 145335 gene locus_tag LOCUS_23650 144823 145335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 146316 145396 gene locus_tag LOCUS_23660 146316 145396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 147363 146338 gene locus_tag LOCUS_23670 147363 146338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 148126 147380 gene locus_tag LOCUS_23680 148126 147380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 148688 148116 gene locus_tag LOCUS_23690 148688 148116 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_23690 149279 148809 gene locus_tag LOCUS_23700 149279 148809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 150730 149330 gene locus_tag LOCUS_23710 150730 149330 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947965.1 protein_id gnl|my_center|LOCUS_23710 153010 151109 gene locus_tag LOCUS_23720 153010 151109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_23720 153399 153061 gene locus_tag LOCUS_23730 153399 153061 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_23730 153746 154897 gene locus_tag LOCUS_23740 153746 154897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_23740 154884 159935 gene locus_tag LOCUS_23750 154884 159935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 160721 159924 gene locus_tag LOCUS_23760 160721 159924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 161871 162794 gene locus_tag LOCUS_23770 gene lolI 161871 162794 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_23770 163507 163737 gene locus_tag LOCUS_23780 163507 163737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 164218 163970 gene locus_tag LOCUS_23790 164218 163970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 164808 164632 gene locus_tag LOCUS_23800 164808 164632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 166436 164853 gene locus_tag LOCUS_23810 166436 164853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 167195 166587 gene locus_tag LOCUS_23820 167195 166587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 168187 167189 gene locus_tag LOCUS_23830 gene fabH2 168187 167189 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence13 6107 666 gene locus_tag LOCUS_23840 6107 666 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108226.1 protein_id gnl|my_center|LOCUS_23840 6531 6094 gene locus_tag LOCUS_23850 6531 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 7555 6674 gene locus_tag LOCUS_23860 7555 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 9638 7545 gene locus_tag LOCUS_23870 9638 7545 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABK5 protein_id gnl|my_center|LOCUS_23870 11096 9645 gene locus_tag LOCUS_23880 11096 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_23880 11487 11194 gene locus_tag LOCUS_23890 11487 11194 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005926255.1 protein_id gnl|my_center|LOCUS_23890 11854 11507 gene locus_tag LOCUS_23900 11854 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 12952 12107 gene locus_tag LOCUS_23910 12952 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_23910 15187 13721 gene locus_tag LOCUS_23920 gene glyQS 15187 13721 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_23920 17982 15229 gene locus_tag LOCUS_23930 17982 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 18888 18070 gene locus_tag LOCUS_23940 18888 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 20551 18935 gene locus_tag LOCUS_23950 20551 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 22433 20853 gene locus_tag LOCUS_23960 22433 20853 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_23960 25520 22452 gene locus_tag LOCUS_23970 25520 22452 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_23970 26019 28445 gene locus_tag LOCUS_23980 26019 28445 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_23980 29153 28551 gene locus_tag LOCUS_23990 gene tag 29153 28551 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_23990 29995 29327 gene locus_tag LOCUS_24000 29995 29327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 30226 31302 gene locus_tag LOCUS_24010 gene prfA 30226 31302 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_24010 34238 31428 gene locus_tag LOCUS_24020 34238 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 35670 34426 gene locus_tag LOCUS_24030 35670 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 39276 35932 gene locus_tag LOCUS_24040 gene mfd 39276 35932 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_24040 40455 41432 gene locus_tag LOCUS_24050 40455 41432 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_24050 41469 42407 gene locus_tag LOCUS_24060 41469 42407 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_24060 42426 42869 gene locus_tag LOCUS_24070 42426 42869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 43386 42916 gene locus_tag LOCUS_24080 43386 42916 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_24080 43835 45007 gene locus_tag LOCUS_24090 43835 45007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 45148 48132 gene locus_tag LOCUS_24100 45148 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 48903 48172 gene locus_tag LOCUS_24110 gene nagB 48903 48172 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AL0 protein_id gnl|my_center|LOCUS_24110 49610 48999 gene locus_tag LOCUS_24120 49610 48999 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_24120 50239 49610 gene locus_tag LOCUS_24130 50239 49610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 53274 50872 gene locus_tag LOCUS_24140 53274 50872 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_24140 54917 54072 gene locus_tag LOCUS_24150 gene ispH 54917 54072 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_24150 55932 55087 gene locus_tag LOCUS_24160 gene crtB 55932 55087 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_24160 57437 55962 gene locus_tag LOCUS_24170 gene crtI 57437 55962 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_24170 57954 57442 gene locus_tag LOCUS_24180 57954 57442 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_24180 59249 58179 gene locus_tag LOCUS_24190 59249 58179 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_24190 60412 59285 gene locus_tag LOCUS_24200 60412 59285 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_24200 60869 60405 gene locus_tag LOCUS_24210 60869 60405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_24210 62208 60889 gene locus_tag LOCUS_24220 gene gntM 62208 60889 CDS product idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_24220 63376 62318 gene locus_tag LOCUS_24230 63376 62318 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_24230 64771 63533 gene locus_tag LOCUS_24240 gene GALNS 64771 63533 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_24240 65796 65224 gene locus_tag LOCUS_24250 65796 65224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 68563 66209 gene locus_tag LOCUS_24260 68563 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 68783 70003 gene locus_tag LOCUS_24270 68783 70003 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_24270 70061 72097 gene locus_tag LOCUS_24280 gene uvrB 70061 72097 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_24280 72098 72538 gene locus_tag LOCUS_24290 72098 72538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 72546 73190 gene locus_tag LOCUS_24300 72546 73190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 73689 73174 gene locus_tag LOCUS_24310 gene recX 73689 73174 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_24310 73763 74524 gene locus_tag LOCUS_24320 gene tpiA 73763 74524 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_24320 74610 75443 gene locus_tag LOCUS_24330 gene prmA 74610 75443 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_24330 76937 75666 gene locus_tag LOCUS_24340 76937 75666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 77817 77005 gene locus_tag LOCUS_24350 77817 77005 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_24350 78032 78802 gene locus_tag LOCUS_24360 gene panC 78032 78802 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5N0 protein_id gnl|my_center|LOCUS_24360 78811 79158 gene locus_tag LOCUS_24370 gene panD 78811 79158 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_24370 79155 80144 gene locus_tag LOCUS_24380 79155 80144 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_24380 80186 80878 gene locus_tag LOCUS_24390 80186 80878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_24390 81164 82303 gene locus_tag LOCUS_24400 81164 82303 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_24400 82445 83374 gene locus_tag LOCUS_24410 82445 83374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 84142 83357 gene locus_tag LOCUS_24420 gene pcrB 84142 83357 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_24420 84446 84123 gene locus_tag LOCUS_24430 84446 84123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 84790 84446 gene locus_tag LOCUS_24440 84790 84446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 85050 85721 gene locus_tag LOCUS_24450 85050 85721 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_24450 85871 87343 gene locus_tag LOCUS_24460 gene crtN 85871 87343 CDS product dehydrosqualene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_24460 88740 87340 gene locus_tag LOCUS_24470 88740 87340 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_24470 90171 88840 gene locus_tag LOCUS_24480 90171 88840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_24480 93235 90173 gene locus_tag LOCUS_24490 93235 90173 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_24490 94321 93245 gene locus_tag LOCUS_24500 94321 93245 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_24500 98079 94705 gene locus_tag LOCUS_24510 98079 94705 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_24510 98695 99396 gene locus_tag LOCUS_24520 98695 99396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_24520 101157 99403 gene locus_tag LOCUS_24530 gene aspS 101157 99403 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_24530 101395 102663 gene locus_tag LOCUS_24540 101395 102663 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_24540 102786 103898 gene locus_tag LOCUS_24550 102786 103898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 103952 104734 gene locus_tag LOCUS_24560 103952 104734 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_24560 104759 105817 gene locus_tag LOCUS_24570 104759 105817 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_24570 107175 105880 gene locus_tag LOCUS_24580 107175 105880 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257098.1 protein_id gnl|my_center|LOCUS_24580 107711 107172 gene locus_tag LOCUS_24590 107711 107172 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_24590 107854 109218 gene locus_tag LOCUS_24600 107854 109218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 109267 109686 gene locus_tag LOCUS_24610 109267 109686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_24610 109693 111111 gene locus_tag LOCUS_24620 109693 111111 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_24620 113647 111290 gene locus_tag LOCUS_24630 113647 111290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 114558 113650 gene locus_tag LOCUS_24640 114558 113650 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_24640 117607 114665 gene locus_tag LOCUS_24650 117607 114665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 119354 117870 gene locus_tag LOCUS_24660 119354 117870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 119846 119385 gene locus_tag LOCUS_24670 119846 119385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 120203 120628 gene locus_tag LOCUS_24680 120203 120628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 protein_id gnl|my_center|LOCUS_24680 121234 120761 gene locus_tag LOCUS_24690 121234 120761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 121778 121251 gene locus_tag LOCUS_24700 gene ygfA 121778 121251 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_24700 123390 121795 gene locus_tag LOCUS_24710 gene bshC 123390 121795 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_24710 123768 125966 gene locus_tag LOCUS_24720 123768 125966 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_24720 126057 126263 gene locus_tag LOCUS_24730 126057 126263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 126314 127576 gene locus_tag LOCUS_24740 126314 127576 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_24740 127588 128067 gene locus_tag LOCUS_24750 gene ispF 127588 128067 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_24750 128079 128768 gene locus_tag LOCUS_24760 128079 128768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_24760 128753 129304 gene locus_tag LOCUS_24770 128753 129304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 129717 130922 gene locus_tag LOCUS_24780 129717 130922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 130939 131835 gene locus_tag LOCUS_24790 130939 131835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 132879 131881 gene locus_tag LOCUS_24800 132879 131881 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_24800 133320 132943 gene locus_tag LOCUS_24810 133320 132943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 134730 133357 gene locus_tag LOCUS_24820 134730 133357 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_24820 135935 134727 gene locus_tag LOCUS_24830 135935 134727 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_24830 137136 135976 gene locus_tag LOCUS_24840 gene aroB 137136 135976 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_24840 138105 137206 gene locus_tag LOCUS_24850 138105 137206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 139025 138114 gene locus_tag LOCUS_24860 139025 138114 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_24860 140017 139130 gene locus_tag LOCUS_24870 140017 139130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 141490 140330 gene locus_tag LOCUS_24880 141490 140330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_24880 142575 141544 gene locus_tag LOCUS_24890 142575 141544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_24890 143949 142744 gene locus_tag LOCUS_24900 143949 142744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_24900 145070 143979 gene locus_tag LOCUS_24910 145070 143979 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_24910 145929 145159 gene locus_tag LOCUS_24920 145929 145159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122498.1 protein_id gnl|my_center|LOCUS_24920 148689 146032 gene locus_tag LOCUS_24930 148689 146032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 150405 148900 gene locus_tag LOCUS_24940 150405 148900 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_24940 153467 150435 gene locus_tag LOCUS_24950 153467 150435 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_24950 155371 153863 gene locus_tag LOCUS_24960 155371 153863 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_24960 158466 155392 gene locus_tag LOCUS_24970 158466 155392 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_24970 159063 158695 gene locus_tag LOCUS_24980 gene rplS 159063 158695 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_24980 159837 159112 gene locus_tag LOCUS_24990 gene trmD 159837 159112 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_24990 160374 159844 gene locus_tag LOCUS_25000 gene rimM 160374 159844 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038J9 protein_id gnl|my_center|LOCUS_25000 160970 160389 gene locus_tag LOCUS_25010 160970 160389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 161198 161270 gene locus_tag LOCUS_t00180 161198 161270 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 162008 161457 gene locus_tag LOCUS_25020 162008 161457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_25020 162632 163729 gene locus_tag LOCUS_25030 162632 163729 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_25030 163766 165391 gene locus_tag LOCUS_25040 gene betT 163766 165391 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040260.1 protein_id gnl|my_center|LOCUS_25040 165402 166262 gene locus_tag LOCUS_25050 165402 166262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence14 603 3734 gene locus_tag LOCUS_25060 603 3734 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_25060 3739 5277 gene locus_tag LOCUS_25070 3739 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_25070 5571 6839 gene locus_tag LOCUS_25080 5571 6839 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_25080 6894 8240 gene locus_tag LOCUS_25090 gene RspA 6894 8240 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_25090 8312 8926 gene locus_tag LOCUS_25100 8312 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 10533 9025 gene locus_tag LOCUS_25110 10533 9025 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118991.1 protein_id gnl|my_center|LOCUS_25110 10709 11503 gene locus_tag LOCUS_25120 gene truA 10709 11503 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_25120 11690 12211 gene locus_tag LOCUS_25130 11690 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_25130 12671 13324 gene locus_tag LOCUS_25140 12671 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 13729 15072 gene locus_tag LOCUS_25150 gene xylE 13729 15072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_25150 15065 15946 gene locus_tag LOCUS_25160 15065 15946 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_25160 16803 16219 gene locus_tag LOCUS_25170 16803 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 16847 17032 gene locus_tag LOCUS_25180 16847 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 18220 17150 gene locus_tag LOCUS_25190 18220 17150 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_25190 18662 18222 gene locus_tag LOCUS_25200 18662 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 20105 18696 gene locus_tag LOCUS_25210 gene putP 20105 18696 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_25210 21016 20267 gene locus_tag LOCUS_25220 21016 20267 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_25220 22980 21046 gene locus_tag LOCUS_25230 gene sdhA 22980 21046 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_25230 23710 23027 gene locus_tag LOCUS_25240 23710 23027 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_25240 24230 26965 gene locus_tag LOCUS_25250 24230 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 27143 28021 gene locus_tag LOCUS_25260 gene fabD 27143 28021 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_25260 28694 28206 gene locus_tag LOCUS_25270 gene folK 28694 28206 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66550 protein_id gnl|my_center|LOCUS_25270 28773 30533 gene locus_tag LOCUS_25280 28773 30533 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_25280 30546 31442 gene locus_tag LOCUS_25290 30546 31442 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_25290 31566 34193 gene locus_tag LOCUS_25300 gene valS 31566 34193 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_25300 34831 34292 gene locus_tag LOCUS_25310 gene ppa 34831 34292 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_25310 36114 35026 gene locus_tag LOCUS_25320 36114 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 38256 36118 gene locus_tag LOCUS_25330 38256 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 38953 38243 gene locus_tag LOCUS_25340 38953 38243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 40052 38943 gene locus_tag LOCUS_25350 40052 38943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 40311 40775 gene locus_tag LOCUS_25360 40311 40775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 42011 40791 gene locus_tag LOCUS_25370 gene ald 42011 40791 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_25370 42436 42008 gene locus_tag LOCUS_25380 42436 42008 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_25380 43997 42444 gene locus_tag LOCUS_25390 gene porX 43997 42444 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_25390 44050 45291 gene locus_tag LOCUS_25400 44050 45291 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_25400 45307 46326 gene locus_tag LOCUS_25410 gene lpxD 45307 46326 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_25410 46379 47773 gene locus_tag LOCUS_25420 gene fabZ 46379 47773 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_25420 47770 48549 gene locus_tag LOCUS_25430 gene lpxA 47770 48549 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_25430 48552 49178 gene locus_tag LOCUS_25440 48552 49178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 49225 49716 gene locus_tag LOCUS_25450 49225 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 49738 50163 gene locus_tag LOCUS_25460 49738 50163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268377.1 protein_id gnl|my_center|LOCUS_25460 52591 50198 gene locus_tag LOCUS_25470 gene mutS2 52591 50198 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_25470 52942 52592 gene locus_tag LOCUS_25480 52942 52592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 53043 53927 gene locus_tag LOCUS_25490 53043 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_25490 53920 54822 gene locus_tag LOCUS_25500 53920 54822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 55064 55855 gene locus_tag LOCUS_25510 55064 55855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_25510 57650 56229 gene locus_tag LOCUS_25520 57650 56229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_25520 58660 57746 gene locus_tag LOCUS_25530 58660 57746 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_25530 60049 58679 gene locus_tag LOCUS_25540 gene trpB 60049 58679 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E092 protein_id gnl|my_center|LOCUS_25540 63495 60163 gene locus_tag LOCUS_25550 63495 60163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 63923 65341 gene locus_tag LOCUS_25560 63923 65341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 67022 65418 gene locus_tag LOCUS_25570 67022 65418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_25570 70265 67041 gene locus_tag LOCUS_25580 70265 67041 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_25580 70837 71520 gene locus_tag LOCUS_25590 70837 71520 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_25590 71526 71900 gene locus_tag LOCUS_25600 71526 71900 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_25600 71912 73201 gene locus_tag LOCUS_25610 71912 73201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 73210 74262 gene locus_tag LOCUS_25620 gene ykfA 73210 74262 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_25620 74365 75018 gene locus_tag LOCUS_25630 74365 75018 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_25630 75953 75165 gene locus_tag LOCUS_25640 75953 75165 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_25640 76368 77084 gene locus_tag LOCUS_25650 76368 77084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_25650 77160 77747 gene locus_tag LOCUS_25660 77160 77747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_25660 78224 77832 gene locus_tag LOCUS_25670 78224 77832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 79695 78268 gene locus_tag LOCUS_25680 79695 78268 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_25680 79826 80221 gene locus_tag LOCUS_25690 79826 80221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 80283 80864 gene locus_tag LOCUS_25700 80283 80864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 80867 81715 gene locus_tag LOCUS_25710 80867 81715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 81712 82167 gene locus_tag LOCUS_25720 gene coaD 81712 82167 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MK4 protein_id gnl|my_center|LOCUS_25720 82844 82155 gene locus_tag LOCUS_25730 82844 82155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 82928 83572 gene locus_tag LOCUS_25740 gene pyrE 82928 83572 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_25740 84460 83675 gene locus_tag LOCUS_25750 84460 83675 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_25750 84815 84453 gene locus_tag LOCUS_25760 84815 84453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 85162 86742 gene locus_tag LOCUS_25770 gene prfC 85162 86742 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_25770 86764 87495 gene locus_tag LOCUS_25780 86764 87495 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_25780 87508 88362 gene locus_tag LOCUS_25790 87508 88362 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_25790 88865 88365 gene locus_tag LOCUS_25800 88865 88365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 89181 90326 gene locus_tag LOCUS_25810 89181 90326 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_25810 91159 90323 gene locus_tag LOCUS_25820 91159 90323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 92124 91162 gene locus_tag LOCUS_25830 92124 91162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 95202 92428 gene locus_tag LOCUS_25840 gene leuS 95202 92428 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_25840 96273 95329 gene locus_tag LOCUS_25850 96273 95329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 97261 96356 gene locus_tag LOCUS_25860 97261 96356 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_25860 97431 98975 gene locus_tag LOCUS_25870 97431 98975 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_25870 98972 99517 gene locus_tag LOCUS_25880 98972 99517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 99518 100387 gene locus_tag LOCUS_25890 gene kdsA 99518 100387 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_25890 100429 102054 gene locus_tag LOCUS_25900 100429 102054 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964231.1 protein_id gnl|my_center|LOCUS_25900 102800 102072 gene locus_tag LOCUS_25910 102800 102072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 103292 103702 gene locus_tag LOCUS_25920 gene ygcM 103292 103702 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_25920 103662 104363 gene locus_tag LOCUS_25930 gene folE2 103662 104363 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_25930 104512 105192 gene locus_tag LOCUS_25940 104512 105192 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_25940 105262 105525 gene locus_tag LOCUS_25950 105262 105525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 105574 106023 gene locus_tag LOCUS_25960 105574 106023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 106023 106646 gene locus_tag LOCUS_25970 106023 106646 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_25970 108291 106831 gene locus_tag LOCUS_25980 108291 106831 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_25980 108570 108361 gene locus_tag LOCUS_25990 108570 108361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 108545 109708 gene locus_tag LOCUS_26000 gene dxr 108545 109708 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_26000 109712 111031 gene locus_tag LOCUS_26010 109712 111031 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A685 protein_id gnl|my_center|LOCUS_26010 111226 113712 gene locus_tag LOCUS_26020 gene lon 111226 113712 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_26020 113725 115104 gene locus_tag LOCUS_26030 gene hslU 113725 115104 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD63 protein_id gnl|my_center|LOCUS_26030 117261 115132 gene locus_tag LOCUS_26040 117261 115132 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_26040 117818 117267 gene locus_tag LOCUS_26050 117818 117267 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_26050 118020 119021 gene locus_tag LOCUS_26060 gene fabH3 118020 119021 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_26060 119039 119602 gene locus_tag LOCUS_26070 gene efp 119039 119602 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_26070 119715 120176 gene locus_tag LOCUS_26080 gene accB 119715 120176 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_26080 120206 121558 gene locus_tag LOCUS_26090 gene accC 120206 121558 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_26090 121891 124206 gene locus_tag LOCUS_26100 121891 124206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 124208 125665 gene locus_tag LOCUS_26110 124208 125665 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_26110 125704 127845 gene locus_tag LOCUS_26120 125704 127845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 128830 127880 gene locus_tag LOCUS_26130 gene prfB 128830 127880 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_26130 129654 129139 gene locus_tag LOCUS_26140 129654 129139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 130764 129697 gene locus_tag LOCUS_26150 gene ilvE 130764 129697 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_26150 131319 130771 gene locus_tag LOCUS_26160 131319 130771 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_26160 132057 131341 gene locus_tag LOCUS_26170 132057 131341 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_26170 134868 132136 gene locus_tag LOCUS_26180 134868 132136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 135191 134904 gene locus_tag LOCUS_26190 gene gatC 135191 134904 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_26190 135817 135209 gene locus_tag LOCUS_26200 135817 135209 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_26200 137402 136035 gene locus_tag LOCUS_26210 gene nfeD 137402 136035 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_26210 137510 138733 gene locus_tag LOCUS_26220 137510 138733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 138909 139928 gene locus_tag LOCUS_26230 gene pdxA 138909 139928 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_26230 139998 140549 gene locus_tag LOCUS_26240 139998 140549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 140568 140759 gene locus_tag LOCUS_26250 gene rpmF 140568 140759 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_26250 142400 140817 gene locus_tag LOCUS_26260 142400 140817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_26260 142540 143691 gene locus_tag LOCUS_26270 142540 143691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 143852 145105 gene locus_tag LOCUS_26280 143852 145105 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_26280 145118 146146 gene locus_tag LOCUS_26290 145118 146146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 146553 146179 gene locus_tag LOCUS_26300 gene yffB 146553 146179 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_26300 147068 150175 gene locus_tag LOCUS_26310 147068 150175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_26310 151546 150260 gene locus_tag LOCUS_26320 gene hemL 151546 150260 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_26320 153169 151553 gene locus_tag LOCUS_26330 153169 151553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 154891 153362 gene locus_tag LOCUS_26340 gene guaA 154891 153362 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_26340 >Feature sequence15 452 3316 gene locus_tag LOCUS_26350 452 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4716 3640 gene locus_tag LOCUS_26360 4716 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 5390 6808 gene locus_tag LOCUS_26370 gene arsA 5390 6808 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_26370 7002 7544 gene locus_tag LOCUS_26380 7002 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 7757 9301 gene locus_tag LOCUS_26390 7757 9301 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_26390 10098 13220 gene locus_tag LOCUS_26400 10098 13220 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_26400 13265 14983 gene locus_tag LOCUS_26410 13265 14983 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_26410 15228 16622 gene locus_tag LOCUS_26420 15228 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_26420 17015 17791 gene locus_tag LOCUS_26430 17015 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 17797 18915 gene locus_tag LOCUS_26440 17797 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 19021 19311 gene locus_tag LOCUS_26450 19021 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 21019 19316 gene locus_tag LOCUS_26460 gene ggt 21019 19316 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_26460 21401 21087 gene locus_tag LOCUS_26470 21401 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 21360 21506 gene locus_tag LOCUS_26480 21360 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 21886 22530 gene locus_tag LOCUS_26490 21886 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 23144 22527 gene locus_tag LOCUS_26500 23144 22527 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_26500 23623 24957 gene locus_tag LOCUS_26510 23623 24957 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388785.1 protein_id gnl|my_center|LOCUS_26510 24954 26318 gene locus_tag LOCUS_26520 24954 26318 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_26520 26364 27512 gene locus_tag LOCUS_26530 26364 27512 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337398.1 protein_id gnl|my_center|LOCUS_26530 27516 28259 gene locus_tag LOCUS_26540 27516 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 28262 29626 gene locus_tag LOCUS_26550 28262 29626 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976259.1 protein_id gnl|my_center|LOCUS_26550 29897 32455 gene locus_tag LOCUS_26560 29897 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 33357 32854 gene locus_tag LOCUS_26570 33357 32854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 34857 33373 gene locus_tag LOCUS_26580 34857 33373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_26580 38209 34871 gene locus_tag LOCUS_26590 38209 34871 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_26590 38971 40095 gene locus_tag LOCUS_26600 38971 40095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_26600 40454 41443 gene locus_tag LOCUS_26610 40454 41443 CDS product 2-keto-3-deoxy-galactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731093.1 protein_id gnl|my_center|LOCUS_26610 41412 42053 gene locus_tag LOCUS_26620 41412 42053 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_26620 42122 43486 gene locus_tag LOCUS_26630 42122 43486 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_26630 44571 48974 gene locus_tag LOCUS_26640 44571 48974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 49611 52904 gene locus_tag LOCUS_26650 49611 52904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 53706 58802 gene locus_tag LOCUS_26660 53706 58802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 59094 59930 gene locus_tag LOCUS_26670 gene hpaG 59094 59930 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_26670 60122 61744 gene locus_tag LOCUS_26680 gene pyrG 60122 61744 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_26680 61796 63616 gene locus_tag LOCUS_26690 gene yidC 61796 63616 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_26690 64106 64789 gene locus_tag LOCUS_26700 64106 64789 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_26700 64796 65575 gene locus_tag LOCUS_26710 64796 65575 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_26710 65589 66512 gene locus_tag LOCUS_26720 gene parB 65589 66512 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_26720 66534 67121 gene locus_tag LOCUS_26730 66534 67121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 67123 67848 gene locus_tag LOCUS_26740 gene dapB 67123 67848 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_26740 67859 68935 gene locus_tag LOCUS_26750 67859 68935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 69735 69073 gene locus_tag LOCUS_26760 gene ung2 69735 69073 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_26760 69808 70194 gene locus_tag LOCUS_26770 gene apaG 69808 70194 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_26770 70205 70978 gene locus_tag LOCUS_26780 70205 70978 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_26780 71459 72382 gene locus_tag LOCUS_26790 71459 72382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 72462 72833 gene locus_tag LOCUS_26800 gene rpsF 72462 72833 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_26800 72830 73081 gene locus_tag LOCUS_26810 gene rpsR 72830 73081 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_26810 73120 73563 gene locus_tag LOCUS_26820 gene rplI 73120 73563 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_26820 73861 73613 gene locus_tag LOCUS_26830 73861 73613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 74097 75083 gene locus_tag LOCUS_26840 74097 75083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_26840 75080 77128 gene locus_tag LOCUS_26850 gene yyaL 75080 77128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 protein_id gnl|my_center|LOCUS_26850 77144 79657 gene locus_tag LOCUS_26860 gene priA 77144 79657 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_26860 80228 81241 gene locus_tag LOCUS_26870 80228 81241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 81251 82138 gene locus_tag LOCUS_26880 81251 82138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 82154 82651 gene locus_tag LOCUS_26890 82154 82651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 82644 83057 gene locus_tag LOCUS_26900 82644 83057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 83132 84571 gene locus_tag LOCUS_26910 83132 84571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 84582 86297 gene locus_tag LOCUS_26920 84582 86297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 86281 88620 gene locus_tag LOCUS_26930 86281 88620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 90747 88651 gene locus_tag LOCUS_26940 90747 88651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 91373 90744 gene locus_tag LOCUS_26950 91373 90744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 93085 91361 gene locus_tag LOCUS_26960 93085 91361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 93926 93123 gene locus_tag LOCUS_26970 93926 93123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 94285 94746 gene locus_tag LOCUS_26980 94285 94746 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_26980 94749 96905 gene locus_tag LOCUS_26990 94749 96905 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_26990 97455 99461 gene locus_tag LOCUS_27000 gene aceB 97455 99461 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_27000 99493 101211 gene locus_tag LOCUS_27010 99493 101211 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_27010 101304 101918 gene locus_tag LOCUS_27020 101304 101918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 101915 102613 gene locus_tag LOCUS_27030 101915 102613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 103503 102634 gene locus_tag LOCUS_27040 103503 102634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 protein_id gnl|my_center|LOCUS_27040 104215 103496 gene locus_tag LOCUS_27050 104215 103496 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_27050 104955 104218 gene locus_tag LOCUS_27060 104955 104218 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH05 protein_id gnl|my_center|LOCUS_27060 105170 105673 gene locus_tag LOCUS_27070 105170 105673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 106397 105810 gene locus_tag LOCUS_27080 106397 105810 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_27080 106480 106635 gene locus_tag LOCUS_27090 106480 106635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 106781 107956 gene locus_tag LOCUS_27100 106781 107956 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_27100 108053 108226 gene locus_tag LOCUS_27110 108053 108226 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_27110 109181 108288 gene locus_tag LOCUS_27120 gene dapA 109181 108288 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_27120 109677 109183 gene locus_tag LOCUS_27130 109677 109183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 112161 109684 gene locus_tag LOCUS_27140 112161 109684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 112480 112280 gene locus_tag LOCUS_27150 112480 112280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 113789 112461 gene locus_tag LOCUS_27160 gene xseA 113789 112461 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_27160 114560 114087 gene locus_tag LOCUS_27170 114560 114087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 114915 114544 gene locus_tag LOCUS_27180 114915 114544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 115496 114948 gene locus_tag LOCUS_27190 115496 114948 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_27190 116616 115684 gene locus_tag LOCUS_27200 gene fmt 116616 115684 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_27200 117793 116621 gene locus_tag LOCUS_27210 117793 116621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_27210 117880 119100 gene locus_tag LOCUS_27220 117880 119100 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_27220 119833 119087 gene locus_tag LOCUS_27230 119833 119087 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_27230 120460 120083 gene locus_tag LOCUS_27240 120460 120083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258310.1 protein_id gnl|my_center|LOCUS_27240 120886 120488 gene locus_tag LOCUS_27250 120886 120488 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616225.1 protein_id gnl|my_center|LOCUS_27250 121372 121178 gene locus_tag LOCUS_27260 121372 121178 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_27260 121603 121409 gene locus_tag LOCUS_27270 121603 121409 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_27270 122995 122204 gene locus_tag LOCUS_27280 122995 122204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 123331 124950 gene locus_tag LOCUS_27290 123331 124950 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_27290 125748 125074 gene locus_tag LOCUS_27300 125748 125074 CDS product lipid A 1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545448.1 protein_id gnl|my_center|LOCUS_27300 126274 125936 gene locus_tag LOCUS_27310 126274 125936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 126898 126416 gene locus_tag LOCUS_27320 126898 126416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 127474 128097 gene locus_tag LOCUS_27330 127474 128097 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_27330 128365 129366 gene locus_tag LOCUS_27340 128365 129366 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_27340 129517 132960 gene locus_tag LOCUS_27350 129517 132960 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_27350 132993 134465 gene locus_tag LOCUS_27360 132993 134465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_27360 135126 136304 gene locus_tag LOCUS_27370 135126 136304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_27370 136252 136539 gene locus_tag LOCUS_27380 136252 136539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence16 2519 252 gene locus_tag LOCUS_27390 2519 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3573 2578 gene locus_tag LOCUS_27400 3573 2578 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59745 protein_id gnl|my_center|LOCUS_27400 6099 3844 gene locus_tag LOCUS_27410 6099 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6580 6957 gene locus_tag LOCUS_27420 6580 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 9315 7330 gene locus_tag LOCUS_27430 9315 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 11005 10253 gene locus_tag LOCUS_27440 11005 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 11545 11078 gene locus_tag LOCUS_27450 11545 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 11791 11579 gene locus_tag LOCUS_27460 11791 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 13726 12635 gene locus_tag LOCUS_27470 gene metE 13726 12635 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_27470 15757 14387 gene locus_tag LOCUS_27480 15757 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 18211 15761 gene locus_tag LOCUS_27490 18211 15761 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_27490 20692 18662 gene locus_tag LOCUS_27500 20692 18662 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_27500 21751 21026 gene locus_tag LOCUS_27510 21751 21026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 22909 22166 gene locus_tag LOCUS_27520 22909 22166 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_27520 23017 25344 gene locus_tag LOCUS_27530 23017 25344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_27530 25368 26273 gene locus_tag LOCUS_27540 gene hemF 25368 26273 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_27540 26277 26870 gene locus_tag LOCUS_27550 gene lpxF 26277 26870 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_27550 27444 26857 gene locus_tag LOCUS_27560 gene ribE 27444 26857 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_27560 27723 27559 gene locus_tag LOCUS_27570 27723 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 27722 28378 gene locus_tag LOCUS_27580 gene pcm 27722 28378 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_27580 28390 28929 gene locus_tag LOCUS_27590 28390 28929 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_27590 28962 29519 gene locus_tag LOCUS_27600 28962 29519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 29524 29847 gene locus_tag LOCUS_27610 gene ydzA 29524 29847 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_27610 29869 30891 gene locus_tag LOCUS_27620 29869 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 30967 31623 gene locus_tag LOCUS_27630 30967 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 34139 31689 gene locus_tag LOCUS_27640 34139 31689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 34965 34126 gene locus_tag LOCUS_27650 34965 34126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 35540 34962 gene locus_tag LOCUS_27660 35540 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 35967 35569 gene locus_tag LOCUS_27670 35967 35569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 37513 36398 gene locus_tag LOCUS_27680 37513 36398 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_27680 39002 37518 gene locus_tag LOCUS_27690 gene gatB 39002 37518 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_27690 41601 39070 gene locus_tag LOCUS_27700 gene alaS 41601 39070 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0M6 protein_id gnl|my_center|LOCUS_27700 41862 42839 gene locus_tag LOCUS_27710 41862 42839 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_27710 43002 43355 gene locus_tag LOCUS_27720 43002 43355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_27720 43336 44466 gene locus_tag LOCUS_27730 gene smf 43336 44466 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_27730 44626 45195 gene locus_tag LOCUS_27740 44626 45195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 46646 45246 gene locus_tag LOCUS_27750 46646 45246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 47187 46624 gene locus_tag LOCUS_27760 gene pfpI 47187 46624 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_27760 48757 47633 gene locus_tag LOCUS_27770 gene dnaN 48757 47633 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_27770 50671 48992 gene locus_tag LOCUS_27780 50671 48992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 51386 50664 gene locus_tag LOCUS_27790 gene gldF 51386 50664 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_27790 52299 51391 gene locus_tag LOCUS_27800 gene gldA 52299 51391 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_27800 53819 52620 gene locus_tag LOCUS_27810 gene pgk 53819 52620 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_27810 54820 53858 gene locus_tag LOCUS_27820 54820 53858 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_27820 55533 54820 gene locus_tag LOCUS_27830 55533 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056811.1 protein_id gnl|my_center|LOCUS_27830 56167 55616 gene locus_tag LOCUS_27840 56167 55616 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_27840 56758 56171 gene locus_tag LOCUS_27850 56758 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 58677 56755 gene locus_tag LOCUS_27860 58677 56755 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_27860 60718 58757 gene locus_tag LOCUS_27870 60718 58757 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_27870 61659 61099 gene locus_tag LOCUS_27880 61659 61099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 62140 61697 gene locus_tag LOCUS_27890 gene yjcF 62140 61697 CDS product putative N-acetyltransferase YjcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31628 protein_id gnl|my_center|LOCUS_27890 63099 62137 gene locus_tag LOCUS_27900 63099 62137 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_27900 63200 63970 gene locus_tag LOCUS_27910 gene fjo14 63200 63970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_27910 64137 64219 gene locus_tag LOCUS_t00190 64137 64219 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64461 64231 gene locus_tag LOCUS_27920 64461 64231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 64701 66173 gene locus_tag LOCUS_27930 64701 66173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 66441 66274 gene locus_tag LOCUS_27940 66441 66274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 66454 67215 gene locus_tag LOCUS_27950 66454 67215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_27950 68583 67654 gene locus_tag LOCUS_27960 68583 67654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 68937 68641 gene locus_tag LOCUS_27970 68937 68641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 69980 69033 gene locus_tag LOCUS_27980 69980 69033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 70448 70002 gene locus_tag LOCUS_27990 70448 70002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 72710 71193 gene locus_tag LOCUS_28000 72710 71193 CDS product SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_28000 74339 72714 gene locus_tag LOCUS_28010 74339 72714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 75532 74336 gene locus_tag LOCUS_28020 gene hsdS 75532 74336 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476039.1 protein_id gnl|my_center|LOCUS_28020 75957 75532 gene locus_tag LOCUS_28030 75957 75532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 76634 75954 gene locus_tag LOCUS_28040 76634 75954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 79455 76657 gene locus_tag LOCUS_28050 79455 76657 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_28050 80033 80698 gene locus_tag LOCUS_28060 80033 80698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 82183 81014 gene locus_tag LOCUS_28070 82183 81014 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_28070 83399 83818 gene locus_tag LOCUS_28080 83399 83818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 84568 83885 gene locus_tag LOCUS_28090 84568 83885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 85707 84748 gene locus_tag LOCUS_28100 85707 84748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 86586 85711 gene locus_tag LOCUS_28110 86586 85711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 87554 88504 gene locus_tag LOCUS_28120 87554 88504 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_28120 91251 88603 gene locus_tag LOCUS_28130 91251 88603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 92066 91374 gene locus_tag LOCUS_28140 gene cysH 92066 91374 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B1 protein_id gnl|my_center|LOCUS_28140 93345 92185 gene locus_tag LOCUS_28150 93345 92185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_28150 93842 94381 gene locus_tag LOCUS_28160 93842 94381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 94387 95325 gene locus_tag LOCUS_28170 94387 95325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 96473 95271 gene locus_tag LOCUS_28180 96473 95271 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_28180 96896 97783 gene locus_tag LOCUS_28190 96896 97783 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_28190 99144 98026 gene locus_tag LOCUS_28200 99144 98026 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700645.1 protein_id gnl|my_center|LOCUS_28200 101953 100277 gene locus_tag LOCUS_28210 101953 100277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 102434 101970 gene locus_tag LOCUS_28220 102434 101970 CDS product beta-1,4-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022157.1 protein_id gnl|my_center|LOCUS_28220 102922 102431 gene locus_tag LOCUS_28230 102922 102431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 103788 102922 gene locus_tag LOCUS_28240 gene ycbI 103788 102922 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_28240 104407 103790 gene locus_tag LOCUS_28250 104407 103790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 105944 104988 gene locus_tag LOCUS_28260 105944 104988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 107067 105937 gene locus_tag LOCUS_28270 107067 105937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 107984 107079 gene locus_tag LOCUS_28280 107984 107079 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902760.1 protein_id gnl|my_center|LOCUS_28280 110787 108166 gene locus_tag LOCUS_28290 110787 108166 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_28290 112426 111281 gene locus_tag LOCUS_28300 gene gmd 112426 111281 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_28300 113417 112464 gene locus_tag LOCUS_28310 gene wcaG 113417 112464 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_28310 114417 113422 gene locus_tag LOCUS_28320 114417 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 114802 115305 gene locus_tag LOCUS_28330 114802 115305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 115428 117215 gene locus_tag LOCUS_28340 115428 117215 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_28340 117603 117205 gene locus_tag LOCUS_28350 117603 117205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_28350 117795 118139 gene locus_tag LOCUS_28360 117795 118139 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_28360 118474 118770 gene locus_tag LOCUS_28370 118474 118770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 119353 118811 gene locus_tag LOCUS_28380 gene hslV 119353 118811 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGY8 protein_id gnl|my_center|LOCUS_28380 121096 119444 gene locus_tag LOCUS_28390 gene pdhC 121096 119444 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_28390 121219 122187 gene locus_tag LOCUS_28400 121219 122187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_28400 122239 122904 gene locus_tag LOCUS_28410 122239 122904 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_28410 122904 123806 gene locus_tag LOCUS_28420 122904 123806 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_28420 124644 125606 gene locus_tag LOCUS_28430 124644 125606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 126525 127832 gene locus_tag LOCUS_28440 gene rfbB 126525 127832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_28440 127862 128842 gene locus_tag LOCUS_28450 127862 128842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 128896 130503 gene locus_tag LOCUS_28460 128896 130503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 130503 131525 gene locus_tag LOCUS_28470 130503 131525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 132810 131551 gene locus_tag LOCUS_28480 132810 131551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 133671 132877 gene locus_tag LOCUS_28490 133671 132877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence17 456 668 gene locus_tag LOCUS_28500 456 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1456 800 gene locus_tag LOCUS_28510 gene sirR 1456 800 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_28510 1570 2730 gene locus_tag LOCUS_28520 1570 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_28520 2732 3160 gene locus_tag LOCUS_28530 2732 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962255.1 protein_id gnl|my_center|LOCUS_28530 3135 4352 gene locus_tag LOCUS_28540 3135 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_28540 5205 9527 gene locus_tag LOCUS_28550 5205 9527 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_28550 9527 10810 gene locus_tag LOCUS_28560 9527 10810 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_28560 10898 11275 gene locus_tag LOCUS_28570 10898 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 11346 11687 gene locus_tag LOCUS_28580 11346 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 12366 13133 gene locus_tag LOCUS_28590 12366 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 13136 13672 gene locus_tag LOCUS_28600 13136 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 13669 14088 gene locus_tag LOCUS_28610 13669 14088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_28610 14100 14990 gene locus_tag LOCUS_28620 14100 14990 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_28620 15006 15434 gene locus_tag LOCUS_28630 15006 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 15431 17944 gene locus_tag LOCUS_28640 15431 17944 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_28640 17969 18424 gene locus_tag LOCUS_28650 17969 18424 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_28650 18435 19199 gene locus_tag LOCUS_28660 18435 19199 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_28660 19207 20523 gene locus_tag LOCUS_28670 19207 20523 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066482.1 protein_id gnl|my_center|LOCUS_28670 20536 20892 gene locus_tag LOCUS_28680 20536 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 20877 22220 gene locus_tag LOCUS_28690 gene nhaA 20877 22220 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_28690 22857 23306 gene locus_tag LOCUS_28700 22857 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 23383 24567 gene locus_tag LOCUS_28710 23383 24567 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_28710 24587 24808 gene locus_tag LOCUS_28720 24587 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 24830 26341 gene locus_tag LOCUS_28730 24830 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 26354 29443 gene locus_tag LOCUS_28740 26354 29443 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_28740 29825 30172 gene locus_tag LOCUS_28750 29825 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28750 30534 30911 gene locus_tag LOCUS_28760 30534 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 30915 32363 gene locus_tag LOCUS_28770 30915 32363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 33080 33418 gene locus_tag LOCUS_28780 33080 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 33549 33929 gene locus_tag LOCUS_28790 33549 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 33929 35431 gene locus_tag LOCUS_28800 33929 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 35438 36088 gene locus_tag LOCUS_28810 35438 36088 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199137.1 protein_id gnl|my_center|LOCUS_28810 36067 36417 gene locus_tag LOCUS_28820 36067 36417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 36419 36763 gene locus_tag LOCUS_28830 36419 36763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 36789 37085 gene locus_tag LOCUS_28840 36789 37085 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107106.1 protein_id gnl|my_center|LOCUS_28840 37140 37445 gene locus_tag LOCUS_28850 37140 37445 CDS product plasmid transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199140.1 protein_id gnl|my_center|LOCUS_28850 37445 37720 gene locus_tag LOCUS_28860 37445 37720 CDS product DUF4133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199141.1 protein_id gnl|my_center|LOCUS_28860 37728 40226 gene locus_tag LOCUS_28870 37728 40226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 40238 40897 gene locus_tag LOCUS_28880 40238 40897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 40901 41548 gene locus_tag LOCUS_28890 40901 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 41545 42204 gene locus_tag LOCUS_28900 41545 42204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 42201 43001 gene locus_tag LOCUS_28910 42201 43001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 42998 44170 gene locus_tag LOCUS_28920 42998 44170 CDS product plasmid transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199145.1 protein_id gnl|my_center|LOCUS_28920 44182 44793 gene locus_tag LOCUS_28930 44182 44793 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199146.1 protein_id gnl|my_center|LOCUS_28930 44993 45211 gene locus_tag LOCUS_28940 44993 45211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 45279 46397 gene locus_tag LOCUS_28950 45279 46397 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777361.1 protein_id gnl|my_center|LOCUS_28950 46411 47253 gene locus_tag LOCUS_28960 46411 47253 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199149.1 protein_id gnl|my_center|LOCUS_28960 47507 48103 gene locus_tag LOCUS_28970 47507 48103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28970 48192 49490 gene locus_tag LOCUS_28980 48192 49490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28980 49521 49700 gene locus_tag LOCUS_28990 49521 49700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 49690 50697 gene locus_tag LOCUS_29000 49690 50697 CDS product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_29000 50694 51608 gene locus_tag LOCUS_29010 50694 51608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 51583 52233 gene locus_tag LOCUS_29020 51583 52233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 52349 52840 gene locus_tag LOCUS_29030 52349 52840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 53268 53420 gene locus_tag LOCUS_29040 53268 53420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 54285 53482 gene locus_tag LOCUS_29050 54285 53482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 54464 54820 gene locus_tag LOCUS_29060 54464 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403846.1 protein_id gnl|my_center|LOCUS_29060 55151 55804 gene locus_tag LOCUS_29070 55151 55804 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_29070 56447 56677 gene locus_tag LOCUS_29080 56447 56677 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_29080 59322 56884 gene locus_tag LOCUS_29090 59322 56884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29090 59859 59374 gene locus_tag LOCUS_29100 59859 59374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29100 61036 61446 gene locus_tag LOCUS_29110 61036 61446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 61424 61867 gene locus_tag LOCUS_29120 61424 61867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 61870 62337 gene locus_tag LOCUS_29130 61870 62337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 62895 64463 gene locus_tag LOCUS_29140 gene hsdM 62895 64463 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_29140 64473 65690 gene locus_tag LOCUS_29150 gene hsdS 64473 65690 CDS product HsdS specificity protein of type I restriction-modification system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068836.1 protein_id gnl|my_center|LOCUS_29150 65870 67063 gene locus_tag LOCUS_29160 65870 67063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 67076 69940 gene locus_tag LOCUS_29170 gene hsdR 67076 69940 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_29170 70386 71849 gene locus_tag LOCUS_29180 70386 71849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 72824 71961 gene locus_tag LOCUS_29190 72824 71961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 73706 72837 gene locus_tag LOCUS_29200 73706 72837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 73980 73753 gene locus_tag LOCUS_29210 73980 73753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_29210 74225 75280 gene locus_tag LOCUS_29220 74225 75280 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_29220 75280 75786 gene locus_tag LOCUS_29230 75280 75786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 76355 76978 gene locus_tag LOCUS_29240 gene yoqW 76355 76978 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_29240 77139 76945 gene locus_tag LOCUS_29250 77139 76945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 77414 77671 gene locus_tag LOCUS_29260 77414 77671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 78478 77771 gene locus_tag LOCUS_29270 78478 77771 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_29270 79473 78475 gene locus_tag LOCUS_29280 79473 78475 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_29280 79789 80874 gene locus_tag LOCUS_29290 79789 80874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211257.1 protein_id gnl|my_center|LOCUS_29290 80910 81359 gene locus_tag LOCUS_29300 80910 81359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 81425 81871 gene locus_tag LOCUS_29310 81425 81871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 81885 82493 gene locus_tag LOCUS_29320 81885 82493 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_29320 82543 82983 gene locus_tag LOCUS_29330 82543 82983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 83044 83895 gene locus_tag LOCUS_29340 83044 83895 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347746.1 protein_id gnl|my_center|LOCUS_29340 84270 85535 gene locus_tag LOCUS_29350 84270 85535 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_29350 85595 87502 gene locus_tag LOCUS_29360 85595 87502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 87675 88142 gene locus_tag LOCUS_29370 87675 88142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 88215 89324 gene locus_tag LOCUS_29380 88215 89324 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202725.1 protein_id gnl|my_center|LOCUS_29380 89543 91783 gene locus_tag LOCUS_29390 89543 91783 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_29390 91899 92357 gene locus_tag LOCUS_29400 91899 92357 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_29400 92369 94639 gene locus_tag LOCUS_29410 92369 94639 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_29410 94879 95046 gene locus_tag LOCUS_29420 94879 95046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 95322 95137 gene locus_tag LOCUS_29430 95322 95137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 96435 95560 gene locus_tag LOCUS_29440 96435 95560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 97775 96453 gene locus_tag LOCUS_29450 97775 96453 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_29450 98450 98734 gene locus_tag LOCUS_29460 98450 98734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 98768 99046 gene locus_tag LOCUS_29470 98768 99046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 99171 99386 gene locus_tag LOCUS_29480 99171 99386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 99906 99496 gene locus_tag LOCUS_29490 99906 99496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 100351 100887 gene locus_tag LOCUS_29500 100351 100887 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_29500 102136 101273 gene locus_tag LOCUS_29510 102136 101273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 104833 102617 gene locus_tag LOCUS_29520 104833 102617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 106340 108643 gene locus_tag LOCUS_29530 106340 108643 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_29530 108853 109113 gene locus_tag LOCUS_29540 108853 109113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 109360 109593 gene locus_tag LOCUS_29550 109360 109593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 110666 110914 gene locus_tag LOCUS_29560 110666 110914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29560 111794 114505 gene locus_tag LOCUS_29570 111794 114505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 114778 115521 gene locus_tag LOCUS_29580 114778 115521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 115798 115995 gene locus_tag LOCUS_29590 115798 115995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 117618 116593 gene locus_tag LOCUS_29600 117618 116593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 117777 118646 gene locus_tag LOCUS_29610 117777 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 119383 118679 gene locus_tag LOCUS_29620 119383 118679 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_29620 120423 119380 gene locus_tag LOCUS_29630 120423 119380 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_29630 120669 121118 gene locus_tag LOCUS_29640 120669 121118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 121136 121582 gene locus_tag LOCUS_29650 121136 121582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 121667 122248 gene locus_tag LOCUS_29660 121667 122248 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068495.1 protein_id gnl|my_center|LOCUS_29660 122319 124559 gene locus_tag LOCUS_29670 122319 124559 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_29670 124667 125125 gene locus_tag LOCUS_29680 124667 125125 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_29680 125138 127408 gene locus_tag LOCUS_29690 125138 127408 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_29690 128623 127490 gene locus_tag LOCUS_29700 128623 127490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 129753 128620 gene locus_tag LOCUS_29710 129753 128620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 131443 130286 gene locus_tag LOCUS_29720 131443 130286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence18 310 1038 gene locus_tag LOCUS_29730 310 1038 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104022.1 protein_id gnl|my_center|LOCUS_29730 1671 3188 gene locus_tag LOCUS_29740 1671 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3342 3740 gene locus_tag LOCUS_29750 3342 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4463 3807 gene locus_tag LOCUS_29760 4463 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 4766 6217 gene locus_tag LOCUS_29770 4766 6217 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_29770 7400 6303 gene locus_tag LOCUS_29780 gene phnW 7400 6303 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLY7 protein_id gnl|my_center|LOCUS_29780 8491 7559 gene locus_tag LOCUS_29790 8491 7559 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_29790 9678 8488 gene locus_tag LOCUS_29800 9678 8488 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_29800 10293 9790 gene locus_tag LOCUS_29810 10293 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_29810 12036 10417 gene locus_tag LOCUS_29820 12036 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 13262 12042 gene locus_tag LOCUS_29830 13262 12042 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_29830 14546 13275 gene locus_tag LOCUS_29840 14546 13275 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_29840 14748 16031 gene locus_tag LOCUS_29850 14748 16031 CDS product metal ion (Mn2+/Fe2+) transporter (Nramp) family metal ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788100.1 protein_id gnl|my_center|LOCUS_29850 18043 16436 gene locus_tag LOCUS_29860 18043 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 18762 21830 gene locus_tag LOCUS_29870 18762 21830 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_29870 21842 23464 gene locus_tag LOCUS_29880 21842 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766966.1 protein_id gnl|my_center|LOCUS_29880 23548 26847 gene locus_tag LOCUS_29890 23548 26847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 28030 27071 gene locus_tag LOCUS_29900 28030 27071 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_29900 29227 28157 gene locus_tag LOCUS_29910 29227 28157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 29746 29279 gene locus_tag LOCUS_29920 29746 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 30426 31262 gene locus_tag LOCUS_29930 30426 31262 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085021.1 protein_id gnl|my_center|LOCUS_29930 31294 33534 gene locus_tag LOCUS_29940 31294 33534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 33709 34749 gene locus_tag LOCUS_29950 33709 34749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 35892 34762 gene locus_tag LOCUS_29960 35892 34762 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_29960 36505 35894 gene locus_tag LOCUS_29970 36505 35894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208541.1 protein_id gnl|my_center|LOCUS_29970 37223 36612 gene locus_tag LOCUS_29980 gene nqrE 37223 36612 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6X2 protein_id gnl|my_center|LOCUS_29980 37920 37237 gene locus_tag LOCUS_29990 gene nqrD 37920 37237 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_29990 38715 37948 gene locus_tag LOCUS_30000 gene nqrC 38715 37948 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_30000 39904 38702 gene locus_tag LOCUS_30010 gene nqrB 39904 38702 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_30010 41271 39910 gene locus_tag LOCUS_30020 gene nqrA 41271 39910 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_30020 42306 41404 gene locus_tag LOCUS_30030 gene ispH 42306 41404 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_30030 42988 42311 gene locus_tag LOCUS_30040 gene cmk 42988 42311 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 protein_id gnl|my_center|LOCUS_30040 43148 44782 gene locus_tag LOCUS_30050 gene ade 43148 44782 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_30050 44809 46131 gene locus_tag LOCUS_30060 44809 46131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 46954 46202 gene locus_tag LOCUS_30070 46954 46202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 47888 47307 gene locus_tag LOCUS_30080 47888 47307 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_30080 49318 47987 gene locus_tag LOCUS_30090 gene gltP 49318 47987 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_30090 50408 49332 gene locus_tag LOCUS_30100 gene aroC 50408 49332 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_30100 51857 50412 gene locus_tag LOCUS_30110 51857 50412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 51997 52188 gene locus_tag LOCUS_30120 51997 52188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 52325 52636 gene locus_tag LOCUS_30130 52325 52636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 54055 52865 gene locus_tag LOCUS_30140 54055 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 54573 56459 gene locus_tag LOCUS_30150 54573 56459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_30150 57362 56502 gene locus_tag LOCUS_30160 gene udp 57362 56502 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_30160 58329 57343 gene locus_tag LOCUS_30170 58329 57343 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTV8 protein_id gnl|my_center|LOCUS_30170 59021 58383 gene locus_tag LOCUS_30180 59021 58383 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_30180 60379 59075 gene locus_tag LOCUS_30190 60379 59075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_30190 61270 60452 gene locus_tag LOCUS_30200 gene pyrF 61270 60452 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_30200 61973 61317 gene locus_tag LOCUS_30210 61973 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 64496 61992 gene locus_tag LOCUS_30220 gene ftsK 64496 61992 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_30220 65454 64561 gene locus_tag LOCUS_30230 gene pyrD 65454 64561 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_30230 66549 65917 gene locus_tag LOCUS_30240 gene arsC 66549 65917 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_30240 67043 66711 gene locus_tag LOCUS_30250 67043 66711 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_30250 68640 67318 gene locus_tag LOCUS_30260 68640 67318 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_30260 69279 70709 gene locus_tag LOCUS_30270 69279 70709 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_30270 71380 72594 gene locus_tag LOCUS_30280 71380 72594 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YH8 protein_id gnl|my_center|LOCUS_30280 72594 74915 gene locus_tag LOCUS_30290 72594 74915 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_30290 74915 75838 gene locus_tag LOCUS_30300 74915 75838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 77255 77581 gene locus_tag LOCUS_30310 77255 77581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 77585 78031 gene locus_tag LOCUS_30320 77585 78031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 78218 78448 gene locus_tag LOCUS_30330 78218 78448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 78438 78785 gene locus_tag LOCUS_30340 78438 78785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 78904 80013 gene locus_tag LOCUS_30350 78904 80013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 80578 80039 gene locus_tag LOCUS_30360 80578 80039 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697198.1 protein_id gnl|my_center|LOCUS_30360 82161 81133 gene locus_tag LOCUS_30370 82161 81133 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_30370 82457 82873 gene locus_tag LOCUS_30380 82457 82873 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_30380 84438 82972 gene locus_tag LOCUS_30390 84438 82972 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_30390 85032 84796 gene locus_tag LOCUS_30400 85032 84796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 86467 85169 gene locus_tag LOCUS_30410 86467 85169 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_30410 86896 87789 gene locus_tag LOCUS_30420 86896 87789 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_30420 87886 90441 gene locus_tag LOCUS_30430 87886 90441 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_30430 90589 91095 gene locus_tag LOCUS_30440 90589 91095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 91415 91110 gene locus_tag LOCUS_30450 91415 91110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_30450 91783 92214 gene locus_tag LOCUS_30460 91783 92214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 92267 92713 gene locus_tag LOCUS_30470 gene crtZ 92267 92713 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_30470 92710 93600 gene locus_tag LOCUS_30480 92710 93600 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_30480 94247 96004 gene locus_tag LOCUS_30490 94247 96004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 96040 96792 gene locus_tag LOCUS_30500 96040 96792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 96804 98051 gene locus_tag LOCUS_30510 96804 98051 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_30510 98107 98634 gene locus_tag LOCUS_30520 98107 98634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_30520 98688 99911 gene locus_tag LOCUS_30530 gene selA 98688 99911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_30530 99915 101156 gene locus_tag LOCUS_30540 99915 101156 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_30540 101553 102707 gene locus_tag LOCUS_30550 101553 102707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 103278 102958 gene locus_tag LOCUS_30560 103278 102958 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_30560 107652 103366 gene locus_tag LOCUS_30570 gene dnaE 107652 103366 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_30570 109785 108007 gene locus_tag LOCUS_30580 109785 108007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 109953 110195 gene locus_tag LOCUS_30590 109953 110195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 110336 113689 gene locus_tag LOCUS_30600 110336 113689 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_30600 113710 115395 gene locus_tag LOCUS_30610 113710 115395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 115888 115703 gene locus_tag LOCUS_30620 115888 115703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 117449 116151 gene locus_tag LOCUS_30630 117449 116151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 118782 117619 gene locus_tag LOCUS_30640 118782 117619 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_30640 120033 118786 gene locus_tag LOCUS_30650 120033 118786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109360.1 protein_id gnl|my_center|LOCUS_30650 120975 120127 gene locus_tag LOCUS_30660 120975 120127 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_30660 121471 122721 gene locus_tag LOCUS_30670 121471 122721 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_30670 122718 123824 gene locus_tag LOCUS_30680 122718 123824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_30680 123838 124881 gene locus_tag LOCUS_30690 123838 124881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 124878 126059 gene locus_tag LOCUS_30700 124878 126059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence19 920 258 gene locus_tag LOCUS_30710 920 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1268 924 gene locus_tag LOCUS_30720 1268 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1993 1448 gene locus_tag LOCUS_30730 1993 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3476 2364 gene locus_tag LOCUS_30740 3476 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_30740 4156 3494 gene locus_tag LOCUS_30750 4156 3494 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_30750 5741 4182 gene locus_tag LOCUS_30760 5741 4182 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_30760 6116 5754 gene locus_tag LOCUS_30770 6116 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 7054 6377 gene locus_tag LOCUS_30780 gene kdpE 7054 6377 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035945.1 protein_id gnl|my_center|LOCUS_30780 7844 7047 gene locus_tag LOCUS_30790 7844 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 7798 8019 gene locus_tag LOCUS_30800 7798 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 10290 8416 gene locus_tag LOCUS_30810 10290 8416 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_30810 10879 12087 gene locus_tag LOCUS_30820 10879 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 12209 13618 gene locus_tag LOCUS_30830 12209 13618 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_30830 13611 14567 gene locus_tag LOCUS_30840 13611 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_30840 14890 16110 gene locus_tag LOCUS_30850 14890 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 19051 17135 gene locus_tag LOCUS_30860 19051 17135 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_30860 19387 20109 gene locus_tag LOCUS_30870 19387 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 20110 21162 gene locus_tag LOCUS_30880 20110 21162 CDS product AIR synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_30880 21159 21800 gene locus_tag LOCUS_30890 gene thiE 21159 21800 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RI59 protein_id gnl|my_center|LOCUS_30890 21803 22087 gene locus_tag LOCUS_30900 21803 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 22667 24622 gene locus_tag LOCUS_30910 22667 24622 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_30910 26516 25149 gene locus_tag LOCUS_30920 26516 25149 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_30920 27787 26714 gene locus_tag LOCUS_30930 gene speB 27787 26714 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_30930 28307 27831 gene locus_tag LOCUS_30940 28307 27831 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_30940 28477 30828 gene locus_tag LOCUS_30950 gene topA 28477 30828 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_30950 31808 31548 gene locus_tag LOCUS_30960 31808 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_30960 32034 31801 gene locus_tag LOCUS_30970 32034 31801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 32204 33469 gene locus_tag LOCUS_30980 32204 33469 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_30980 33498 36905 gene locus_tag LOCUS_30990 33498 36905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 37421 38536 gene locus_tag LOCUS_31000 37421 38536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 38543 40513 gene locus_tag LOCUS_31010 38543 40513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 40527 41225 gene locus_tag LOCUS_31020 gene cobB 40527 41225 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H9 protein_id gnl|my_center|LOCUS_31020 41246 41896 gene locus_tag LOCUS_31030 41246 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 42866 42069 gene locus_tag LOCUS_31040 42866 42069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 44056 43037 gene locus_tag LOCUS_31050 44056 43037 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_31050 45463 44096 gene locus_tag LOCUS_31060 45463 44096 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_31060 45630 46172 gene locus_tag LOCUS_31070 45630 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 46176 46751 gene locus_tag LOCUS_31080 gene maa 46176 46751 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536391.1 protein_id gnl|my_center|LOCUS_31080 48430 46748 gene locus_tag LOCUS_31090 gene fadD 48430 46748 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_707317.1 protein_id gnl|my_center|LOCUS_31090 48633 49247 gene locus_tag LOCUS_31100 48633 49247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_31100 50429 49497 gene locus_tag LOCUS_31110 50429 49497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 52780 50429 gene locus_tag LOCUS_31120 52780 50429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_31120 55322 53547 gene locus_tag LOCUS_31130 gene sglT 55322 53547 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_31130 57236 55395 gene locus_tag LOCUS_31140 gene atsG 57236 55395 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_31140 59469 57484 gene locus_tag LOCUS_31150 59469 57484 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_31150 60944 59592 gene locus_tag LOCUS_31160 60944 59592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_31160 62550 60994 gene locus_tag LOCUS_31170 62550 60994 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_31170 62720 64156 gene locus_tag LOCUS_31180 gene GALNS 62720 64156 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_31180 64325 65473 gene locus_tag LOCUS_31190 64325 65473 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_31190 67387 66098 gene locus_tag LOCUS_31200 67387 66098 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_31200 68463 68708 gene locus_tag LOCUS_31210 68463 68708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 69688 68822 gene locus_tag LOCUS_31220 69688 68822 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_31220 70177 71763 gene locus_tag LOCUS_31230 70177 71763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_31230 71861 74818 gene locus_tag LOCUS_31240 71861 74818 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_31240 75842 74829 gene locus_tag LOCUS_31250 75842 74829 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_31250 76480 75836 gene locus_tag LOCUS_31260 76480 75836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 76870 78105 gene locus_tag LOCUS_31270 76870 78105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 78244 79815 gene locus_tag LOCUS_31280 78244 79815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_31280 79934 80644 gene locus_tag LOCUS_31290 79934 80644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 80968 81156 gene locus_tag LOCUS_31300 80968 81156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 81347 84433 gene locus_tag LOCUS_31310 81347 84433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 84435 85601 gene locus_tag LOCUS_31320 84435 85601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 87202 85607 gene locus_tag LOCUS_31330 87202 85607 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_31330 88792 87380 gene locus_tag LOCUS_31340 88792 87380 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_31340 88981 90066 gene locus_tag LOCUS_31350 88981 90066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 90095 90967 gene locus_tag LOCUS_31360 90095 90967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_31360 92713 91295 gene locus_tag LOCUS_31370 92713 91295 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_31370 94326 92851 gene locus_tag LOCUS_31380 gene arsA 94326 92851 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_31380 94897 94460 gene locus_tag LOCUS_31390 94897 94460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_31390 96422 95466 gene locus_tag LOCUS_31400 96422 95466 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_31400 97411 96455 gene locus_tag LOCUS_31410 97411 96455 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_31410 98996 97539 gene locus_tag LOCUS_31420 98996 97539 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_31420 101408 99000 gene locus_tag LOCUS_31430 101408 99000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_31430 101669 101863 gene locus_tag LOCUS_31440 101669 101863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 102250 102603 gene locus_tag LOCUS_31450 102250 102603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 103033 103536 gene locus_tag LOCUS_31460 103033 103536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 104080 104589 gene locus_tag LOCUS_31470 104080 104589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 104797 106458 gene locus_tag LOCUS_31480 gene araB 104797 106458 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FK5 protein_id gnl|my_center|LOCUS_31480 106827 107408 gene locus_tag LOCUS_31490 106827 107408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 107551 108876 gene locus_tag LOCUS_31500 gene dbpA 107551 108876 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_31500 109736 108906 gene locus_tag LOCUS_31510 109736 108906 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_31510 110009 112021 gene locus_tag LOCUS_31520 110009 112021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_31520 112723 113571 gene locus_tag LOCUS_31530 112723 113571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 114217 113702 gene locus_tag LOCUS_31540 114217 113702 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_31540 114320 115120 gene locus_tag LOCUS_31550 gene uspA 114320 115120 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_31550 115124 116101 gene locus_tag LOCUS_31560 115124 116101 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_31560 116145 117515 gene locus_tag LOCUS_31570 116145 117515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 118409 117558 gene locus_tag LOCUS_31580 118409 117558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 118566 119327 gene locus_tag LOCUS_31590 118566 119327 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_31590 119342 121012 gene locus_tag LOCUS_31600 119342 121012 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_31600 121083 121883 gene locus_tag LOCUS_31610 gene proC 121083 121883 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_31610 121912 122916 gene locus_tag LOCUS_31620 121912 122916 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence20 189 2468 gene locus_tag LOCUS_31630 189 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2572 2898 gene locus_tag LOCUS_31640 2572 2898 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_31640 2929 3327 gene locus_tag LOCUS_31650 2929 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_31650 4106 3381 gene locus_tag LOCUS_31660 4106 3381 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_31660 4901 5302 gene locus_tag LOCUS_31670 4901 5302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_31670 5304 7718 gene locus_tag LOCUS_31680 5304 7718 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_31680 7735 8271 gene locus_tag LOCUS_31690 7735 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107766.1 protein_id gnl|my_center|LOCUS_31690 8911 9798 gene locus_tag LOCUS_31700 8911 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 9977 13285 gene locus_tag LOCUS_31710 9977 13285 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_31710 13300 15000 gene locus_tag LOCUS_31720 13300 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_31720 16109 15198 gene locus_tag LOCUS_31730 16109 15198 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31730 16623 16111 gene locus_tag LOCUS_31740 16623 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 17199 17534 gene locus_tag LOCUS_31750 17199 17534 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_31750 17656 18435 gene locus_tag LOCUS_31760 gene arsC 17656 18435 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_31760 18441 19787 gene locus_tag LOCUS_31770 18441 19787 CDS product peptide permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501964.1 protein_id gnl|my_center|LOCUS_31770 19930 20985 gene locus_tag LOCUS_31780 19930 20985 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_31780 20982 21710 gene locus_tag LOCUS_31790 20982 21710 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_31790 23227 21725 gene locus_tag LOCUS_31800 23227 21725 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_31800 23455 25263 gene locus_tag LOCUS_31810 23455 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 25392 26375 gene locus_tag LOCUS_31820 25392 26375 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_31820 26500 27348 gene locus_tag LOCUS_31830 26500 27348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 27748 28206 gene locus_tag LOCUS_31840 27748 28206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 28888 29658 gene locus_tag LOCUS_31850 28888 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 29729 30814 gene locus_tag LOCUS_31860 29729 30814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 30865 31293 gene locus_tag LOCUS_31870 30865 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_31870 31499 32071 gene locus_tag LOCUS_31880 31499 32071 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_31880 32077 33078 gene locus_tag LOCUS_31890 gene yfmJ 32077 33078 CDS product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 protein_id gnl|my_center|LOCUS_31890 33857 33576 gene locus_tag LOCUS_31900 33857 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 34497 35102 gene locus_tag LOCUS_31910 34497 35102 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143815.1 protein_id gnl|my_center|LOCUS_31910 35176 35910 gene locus_tag LOCUS_31920 35176 35910 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123286.1 protein_id gnl|my_center|LOCUS_31920 35928 36731 gene locus_tag LOCUS_31930 35928 36731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 38314 36938 gene locus_tag LOCUS_31940 38314 36938 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 protein_id gnl|my_center|LOCUS_31940 41045 38742 gene locus_tag LOCUS_31950 41045 38742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 42527 41079 gene locus_tag LOCUS_31960 42527 41079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_31960 43292 42540 gene locus_tag LOCUS_31970 gene rhgT 43292 42540 CDS product rhamnogalacturonan acetylesterase RhgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31523 protein_id gnl|my_center|LOCUS_31970 45166 43454 gene locus_tag LOCUS_31980 45166 43454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_31980 48759 45193 gene locus_tag LOCUS_31990 48759 45193 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761957.1 protein_id gnl|my_center|LOCUS_31990 49952 48876 gene locus_tag LOCUS_32000 49952 48876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 50665 50069 gene locus_tag LOCUS_32010 50665 50069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 52043 50988 gene locus_tag LOCUS_32020 52043 50988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 53097 52279 gene locus_tag LOCUS_32030 53097 52279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 53823 53122 gene locus_tag LOCUS_32040 53823 53122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 55679 54114 gene locus_tag LOCUS_32050 55679 54114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 56350 55715 gene locus_tag LOCUS_32060 56350 55715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_32060 57202 56570 gene locus_tag LOCUS_32070 57202 56570 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_32070 57677 57213 gene locus_tag LOCUS_32080 57677 57213 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_32080 58102 57674 gene locus_tag LOCUS_32090 58102 57674 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_32090 58892 58218 gene locus_tag LOCUS_32100 58892 58218 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_32100 59487 58885 gene locus_tag LOCUS_32110 59487 58885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 60289 59474 gene locus_tag LOCUS_32120 60289 59474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 60806 60327 gene locus_tag LOCUS_32130 60806 60327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 61087 60806 gene locus_tag LOCUS_32140 61087 60806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 61710 61090 gene locus_tag LOCUS_32150 61710 61090 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_32150 62800 61772 gene locus_tag LOCUS_32160 62800 61772 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533036.1 protein_id gnl|my_center|LOCUS_32160 63682 62876 gene locus_tag LOCUS_32170 63682 62876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 64583 63876 gene locus_tag LOCUS_32180 gene gufA 64583 63876 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_32180 65825 64737 gene locus_tag LOCUS_32190 65825 64737 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_32190 66625 65996 gene locus_tag LOCUS_32200 66625 65996 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_32200 66916 67299 gene locus_tag LOCUS_32210 66916 67299 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_32210 67392 67862 gene locus_tag LOCUS_32220 gene scpB 67392 67862 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_32220 67994 69037 gene locus_tag LOCUS_32230 67994 69037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 69098 69379 gene locus_tag LOCUS_32240 69098 69379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_32240 69386 70768 gene locus_tag LOCUS_32250 69386 70768 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_444230.2 protein_id gnl|my_center|LOCUS_32250 71751 71353 gene locus_tag LOCUS_32260 gene ctb 71751 71353 CDS product group 3 truncated hemoglobin ctb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB48 protein_id gnl|my_center|LOCUS_32260 72105 71758 gene locus_tag LOCUS_32270 72105 71758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454259.1 protein_id gnl|my_center|LOCUS_32270 73251 74417 gene locus_tag LOCUS_32280 73251 74417 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107629.1 protein_id gnl|my_center|LOCUS_32280 75071 75460 gene locus_tag LOCUS_32290 75071 75460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 75507 76580 gene locus_tag LOCUS_32300 75507 76580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 76607 76840 gene locus_tag LOCUS_32310 76607 76840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 76861 77343 gene locus_tag LOCUS_32320 76861 77343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 77355 77693 gene locus_tag LOCUS_32330 77355 77693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323450.1 protein_id gnl|my_center|LOCUS_32330 77707 77916 gene locus_tag LOCUS_32340 77707 77916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 77913 78524 gene locus_tag LOCUS_32350 77913 78524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 78544 78762 gene locus_tag LOCUS_32360 78544 78762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 78780 79958 gene locus_tag LOCUS_32370 78780 79958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 79955 80668 gene locus_tag LOCUS_32380 79955 80668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108425.1 protein_id gnl|my_center|LOCUS_32380 80668 81474 gene locus_tag LOCUS_32390 80668 81474 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_32390 82154 81705 gene locus_tag LOCUS_32400 82154 81705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 82429 82151 gene locus_tag LOCUS_32410 82429 82151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 82996 82703 gene locus_tag LOCUS_32420 82996 82703 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291424.1 protein_id gnl|my_center|LOCUS_32420 83288 82977 gene locus_tag LOCUS_32430 83288 82977 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295307.1 protein_id gnl|my_center|LOCUS_32430 83652 83467 gene locus_tag LOCUS_32440 83652 83467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 84433 83813 gene locus_tag LOCUS_32450 gene yrdC 84433 83813 CDS product putative isochorismatase family protein YrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07081 protein_id gnl|my_center|LOCUS_32450 84695 85249 gene locus_tag LOCUS_32460 84695 85249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 85314 86366 gene locus_tag LOCUS_32470 85314 86366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 86377 86694 gene locus_tag LOCUS_32480 86377 86694 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 protein_id gnl|my_center|LOCUS_32480 87196 86747 gene locus_tag LOCUS_32490 87196 86747 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107096.1 protein_id gnl|my_center|LOCUS_32490 87770 87210 gene locus_tag LOCUS_32500 87770 87210 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202371.1 protein_id gnl|my_center|LOCUS_32500 88687 87797 gene locus_tag LOCUS_32510 88687 87797 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107097.1 protein_id gnl|my_center|LOCUS_32510 90046 88712 gene locus_tag LOCUS_32520 90046 88712 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202373.1 protein_id gnl|my_center|LOCUS_32520 90317 90033 gene locus_tag LOCUS_32530 90317 90033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 90769 90335 gene locus_tag LOCUS_32540 90769 90335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 91404 90781 gene locus_tag LOCUS_32550 91404 90781 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_32550 92421 91426 gene locus_tag LOCUS_32560 92421 91426 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_32560 93020 92424 gene locus_tag LOCUS_32570 93020 92424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485401.1 protein_id gnl|my_center|LOCUS_32570 95582 93081 gene locus_tag LOCUS_32580 95582 93081 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_32580 96228 95923 gene locus_tag LOCUS_32590 96228 95923 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107106.1 protein_id gnl|my_center|LOCUS_32590 97731 96430 gene locus_tag LOCUS_32600 97731 96430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 98270 97764 gene locus_tag LOCUS_32610 98270 97764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 98812 98402 gene locus_tag LOCUS_32620 98812 98402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 99592 98825 gene locus_tag LOCUS_32630 99592 98825 CDS product conjugal transfer protein TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107109.1 protein_id gnl|my_center|LOCUS_32630 100276 100713 gene locus_tag LOCUS_32640 100276 100713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202380.1 protein_id gnl|my_center|LOCUS_32640 100716 102002 gene locus_tag LOCUS_32650 100716 102002 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202381.1 protein_id gnl|my_center|LOCUS_32650 102116 102982 gene locus_tag LOCUS_32660 102116 102982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 103045 103527 gene locus_tag LOCUS_32670 103045 103527 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346988.1 protein_id gnl|my_center|LOCUS_32670 103699 104622 gene locus_tag LOCUS_32680 103699 104622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105900.1 protein_id gnl|my_center|LOCUS_32680 104705 105631 gene locus_tag LOCUS_32690 104705 105631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_32690 105694 106071 gene locus_tag LOCUS_32700 105694 106071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 107023 106103 gene locus_tag LOCUS_32710 107023 106103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 107667 107089 gene locus_tag LOCUS_32720 107667 107089 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_32720 107843 107664 gene locus_tag LOCUS_32730 107843 107664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 107885 109885 gene locus_tag LOCUS_32740 107885 109885 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202382.1 protein_id gnl|my_center|LOCUS_32740 110541 111923 gene locus_tag LOCUS_32750 110541 111923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 111934 115113 gene locus_tag LOCUS_32760 111934 115113 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_32760 115183 116247 gene locus_tag LOCUS_32770 115183 116247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 116253 116819 gene locus_tag LOCUS_32780 116253 116819 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_32780 116868 117314 gene locus_tag LOCUS_32790 116868 117314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 117325 118998 gene locus_tag LOCUS_32800 117325 118998 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_32800 119027 119605 gene locus_tag LOCUS_32810 119027 119605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 119623 120246 gene locus_tag LOCUS_32820 119623 120246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 120261 120722 gene locus_tag LOCUS_32830 120261 120722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_32830 120754 122169 gene locus_tag LOCUS_32840 120754 122169 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence21 1210 185 gene locus_tag LOCUS_32850 1210 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3531 1210 gene locus_tag LOCUS_32860 3531 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5313 4042 gene locus_tag LOCUS_32870 gene purA 5313 4042 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_32870 5773 5429 gene locus_tag LOCUS_32880 gene spoIIAA 5773 5429 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GQ8 protein_id gnl|my_center|LOCUS_32880 6272 5784 gene locus_tag LOCUS_32890 6272 5784 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_32890 8550 6331 gene locus_tag LOCUS_32900 gene relA 8550 6331 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_32900 8782 8864 gene locus_tag LOCUS_t00200 8782 8864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8955 10283 gene locus_tag LOCUS_32910 gene tig 8955 10283 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_32910 10367 11038 gene locus_tag LOCUS_32920 gene clpP 10367 11038 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_32920 11046 12269 gene locus_tag LOCUS_32930 gene clpX 11046 12269 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_32930 13372 12266 gene locus_tag LOCUS_32940 gene lpxB 13372 12266 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_32940 13821 13402 gene locus_tag LOCUS_32950 13821 13402 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_32950 14541 15323 gene locus_tag LOCUS_32960 14541 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 15534 16202 gene locus_tag LOCUS_32970 15534 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 16203 16946 gene locus_tag LOCUS_32980 16203 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 20544 17098 gene locus_tag LOCUS_32990 20544 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 21610 20786 gene locus_tag LOCUS_33000 21610 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 23052 21610 gene locus_tag LOCUS_33010 23052 21610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_33010 26035 23060 gene locus_tag LOCUS_33020 26035 23060 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_33020 28057 26192 gene locus_tag LOCUS_33030 28057 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 28747 28118 gene locus_tag LOCUS_33040 gene queE 28747 28118 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_33040 29701 28802 gene locus_tag LOCUS_33050 gene folD 29701 28802 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_33050 31580 29787 gene locus_tag LOCUS_33060 gene lepA 31580 29787 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_33060 31719 32318 gene locus_tag LOCUS_33070 31719 32318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 32330 32869 gene locus_tag LOCUS_33080 32330 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 34804 32879 gene locus_tag LOCUS_33090 34804 32879 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_33090 34815 35486 gene locus_tag LOCUS_33100 34815 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 35506 35922 gene locus_tag LOCUS_33110 35506 35922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 37142 36090 gene locus_tag LOCUS_33120 37142 36090 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_33120 39041 37155 gene locus_tag LOCUS_33130 gene purF 39041 37155 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_33130 40001 39186 gene locus_tag LOCUS_33140 gene murI 40001 39186 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_33140 40347 40096 gene locus_tag LOCUS_33150 40347 40096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 40301 40675 gene locus_tag LOCUS_33160 40301 40675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 40774 42141 gene locus_tag LOCUS_33170 40774 42141 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_33170 44669 42138 gene locus_tag LOCUS_33180 44669 42138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 45668 45033 gene locus_tag LOCUS_33190 45668 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932420.1 protein_id gnl|my_center|LOCUS_33190 47071 45704 gene locus_tag LOCUS_33200 47071 45704 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_33200 48053 47130 gene locus_tag LOCUS_33210 gene pyrB 48053 47130 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_33210 48607 48056 gene locus_tag LOCUS_33220 gene pyrR1 48607 48056 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_33220 50247 48658 gene locus_tag LOCUS_33230 50247 48658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 50614 52269 gene locus_tag LOCUS_33240 50614 52269 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_33240 52266 52553 gene locus_tag LOCUS_33250 52266 52553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 52550 53215 gene locus_tag LOCUS_33260 52550 53215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 53324 54241 gene locus_tag LOCUS_33270 53324 54241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_33270 54844 54245 gene locus_tag LOCUS_33280 54844 54245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 55779 55372 gene locus_tag LOCUS_33290 55779 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 56031 55798 gene locus_tag LOCUS_33300 56031 55798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 56462 56052 gene locus_tag LOCUS_33310 56462 56052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 57143 56976 gene locus_tag LOCUS_33320 57143 56976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 57615 57412 gene locus_tag LOCUS_33330 57615 57412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 58149 57685 gene locus_tag LOCUS_33340 58149 57685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 58682 61501 gene locus_tag LOCUS_33350 gene carB 58682 61501 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_33350 61696 61950 gene locus_tag LOCUS_33360 61696 61950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 62798 62061 gene locus_tag LOCUS_33370 62798 62061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 63275 63859 gene locus_tag LOCUS_33380 63275 63859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 65567 63933 gene locus_tag LOCUS_33390 gene cstA 65567 63933 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_33390 65861 66778 gene locus_tag LOCUS_33400 65861 66778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 66882 67724 gene locus_tag LOCUS_33410 gene accD 66882 67724 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_33410 67849 69153 gene locus_tag LOCUS_33420 gene nqrF 67849 69153 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_33420 69403 70560 gene locus_tag LOCUS_33430 gene fjo29 69403 70560 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_33430 70612 70839 gene locus_tag LOCUS_33440 70612 70839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 70840 71682 gene locus_tag LOCUS_33450 70840 71682 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_33450 71679 72488 gene locus_tag LOCUS_33460 gene murQ 71679 72488 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_33460 73575 72499 gene locus_tag LOCUS_33470 73575 72499 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_33470 74546 73578 gene locus_tag LOCUS_33480 gene kdsD 74546 73578 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_33480 74645 76822 gene locus_tag LOCUS_33490 74645 76822 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_33490 76840 78135 gene locus_tag LOCUS_33500 gene purD 76840 78135 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_33500 78271 79560 gene locus_tag LOCUS_33510 gene fjo17 78271 79560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_33510 79550 80023 gene locus_tag LOCUS_33520 79550 80023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 84120 80119 gene locus_tag LOCUS_33530 84120 80119 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865167.1 protein_id gnl|my_center|LOCUS_33530 84932 84120 gene locus_tag LOCUS_33540 84932 84120 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_33540 85943 85446 gene locus_tag LOCUS_33550 85943 85446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 86505 87905 gene locus_tag LOCUS_33560 86505 87905 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_33560 87902 88279 gene locus_tag LOCUS_33570 87902 88279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 89343 88312 gene locus_tag LOCUS_33580 gene thiL 89343 88312 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_33580 89647 89973 gene locus_tag LOCUS_33590 gene sufA 89647 89973 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_33590 90428 93496 gene locus_tag LOCUS_33600 90428 93496 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_33600 93580 94881 gene locus_tag LOCUS_33610 93580 94881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_33610 95180 96271 gene locus_tag LOCUS_33620 gene gcvT 95180 96271 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_33620 96268 96972 gene locus_tag LOCUS_33630 gene comB 96268 96972 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_33630 97572 97030 gene locus_tag LOCUS_33640 97572 97030 CDS product potassium-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_33640 99476 97698 gene locus_tag LOCUS_33650 99476 97698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 99967 99509 gene locus_tag LOCUS_33660 99967 99509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_33660 101198 99969 gene locus_tag LOCUS_33670 101198 99969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 105019 101195 gene locus_tag LOCUS_33680 105019 101195 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_33680 105454 105119 gene locus_tag LOCUS_33690 105454 105119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 105955 105596 gene locus_tag LOCUS_33700 105955 105596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 106625 106020 gene locus_tag LOCUS_33710 gene hisI 106625 106020 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT3 protein_id gnl|my_center|LOCUS_33710 107436 106675 gene locus_tag LOCUS_33720 gene hisF 107436 106675 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_33720 108160 107438 gene locus_tag LOCUS_33730 gene hisA 108160 107438 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_33730 108744 108160 gene locus_tag LOCUS_33740 gene hisH 108744 108160 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_33740 110497 109601 gene locus_tag LOCUS_33750 110497 109601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 111082 110837 gene locus_tag LOCUS_33760 111082 110837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 111683 112624 gene locus_tag LOCUS_33770 111683 112624 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_33770 112783 113733 gene locus_tag LOCUS_33780 gene lolI 112783 113733 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence22 1076 918 gene locus_tag LOCUS_33790 1076 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4362 3088 gene locus_tag LOCUS_33800 4362 3088 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_33800 5791 4628 gene locus_tag LOCUS_33810 5791 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816589.1 protein_id gnl|my_center|LOCUS_33810 8384 8136 gene locus_tag LOCUS_33820 8384 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 8690 8418 gene locus_tag LOCUS_33830 8690 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33830 9208 8687 gene locus_tag LOCUS_33840 9208 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 10189 9581 gene locus_tag LOCUS_33850 10189 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 11211 10414 gene locus_tag LOCUS_33860 11211 10414 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_33860 11899 11213 gene locus_tag LOCUS_33870 gene rsmI 11899 11213 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_33870 12131 11901 gene locus_tag LOCUS_33880 12131 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 12409 12143 gene locus_tag LOCUS_33890 12409 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 14622 12508 gene locus_tag LOCUS_33900 14622 12508 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_33900 15976 14717 gene locus_tag LOCUS_33910 15976 14717 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_33910 16194 15976 gene locus_tag LOCUS_33920 16194 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 16809 16204 gene locus_tag LOCUS_33930 16809 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 18315 17053 gene locus_tag LOCUS_33940 18315 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 19664 18369 gene locus_tag LOCUS_33950 19664 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403554.1 protein_id gnl|my_center|LOCUS_33950 20253 19651 gene locus_tag LOCUS_33960 20253 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 20482 21600 gene locus_tag LOCUS_33970 20482 21600 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_33970 21597 22823 gene locus_tag LOCUS_33980 21597 22823 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_33980 23002 24525 gene locus_tag LOCUS_33990 23002 24525 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_33990 25343 24780 gene locus_tag LOCUS_34000 25343 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 26878 25349 gene locus_tag LOCUS_34010 gene gpmI 26878 25349 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_34010 27275 27529 gene locus_tag LOCUS_34020 27275 27529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 27573 28451 gene locus_tag LOCUS_34030 27573 28451 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_34030 30219 28408 gene locus_tag LOCUS_34040 30219 28408 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_34040 31931 30606 gene locus_tag LOCUS_34050 31931 30606 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_34050 32449 31973 gene locus_tag LOCUS_34060 gene ribH 32449 31973 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_34060 33248 32526 gene locus_tag LOCUS_34070 33248 32526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_34070 34935 33526 gene locus_tag LOCUS_34080 34935 33526 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_34080 35435 36544 gene locus_tag LOCUS_34090 35435 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 36685 37581 gene locus_tag LOCUS_34100 36685 37581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 38868 37999 gene locus_tag LOCUS_34110 gene atpG 38868 37999 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_34110 40491 38914 gene locus_tag LOCUS_34120 gene atpA 40491 38914 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_34120 41089 40529 gene locus_tag LOCUS_34130 gene atpH 41089 40529 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA62 protein_id gnl|my_center|LOCUS_34130 41594 41100 gene locus_tag LOCUS_34140 gene atpF 41594 41100 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_34140 41931 41674 gene locus_tag LOCUS_34150 41931 41674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 42994 41972 gene locus_tag LOCUS_34160 gene atpB 42994 41972 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_34160 43173 43406 gene locus_tag LOCUS_34170 43173 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 44064 43645 gene locus_tag LOCUS_34180 44064 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_34180 44936 44067 gene locus_tag LOCUS_34190 44936 44067 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_34190 45137 47683 gene locus_tag LOCUS_34200 gene sprE 45137 47683 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_34200 47692 50001 gene locus_tag LOCUS_34210 gene mrcA 47692 50001 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_34210 50216 52018 gene locus_tag LOCUS_34220 gene uvrC 50216 52018 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_34220 52895 52071 gene locus_tag LOCUS_34230 52895 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 54540 52939 gene locus_tag LOCUS_34240 gene gldM 54540 52939 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_34240 55359 54598 gene locus_tag LOCUS_34250 55359 54598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 56511 55471 gene locus_tag LOCUS_34260 56511 55471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 57654 56680 gene locus_tag LOCUS_34270 57654 56680 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_34270 58505 57732 gene locus_tag LOCUS_34280 58505 57732 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_34280 59634 58522 gene locus_tag LOCUS_34290 59634 58522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 61310 59634 gene locus_tag LOCUS_34300 61310 59634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404845.1 protein_id gnl|my_center|LOCUS_34300 62212 61364 gene locus_tag LOCUS_34310 62212 61364 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_34310 62512 62297 gene locus_tag LOCUS_34320 62512 62297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 62667 63698 gene locus_tag LOCUS_34330 62667 63698 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_34330 63722 64036 gene locus_tag LOCUS_34340 63722 64036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 65635 64187 gene locus_tag LOCUS_34350 gene aldH 65635 64187 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206391.1 protein_id gnl|my_center|LOCUS_34350 66921 65785 gene locus_tag LOCUS_34360 66921 65785 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_34360 67201 68097 gene locus_tag LOCUS_34370 67201 68097 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_34370 68291 69295 gene locus_tag LOCUS_34380 68291 69295 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_34380 72302 69522 gene locus_tag LOCUS_34390 72302 69522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 74608 72479 gene locus_tag LOCUS_34400 gene recQ 74608 72479 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_34400 76654 74930 gene locus_tag LOCUS_34410 76654 74930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 78711 76900 gene locus_tag LOCUS_34420 gene rho 78711 76900 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_34420 79063 80082 gene locus_tag LOCUS_34430 79063 80082 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411484.1 protein_id gnl|my_center|LOCUS_34430 80502 80098 gene locus_tag LOCUS_34440 80502 80098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 81512 80649 gene locus_tag LOCUS_34450 81512 80649 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707481.1 protein_id gnl|my_center|LOCUS_34450 82726 81698 gene locus_tag LOCUS_34460 82726 81698 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_34460 82811 84178 gene locus_tag LOCUS_34470 gene rtcB 82811 84178 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_34470 85143 84214 gene locus_tag LOCUS_34480 85143 84214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 85649 88750 gene locus_tag LOCUS_34490 85649 88750 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_34490 88778 90283 gene locus_tag LOCUS_34500 88778 90283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_34500 90615 91655 gene locus_tag LOCUS_34510 90615 91655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_34510 91684 92535 gene locus_tag LOCUS_34520 91684 92535 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_34520 92595 93419 gene locus_tag LOCUS_34530 92595 93419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 93423 94226 gene locus_tag LOCUS_34540 gene bpoC 93423 94226 CDS product putative non-heme bromoperoxidase BpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNH1 protein_id gnl|my_center|LOCUS_34540 94862 95254 gene locus_tag LOCUS_34550 94862 95254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 95385 96515 gene locus_tag LOCUS_34560 95385 96515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_34560 96686 98263 gene locus_tag LOCUS_34570 96686 98263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_34570 98520 99029 gene locus_tag LOCUS_34580 98520 99029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_34580 99363 100775 gene locus_tag LOCUS_34590 99363 100775 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_34590 101295 102011 gene locus_tag LOCUS_34600 gene ku 101295 102011 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34859 protein_id gnl|my_center|LOCUS_34600 102012 104438 gene locus_tag LOCUS_34610 102012 104438 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_34610 104741 105316 gene locus_tag LOCUS_34620 104741 105316 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_34620 105942 106901 gene locus_tag LOCUS_34630 105942 106901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_34630 107079 107603 gene locus_tag LOCUS_34640 107079 107603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 107833 108240 gene locus_tag LOCUS_34650 107833 108240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 108639 109370 gene locus_tag LOCUS_34660 108639 109370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 109645 111222 gene locus_tag LOCUS_34670 109645 111222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 111403 112101 gene locus_tag LOCUS_34680 gene drrA 111403 112101 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_34680 112107 113564 gene locus_tag LOCUS_34690 112107 113564 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_34690 >Feature sequence23 1044 532 gene locus_tag LOCUS_34700 1044 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_34700 1757 1041 gene locus_tag LOCUS_34710 1757 1041 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_34710 3602 1941 gene locus_tag LOCUS_34720 3602 1941 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_34720 3973 3599 gene locus_tag LOCUS_34730 gene rnpA 3973 3599 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_34730 4294 5937 gene locus_tag LOCUS_34740 4294 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 6719 6003 gene locus_tag LOCUS_34750 6719 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 8785 6737 gene locus_tag LOCUS_34760 8785 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34760 10139 8805 gene locus_tag LOCUS_34770 10139 8805 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_34770 10749 10303 gene locus_tag LOCUS_34780 10749 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 10905 12113 gene locus_tag LOCUS_34790 10905 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_34790 12683 12889 gene locus_tag LOCUS_34800 12683 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 12891 13193 gene locus_tag LOCUS_34810 12891 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962281.1 protein_id gnl|my_center|LOCUS_34810 15268 13850 gene locus_tag LOCUS_34820 15268 13850 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_34820 15698 16834 gene locus_tag LOCUS_34830 15698 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 17670 17368 gene locus_tag LOCUS_34840 17670 17368 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_34840 17888 17667 gene locus_tag LOCUS_34850 17888 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 18344 19495 gene locus_tag LOCUS_34860 18344 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 19550 20698 gene locus_tag LOCUS_34870 19550 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 21701 20958 gene locus_tag LOCUS_34880 21701 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 22261 21713 gene locus_tag LOCUS_34890 22261 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 24543 22303 gene locus_tag LOCUS_34900 24543 22303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 25003 26871 gene locus_tag LOCUS_34910 25003 26871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 29260 26981 gene locus_tag LOCUS_34920 29260 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 29460 30689 gene locus_tag LOCUS_34930 29460 30689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 32087 30867 gene locus_tag LOCUS_34940 32087 30867 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948224.1 protein_id gnl|my_center|LOCUS_34940 32283 33305 gene locus_tag LOCUS_34950 gene adhP 32283 33305 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_34950 33723 34109 gene locus_tag LOCUS_34960 33723 34109 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_34960 34121 34597 gene locus_tag LOCUS_34970 34121 34597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 34806 36116 gene locus_tag LOCUS_34980 34806 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_34980 36235 36777 gene locus_tag LOCUS_34990 36235 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 36787 37395 gene locus_tag LOCUS_35000 36787 37395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 38950 37457 gene locus_tag LOCUS_35010 38950 37457 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_35010 42079 38957 gene locus_tag LOCUS_35020 42079 38957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_35020 42623 42811 gene locus_tag LOCUS_35030 42623 42811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 42808 45933 gene locus_tag LOCUS_35040 42808 45933 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_35040 46002 47780 gene locus_tag LOCUS_35050 46002 47780 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_35050 48162 48089 gene locus_tag LOCUS_t00210 48162 48089 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 48274 48999 gene locus_tag LOCUS_35060 48274 48999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 50138 49455 gene locus_tag LOCUS_35070 50138 49455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 50867 50298 gene locus_tag LOCUS_35080 50867 50298 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_35080 52564 50885 gene locus_tag LOCUS_35090 52564 50885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_35090 53979 52705 gene locus_tag LOCUS_35100 53979 52705 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_35100 54230 55396 gene locus_tag LOCUS_35110 54230 55396 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_35110 55412 56467 gene locus_tag LOCUS_35120 55412 56467 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_35120 56485 56916 gene locus_tag LOCUS_35130 56485 56916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 56923 57660 gene locus_tag LOCUS_35140 56923 57660 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_35140 60024 57790 gene locus_tag LOCUS_35150 gene icd 60024 57790 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_35150 61070 60249 gene locus_tag LOCUS_35160 gene panB 61070 60249 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_35160 61578 61072 gene locus_tag LOCUS_35170 gene pyrR2 61578 61072 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_35170 62608 61685 gene locus_tag LOCUS_35180 gene rsgA 62608 61685 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_35180 63849 62605 gene locus_tag LOCUS_35190 gene kdtA 63849 62605 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_35190 64507 63860 gene locus_tag LOCUS_35200 64507 63860 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_35200 64995 64507 gene locus_tag LOCUS_35210 gene cdd 64995 64507 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_35210 65670 68702 gene locus_tag LOCUS_35220 65670 68702 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_35220 68714 70117 gene locus_tag LOCUS_35230 68714 70117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_35230 70414 71745 gene locus_tag LOCUS_35240 gene dacB 70414 71745 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_35240 71836 72534 gene locus_tag LOCUS_35250 71836 72534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_35250 72778 73035 gene locus_tag LOCUS_35260 72778 73035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_35260 73035 73310 gene locus_tag LOCUS_35270 73035 73310 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_35270 73494 76052 gene locus_tag LOCUS_35280 73494 76052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 76203 76547 gene locus_tag LOCUS_35290 76203 76547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 76657 78075 gene locus_tag LOCUS_35300 gene sdaA 76657 78075 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_35300 78108 79010 gene locus_tag LOCUS_35310 78108 79010 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_35310 79097 80995 gene locus_tag LOCUS_35320 79097 80995 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107131.1 protein_id gnl|my_center|LOCUS_35320 81780 81052 gene locus_tag LOCUS_35330 81780 81052 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_35330 82238 81780 gene locus_tag LOCUS_35340 gene rnhA 82238 81780 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_35340 82555 83331 gene locus_tag LOCUS_35350 82555 83331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 83755 83396 gene locus_tag LOCUS_35360 83755 83396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 84057 85118 gene locus_tag LOCUS_35370 84057 85118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 85615 85232 gene locus_tag LOCUS_35380 85615 85232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 86245 85703 gene locus_tag LOCUS_35390 86245 85703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 86791 86267 gene locus_tag LOCUS_35400 86791 86267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766991.1 protein_id gnl|my_center|LOCUS_35400 89505 86794 gene locus_tag LOCUS_35410 89505 86794 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_35410 90336 89593 gene locus_tag LOCUS_35420 gene uppS 90336 89593 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_35420 91120 90419 gene locus_tag LOCUS_35430 91120 90419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 92127 91252 gene locus_tag LOCUS_35440 gene nadK 92127 91252 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_35440 92799 92134 gene locus_tag LOCUS_35450 92799 92134 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_35450 93522 92932 gene locus_tag LOCUS_35460 gene trpG 93522 92932 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_35460 94051 93506 gene locus_tag LOCUS_35470 94051 93506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_35470 94511 94059 gene locus_tag LOCUS_35480 94511 94059 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_35480 94657 95373 gene locus_tag LOCUS_35490 gene pdxJ 94657 95373 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_35490 95387 96148 gene locus_tag LOCUS_35500 95387 96148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_35500 97721 98434 gene locus_tag LOCUS_35510 97721 98434 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_35510 99780 98617 gene locus_tag LOCUS_35520 99780 98617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 100859 99777 gene locus_tag LOCUS_35530 100859 99777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 101390 102130 gene locus_tag LOCUS_35540 101390 102130 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_35540 102132 103508 gene locus_tag LOCUS_35550 102132 103508 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_35550 103505 104086 gene locus_tag LOCUS_35560 103505 104086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_35560 105726 104194 gene locus_tag LOCUS_35570 105726 104194 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108637.1 protein_id gnl|my_center|LOCUS_35570 107054 106098 gene locus_tag LOCUS_35580 107054 106098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 107724 107152 gene locus_tag LOCUS_35590 107724 107152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 109675 107732 gene locus_tag LOCUS_35600 109675 107732 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence24 1011 253 gene locus_tag LOCUS_35610 1011 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1869 1324 gene locus_tag LOCUS_35620 1869 1324 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_35620 2365 2009 gene locus_tag LOCUS_35630 2365 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3869 2916 gene locus_tag LOCUS_35640 3869 2916 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_35640 4498 4226 gene locus_tag LOCUS_35650 4498 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4989 4519 gene locus_tag LOCUS_35660 4989 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 13310 5196 gene locus_tag LOCUS_35670 13310 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 13533 14753 gene locus_tag LOCUS_35680 13533 14753 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_35680 14835 16454 gene locus_tag LOCUS_35690 14835 16454 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_35690 17929 16520 gene locus_tag LOCUS_35700 gene nagA 17929 16520 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_35700 19092 17986 gene locus_tag LOCUS_35710 19092 17986 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_35710 20415 19372 gene locus_tag LOCUS_35720 20415 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 20560 21948 gene locus_tag LOCUS_35730 20560 21948 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_35730 22245 24080 gene locus_tag LOCUS_35740 gene glmS 22245 24080 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_35740 24108 26318 gene locus_tag LOCUS_35750 24108 26318 CDS product DUF4954 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956822.1 protein_id gnl|my_center|LOCUS_35750 26697 28667 gene locus_tag LOCUS_35760 26697 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 28677 30344 gene locus_tag LOCUS_35770 28677 30344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 31591 30311 gene locus_tag LOCUS_35780 31591 30311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 31699 32286 gene locus_tag LOCUS_35790 31699 32286 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_35790 33303 32302 gene locus_tag LOCUS_35800 33303 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 34444 33368 gene locus_tag LOCUS_35810 gene idh 34444 33368 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_35810 35344 34517 gene locus_tag LOCUS_35820 35344 34517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_35820 38492 35379 gene locus_tag LOCUS_35830 38492 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 39391 38510 gene locus_tag LOCUS_35840 39391 38510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 40177 39416 gene locus_tag LOCUS_35850 40177 39416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 41502 40204 gene locus_tag LOCUS_35860 41502 40204 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_35860 43150 42278 gene locus_tag LOCUS_35870 43150 42278 CDS product regucalcin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181677.1 protein_id gnl|my_center|LOCUS_35870 44089 43202 gene locus_tag LOCUS_35880 44089 43202 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_35880 44903 44112 gene locus_tag LOCUS_35890 44903 44112 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_35890 45931 44906 gene locus_tag LOCUS_35900 45931 44906 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_35900 46652 45954 gene locus_tag LOCUS_35910 46652 45954 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_35910 47095 47451 gene locus_tag LOCUS_35920 47095 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 47460 48602 gene locus_tag LOCUS_35930 47460 48602 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_35930 49665 48640 gene locus_tag LOCUS_35940 49665 48640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 50845 49673 gene locus_tag LOCUS_35950 50845 49673 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_35950 52527 50842 gene locus_tag LOCUS_35960 52527 50842 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_35960 53092 58779 gene locus_tag LOCUS_35970 53092 58779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 58776 59804 gene locus_tag LOCUS_35980 58776 59804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 60090 65762 gene locus_tag LOCUS_35990 60090 65762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 65759 66790 gene locus_tag LOCUS_36000 65759 66790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 67038 68411 gene locus_tag LOCUS_36010 67038 68411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 68504 69712 gene locus_tag LOCUS_36020 68504 69712 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_36020 70156 71397 gene locus_tag LOCUS_36030 70156 71397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_36030 71867 72757 gene locus_tag LOCUS_36040 71867 72757 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_36040 72759 73796 gene locus_tag LOCUS_36050 72759 73796 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_36050 74282 73926 gene locus_tag LOCUS_36060 74282 73926 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072992.1 protein_id gnl|my_center|LOCUS_36060 74428 74760 gene locus_tag LOCUS_36070 74428 74760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 75026 76042 gene locus_tag LOCUS_36080 75026 76042 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_36080 76039 77655 gene locus_tag LOCUS_36090 gene lig2 76039 77655 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_36090 77922 79016 gene locus_tag LOCUS_36100 77922 79016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 80077 79073 gene locus_tag LOCUS_36110 gene fjo19 80077 79073 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_36110 82954 80129 gene locus_tag LOCUS_36120 gene rapA 82954 80129 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL5 protein_id gnl|my_center|LOCUS_36120 83414 84406 gene locus_tag LOCUS_36130 83414 84406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_36130 85936 84884 gene locus_tag LOCUS_36140 85936 84884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461963.1 protein_id gnl|my_center|LOCUS_36140 86465 86049 gene locus_tag LOCUS_36150 86465 86049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272725.1 protein_id gnl|my_center|LOCUS_36150 86679 87260 gene locus_tag LOCUS_36160 86679 87260 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_36160 87469 87969 gene locus_tag LOCUS_36170 87469 87969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 88401 90248 gene locus_tag LOCUS_36180 88401 90248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 90659 92104 gene locus_tag LOCUS_36190 90659 92104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 92219 92614 gene locus_tag LOCUS_36200 92219 92614 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_36200 92639 93175 gene locus_tag LOCUS_36210 92639 93175 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_36210 93229 93771 gene locus_tag LOCUS_36220 93229 93771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_36220 94145 93801 gene locus_tag LOCUS_36230 94145 93801 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_36230 94241 94900 gene locus_tag LOCUS_36240 94241 94900 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 protein_id gnl|my_center|LOCUS_36240 95480 97036 gene locus_tag LOCUS_36250 95480 97036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 97067 98599 gene locus_tag LOCUS_36260 97067 98599 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_36260 98870 99766 gene locus_tag LOCUS_36270 98870 99766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615243.1 protein_id gnl|my_center|LOCUS_36270 99850 100470 gene locus_tag LOCUS_36280 99850 100470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 102135 101026 gene locus_tag LOCUS_36290 102135 101026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 104033 102627 gene locus_tag LOCUS_36300 104033 102627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_36300 >Feature sequence25 942 694 gene locus_tag LOCUS_36310 942 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 1079 1006 gene locus_tag LOCUS_t00220 1079 1006 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1420 2310 gene locus_tag LOCUS_36320 gene era 1420 2310 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_36320 2322 3635 gene locus_tag LOCUS_36330 gene der 2322 3635 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A135 protein_id gnl|my_center|LOCUS_36330 3644 4183 gene locus_tag LOCUS_36340 3644 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 4928 4278 gene locus_tag LOCUS_36350 gene rsmG 4928 4278 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_36350 5545 4934 gene locus_tag LOCUS_36360 gene sigW 5545 4934 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_36360 6603 5536 gene locus_tag LOCUS_36370 6603 5536 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_36370 6952 8082 gene locus_tag LOCUS_36380 gene tgt 6952 8082 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_36380 8137 9210 gene locus_tag LOCUS_36390 8137 9210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_36390 9220 10125 gene locus_tag LOCUS_36400 9220 10125 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_36400 10995 10186 gene locus_tag LOCUS_36410 gene ispE 10995 10186 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_36410 11597 13219 gene locus_tag LOCUS_36420 gene ilvD 11597 13219 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_36420 13225 14919 gene locus_tag LOCUS_36430 gene ilvB 13225 14919 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_36430 14925 15425 gene locus_tag LOCUS_36440 gene ilvH 14925 15425 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_36440 15458 16501 gene locus_tag LOCUS_36450 15458 16501 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_36450 16511 18010 gene locus_tag LOCUS_36460 gene leuA 16511 18010 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_36460 18033 19454 gene locus_tag LOCUS_36470 gene leuC 18033 19454 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_36470 19459 20049 gene locus_tag LOCUS_36480 19459 20049 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_36480 20101 21690 gene locus_tag LOCUS_36490 20101 21690 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_36490 21659 22729 gene locus_tag LOCUS_36500 gene leuB 21659 22729 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_36500 23627 22806 gene locus_tag LOCUS_36510 23627 22806 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_36510 25385 23733 gene locus_tag LOCUS_36520 gene recN 25385 23733 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_36520 26344 25433 gene locus_tag LOCUS_36530 26344 25433 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_36530 27733 26504 gene locus_tag LOCUS_36540 gene coaBC 27733 26504 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_36540 28052 27735 gene locus_tag LOCUS_36550 28052 27735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_36550 28992 28066 gene locus_tag LOCUS_36560 28992 28066 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_36560 29771 29058 gene locus_tag LOCUS_36570 29771 29058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 31537 29990 gene locus_tag LOCUS_36580 31537 29990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_36580 31647 32987 gene locus_tag LOCUS_36590 gene tilS 31647 32987 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_36590 32971 33486 gene locus_tag LOCUS_36600 32971 33486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 33573 34511 gene locus_tag LOCUS_36610 gene mdh 33573 34511 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_36610 34708 37329 gene locus_tag LOCUS_36620 34708 37329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 37340 39049 gene locus_tag LOCUS_36630 37340 39049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 39220 39951 gene locus_tag LOCUS_36640 39220 39951 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_36640 40300 41382 gene locus_tag LOCUS_36650 40300 41382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 41382 42641 gene locus_tag LOCUS_36660 gene lolC 41382 42641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_36660 42642 43325 gene locus_tag LOCUS_36670 gene lolD 42642 43325 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_36670 43586 44650 gene locus_tag LOCUS_36680 43586 44650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 44979 44788 gene locus_tag LOCUS_36690 44979 44788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 44882 45394 gene locus_tag LOCUS_36700 44882 45394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 46193 45432 gene locus_tag LOCUS_36710 gene agaR 46193 45432 CDS product putative aga operon transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACK2 protein_id gnl|my_center|LOCUS_36710 46291 47853 gene locus_tag LOCUS_36720 gene glpA 46291 47853 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_36720 47864 49366 gene locus_tag LOCUS_36730 gene glpK 47864 49366 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X50 protein_id gnl|my_center|LOCUS_36730 49369 50115 gene locus_tag LOCUS_36740 gene glpF 49369 50115 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_36740 51735 50461 gene locus_tag LOCUS_36750 gene rodA 51735 50461 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_36750 53538 51736 gene locus_tag LOCUS_36760 53538 51736 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_36760 54060 53539 gene locus_tag LOCUS_36770 54060 53539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 54890 54057 gene locus_tag LOCUS_36780 54890 54057 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_36780 55926 54898 gene locus_tag LOCUS_36790 gene mreB 55926 54898 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_36790 57833 56307 gene locus_tag LOCUS_36800 gene purH 57833 56307 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_36800 58524 57967 gene locus_tag LOCUS_36810 gene purN 58524 57967 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_36810 59554 58607 gene locus_tag LOCUS_36820 59554 58607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 60376 59579 gene locus_tag LOCUS_36830 60376 59579 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_36830 61326 60544 gene locus_tag LOCUS_36840 61326 60544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_36840 63929 61401 gene locus_tag LOCUS_36850 63929 61401 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_36850 64386 63970 gene locus_tag LOCUS_36860 64386 63970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 64632 64390 gene locus_tag LOCUS_36870 64632 64390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 65308 64634 gene locus_tag LOCUS_36880 65308 64634 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_36880 66630 65965 gene locus_tag LOCUS_36890 66630 65965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 66810 67835 gene locus_tag LOCUS_36900 66810 67835 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_36900 69308 68031 gene locus_tag LOCUS_36910 gene serS 69308 68031 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_36910 69427 70347 gene locus_tag LOCUS_36920 69427 70347 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_36920 70395 71153 gene locus_tag LOCUS_36930 70395 71153 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_36930 71177 72037 gene locus_tag LOCUS_36940 gene hpaG 71177 72037 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_36940 72790 72089 gene locus_tag LOCUS_36950 72790 72089 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203531.1 protein_id gnl|my_center|LOCUS_36950 73495 76716 gene locus_tag LOCUS_36960 73495 76716 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_36960 76744 78228 gene locus_tag LOCUS_36970 76744 78228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795013.1 protein_id gnl|my_center|LOCUS_36970 78268 79434 gene locus_tag LOCUS_36980 78268 79434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 79654 80286 gene locus_tag LOCUS_36990 79654 80286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 80311 81426 gene locus_tag LOCUS_37000 80311 81426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 81432 82604 gene locus_tag LOCUS_37010 81432 82604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 82608 84155 gene locus_tag LOCUS_37020 82608 84155 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120375.1 protein_id gnl|my_center|LOCUS_37020 84139 85275 gene locus_tag LOCUS_37030 84139 85275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 85306 86094 gene locus_tag LOCUS_37040 85306 86094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 86101 86997 gene locus_tag LOCUS_37050 86101 86997 CDS product succinylglutamate desuccinylase/aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_37050 86998 87825 gene locus_tag LOCUS_37060 86998 87825 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_37060 87822 88913 gene locus_tag LOCUS_37070 87822 88913 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_37070 88933 89838 gene locus_tag LOCUS_37080 gene nanA 88933 89838 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKT6 protein_id gnl|my_center|LOCUS_37080 89988 90368 gene locus_tag LOCUS_37090 89988 90368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703642.1 protein_id gnl|my_center|LOCUS_37090 90358 91854 gene locus_tag LOCUS_37100 90358 91854 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 protein_id gnl|my_center|LOCUS_37100 91851 92720 gene locus_tag LOCUS_37110 91851 92720 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_37110 92740 93726 gene locus_tag LOCUS_37120 92740 93726 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_37120 93756 96314 gene locus_tag LOCUS_37130 93756 96314 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_37130 96827 98308 gene locus_tag LOCUS_37140 96827 98308 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_37140 98667 98744 gene locus_tag LOCUS_t00230 98667 98744 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 98774 99028 gene locus_tag LOCUS_37150 98774 99028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence26 2052 232 gene locus_tag LOCUS_37160 2052 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209314.1 protein_id gnl|my_center|LOCUS_37160 2852 2058 gene locus_tag LOCUS_37170 2852 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 4055 3186 gene locus_tag LOCUS_37180 4055 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 9434 6588 gene locus_tag LOCUS_37190 9434 6588 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_37190 9959 9621 gene locus_tag LOCUS_37200 gene ytxJ 9959 9621 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_37200 10246 10088 gene locus_tag LOCUS_37210 10246 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 10188 11513 gene locus_tag LOCUS_37220 10188 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 12196 11522 gene locus_tag LOCUS_37230 gene dnaQ 12196 11522 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_37230 14144 12198 gene locus_tag LOCUS_37240 14144 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_37240 16127 14229 gene locus_tag LOCUS_37250 gene acsA 16127 14229 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_37250 17898 16213 gene locus_tag LOCUS_37260 17898 16213 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_37260 18185 17922 gene locus_tag LOCUS_37270 18185 17922 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_37270 18877 18356 gene locus_tag LOCUS_37280 18877 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 19494 18877 gene locus_tag LOCUS_37290 gene pnuC 19494 18877 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_37290 21332 19590 gene locus_tag LOCUS_37300 21332 19590 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_37300 21723 23438 gene locus_tag LOCUS_37310 gene ilvD5 21723 23438 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_37310 23503 24279 gene locus_tag LOCUS_37320 23503 24279 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_37320 24451 24717 gene locus_tag LOCUS_37330 24451 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 24728 25744 gene locus_tag LOCUS_37340 24728 25744 CDS product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124069.1 protein_id gnl|my_center|LOCUS_37340 26060 27034 gene locus_tag LOCUS_37350 26060 27034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 27041 27304 gene locus_tag LOCUS_37360 27041 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 28688 27324 gene locus_tag LOCUS_37370 28688 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 29147 29992 gene locus_tag LOCUS_37380 29147 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 30209 30820 gene locus_tag LOCUS_37390 30209 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 31023 32366 gene locus_tag LOCUS_37400 31023 32366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 32536 33237 gene locus_tag LOCUS_37410 32536 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_37410 33679 33981 gene locus_tag LOCUS_37420 33679 33981 CDS product addiction module antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388216.1 protein_id gnl|my_center|LOCUS_37420 33974 34264 gene locus_tag LOCUS_37430 33974 34264 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_37430 34331 34756 gene locus_tag LOCUS_37440 34331 34756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 35200 35610 gene locus_tag LOCUS_37450 35200 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 35627 36760 gene locus_tag LOCUS_37460 35627 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_37460 36844 37413 gene locus_tag LOCUS_37470 36844 37413 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_37470 37475 38491 gene locus_tag LOCUS_37480 gene hpnA 37475 38491 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_37480 39323 40741 gene locus_tag LOCUS_37490 39323 40741 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_37490 40758 41264 gene locus_tag LOCUS_37500 40758 41264 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853140.1 protein_id gnl|my_center|LOCUS_37500 41746 41955 gene locus_tag LOCUS_37510 41746 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 42157 43062 gene locus_tag LOCUS_37520 42157 43062 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122640.1 protein_id gnl|my_center|LOCUS_37520 43485 45593 gene locus_tag LOCUS_37530 43485 45593 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_37530 45603 46886 gene locus_tag LOCUS_37540 45603 46886 CDS product putative sugar isomerase R00627 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S14 protein_id gnl|my_center|LOCUS_37540 46923 48254 gene locus_tag LOCUS_37550 46923 48254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 48272 49195 gene locus_tag LOCUS_37560 48272 49195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 49192 50505 gene locus_tag LOCUS_37570 49192 50505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_37570 51008 50586 gene locus_tag LOCUS_37580 51008 50586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_37580 51186 51581 gene locus_tag LOCUS_37590 51186 51581 CDS product glcG protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920042.1 protein_id gnl|my_center|LOCUS_37590 51627 52784 gene locus_tag LOCUS_37600 51627 52784 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_37600 52799 53728 gene locus_tag LOCUS_37610 52799 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_37610 54977 53898 gene locus_tag LOCUS_37620 54977 53898 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_37620 55102 56679 gene locus_tag LOCUS_37630 55102 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 56811 58937 gene locus_tag LOCUS_37640 56811 58937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 59083 61902 gene locus_tag LOCUS_37650 gene uvrA1 59083 61902 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_37650 63535 64467 gene locus_tag LOCUS_37660 63535 64467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 64799 65779 gene locus_tag LOCUS_37670 64799 65779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_37670 65797 67116 gene locus_tag LOCUS_37680 65797 67116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_37680 67121 68041 gene locus_tag LOCUS_37690 67121 68041 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLG7 protein_id gnl|my_center|LOCUS_37690 68586 68113 gene locus_tag LOCUS_37700 68586 68113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 68983 69207 gene locus_tag LOCUS_37710 68983 69207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 69625 69209 gene locus_tag LOCUS_37720 69625 69209 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 protein_id gnl|my_center|LOCUS_37720 71520 69745 gene locus_tag LOCUS_37730 gene sglT 71520 69745 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_37730 71815 72885 gene locus_tag LOCUS_37740 71815 72885 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_37740 72904 74997 gene locus_tag LOCUS_37750 gene recG 72904 74997 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_37750 75084 75920 gene locus_tag LOCUS_37760 75084 75920 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_37760 75932 76588 gene locus_tag LOCUS_37770 75932 76588 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_37770 76665 77636 gene locus_tag LOCUS_37780 76665 77636 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_37780 77668 78708 gene locus_tag LOCUS_37790 77668 78708 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_37790 78732 79466 gene locus_tag LOCUS_37800 gene algR 78732 79466 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_37800 79595 80350 gene locus_tag LOCUS_37810 79595 80350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 81685 80405 gene locus_tag LOCUS_37820 81685 80405 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_37820 82139 82609 gene locus_tag LOCUS_37830 82139 82609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_37830 83622 82798 gene locus_tag LOCUS_37840 83622 82798 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_37840 83951 83700 gene locus_tag LOCUS_37850 83951 83700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 84232 83999 gene locus_tag LOCUS_37860 84232 83999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 86731 84548 gene locus_tag LOCUS_37870 gene pepX1 86731 84548 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_37870 87040 88143 gene locus_tag LOCUS_37880 87040 88143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 88956 88180 gene locus_tag LOCUS_37890 gene coaX 88956 88180 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_37890 89086 89565 gene locus_tag LOCUS_37900 89086 89565 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_37900 89743 90843 gene locus_tag LOCUS_37910 89743 90843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_37910 90847 92373 gene locus_tag LOCUS_37920 90847 92373 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_37920 93660 92911 gene locus_tag LOCUS_37930 93660 92911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 93879 94427 gene locus_tag LOCUS_37940 93879 94427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 94774 95241 gene locus_tag LOCUS_37950 94774 95241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 95283 95954 gene locus_tag LOCUS_37960 gene chd1 95283 95954 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_37960 95969 96727 gene locus_tag LOCUS_37970 95969 96727 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_37970 97213 96746 gene locus_tag LOCUS_37980 97213 96746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence27 1917 289 gene locus_tag LOCUS_37990 gene groL 1917 289 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_37990 2248 1970 gene locus_tag LOCUS_38000 gene groS 2248 1970 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_38000 2478 3191 gene locus_tag LOCUS_38010 2478 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4231 3242 gene locus_tag LOCUS_38020 4231 3242 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_38020 4759 4391 gene locus_tag LOCUS_38030 4759 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 5617 4775 gene locus_tag LOCUS_38040 5617 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_38040 6146 5658 gene locus_tag LOCUS_38050 6146 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_38050 7491 6178 gene locus_tag LOCUS_38060 7491 6178 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_38060 8966 7506 gene locus_tag LOCUS_38070 gene miaB 8966 7506 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_38070 9261 10772 gene locus_tag LOCUS_38080 9261 10772 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMS0 protein_id gnl|my_center|LOCUS_38080 10880 15898 gene locus_tag LOCUS_38090 10880 15898 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_38090 15948 18221 gene locus_tag LOCUS_38100 15948 18221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_38100 18445 18218 gene locus_tag LOCUS_38110 18445 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 19916 18840 gene locus_tag LOCUS_38120 gene dinB2 19916 18840 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_38120 21274 19925 gene locus_tag LOCUS_38130 gene gdhA 21274 19925 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_38130 22555 21275 gene locus_tag LOCUS_38140 gene pabB 22555 21275 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_38140 23362 22640 gene locus_tag LOCUS_38150 23362 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 23857 24372 gene locus_tag LOCUS_38160 23857 24372 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_38160 26101 24374 gene locus_tag LOCUS_38170 gene aceK 26101 24374 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_38170 26320 26961 gene locus_tag LOCUS_38180 26320 26961 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_38180 26943 28211 gene locus_tag LOCUS_38190 26943 28211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_38190 28726 32679 gene locus_tag LOCUS_38200 28726 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 32758 34065 gene locus_tag LOCUS_38210 32758 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 34516 35559 gene locus_tag LOCUS_38220 34516 35559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38220 35564 38278 gene locus_tag LOCUS_38230 35564 38278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38230 38373 39326 gene locus_tag LOCUS_38240 38373 39326 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_38240 39455 39919 gene locus_tag LOCUS_38250 39455 39919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 39916 41340 gene locus_tag LOCUS_38260 39916 41340 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_38260 41337 42068 gene locus_tag LOCUS_38270 41337 42068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 42769 44016 gene locus_tag LOCUS_38280 gene pyrC2 42769 44016 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_38280 44009 44524 gene locus_tag LOCUS_38290 44009 44524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 44536 45087 gene locus_tag LOCUS_38300 44536 45087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 45095 46057 gene locus_tag LOCUS_38310 45095 46057 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_38310 46057 47001 gene locus_tag LOCUS_38320 46057 47001 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_38320 48174 48911 gene locus_tag LOCUS_38330 48174 48911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 48921 51353 gene locus_tag LOCUS_38340 gene wzc 48921 51353 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_38340 51956 53254 gene locus_tag LOCUS_38350 51956 53254 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_38350 53351 54787 gene locus_tag LOCUS_38360 53351 54787 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_38360 54787 55869 gene locus_tag LOCUS_38370 54787 55869 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202147.1 protein_id gnl|my_center|LOCUS_38370 56406 57311 gene locus_tag LOCUS_38380 56406 57311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 57379 58431 gene locus_tag LOCUS_38390 57379 58431 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_38390 58691 59716 gene locus_tag LOCUS_38400 58691 59716 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_38400 60124 61569 gene locus_tag LOCUS_38410 60124 61569 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_38410 61580 62629 gene locus_tag LOCUS_38420 61580 62629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 62631 63770 gene locus_tag LOCUS_38430 62631 63770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 63792 64943 gene locus_tag LOCUS_38440 63792 64943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288206.1 protein_id gnl|my_center|LOCUS_38440 64996 65697 gene locus_tag LOCUS_38450 64996 65697 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_38450 65814 67007 gene locus_tag LOCUS_38460 65814 67007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 67207 68346 gene locus_tag LOCUS_38470 67207 68346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 68363 69502 gene locus_tag LOCUS_38480 68363 69502 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_38480 69539 70093 gene locus_tag LOCUS_38490 69539 70093 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_38490 70106 70858 gene locus_tag LOCUS_38500 70106 70858 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_38500 70944 71885 gene locus_tag LOCUS_38510 70944 71885 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_38510 72125 73081 gene locus_tag LOCUS_38520 72125 73081 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039951.1 protein_id gnl|my_center|LOCUS_38520 73289 74455 gene locus_tag LOCUS_38530 73289 74455 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_38530 74466 75056 gene locus_tag LOCUS_38540 74466 75056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 75082 75660 gene locus_tag LOCUS_38550 75082 75660 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_38550 76609 78165 gene locus_tag LOCUS_38560 gene wbpM 76609 78165 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_38560 79146 81083 gene locus_tag LOCUS_38570 79146 81083 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_38570 81324 82730 gene locus_tag LOCUS_38580 gene trpE 81324 82730 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_38580 82753 83334 gene locus_tag LOCUS_38590 82753 83334 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_38590 83334 84344 gene locus_tag LOCUS_38600 gene trpD 83334 84344 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_38600 84347 85168 gene locus_tag LOCUS_38610 gene trpC 84347 85168 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_38610 85165 85839 gene locus_tag LOCUS_38620 gene trpF 85165 85839 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_38620 85826 87004 gene locus_tag LOCUS_38630 gene trpB 85826 87004 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_38630 87004 87783 gene locus_tag LOCUS_38640 gene trpA 87004 87783 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_38640 87780 88799 gene locus_tag LOCUS_38650 gene aroF1 87780 88799 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence28 163 2148 gene locus_tag LOCUS_38660 163 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2207 3658 gene locus_tag LOCUS_38670 2207 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3655 5202 gene locus_tag LOCUS_38680 3655 5202 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_38680 5306 7351 gene locus_tag LOCUS_38690 5306 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 7641 8990 gene locus_tag LOCUS_38700 7641 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 9772 9239 gene locus_tag LOCUS_38710 9772 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 9871 10107 gene locus_tag LOCUS_38720 9871 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 10111 12330 gene locus_tag LOCUS_38730 10111 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 12327 12599 gene locus_tag LOCUS_38740 12327 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 12666 13616 gene locus_tag LOCUS_38750 12666 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 13727 14062 gene locus_tag LOCUS_38760 13727 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 14010 14456 gene locus_tag LOCUS_38770 14010 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 14461 14955 gene locus_tag LOCUS_38780 14461 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 14958 15599 gene locus_tag LOCUS_38790 14958 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 15596 16000 gene locus_tag LOCUS_38800 15596 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 15997 16641 gene locus_tag LOCUS_38810 15997 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 16638 17060 gene locus_tag LOCUS_38820 16638 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 17072 17431 gene locus_tag LOCUS_38830 17072 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 17397 17672 gene locus_tag LOCUS_38840 17397 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 17679 17906 gene locus_tag LOCUS_38850 17679 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 17903 18340 gene locus_tag LOCUS_38860 17903 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 18422 18691 gene locus_tag LOCUS_38870 18422 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 18691 18987 gene locus_tag LOCUS_38880 18691 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 18978 19151 gene locus_tag LOCUS_38890 18978 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 19156 19581 gene locus_tag LOCUS_38900 19156 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 19587 19754 gene locus_tag LOCUS_38910 19587 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 19780 20037 gene locus_tag LOCUS_38920 19780 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 20130 20558 gene locus_tag LOCUS_38930 20130 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 20584 20874 gene locus_tag LOCUS_38940 20584 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 21398 20931 gene locus_tag LOCUS_38950 21398 20931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 21925 21395 gene locus_tag LOCUS_38960 21925 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 22725 21925 gene locus_tag LOCUS_38970 22725 21925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 23972 22725 gene locus_tag LOCUS_38980 23972 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 27233 24057 gene locus_tag LOCUS_38990 27233 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 28881 27268 gene locus_tag LOCUS_39000 28881 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980890.1 protein_id gnl|my_center|LOCUS_39000 29318 28881 gene locus_tag LOCUS_39010 29318 28881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 29574 30554 gene locus_tag LOCUS_39020 29574 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 30615 31724 gene locus_tag LOCUS_39030 30615 31724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 31796 32029 gene locus_tag LOCUS_39040 31796 32029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 32031 32624 gene locus_tag LOCUS_39050 32031 32624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 32629 32901 gene locus_tag LOCUS_39060 32629 32901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 32904 33482 gene locus_tag LOCUS_39070 32904 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 33624 36008 gene locus_tag LOCUS_39080 33624 36008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 36001 38031 gene locus_tag LOCUS_39090 36001 38031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 38024 39703 gene locus_tag LOCUS_39100 38024 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 39703 41103 gene locus_tag LOCUS_39110 39703 41103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 41100 41927 gene locus_tag LOCUS_39120 41100 41927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 41893 42396 gene locus_tag LOCUS_39130 41893 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 42428 42976 gene locus_tag LOCUS_39140 42428 42976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 44725 43205 gene locus_tag LOCUS_39150 44725 43205 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_39150 45281 46021 gene locus_tag LOCUS_39160 45281 46021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 47387 46263 gene locus_tag LOCUS_39170 47387 46263 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_39170 48652 47432 gene locus_tag LOCUS_39180 48652 47432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_39180 49156 50001 gene locus_tag LOCUS_39190 49156 50001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 50330 50103 gene locus_tag LOCUS_39200 50330 50103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 51649 50342 gene locus_tag LOCUS_39210 51649 50342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 52101 53237 gene locus_tag LOCUS_39220 52101 53237 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462089.1 protein_id gnl|my_center|LOCUS_39220 54226 53366 gene locus_tag LOCUS_39230 54226 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 57147 55051 gene locus_tag LOCUS_39240 57147 55051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 58382 58203 gene locus_tag LOCUS_39250 58382 58203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 60051 58534 gene locus_tag LOCUS_39260 60051 58534 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_39260 60933 60151 gene locus_tag LOCUS_39270 60933 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 61508 61239 gene locus_tag LOCUS_39280 61508 61239 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_39280 62607 61714 gene locus_tag LOCUS_39290 62607 61714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 62997 65159 gene locus_tag LOCUS_39300 62997 65159 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_39300 65832 65419 gene locus_tag LOCUS_39310 65832 65419 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_39310 66110 65832 gene locus_tag LOCUS_39320 66110 65832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 66920 66270 gene locus_tag LOCUS_39330 66920 66270 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_39330 68113 67274 gene locus_tag LOCUS_39340 68113 67274 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068192.1 protein_id gnl|my_center|LOCUS_39340 69156 68587 gene locus_tag LOCUS_39350 69156 68587 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 protein_id gnl|my_center|LOCUS_39350 69653 69153 gene locus_tag LOCUS_39360 69653 69153 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_39360 70488 70057 gene locus_tag LOCUS_39370 70488 70057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 70948 70625 gene locus_tag LOCUS_39380 70948 70625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 72277 71600 gene locus_tag LOCUS_39390 72277 71600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 72831 72583 gene locus_tag LOCUS_39400 72831 72583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 73507 73052 gene locus_tag LOCUS_39410 73507 73052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 76695 74143 gene locus_tag LOCUS_39420 gene ppc 76695 74143 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12880 protein_id gnl|my_center|LOCUS_39420 77099 76884 gene locus_tag LOCUS_39430 77099 76884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 77080 79245 gene locus_tag LOCUS_39440 gene mrpA 77080 79245 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_39440 79248 79658 gene locus_tag LOCUS_39450 gene mrpB 79248 79658 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_39450 79660 80013 gene locus_tag LOCUS_39460 gene mrpC 79660 80013 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_39460 80010 81518 gene locus_tag LOCUS_39470 gene mrpD 80010 81518 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_39470 81531 82010 gene locus_tag LOCUS_39480 gene mrpE 81531 82010 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_39480 82007 82282 gene locus_tag LOCUS_39490 gene mrpF 82007 82282 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_39490 82275 82670 gene locus_tag LOCUS_39500 gene mrpG 82275 82670 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_39500 82684 83811 gene locus_tag LOCUS_39510 82684 83811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204946.1 protein_id gnl|my_center|LOCUS_39510 83915 84952 gene locus_tag LOCUS_39520 gene asnA 83915 84952 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V7 protein_id gnl|my_center|LOCUS_39520 85112 85309 gene locus_tag LOCUS_39530 85112 85309 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_39530 86733 85861 gene locus_tag LOCUS_39540 86733 85861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 87202 86804 gene locus_tag LOCUS_39550 87202 86804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_39550 87849 88697 gene locus_tag LOCUS_39560 87849 88697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 89034 89219 gene locus_tag LOCUS_39570 89034 89219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence29 197 784 gene locus_tag LOCUS_39580 197 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 1026 1490 gene locus_tag LOCUS_39590 1026 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 1693 2193 gene locus_tag LOCUS_39600 1693 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2343 3383 gene locus_tag LOCUS_39610 2343 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_39610 4598 5161 gene locus_tag LOCUS_39620 4598 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 5197 5406 gene locus_tag LOCUS_39630 5197 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 5551 5982 gene locus_tag LOCUS_39640 5551 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 6087 6902 gene locus_tag LOCUS_39650 6087 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 6989 7606 gene locus_tag LOCUS_39660 6989 7606 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023269.1 protein_id gnl|my_center|LOCUS_39660 7619 8167 gene locus_tag LOCUS_39670 7619 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 8989 9153 gene locus_tag LOCUS_39680 8989 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 9129 9803 gene locus_tag LOCUS_39690 9129 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 10046 10429 gene locus_tag LOCUS_39700 10046 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 11266 11547 gene locus_tag LOCUS_39710 11266 11547 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_39710 11559 11861 gene locus_tag LOCUS_39720 11559 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 12453 13034 gene locus_tag LOCUS_39730 12453 13034 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_39730 13088 13960 gene locus_tag LOCUS_39740 13088 13960 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_39740 15518 14163 gene locus_tag LOCUS_39750 15518 14163 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_39750 16297 15515 gene locus_tag LOCUS_39760 16297 15515 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_39760 16597 16989 gene locus_tag LOCUS_39770 16597 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 16986 17387 gene locus_tag LOCUS_39780 16986 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 17594 18547 gene locus_tag LOCUS_39790 17594 18547 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_39790 18991 19980 gene locus_tag LOCUS_39800 18991 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 20603 22315 gene locus_tag LOCUS_39810 20603 22315 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_39810 22317 23831 gene locus_tag LOCUS_39820 gene uxuB 22317 23831 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_39820 23972 24535 gene locus_tag LOCUS_39830 23972 24535 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727712.1 protein_id gnl|my_center|LOCUS_39830 24592 25158 gene locus_tag LOCUS_39840 24592 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 25435 26079 gene locus_tag LOCUS_39850 25435 26079 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_39850 26226 27032 gene locus_tag LOCUS_39860 26226 27032 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_39860 27246 27872 gene locus_tag LOCUS_39870 27246 27872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 27953 29236 gene locus_tag LOCUS_39880 27953 29236 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_39880 29453 30388 gene locus_tag LOCUS_39890 29453 30388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 30416 30916 gene locus_tag LOCUS_39900 30416 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_39900 30949 32049 gene locus_tag LOCUS_39910 30949 32049 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_39910 32216 32986 gene locus_tag LOCUS_39920 gene modA 32216 32986 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_39920 32986 33660 gene locus_tag LOCUS_39930 gene modB 32986 33660 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_39930 33653 34327 gene locus_tag LOCUS_39940 33653 34327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 35654 34422 gene locus_tag LOCUS_39950 35654 34422 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_39950 36286 37488 gene locus_tag LOCUS_39960 36286 37488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_39960 37728 38483 gene locus_tag LOCUS_39970 37728 38483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_39970 39812 38553 gene locus_tag LOCUS_39980 39812 38553 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_39980 40180 39809 gene locus_tag LOCUS_39990 40180 39809 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_39990 40540 40980 gene locus_tag LOCUS_40000 40540 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 41108 42688 gene locus_tag LOCUS_40010 41108 42688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 43534 42788 gene locus_tag LOCUS_40020 43534 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 43841 44449 gene locus_tag LOCUS_40030 43841 44449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 44452 45549 gene locus_tag LOCUS_40040 44452 45549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 46391 45612 gene locus_tag LOCUS_40050 46391 45612 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_40050 46975 46406 gene locus_tag LOCUS_40060 46975 46406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_40060 48864 47611 gene locus_tag LOCUS_40070 gene metK 48864 47611 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_40070 49617 48946 gene locus_tag LOCUS_40080 49617 48946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 52721 49764 gene locus_tag LOCUS_40090 52721 49764 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_40090 53178 52831 gene locus_tag LOCUS_40100 53178 52831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 54032 53370 gene locus_tag LOCUS_40110 gene udk 54032 53370 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_40110 54618 54040 gene locus_tag LOCUS_40120 54618 54040 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_40120 54952 55542 gene locus_tag LOCUS_40130 54952 55542 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_40130 56223 55663 gene locus_tag LOCUS_40140 56223 55663 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_40140 56835 56305 gene locus_tag LOCUS_40150 56835 56305 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_40150 60407 57309 gene locus_tag LOCUS_40160 60407 57309 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_40160 61483 60413 gene locus_tag LOCUS_40170 61483 60413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 62838 61540 gene locus_tag LOCUS_40180 62838 61540 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107396.1 protein_id gnl|my_center|LOCUS_40180 64281 62911 gene locus_tag LOCUS_40190 64281 62911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 64958 64278 gene locus_tag LOCUS_40200 64958 64278 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_40200 65582 65178 gene locus_tag LOCUS_40210 65582 65178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 67421 66414 gene locus_tag LOCUS_40220 67421 66414 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987014.1 protein_id gnl|my_center|LOCUS_40220 68095 67418 gene locus_tag LOCUS_40230 68095 67418 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970705.1 protein_id gnl|my_center|LOCUS_40230 69439 68933 gene locus_tag LOCUS_40240 69439 68933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 70361 69726 gene locus_tag LOCUS_40250 70361 69726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 70813 70370 gene locus_tag LOCUS_40260 70813 70370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 71472 70894 gene locus_tag LOCUS_40270 71472 70894 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_40270 71903 72064 gene locus_tag LOCUS_40280 71903 72064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 73386 71995 gene locus_tag LOCUS_40290 gene atoE 73386 71995 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76460 protein_id gnl|my_center|LOCUS_40290 74900 74154 gene locus_tag LOCUS_40300 74900 74154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence30 1169 252 gene locus_tag LOCUS_40310 1169 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_40310 4194 2242 gene locus_tag LOCUS_40320 4194 2242 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_40320 6350 4215 gene locus_tag LOCUS_40330 6350 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 7926 6514 gene locus_tag LOCUS_40340 7926 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 10198 7997 gene locus_tag LOCUS_40350 10198 7997 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 protein_id gnl|my_center|LOCUS_40350 12078 10195 gene locus_tag LOCUS_40360 12078 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 14249 12453 gene locus_tag LOCUS_40370 14249 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_40370 17435 14250 gene locus_tag LOCUS_40380 17435 14250 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_40380 18821 19534 gene locus_tag LOCUS_40390 18821 19534 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_40390 22269 20095 gene locus_tag LOCUS_40400 22269 20095 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_40400 22922 22560 gene locus_tag LOCUS_40410 22922 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 25332 22924 gene locus_tag LOCUS_40420 25332 22924 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_40420 25799 25329 gene locus_tag LOCUS_40430 25799 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_40430 26253 27272 gene locus_tag LOCUS_40440 26253 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 29523 27247 gene locus_tag LOCUS_40450 29523 27247 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_40450 29729 31597 gene locus_tag LOCUS_40460 29729 31597 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_40460 31849 32241 gene locus_tag LOCUS_40470 31849 32241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 32440 34854 gene locus_tag LOCUS_40480 32440 34854 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_40480 35702 34902 gene locus_tag LOCUS_40490 35702 34902 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_40490 36190 36669 gene locus_tag LOCUS_40500 36190 36669 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_40500 37054 36686 gene locus_tag LOCUS_40510 37054 36686 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_40510 37621 37088 gene locus_tag LOCUS_40520 37621 37088 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_40520 37667 39697 gene locus_tag LOCUS_40530 gene dcp1 37667 39697 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_40530 41225 40182 gene locus_tag LOCUS_40540 41225 40182 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_40540 41605 42783 gene locus_tag LOCUS_40550 41605 42783 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_40550 44411 42831 gene locus_tag LOCUS_40560 44411 42831 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_40560 44643 45977 gene locus_tag LOCUS_40570 44643 45977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 46151 48211 gene locus_tag LOCUS_40580 gene metG 46151 48211 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_40580 48340 48771 gene locus_tag LOCUS_40590 48340 48771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 49405 48785 gene locus_tag LOCUS_40600 49405 48785 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105413.1 protein_id gnl|my_center|LOCUS_40600 49563 50324 gene locus_tag LOCUS_40610 49563 50324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 51110 50337 gene locus_tag LOCUS_40620 51110 50337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 51364 51107 gene locus_tag LOCUS_40630 51364 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 53791 51527 gene locus_tag LOCUS_40640 53791 51527 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_40640 53940 54293 gene locus_tag LOCUS_40650 53940 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 55360 54350 gene locus_tag LOCUS_40660 55360 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 57954 55735 gene locus_tag LOCUS_40670 57954 55735 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_40670 58443 60842 gene locus_tag LOCUS_40680 58443 60842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 60967 62880 gene locus_tag LOCUS_40690 60967 62880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 62966 63295 gene locus_tag LOCUS_40700 62966 63295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 63523 64347 gene locus_tag LOCUS_40710 63523 64347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 66052 64577 gene locus_tag LOCUS_40720 gene araA 66052 64577 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_40720 66285 66992 gene locus_tag LOCUS_40730 66285 66992 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_40730 70496 67089 gene locus_tag LOCUS_40740 70496 67089 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_40740 71643 70504 gene locus_tag LOCUS_40750 71643 70504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 73004 71658 gene locus_tag LOCUS_40760 73004 71658 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence31 3188 69 gene locus_tag LOCUS_40770 3188 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 5590 3314 gene locus_tag LOCUS_40780 5590 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 7927 5633 gene locus_tag LOCUS_40790 7927 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 8591 7893 gene locus_tag LOCUS_40800 8591 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 9918 8584 gene locus_tag LOCUS_40810 9918 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 13642 9911 gene locus_tag LOCUS_40820 gene sbcC 13642 9911 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YM9 protein_id gnl|my_center|LOCUS_40820 14892 13645 gene locus_tag LOCUS_40830 gene sbcD 14892 13645 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB67 protein_id gnl|my_center|LOCUS_40830 15619 14909 gene locus_tag LOCUS_40840 15619 14909 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_40840 18851 15612 gene locus_tag LOCUS_40850 18851 15612 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_40850 19829 18864 gene locus_tag LOCUS_40860 19829 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 20254 19826 gene locus_tag LOCUS_40870 20254 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 21268 20255 gene locus_tag LOCUS_40880 21268 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 22282 21272 gene locus_tag LOCUS_40890 22282 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 23535 22282 gene locus_tag LOCUS_40900 23535 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871055.1 protein_id gnl|my_center|LOCUS_40900 25063 23528 gene locus_tag LOCUS_40910 gene hsdM 25063 23528 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_40910 25490 25065 gene locus_tag LOCUS_40920 25490 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 26066 25494 gene locus_tag LOCUS_40930 26066 25494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 28195 26207 gene locus_tag LOCUS_40940 28195 26207 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108393.1 protein_id gnl|my_center|LOCUS_40940 29512 28208 gene locus_tag LOCUS_40950 29512 28208 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202381.1 protein_id gnl|my_center|LOCUS_40950 29889 29500 gene locus_tag LOCUS_40960 29889 29500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 31024 30125 gene locus_tag LOCUS_40970 gene traP 31024 30125 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_40970 31673 31125 gene locus_tag LOCUS_40980 31673 31125 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 protein_id gnl|my_center|LOCUS_40980 31744 32061 gene locus_tag LOCUS_40990 31744 32061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 32285 32076 gene locus_tag LOCUS_41000 32285 32076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 33719 32583 gene locus_tag LOCUS_41010 33719 32583 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41010 34040 33810 gene locus_tag LOCUS_41020 34040 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41020 34214 34987 gene locus_tag LOCUS_41030 34214 34987 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764892.1 protein_id gnl|my_center|LOCUS_41030 34984 35493 gene locus_tag LOCUS_41040 34984 35493 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963696.1 protein_id gnl|my_center|LOCUS_41040 35490 35954 gene locus_tag LOCUS_41050 35490 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 35961 37019 gene locus_tag LOCUS_41060 gene ilvE 35961 37019 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_41060 37032 37565 gene locus_tag LOCUS_41070 gene yfiT 37032 37565 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_41070 37556 37990 gene locus_tag LOCUS_41080 37556 37990 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_41080 38010 38081 gene locus_tag LOCUS_t00240 38010 38081 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 38248 38976 gene locus_tag LOCUS_41090 38248 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 38966 39706 gene locus_tag LOCUS_41100 38966 39706 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957208.1 protein_id gnl|my_center|LOCUS_41100 39703 40413 gene locus_tag LOCUS_41110 39703 40413 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_41110 40397 40852 gene locus_tag LOCUS_41120 40397 40852 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_41120 40860 41363 gene locus_tag LOCUS_41130 40860 41363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 41370 41717 gene locus_tag LOCUS_41140 41370 41717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205353.1 protein_id gnl|my_center|LOCUS_41140 41722 42372 gene locus_tag LOCUS_41150 41722 42372 CDS product hypothetical isochorismatase hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702589.1 protein_id gnl|my_center|LOCUS_41150 42365 42916 gene locus_tag LOCUS_41160 42365 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_41160 42929 43267 gene locus_tag LOCUS_41170 42929 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 43347 44555 gene locus_tag LOCUS_41180 43347 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 44568 45098 gene locus_tag LOCUS_41190 44568 45098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 45341 45823 gene locus_tag LOCUS_41200 45341 45823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 46030 46302 gene locus_tag LOCUS_41210 46030 46302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560983.1 protein_id gnl|my_center|LOCUS_41210 46315 46743 gene locus_tag LOCUS_41220 46315 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 46829 52351 gene locus_tag LOCUS_41230 46829 52351 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108226.1 protein_id gnl|my_center|LOCUS_41230 52370 52684 gene locus_tag LOCUS_41240 52370 52684 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008648476.1 protein_id gnl|my_center|LOCUS_41240 52721 55198 gene locus_tag LOCUS_41250 52721 55198 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_41250 55195 55884 gene locus_tag LOCUS_41260 55195 55884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 55920 56549 gene locus_tag LOCUS_41270 55920 56549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 56546 57184 gene locus_tag LOCUS_41280 56546 57184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 57196 58410 gene locus_tag LOCUS_41290 57196 58410 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_41290 58559 59053 gene locus_tag LOCUS_41300 58559 59053 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308760.1 protein_id gnl|my_center|LOCUS_41300 59124 59603 gene locus_tag LOCUS_41310 59124 59603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 59606 60907 gene locus_tag LOCUS_41320 59606 60907 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291521.1 protein_id gnl|my_center|LOCUS_41320 60931 61806 gene locus_tag LOCUS_41330 60931 61806 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485412.1 protein_id gnl|my_center|LOCUS_41330 61824 62624 gene locus_tag LOCUS_41340 61824 62624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 62630 62923 gene locus_tag LOCUS_41350 62630 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 62988 63146 gene locus_tag LOCUS_41360 62988 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 63209 64783 gene locus_tag LOCUS_41370 63209 64783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 64794 64721 gene locus_tag LOCUS_t00250 64794 64721 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 64923 64849 gene locus_tag LOCUS_t00260 64923 64849 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65086 66540 gene locus_tag LOCUS_41380 65086 66540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 66683 68014 gene locus_tag LOCUS_41390 66683 68014 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_41390 68910 68017 gene locus_tag LOCUS_41400 68910 68017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 69273 70232 gene locus_tag LOCUS_41410 69273 70232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 70673 71104 gene locus_tag LOCUS_41420 70673 71104 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_41420 71109 72113 gene locus_tag LOCUS_41430 71109 72113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 >Feature sequence32 915 433 gene locus_tag LOCUS_41440 915 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 2169 994 gene locus_tag LOCUS_41450 2169 994 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_41450 2612 2169 gene locus_tag LOCUS_41460 2612 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 3974 2688 gene locus_tag LOCUS_41470 3974 2688 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_41470 4648 3971 gene locus_tag LOCUS_41480 4648 3971 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_41480 7920 4768 gene locus_tag LOCUS_41490 gene res 7920 4768 CDS product type III restriction-modification system restriction subunit Res inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_41490 8468 8103 gene locus_tag LOCUS_41500 8468 8103 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_41500 9334 8720 gene locus_tag LOCUS_41510 9334 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 10053 9514 gene locus_tag LOCUS_41520 10053 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 10558 10028 gene locus_tag LOCUS_41530 10558 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 10983 10561 gene locus_tag LOCUS_41540 10983 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 11458 10973 gene locus_tag LOCUS_41550 11458 10973 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_41550 11854 11781 gene locus_tag LOCUS_t00270 11854 11781 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11943 13274 gene locus_tag LOCUS_41560 11943 13274 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_41560 13287 14081 gene locus_tag LOCUS_41570 13287 14081 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_41570 14257 14745 gene locus_tag LOCUS_41580 14257 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_41580 14767 16716 gene locus_tag LOCUS_41590 14767 16716 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_41590 16762 17931 gene locus_tag LOCUS_41600 16762 17931 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_41600 17955 19283 gene locus_tag LOCUS_41610 17955 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 19885 19232 gene locus_tag LOCUS_41620 19885 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 20781 19936 gene locus_tag LOCUS_41630 20781 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 20883 21512 gene locus_tag LOCUS_41640 20883 21512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 21890 22669 gene locus_tag LOCUS_41650 21890 22669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_41650 22761 23369 gene locus_tag LOCUS_41660 22761 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 23469 25853 gene locus_tag LOCUS_41670 23469 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 26745 27770 gene locus_tag LOCUS_41680 26745 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 29139 28405 gene locus_tag LOCUS_41690 29139 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_41690 30220 29153 gene locus_tag LOCUS_41700 30220 29153 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_41700 30378 31415 gene locus_tag LOCUS_41710 gene ruvB 30378 31415 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_41710 31448 32380 gene locus_tag LOCUS_41720 gene queG 31448 32380 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_41720 32919 32377 gene locus_tag LOCUS_41730 32919 32377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 33718 34164 gene locus_tag LOCUS_41740 33718 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 34164 34859 gene locus_tag LOCUS_41750 34164 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 34810 35214 gene locus_tag LOCUS_41760 34810 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 35211 36038 gene locus_tag LOCUS_41770 35211 36038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 36112 36870 gene locus_tag LOCUS_41780 36112 36870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 37430 36846 gene locus_tag LOCUS_41790 37430 36846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 37755 37531 gene locus_tag LOCUS_41800 37755 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 39292 37757 gene locus_tag LOCUS_41810 gene gltX 39292 37757 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_41810 39431 40036 gene locus_tag LOCUS_41820 39431 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 40177 40629 gene locus_tag LOCUS_41830 40177 40629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 41561 41247 gene locus_tag LOCUS_41840 41561 41247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 41886 44702 gene locus_tag LOCUS_41850 gene polA 41886 44702 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_41850 44869 46146 gene locus_tag LOCUS_41860 gene radA 44869 46146 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_41860 46936 46220 gene locus_tag LOCUS_41870 46936 46220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 48565 47090 gene locus_tag LOCUS_41880 48565 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 48674 49684 gene locus_tag LOCUS_41890 gene ykfB 48674 49684 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_41890 49699 50757 gene locus_tag LOCUS_41900 49699 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 51044 51397 gene locus_tag LOCUS_41910 51044 51397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_41910 53565 51694 gene locus_tag LOCUS_41920 53565 51694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 53724 54470 gene locus_tag LOCUS_41930 53724 54470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 56167 54488 gene locus_tag LOCUS_41940 56167 54488 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_41940 56426 57526 gene locus_tag LOCUS_41950 gene vdh 56426 57526 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_41950 57674 58858 gene locus_tag LOCUS_41960 57674 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 58867 59175 gene locus_tag LOCUS_41970 58867 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 59188 59733 gene locus_tag LOCUS_41980 59188 59733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_41980 59736 60056 gene locus_tag LOCUS_41990 gene yajC 59736 60056 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_41990 60129 61034 gene locus_tag LOCUS_42000 60129 61034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 61027 61635 gene locus_tag LOCUS_42010 gene coaE 61027 61635 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_42010 61889 61644 gene locus_tag LOCUS_42020 61889 61644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 62310 62792 gene locus_tag LOCUS_42030 62310 62792 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705408.1 protein_id gnl|my_center|LOCUS_42030 62967 64469 gene locus_tag LOCUS_42040 gene atpD 62967 64469 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_42040 64523 64768 gene locus_tag LOCUS_42050 64523 64768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 65663 64854 gene locus_tag LOCUS_42060 gene murQ 65663 64854 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_42060 66511 65699 gene locus_tag LOCUS_42070 gene hpcH 66511 65699 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_42070 >Feature sequence33 <1 1758 gene locus_tag LOCUS_42080 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:cation transporter 1898 2425 gene locus_tag LOCUS_42090 1898 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 2515 2904 gene locus_tag LOCUS_42100 2515 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 2933 3484 gene locus_tag LOCUS_42110 2933 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 3641 5962 gene locus_tag LOCUS_42120 3641 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 6010 6573 gene locus_tag LOCUS_42130 6010 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_42130 6730 7098 gene locus_tag LOCUS_42140 6730 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_42140 7126 7590 gene locus_tag LOCUS_42150 7126 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_42150 7702 7872 gene locus_tag LOCUS_42160 7702 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 7893 8486 gene locus_tag LOCUS_42170 7893 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 8567 8776 gene locus_tag LOCUS_42180 8567 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 8859 9326 gene locus_tag LOCUS_42190 8859 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 9355 10629 gene locus_tag LOCUS_42200 9355 10629 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_42200 11001 12161 gene locus_tag LOCUS_42210 11001 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 12529 13143 gene locus_tag LOCUS_42220 12529 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 13394 14050 gene locus_tag LOCUS_42230 13394 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 14176 14631 gene locus_tag LOCUS_42240 14176 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 15066 15878 gene locus_tag LOCUS_42250 15066 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 16284 16592 gene locus_tag LOCUS_42260 16284 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 16609 16998 gene locus_tag LOCUS_42270 16609 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_42270 17002 17277 gene locus_tag LOCUS_42280 17002 17277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 17504 17716 gene locus_tag LOCUS_42290 17504 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 17713 18057 gene locus_tag LOCUS_42300 gene glnB 17713 18057 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43795 protein_id gnl|my_center|LOCUS_42300 18054 18887 gene locus_tag LOCUS_42310 gene uspA 18054 18887 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_42310 18892 19377 gene locus_tag LOCUS_42320 18892 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 19543 19884 gene locus_tag LOCUS_42330 19543 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 19895 20614 gene locus_tag LOCUS_42340 19895 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 20601 21935 gene locus_tag LOCUS_42350 gene ndh 20601 21935 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_42350 21932 23245 gene locus_tag LOCUS_42360 gene nhaA 21932 23245 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_42360 23252 23812 gene locus_tag LOCUS_42370 23252 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 23916 24944 gene locus_tag LOCUS_42380 23916 24944 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_42380 25814 25560 gene locus_tag LOCUS_42390 25814 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 26142 27170 gene locus_tag LOCUS_42400 26142 27170 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_42400 27314 27568 gene locus_tag LOCUS_42410 27314 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42410 27561 28910 gene locus_tag LOCUS_42420 27561 28910 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_42420 28942 30630 gene locus_tag LOCUS_42430 28942 30630 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932437.1 protein_id gnl|my_center|LOCUS_42430 30746 31360 gene locus_tag LOCUS_42440 30746 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 31365 32285 gene locus_tag LOCUS_42450 31365 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 32324 34864 gene locus_tag LOCUS_42460 32324 34864 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729K1 protein_id gnl|my_center|LOCUS_42460 34941 35942 gene locus_tag LOCUS_42470 gene pfkA 34941 35942 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_42470 36154 38280 gene locus_tag LOCUS_42480 36154 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 38382 39371 gene locus_tag LOCUS_42490 38382 39371 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_42490 39420 41063 gene locus_tag LOCUS_42500 39420 41063 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_42500 41060 44641 gene locus_tag LOCUS_42510 gene nifJ-1 41060 44641 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KID4 protein_id gnl|my_center|LOCUS_42510 44698 44889 gene locus_tag LOCUS_42520 44698 44889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42520 44965 45228 gene locus_tag LOCUS_42530 44965 45228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42530 46064 48493 gene locus_tag LOCUS_42540 gene phuR 46064 48493 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_42540 49043 49897 gene locus_tag LOCUS_42550 49043 49897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_42550 49919 51289 gene locus_tag LOCUS_42560 49919 51289 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947965.1 protein_id gnl|my_center|LOCUS_42560 51289 52809 gene locus_tag LOCUS_42570 51289 52809 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_42570 52814 53710 gene locus_tag LOCUS_42580 52814 53710 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_42580 53703 54380 gene locus_tag LOCUS_42590 53703 54380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 54397 55710 gene locus_tag LOCUS_42600 54397 55710 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_42600 55748 56422 gene locus_tag LOCUS_42610 55748 56422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 56488 56679 gene locus_tag LOCUS_42620 56488 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 56676 57407 gene locus_tag LOCUS_42630 56676 57407 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237263.1 protein_id gnl|my_center|LOCUS_42630 57420 59516 gene locus_tag LOCUS_42640 57420 59516 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_42640 59516 60751 gene locus_tag LOCUS_42650 59516 60751 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_42650 60770 61828 gene locus_tag LOCUS_42660 60770 61828 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_42660 61854 62303 gene locus_tag LOCUS_42670 61854 62303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 62294 63067 gene locus_tag LOCUS_42680 62294 63067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_42680 63073 63708 gene locus_tag LOCUS_42690 63073 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_42690 63840 64316 gene locus_tag LOCUS_42700 63840 64316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 64511 65011 gene locus_tag LOCUS_42710 64511 65011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence34 204 359 gene locus_tag LOCUS_42720 204 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 383 1441 gene locus_tag LOCUS_42730 383 1441 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_42730 1452 2528 gene locus_tag LOCUS_42740 1452 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 2861 2652 gene locus_tag LOCUS_42750 2861 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 3760 4989 gene locus_tag LOCUS_42760 3760 4989 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_42760 4992 5630 gene locus_tag LOCUS_42770 4992 5630 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_42770 5644 7233 gene locus_tag LOCUS_42780 5644 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 7278 8270 gene locus_tag LOCUS_42790 7278 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_42790 8871 8419 gene locus_tag LOCUS_42800 8871 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 10142 8997 gene locus_tag LOCUS_42810 10142 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 11184 10324 gene locus_tag LOCUS_42820 11184 10324 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_42820 11307 12794 gene locus_tag LOCUS_42830 11307 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_42830 12791 13489 gene locus_tag LOCUS_42840 12791 13489 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_42840 13731 14906 gene locus_tag LOCUS_42850 13731 14906 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_42850 14908 15360 gene locus_tag LOCUS_42860 14908 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 16693 15362 gene locus_tag LOCUS_42870 16693 15362 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_42870 16888 19053 gene locus_tag LOCUS_42880 16888 19053 CDS product glycosyl hydrolase family 31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_42880 19431 19877 gene locus_tag LOCUS_42890 19431 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 19995 21803 gene locus_tag LOCUS_42900 19995 21803 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_42900 21962 22939 gene locus_tag LOCUS_42910 gene pfkA 21962 22939 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_42910 22942 23310 gene locus_tag LOCUS_42920 22942 23310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 24209 23298 gene locus_tag LOCUS_42930 gene miaA1 24209 23298 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_42930 24256 25014 gene locus_tag LOCUS_42940 24256 25014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 25007 25387 gene locus_tag LOCUS_42950 25007 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 25389 25667 gene locus_tag LOCUS_42960 25389 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 25664 26425 gene locus_tag LOCUS_42970 gene phnP 25664 26425 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_42970 26427 27992 gene locus_tag LOCUS_42980 26427 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_42980 29659 28229 gene locus_tag LOCUS_42990 gene pykA 29659 28229 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_42990 30099 29671 gene locus_tag LOCUS_43000 30099 29671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 30248 30484 gene locus_tag LOCUS_43010 gene acpP 30248 30484 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_43010 30504 31757 gene locus_tag LOCUS_43020 30504 31757 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_43020 31760 32503 gene locus_tag LOCUS_43030 31760 32503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 32544 34400 gene locus_tag LOCUS_43040 gene nadE 32544 34400 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_43040 34431 35534 gene locus_tag LOCUS_43050 34431 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 36037 37296 gene locus_tag LOCUS_43060 36037 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 37438 38199 gene locus_tag LOCUS_43070 37438 38199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 38196 40298 gene locus_tag LOCUS_43080 38196 40298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_43080 40759 40340 gene locus_tag LOCUS_43090 gene mscL 40759 40340 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG6 protein_id gnl|my_center|LOCUS_43090 40874 42934 gene locus_tag LOCUS_43100 gene ptrB 40874 42934 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_43100 44312 43128 gene locus_tag LOCUS_43110 44312 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 44768 46195 gene locus_tag LOCUS_43120 44768 46195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_43120 46217 47197 gene locus_tag LOCUS_43130 46217 47197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_43130 47194 47934 gene locus_tag LOCUS_43140 47194 47934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_43140 47981 48838 gene locus_tag LOCUS_43150 47981 48838 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_43150 48936 50177 gene locus_tag LOCUS_43160 48936 50177 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_43160 53264 50211 gene locus_tag LOCUS_43170 53264 50211 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_43170 54329 53268 gene locus_tag LOCUS_43180 54329 53268 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_43180 56407 54857 gene locus_tag LOCUS_43190 56407 54857 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_43190 57467 56583 gene locus_tag LOCUS_43200 57467 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 58899 57481 gene locus_tag LOCUS_43210 58899 57481 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884432.1 protein_id gnl|my_center|LOCUS_43210 59559 59961 gene locus_tag LOCUS_tm00010 59559 59961 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 60663 60920 gene locus_tag LOCUS_43220 60663 60920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 61213 62304 gene locus_tag LOCUS_43230 61213 62304 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_43230 62414 62731 gene locus_tag LOCUS_43240 62414 62731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence35 134 2323 gene locus_tag LOCUS_43250 134 2323 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581323.1 protein_id gnl|my_center|LOCUS_43250 3387 2488 gene locus_tag LOCUS_43260 3387 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 5015 3528 gene locus_tag LOCUS_43270 5015 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 6309 5032 gene locus_tag LOCUS_43280 6309 5032 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_43280 7325 6438 gene locus_tag LOCUS_43290 7325 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 8764 7451 gene locus_tag LOCUS_43300 8764 7451 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_43300 9657 8782 gene locus_tag LOCUS_43310 9657 8782 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_43310 10840 9719 gene locus_tag LOCUS_43320 gene uxuA 10840 9719 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_43320 12333 10900 gene locus_tag LOCUS_43330 gene gntP 12333 10900 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_43330 13111 12338 gene locus_tag LOCUS_43340 gene hpcH 13111 12338 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_43340 14718 13267 gene locus_tag LOCUS_43350 14718 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_43350 18311 14850 gene locus_tag LOCUS_43360 18311 14850 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_43360 19385 18351 gene locus_tag LOCUS_43370 19385 18351 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_43370 20102 19515 gene locus_tag LOCUS_43380 20102 19515 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_43380 20523 20855 gene locus_tag LOCUS_43390 20523 20855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 20857 21270 gene locus_tag LOCUS_43400 gene moaE 20857 21270 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_43400 21400 22296 gene locus_tag LOCUS_43410 gene moaA 21400 22296 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59038 protein_id gnl|my_center|LOCUS_43410 22326 23522 gene locus_tag LOCUS_43420 gene moeA 22326 23522 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_43420 23527 24675 gene locus_tag LOCUS_43430 23527 24675 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_43430 24838 25137 gene locus_tag LOCUS_43440 24838 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 25190 26056 gene locus_tag LOCUS_43450 25190 26056 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_43450 27208 26120 gene locus_tag LOCUS_43460 27208 26120 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_43460 28087 27245 gene locus_tag LOCUS_43470 28087 27245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 29439 29744 gene locus_tag LOCUS_43480 29439 29744 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704671.1 protein_id gnl|my_center|LOCUS_43480 29764 30156 gene locus_tag LOCUS_43490 29764 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 30983 30177 gene locus_tag LOCUS_43500 gene yscE 30983 30177 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255244.1 protein_id gnl|my_center|LOCUS_43500 32116 30998 gene locus_tag LOCUS_43510 32116 30998 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_43510 33427 32225 gene locus_tag LOCUS_43520 33427 32225 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_43520 34443 35993 gene locus_tag LOCUS_43530 34443 35993 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_43530 37292 36597 gene locus_tag LOCUS_43540 37292 36597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 38396 37296 gene locus_tag LOCUS_43550 38396 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141024.1 protein_id gnl|my_center|LOCUS_43550 39590 38820 gene locus_tag LOCUS_43560 39590 38820 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_43560 40988 39972 gene locus_tag LOCUS_43570 40988 39972 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_43570 42222 41224 gene locus_tag LOCUS_43580 42222 41224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 43317 42316 gene locus_tag LOCUS_43590 43317 42316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 43720 46419 gene locus_tag LOCUS_43600 43720 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 47601 46594 gene locus_tag LOCUS_43610 47601 46594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 48306 47674 gene locus_tag LOCUS_43620 48306 47674 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510757.1 protein_id gnl|my_center|LOCUS_43620 48587 48997 gene locus_tag LOCUS_43630 48587 48997 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_43630 49347 49946 gene locus_tag LOCUS_43640 49347 49946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 50234 50590 gene locus_tag LOCUS_43650 50234 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 50701 51567 gene locus_tag LOCUS_43660 50701 51567 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_43660 52355 51561 gene locus_tag LOCUS_43670 52355 51561 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_43670 52473 52934 gene locus_tag LOCUS_43680 52473 52934 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_43680 52980 53768 gene locus_tag LOCUS_43690 52980 53768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 54066 55091 gene locus_tag LOCUS_43700 54066 55091 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_43700 55112 55564 gene locus_tag LOCUS_43710 55112 55564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_43710 55653 56315 gene locus_tag LOCUS_43720 55653 56315 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_43720 56855 56409 gene locus_tag LOCUS_43730 56855 56409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 57442 57083 gene locus_tag LOCUS_43740 57442 57083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 57756 57601 gene locus_tag LOCUS_43750 57756 57601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 57850 58560 gene locus_tag LOCUS_43760 57850 58560 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_43760 59129 58563 gene locus_tag LOCUS_43770 59129 58563 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_43770 60065 59847 gene locus_tag LOCUS_43780 60065 59847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 61012 60173 gene locus_tag LOCUS_43790 61012 60173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 >Feature sequence36 640 3651 gene locus_tag LOCUS_43800 640 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 4581 3658 gene locus_tag LOCUS_43810 4581 3658 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_43810 5027 4656 gene locus_tag LOCUS_43820 5027 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 5477 6745 gene locus_tag LOCUS_43830 gene glyA 5477 6745 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_43830 6757 7602 gene locus_tag LOCUS_43840 gene tatC 6757 7602 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_43840 7613 8047 gene locus_tag LOCUS_43850 gene rpiB 7613 8047 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_43850 9389 8070 gene locus_tag LOCUS_43860 9389 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 9562 9948 gene locus_tag LOCUS_43870 9562 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 10106 11245 gene locus_tag LOCUS_43880 10106 11245 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_43880 11344 14280 gene locus_tag LOCUS_43890 11344 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 14331 15185 gene locus_tag LOCUS_43900 gene purU 14331 15185 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_43900 15698 15270 gene locus_tag LOCUS_43910 15698 15270 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257335.1 protein_id gnl|my_center|LOCUS_43910 16908 15754 gene locus_tag LOCUS_43920 gene alr 16908 15754 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_43920 18042 16912 gene locus_tag LOCUS_43930 gene celE 18042 16912 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_43930 18733 18026 gene locus_tag LOCUS_43940 18733 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 18885 19847 gene locus_tag LOCUS_43950 18885 19847 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_43950 20997 19849 gene locus_tag LOCUS_43960 20997 19849 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_43960 22410 21022 gene locus_tag LOCUS_43970 22410 21022 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_43970 22690 22460 gene locus_tag LOCUS_43980 22690 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 22766 23578 gene locus_tag LOCUS_43990 22766 23578 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_43990 25718 24201 gene locus_tag LOCUS_44000 25718 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_44000 26470 25739 gene locus_tag LOCUS_44010 gene lptB 26470 25739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_44010 28173 26473 gene locus_tag LOCUS_44020 28173 26473 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_44020 28879 28283 gene locus_tag LOCUS_44030 28879 28283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 30001 29123 gene locus_tag LOCUS_44040 gene lipA 30001 29123 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_44040 30741 30070 gene locus_tag LOCUS_44050 30741 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 31293 31757 gene locus_tag LOCUS_44060 31293 31757 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_44060 31738 33057 gene locus_tag LOCUS_44070 31738 33057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 33130 34038 gene locus_tag LOCUS_44080 33130 34038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 34549 34091 gene locus_tag LOCUS_44090 34549 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 35472 34546 gene locus_tag LOCUS_44100 gene yrbG 35472 34546 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_44100 36126 35485 gene locus_tag LOCUS_44110 gene upp 36126 35485 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_44110 37441 36197 gene locus_tag LOCUS_44120 37441 36197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 37644 38561 gene locus_tag LOCUS_44130 37644 38561 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_44130 38641 39177 gene locus_tag LOCUS_44140 38641 39177 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_44140 39205 39777 gene locus_tag LOCUS_44150 gene adk 39205 39777 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_44150 39893 40882 gene locus_tag LOCUS_44160 gene obg 39893 40882 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_44160 40963 41529 gene locus_tag LOCUS_44170 gene grpE 40963 41529 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_44170 41536 42648 gene locus_tag LOCUS_44180 gene dnaJ 41536 42648 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_44180 42760 43605 gene locus_tag LOCUS_44190 42760 43605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 43673 44575 gene locus_tag LOCUS_44200 gene natA 43673 44575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_44200 44556 45875 gene locus_tag LOCUS_44210 gene natB 44556 45875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_44210 46006 47214 gene locus_tag LOCUS_44220 gene porY 46006 47214 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_44220 47229 48740 gene locus_tag LOCUS_44230 47229 48740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 50505 48865 gene locus_tag LOCUS_44240 gene pruA 50505 48865 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_44240 51348 50653 gene locus_tag LOCUS_44250 51348 50653 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_44250 51738 51355 gene locus_tag LOCUS_44260 51738 51355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_44260 51886 52530 gene locus_tag LOCUS_44270 51886 52530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 52652 54292 gene locus_tag LOCUS_44280 gene pafA 52652 54292 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_44280 54956 55204 gene locus_tag LOCUS_44290 54956 55204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 55191 55526 gene locus_tag LOCUS_44300 55191 55526 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_44300 55648 56469 gene locus_tag LOCUS_44310 55648 56469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_44310 56986 56609 gene locus_tag LOCUS_44320 56986 56609 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_44320 >Feature sequence37 337 3528 gene locus_tag LOCUS_44330 337 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_44330 3528 4997 gene locus_tag LOCUS_44340 3528 4997 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_44340 5007 6071 gene locus_tag LOCUS_44350 gene pam 5007 6071 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_44350 6542 8863 gene locus_tag LOCUS_44360 gene metE 6542 8863 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 protein_id gnl|my_center|LOCUS_44360 9991 8918 gene locus_tag LOCUS_44370 9991 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 11769 10111 gene locus_tag LOCUS_44380 11769 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_44380 15164 11802 gene locus_tag LOCUS_44390 15164 11802 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_44390 16746 15730 gene locus_tag LOCUS_44400 16746 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 18195 17485 gene locus_tag LOCUS_44410 18195 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_44410 19449 18247 gene locus_tag LOCUS_44420 gene aspC1 19449 18247 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_44420 19604 20548 gene locus_tag LOCUS_44430 19604 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 20898 20542 gene locus_tag LOCUS_44440 20898 20542 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_44440 20931 21674 gene locus_tag LOCUS_44450 gene lipB 20931 21674 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_44450 21671 22072 gene locus_tag LOCUS_44460 21671 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_44460 22078 22812 gene locus_tag LOCUS_44470 22078 22812 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_44470 22894 25071 gene locus_tag LOCUS_44480 gene rnr 22894 25071 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_44480 25061 26047 gene locus_tag LOCUS_44490 25061 26047 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_44490 26052 26681 gene locus_tag LOCUS_44500 26052 26681 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_44500 27047 26739 gene locus_tag LOCUS_44510 27047 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 27433 27173 gene locus_tag LOCUS_44520 gene rpmA 27433 27173 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_44520 27706 27467 gene locus_tag LOCUS_44530 27706 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 28372 29352 gene locus_tag LOCUS_44540 gene nrdB 28372 29352 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_44540 29383 31779 gene locus_tag LOCUS_44550 gene nrdA 29383 31779 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_44550 33828 32047 gene locus_tag LOCUS_44560 33828 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 35268 34141 gene locus_tag LOCUS_44570 35268 34141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 35857 35519 gene locus_tag LOCUS_44580 35857 35519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 protein_id gnl|my_center|LOCUS_44580 36212 38119 gene locus_tag LOCUS_44590 36212 38119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 38218 39462 gene locus_tag LOCUS_44600 38218 39462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 40452 39823 gene locus_tag LOCUS_44610 40452 39823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 41074 42069 gene locus_tag LOCUS_44620 41074 42069 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_44620 43537 42536 gene locus_tag LOCUS_44630 43537 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 44698 44189 gene locus_tag LOCUS_44640 44698 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 46250 45432 gene locus_tag LOCUS_44650 46250 45432 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_44650 46685 46506 gene locus_tag LOCUS_44660 46685 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 47309 46743 gene locus_tag LOCUS_44670 47309 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 48407 48060 gene locus_tag LOCUS_44680 48407 48060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 48552 48737 gene locus_tag LOCUS_44690 48552 48737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 49520 48882 gene locus_tag LOCUS_44700 49520 48882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 51089 50202 gene locus_tag LOCUS_44710 51089 50202 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44710 51989 51501 gene locus_tag LOCUS_44720 51989 51501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 52444 52154 gene locus_tag LOCUS_44730 52444 52154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_44730 52809 52441 gene locus_tag LOCUS_44740 52809 52441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 53827 53504 gene locus_tag LOCUS_44750 53827 53504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 54714 53833 gene locus_tag LOCUS_44760 gene mrr 54714 53833 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_44760 55748 55251 gene locus_tag LOCUS_44770 55748 55251 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_44770 56884 55745 gene locus_tag LOCUS_44780 56884 55745 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence38 186 479 gene locus_tag LOCUS_44790 186 479 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_44790 482 838 gene locus_tag LOCUS_44800 482 838 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_44800 2227 1436 gene locus_tag LOCUS_44810 gene surE 2227 1436 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_44810 2763 2227 gene locus_tag LOCUS_44820 2763 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 4182 2965 gene locus_tag LOCUS_44830 gene ribBA 4182 2965 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_44830 6198 4261 gene locus_tag LOCUS_44840 gene dnaG 6198 4261 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_44840 6596 7693 gene locus_tag LOCUS_44850 6596 7693 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P46 protein_id gnl|my_center|LOCUS_44850 7699 7947 gene locus_tag LOCUS_44860 7699 7947 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_44860 7963 10983 gene locus_tag LOCUS_44870 7963 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 11131 11904 gene locus_tag LOCUS_44880 11131 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 11905 13728 gene locus_tag LOCUS_44890 11905 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 13735 14040 gene locus_tag LOCUS_44900 13735 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 15166 14054 gene locus_tag LOCUS_44910 15166 14054 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_44910 15788 15159 gene locus_tag LOCUS_44920 15788 15159 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_44920 15978 16054 gene locus_tag LOCUS_t00280 15978 16054 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18310 16532 gene locus_tag LOCUS_44930 18310 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 18595 18437 gene locus_tag LOCUS_44940 18595 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 19073 20557 gene locus_tag LOCUS_44950 19073 20557 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_44950 21151 20570 gene locus_tag LOCUS_44960 gene rnhB 21151 20570 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_44960 23798 21126 gene locus_tag LOCUS_44970 23798 21126 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_44970 25197 24070 gene locus_tag LOCUS_44980 25197 24070 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_44980 26006 25194 gene locus_tag LOCUS_44990 26006 25194 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_44990 27515 26172 gene locus_tag LOCUS_45000 27515 26172 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_45000 28884 27505 gene locus_tag LOCUS_45010 28884 27505 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_45010 29085 29513 gene locus_tag LOCUS_45020 29085 29513 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_45020 30003 29569 gene locus_tag LOCUS_45030 30003 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 30937 30155 gene locus_tag LOCUS_45040 30937 30155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 31793 30969 gene locus_tag LOCUS_45050 gene lpxH 31793 30969 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_45050 33963 31927 gene locus_tag LOCUS_45060 gene ftsH 33963 31927 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_45060 34385 34032 gene locus_tag LOCUS_45070 gene rsfS 34385 34032 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_45070 34487 35248 gene locus_tag LOCUS_45080 34487 35248 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_45080 35315 36634 gene locus_tag LOCUS_45090 gene ahcY 35315 36634 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_45090 37019 37387 gene locus_tag LOCUS_45100 37019 37387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 37398 38063 gene locus_tag LOCUS_45110 37398 38063 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_45110 38230 42339 gene locus_tag LOCUS_45120 38230 42339 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_45120 42332 44398 gene locus_tag LOCUS_45130 42332 44398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_45130 45288 44902 gene locus_tag LOCUS_45140 45288 44902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_45140 46057 45263 gene locus_tag LOCUS_45150 46057 45263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_45150 46244 46816 gene locus_tag LOCUS_45160 46244 46816 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_45160 47192 48565 gene locus_tag LOCUS_45170 47192 48565 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 protein_id gnl|my_center|LOCUS_45170 48586 49542 gene locus_tag LOCUS_45180 48586 49542 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_45180 49549 50709 gene locus_tag LOCUS_45190 49549 50709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962466.1 protein_id gnl|my_center|LOCUS_45190 52824 50770 gene locus_tag LOCUS_45200 52824 50770 CDS product 7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403897.1 protein_id gnl|my_center|LOCUS_45200 53732 52905 gene locus_tag LOCUS_45210 53732 52905 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_45210 54756 54559 gene locus_tag LOCUS_45220 54756 54559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 55594 54746 gene locus_tag LOCUS_45230 55594 54746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence39 2008 1280 gene locus_tag LOCUS_45240 2008 1280 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_45240 3014 2025 gene locus_tag LOCUS_45250 gene ddl 3014 2025 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_45250 3362 7594 gene locus_tag LOCUS_45260 3362 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 7856 9775 gene locus_tag LOCUS_45270 7856 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 10954 9887 gene locus_tag LOCUS_45280 gene pam 10954 9887 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_45280 12391 10964 gene locus_tag LOCUS_45290 12391 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_45290 15001 12407 gene locus_tag LOCUS_45300 15001 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 15448 18003 gene locus_tag LOCUS_45310 15448 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 18005 19468 gene locus_tag LOCUS_45320 18005 19468 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_45320 20556 19555 gene locus_tag LOCUS_45330 20556 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 21015 21521 gene locus_tag LOCUS_45340 21015 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 21730 22920 gene locus_tag LOCUS_45350 gene yycB 21730 22920 CDS product putative transporter YycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37482 protein_id gnl|my_center|LOCUS_45350 23079 23681 gene locus_tag LOCUS_45360 23079 23681 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_45360 24309 23689 gene locus_tag LOCUS_45370 gene mtgA 24309 23689 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_45370 25885 24620 gene locus_tag LOCUS_45380 gene hflX 25885 24620 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_45380 26115 26666 gene locus_tag LOCUS_45390 gene rmlC 26115 26666 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_45390 26666 27421 gene locus_tag LOCUS_45400 26666 27421 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_45400 27438 28406 gene locus_tag LOCUS_45410 gene dfrA 27438 28406 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_45410 28506 29918 gene locus_tag LOCUS_45420 28506 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_45420 29955 30716 gene locus_tag LOCUS_45430 29955 30716 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_45430 30748 31683 gene locus_tag LOCUS_45440 30748 31683 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_45440 31680 32426 gene locus_tag LOCUS_45450 31680 32426 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_45450 34985 32493 gene locus_tag LOCUS_45460 34985 32493 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_45460 35107 36222 gene locus_tag LOCUS_45470 35107 36222 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_45470 38687 36285 gene locus_tag LOCUS_45480 38687 36285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_45480 39983 38916 gene locus_tag LOCUS_45490 39983 38916 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_45490 40695 40081 gene locus_tag LOCUS_45500 40695 40081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 41303 40698 gene locus_tag LOCUS_45510 41303 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 43579 41327 gene locus_tag LOCUS_45520 43579 41327 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404049.1 protein_id gnl|my_center|LOCUS_45520 43729 44271 gene locus_tag LOCUS_45530 43729 44271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 44287 45990 gene locus_tag LOCUS_45540 44287 45990 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_45540 48629 46359 gene locus_tag LOCUS_45550 48629 46359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479519.1 protein_id gnl|my_center|LOCUS_45550 49810 48629 gene locus_tag LOCUS_45560 49810 48629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479557.1 protein_id gnl|my_center|LOCUS_45560 51392 50712 gene locus_tag LOCUS_45570 51392 50712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 51951 51763 gene locus_tag LOCUS_45580 51951 51763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 >Feature sequence40 321 1613 gene locus_tag LOCUS_45590 321 1613 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_45590 1625 1828 gene locus_tag LOCUS_45600 1625 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 1848 2705 gene locus_tag LOCUS_45610 1848 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 2909 3214 gene locus_tag LOCUS_45620 2909 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 3218 3490 gene locus_tag LOCUS_45630 3218 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 3501 4949 gene locus_tag LOCUS_45640 3501 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 4930 5349 gene locus_tag LOCUS_45650 4930 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 5624 5914 gene locus_tag LOCUS_45660 5624 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 6089 6015 gene locus_tag LOCUS_t00290 6089 6015 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8073 6472 gene locus_tag LOCUS_45670 8073 6472 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224002.1 protein_id gnl|my_center|LOCUS_45670 6484 6558 gene locus_tag LOCUS_t00300 6484 6558 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9778 8294 gene locus_tag LOCUS_45680 gene ccrB 9778 8294 CDS product cassette chromosome recombinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_45680 9935 9768 gene locus_tag LOCUS_45690 9935 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 10535 10927 gene locus_tag LOCUS_45700 10535 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 10972 12045 gene locus_tag LOCUS_45710 10972 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 12100 12624 gene locus_tag LOCUS_45720 12100 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 12656 12874 gene locus_tag LOCUS_45730 12656 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 12891 14066 gene locus_tag LOCUS_45740 12891 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 14063 14788 gene locus_tag LOCUS_45750 14063 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108425.1 protein_id gnl|my_center|LOCUS_45750 14785 15591 gene locus_tag LOCUS_45760 14785 15591 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_45760 16262 15960 gene locus_tag LOCUS_45770 16262 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 16810 16364 gene locus_tag LOCUS_45780 16810 16364 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107096.1 protein_id gnl|my_center|LOCUS_45780 17382 16822 gene locus_tag LOCUS_45790 17382 16822 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008026705.1 protein_id gnl|my_center|LOCUS_45790 18299 17403 gene locus_tag LOCUS_45800 18299 17403 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291522.1 protein_id gnl|my_center|LOCUS_45800 19655 18324 gene locus_tag LOCUS_45810 19655 18324 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202373.1 protein_id gnl|my_center|LOCUS_45810 19929 19642 gene locus_tag LOCUS_45820 19929 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 20371 19943 gene locus_tag LOCUS_45830 20371 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 21007 20384 gene locus_tag LOCUS_45840 21007 20384 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_45840 22024 21032 gene locus_tag LOCUS_45850 22024 21032 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_45850 22660 22028 gene locus_tag LOCUS_45860 22660 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485401.1 protein_id gnl|my_center|LOCUS_45860 25192 22688 gene locus_tag LOCUS_45870 25192 22688 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_45870 25521 25189 gene locus_tag LOCUS_45880 25521 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291514.1 protein_id gnl|my_center|LOCUS_45880 25841 25533 gene locus_tag LOCUS_45890 25841 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800207.1 protein_id gnl|my_center|LOCUS_45890 26064 26867 gene locus_tag LOCUS_45900 26064 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464673.1 protein_id gnl|my_center|LOCUS_45900 28503 27376 gene locus_tag LOCUS_45910 28503 27376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 29303 28500 gene locus_tag LOCUS_45920 29303 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 29540 29307 gene locus_tag LOCUS_45930 29540 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_45930 29706 30230 gene locus_tag LOCUS_45940 29706 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 30227 30622 gene locus_tag LOCUS_45950 30227 30622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 30606 31427 gene locus_tag LOCUS_45960 30606 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_45960 31695 31501 gene locus_tag LOCUS_45970 31695 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 33246 32635 gene locus_tag LOCUS_45980 33246 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 33907 33518 gene locus_tag LOCUS_45990 33907 33518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 34290 33904 gene locus_tag LOCUS_46000 34290 33904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 35002 34364 gene locus_tag LOCUS_46010 35002 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 35453 35253 gene locus_tag LOCUS_46020 35453 35253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 37616 35562 gene locus_tag LOCUS_46030 37616 35562 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_46030 38219 37635 gene locus_tag LOCUS_46040 38219 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_46040 38929 38216 gene locus_tag LOCUS_46050 38929 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 40239 38926 gene locus_tag LOCUS_46060 40239 38926 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_46060 42604 40250 gene locus_tag LOCUS_46070 42604 40250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 43313 42615 gene locus_tag LOCUS_46080 43313 42615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 43775 43338 gene locus_tag LOCUS_46090 43775 43338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 44361 43873 gene locus_tag LOCUS_46100 44361 43873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 <46324 44576 gene locus_tag LOCUS_46110 <46324 44576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:cation transporter >Feature sequence41 1447 1043 gene locus_tag LOCUS_46120 1447 1043 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_46120 1984 1511 gene locus_tag LOCUS_46130 gene greA 1984 1511 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_46130 3057 2125 gene locus_tag LOCUS_46140 3057 2125 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_46140 4432 3065 gene locus_tag LOCUS_46150 gene mgtE 4432 3065 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_46150 5202 4420 gene locus_tag LOCUS_46160 gene rsmA 5202 4420 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_46160 5862 5437 gene locus_tag LOCUS_46170 5862 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 6393 7628 gene locus_tag LOCUS_46180 gene sbcD 6393 7628 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ16 protein_id gnl|my_center|LOCUS_46180 7625 10663 gene locus_tag LOCUS_46190 gene sbcC 7625 10663 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS0 protein_id gnl|my_center|LOCUS_46190 11773 10721 gene locus_tag LOCUS_46200 11773 10721 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_46200 13207 11927 gene locus_tag LOCUS_46210 13207 11927 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_46210 15135 13219 gene locus_tag LOCUS_46220 15135 13219 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_46220 15773 15699 gene locus_tag LOCUS_t00310 15773 15699 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17196 15853 gene locus_tag LOCUS_46230 gene pyrC1 17196 15853 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_46230 17266 18621 gene locus_tag LOCUS_46240 17266 18621 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_46240 19529 18672 gene locus_tag LOCUS_46250 19529 18672 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_46250 19711 20667 gene locus_tag LOCUS_46260 19711 20667 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_46260 21214 20759 gene locus_tag LOCUS_46270 21214 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_46270 21946 21353 gene locus_tag LOCUS_46280 21946 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 23607 22108 gene locus_tag LOCUS_46290 23607 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 23783 26665 gene locus_tag LOCUS_46300 gene gcvP 23783 26665 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_46300 28252 26852 gene locus_tag LOCUS_46310 gene fumC 28252 26852 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_46310 28857 28375 gene locus_tag LOCUS_46320 28857 28375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 29266 28886 gene locus_tag LOCUS_46330 29266 28886 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_46330 30032 29343 gene locus_tag LOCUS_46340 gene rprY 30032 29343 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_46340 31708 30029 gene locus_tag LOCUS_46350 31708 30029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 31941 33173 gene locus_tag LOCUS_46360 31941 33173 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_46360 33566 33778 gene locus_tag LOCUS_46370 33566 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 34956 34369 gene locus_tag LOCUS_46380 34956 34369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 35739 34963 gene locus_tag LOCUS_46390 35739 34963 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_46390 37838 35736 gene locus_tag LOCUS_46400 37838 35736 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_46400 38601 37876 gene locus_tag LOCUS_46410 gene cysH 38601 37876 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_46410 39147 38731 gene locus_tag LOCUS_46420 39147 38731 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_46420 41269 39386 gene locus_tag LOCUS_46430 gene htpG 41269 39386 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_46430 41596 43896 gene locus_tag LOCUS_46440 41596 43896 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_46440 >Feature sequence42 1540 266 gene locus_tag LOCUS_46450 1540 266 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_46450 2482 4899 gene locus_tag LOCUS_46460 gene wzc 2482 4899 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_46460 5440 5228 gene locus_tag LOCUS_46470 5440 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 5439 6278 gene locus_tag LOCUS_46480 5439 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 6368 7330 gene locus_tag LOCUS_46490 6368 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 7401 8420 gene locus_tag LOCUS_46500 7401 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 8425 9732 gene locus_tag LOCUS_46510 gene algD 8425 9732 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_46510 10840 9848 gene locus_tag LOCUS_46520 10840 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 12132 11065 gene locus_tag LOCUS_46530 12132 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 13816 12917 gene locus_tag LOCUS_46540 13816 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 15457 13838 gene locus_tag LOCUS_46550 15457 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 17151 15634 gene locus_tag LOCUS_46560 17151 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 18416 17304 gene locus_tag LOCUS_46570 18416 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 28419 19015 gene locus_tag LOCUS_46580 28419 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 31167 29251 gene locus_tag LOCUS_46590 31167 29251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 32964 31993 gene locus_tag LOCUS_46600 32964 31993 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_46600 33824 33000 gene locus_tag LOCUS_46610 33824 33000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 34214 35323 gene locus_tag LOCUS_46620 34214 35323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 35417 36580 gene locus_tag LOCUS_46630 35417 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_46630 >Feature sequence43 2897 534 gene locus_tag LOCUS_46640 2897 534 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_46640 5151 3316 gene locus_tag LOCUS_46650 5151 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5730 7136 gene locus_tag LOCUS_46660 5730 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_46660 8162 7518 gene locus_tag LOCUS_46670 8162 7518 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_46670 9969 8365 gene locus_tag LOCUS_46680 gene sulP 9969 8365 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_46680 10332 10084 gene locus_tag LOCUS_46690 10332 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 11278 10610 gene locus_tag LOCUS_46700 11278 10610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_46700 13487 11316 gene locus_tag LOCUS_46710 13487 11316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_46710 16278 13849 gene locus_tag LOCUS_46720 16278 13849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_46720 18704 16290 gene locus_tag LOCUS_46730 18704 16290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_46730 21148 18716 gene locus_tag LOCUS_46740 21148 18716 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_46740 23639 21243 gene locus_tag LOCUS_46750 23639 21243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_46750 24375 23680 gene locus_tag LOCUS_46760 24375 23680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_46760 25693 24443 gene locus_tag LOCUS_46770 25693 24443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_46770 27043 25697 gene locus_tag LOCUS_46780 27043 25697 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_46780 27248 28612 gene locus_tag LOCUS_46790 27248 28612 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_46790 28612 29964 gene locus_tag LOCUS_46800 28612 29964 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_46800 30190 30265 gene locus_tag LOCUS_t00320 30190 30265 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30572 30276 gene locus_tag LOCUS_46810 30572 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 31470 30565 gene locus_tag LOCUS_46820 31470 30565 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_46820 31586 31981 gene locus_tag LOCUS_46830 31586 31981 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_46830 32667 34631 gene locus_tag LOCUS_46840 32667 34631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 >Feature sequence44 668 102 gene locus_tag LOCUS_46850 668 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 1921 767 gene locus_tag LOCUS_46860 1921 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 3198 2041 gene locus_tag LOCUS_46870 3198 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 4453 3302 gene locus_tag LOCUS_46880 4453 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5697 4558 gene locus_tag LOCUS_46890 5697 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 5971 5759 gene locus_tag LOCUS_46900 5971 5759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_46900 6427 5975 gene locus_tag LOCUS_46910 6427 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 6881 7873 gene locus_tag LOCUS_46920 6881 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 8467 7931 gene locus_tag LOCUS_46930 8467 7931 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_46930 8654 11254 gene locus_tag LOCUS_46940 gene mutS 8654 11254 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_46940 11390 11463 gene locus_tag LOCUS_t00330 11390 11463 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11555 11639 gene locus_tag LOCUS_t00340 11555 11639 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13878 11722 gene locus_tag LOCUS_46950 13878 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 14330 15475 gene locus_tag LOCUS_46960 14330 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 15972 15589 gene locus_tag LOCUS_46970 15972 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 16773 16528 gene locus_tag LOCUS_46980 16773 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 17227 18072 gene locus_tag LOCUS_46990 17227 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004326095.1 protein_id gnl|my_center|LOCUS_46990 18322 18630 gene locus_tag LOCUS_47000 18322 18630 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005926255.1 protein_id gnl|my_center|LOCUS_47000 18715 20178 gene locus_tag LOCUS_47010 18715 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_47010 20185 22266 gene locus_tag LOCUS_47020 20185 22266 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABK5 protein_id gnl|my_center|LOCUS_47020 22385 23173 gene locus_tag LOCUS_47030 22385 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 protein_id gnl|my_center|LOCUS_47030 23177 24106 gene locus_tag LOCUS_47040 23177 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_47040 24327 24764 gene locus_tag LOCUS_47050 24327 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485366.1 protein_id gnl|my_center|LOCUS_47050 24751 30150 gene locus_tag LOCUS_47060 24751 30150 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108226.1 protein_id gnl|my_center|LOCUS_47060 30728 30231 gene locus_tag LOCUS_47070 30728 30231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 30957 30745 gene locus_tag LOCUS_47080 30957 30745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 31840 30923 gene locus_tag LOCUS_47090 31840 30923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_47090 33034 31859 gene locus_tag LOCUS_47100 33034 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 >Feature sequence45 156 1250 gene locus_tag LOCUS_47110 156 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 1422 1967 gene locus_tag LOCUS_47120 1422 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 3751 5268 gene locus_tag LOCUS_47130 3751 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5362 6318 gene locus_tag LOCUS_47140 5362 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 6518 7501 gene locus_tag LOCUS_47150 6518 7501 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_47150 7844 8473 gene locus_tag LOCUS_47160 7844 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47160 8443 9852 gene locus_tag LOCUS_47170 8443 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 9833 10924 gene locus_tag LOCUS_47180 9833 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 14627 10989 gene locus_tag LOCUS_47190 14627 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 15497 14640 gene locus_tag LOCUS_47200 15497 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 15638 16741 gene locus_tag LOCUS_47210 15638 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 16967 17617 gene locus_tag LOCUS_47220 16967 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 18552 17641 gene locus_tag LOCUS_47230 18552 17641 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_47230 19534 18623 gene locus_tag LOCUS_47240 gene fjo11 19534 18623 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_47240 20571 19582 gene locus_tag LOCUS_47250 20571 19582 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_47250 20721 21659 gene locus_tag LOCUS_47260 20721 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 21893 22831 gene locus_tag LOCUS_47270 21893 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 22824 23030 gene locus_tag LOCUS_47280 22824 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 23014 23853 gene locus_tag LOCUS_47290 23014 23853 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_47290 23966 24628 gene locus_tag LOCUS_47300 gene psd 23966 24628 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_47300 25326 24682 gene locus_tag LOCUS_47310 25326 24682 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 protein_id gnl|my_center|LOCUS_47310 26083 25316 gene locus_tag LOCUS_47320 26083 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 27131 26781 gene locus_tag LOCUS_47330 27131 26781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 27529 28365 gene locus_tag LOCUS_47340 27529 28365 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619395.1 protein_id gnl|my_center|LOCUS_47340 29554 28523 gene locus_tag LOCUS_47350 29554 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence46 1293 478 gene locus_tag LOCUS_47360 1293 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 2693 3394 gene locus_tag LOCUS_47370 2693 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 4135 3680 gene locus_tag LOCUS_47380 4135 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 4895 4491 gene locus_tag LOCUS_47390 4895 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 7115 5241 gene locus_tag LOCUS_47400 7115 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 8613 7459 gene locus_tag LOCUS_47410 8613 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 10310 9036 gene locus_tag LOCUS_47420 10310 9036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_47420 10768 10307 gene locus_tag LOCUS_47430 10768 10307 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_47430 11643 10765 gene locus_tag LOCUS_47440 11643 10765 CDS product sialic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017179.1 protein_id gnl|my_center|LOCUS_47440 17087 11835 gene locus_tag LOCUS_47450 17087 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 17192 18181 gene locus_tag LOCUS_47460 gene asd 17192 18181 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_47460 18182 19387 gene locus_tag LOCUS_47470 18182 19387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_47470 22917 19888 gene locus_tag LOCUS_47480 gene infB 22917 19888 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_47480 24232 22988 gene locus_tag LOCUS_47490 gene nusA 24232 22988 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_47490 24708 24238 gene locus_tag LOCUS_47500 gene rimP 24708 24238 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_47500 24867 26363 gene locus_tag LOCUS_47510 gene cysS 24867 26363 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F4 protein_id gnl|my_center|LOCUS_47510 26353 27345 gene locus_tag LOCUS_47520 26353 27345 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_47520 27369 28523 gene locus_tag LOCUS_47530 27369 28523 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_47530 >Feature sequence47 336 839 gene locus_tag LOCUS_47540 336 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 940 1902 gene locus_tag LOCUS_47550 940 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 2791 2090 gene locus_tag LOCUS_47560 2791 2090 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_47560 3824 2778 gene locus_tag LOCUS_47570 3824 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 3986 5371 gene locus_tag LOCUS_47580 3986 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 5381 8665 gene locus_tag LOCUS_47590 5381 8665 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_47590 8655 9743 gene locus_tag LOCUS_47600 8655 9743 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_47600 10808 10065 gene locus_tag LOCUS_47610 10808 10065 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_47610 11470 10805 gene locus_tag LOCUS_47620 11470 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 12851 11871 gene locus_tag LOCUS_47630 12851 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_47630 14087 12858 gene locus_tag LOCUS_47640 14087 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 14420 15625 gene locus_tag LOCUS_47650 14420 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 15668 16096 gene locus_tag LOCUS_47660 15668 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 16399 17538 gene locus_tag LOCUS_47670 16399 17538 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392111.1 protein_id gnl|my_center|LOCUS_47670 19457 17880 gene locus_tag LOCUS_47680 19457 17880 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6X5 protein_id gnl|my_center|LOCUS_47680 19966 20742 gene locus_tag LOCUS_47690 19966 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 20840 22132 gene locus_tag LOCUS_47700 20840 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 23444 22332 gene locus_tag LOCUS_47710 23444 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 23925 24344 gene locus_tag LOCUS_47720 23925 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963066.1 protein_id gnl|my_center|LOCUS_47720 >Feature sequence48 931 215 gene locus_tag LOCUS_47730 931 215 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_47730 1992 961 gene locus_tag LOCUS_47740 1992 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 2943 2005 gene locus_tag LOCUS_47750 2943 2005 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP0 protein_id gnl|my_center|LOCUS_47750 3962 3099 gene locus_tag LOCUS_47760 3962 3099 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_47760 6198 4063 gene locus_tag LOCUS_47770 gene pnp 6198 4063 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_47770 6575 6300 gene locus_tag LOCUS_47780 gene rpsO 6575 6300 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 protein_id gnl|my_center|LOCUS_47780 8468 6639 gene locus_tag LOCUS_47790 8468 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 9173 8694 gene locus_tag LOCUS_47800 9173 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 9192 9266 gene locus_tag LOCUS_t00350 9192 9266 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10174 9830 gene locus_tag LOCUS_47810 gene rplT 10174 9830 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_47810 11038 10487 gene locus_tag LOCUS_47820 gene infC 11038 10487 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_47820 13079 11124 gene locus_tag LOCUS_47830 gene thrS 13079 11124 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_47830 13635 14051 gene locus_tag LOCUS_47840 13635 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_47840 14837 14145 gene locus_tag LOCUS_47850 gene trmH 14837 14145 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51081 protein_id gnl|my_center|LOCUS_47850 17443 14849 gene locus_tag LOCUS_47860 gene parC 17443 14849 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_47860 19554 17650 gene locus_tag LOCUS_47870 gene parE 19554 17650 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_47870 20071 19574 gene locus_tag LOCUS_47880 20071 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 21760 20168 gene locus_tag LOCUS_47890 21760 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 22604 21828 gene locus_tag LOCUS_47900 gene phhA 22604 21828 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_47900 22950 23516 gene locus_tag LOCUS_47910 22950 23516 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_47910 23679 24029 gene locus_tag LOCUS_47920 23679 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 >Feature sequence49 1165 368 gene locus_tag LOCUS_47930 1165 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 3343 2534 gene locus_tag LOCUS_47940 3343 2534 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_47940 4598 3336 gene locus_tag LOCUS_47950 4598 3336 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_47950 8939 4617 gene locus_tag LOCUS_47960 8939 4617 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109046.1 protein_id gnl|my_center|LOCUS_47960 10002 9592 gene locus_tag LOCUS_47970 10002 9592 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_47970 12101 10002 gene locus_tag LOCUS_47980 12101 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 13151 12108 gene locus_tag LOCUS_47990 13151 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_47990 14584 13151 gene locus_tag LOCUS_48000 14584 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 16704 14620 gene locus_tag LOCUS_48010 16704 14620 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_48010 17001 16717 gene locus_tag LOCUS_48020 17001 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 17627 17121 gene locus_tag LOCUS_48030 17627 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 18782 18147 gene locus_tag LOCUS_48040 18782 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 19243 18794 gene locus_tag LOCUS_48050 19243 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 20015 19248 gene locus_tag LOCUS_48060 20015 19248 CDS product conjugal transfer protein TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107109.1 protein_id gnl|my_center|LOCUS_48060 20753 21190 gene locus_tag LOCUS_48070 20753 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007216065.1 protein_id gnl|my_center|LOCUS_48070 21193 22482 gene locus_tag LOCUS_48080 21193 22482 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107110.1 protein_id gnl|my_center|LOCUS_48080 22583 23338 gene locus_tag LOCUS_48090 22583 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 >Feature sequence50 1291 134 gene locus_tag LOCUS_48100 1291 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 1934 2788 gene locus_tag LOCUS_48110 1934 2788 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_48110 3298 4959 gene locus_tag LOCUS_48120 3298 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122167.1 protein_id gnl|my_center|LOCUS_48120 5013 6149 gene locus_tag LOCUS_48130 5013 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 7070 6819 gene locus_tag LOCUS_48140 7070 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 7658 7413 gene locus_tag LOCUS_48150 7658 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 8137 7838 gene locus_tag LOCUS_48160 8137 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 8440 8150 gene locus_tag LOCUS_48170 8440 8150 CDS product protein killer gene system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816230.1 protein_id gnl|my_center|LOCUS_48170 9411 9935 gene locus_tag LOCUS_48180 9411 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_48180 11317 10166 gene locus_tag LOCUS_48190 11317 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 12200 11964 gene locus_tag LOCUS_48200 12200 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48200 12880 13542 gene locus_tag LOCUS_48210 12880 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 14272 13553 gene locus_tag LOCUS_48220 14272 13553 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708757.1 protein_id gnl|my_center|LOCUS_48220 15842 14259 gene locus_tag LOCUS_48230 15842 14259 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090936.1 protein_id gnl|my_center|LOCUS_48230 16072 16614 gene locus_tag LOCUS_48240 16072 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 18352 17738 gene locus_tag LOCUS_48250 18352 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 18693 18349 gene locus_tag LOCUS_48260 18693 18349 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_48260 20830 20027 gene locus_tag LOCUS_48270 20830 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48270 21881 21240 gene locus_tag LOCUS_48280 21881 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence51 134 340 gene locus_tag LOCUS_48290 134 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 283 456 gene locus_tag LOCUS_48300 283 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 456 1106 gene locus_tag LOCUS_48310 456 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_48310 1209 3209 gene locus_tag LOCUS_48320 1209 3209 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071086.1 protein_id gnl|my_center|LOCUS_48320 3209 3826 gene locus_tag LOCUS_48330 3209 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 4260 5216 gene locus_tag LOCUS_48340 4260 5216 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_48340 5827 6747 gene locus_tag LOCUS_48350 5827 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 7943 7113 gene locus_tag LOCUS_48360 7943 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 8405 8866 gene locus_tag LOCUS_48370 gene yjaB 8405 8866 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_48370 9345 10376 gene locus_tag LOCUS_48380 9345 10376 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_48380 10880 12019 gene locus_tag LOCUS_48390 10880 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 12061 14640 gene locus_tag LOCUS_48400 12061 14640 CDS product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_48400 14788 15396 gene locus_tag LOCUS_48410 14788 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 15523 16524 gene locus_tag LOCUS_48420 15523 16524 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_48420 16740 20168 gene locus_tag LOCUS_48430 16740 20168 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_48430 20186 21721 gene locus_tag LOCUS_48440 20186 21721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_48440 >Feature sequence52 668 258 gene locus_tag LOCUS_48450 668 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 1595 672 gene locus_tag LOCUS_48460 1595 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 10211 1596 gene locus_tag LOCUS_48470 10211 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 11118 10222 gene locus_tag LOCUS_48480 11118 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 11928 13517 gene locus_tag LOCUS_48490 11928 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 13980 13771 gene locus_tag LOCUS_48500 13980 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 15233 13947 gene locus_tag LOCUS_48510 15233 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 15959 15886 gene locus_tag LOCUS_t00360 15959 15886 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18141 16108 gene locus_tag LOCUS_48520 18141 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_48520 18749 18201 gene locus_tag LOCUS_48530 18749 18201 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_48530 18869 19507 gene locus_tag LOCUS_48540 gene pdxH 18869 19507 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_48540 >Feature sequence53 434 171 gene locus_tag LOCUS_48550 434 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 840 427 gene locus_tag LOCUS_48560 840 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 1570 1100 gene locus_tag LOCUS_48570 1570 1100 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_48570 2609 1563 gene locus_tag LOCUS_48580 gene ribD 2609 1563 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_48580 3315 2611 gene locus_tag LOCUS_48590 3315 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 4529 3468 gene locus_tag LOCUS_48600 4529 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 4784 5968 gene locus_tag LOCUS_48610 4784 5968 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_48610 5972 9151 gene locus_tag LOCUS_48620 5972 9151 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_48620 9163 10584 gene locus_tag LOCUS_48630 9163 10584 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_48630 10636 11964 gene locus_tag LOCUS_48640 gene dgt 10636 11964 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_48640 13009 16383 gene locus_tag LOCUS_48650 gene ileS 13009 16383 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_48650 16385 17026 gene locus_tag LOCUS_48660 gene lspA 16385 17026 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_48660 >Feature sequence54 173 526 gene locus_tag LOCUS_48670 173 526 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_48670 710 1408 gene locus_tag LOCUS_48680 710 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 1692 2390 gene locus_tag LOCUS_48690 1692 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 protein_id gnl|my_center|LOCUS_48690 3225 2491 gene locus_tag LOCUS_48700 3225 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 3571 3975 gene locus_tag LOCUS_48710 3571 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 4285 5253 gene locus_tag LOCUS_48720 4285 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 5265 5915 gene locus_tag LOCUS_48730 5265 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 5939 6709 gene locus_tag LOCUS_48740 5939 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 6709 7287 gene locus_tag LOCUS_48750 6709 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 7316 7933 gene locus_tag LOCUS_48760 7316 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 8146 8310 gene locus_tag LOCUS_48770 8146 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 8334 9038 gene locus_tag LOCUS_48780 8334 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 9385 10230 gene locus_tag LOCUS_48790 9385 10230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_48790 11837 10314 gene locus_tag LOCUS_48800 11837 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 12224 12994 gene locus_tag LOCUS_48810 12224 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48810 13145 14485 gene locus_tag LOCUS_48820 13145 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48820 >Feature sequence55 1054 203 gene locus_tag LOCUS_48830 1054 203 CDS product internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483943.1 protein_id gnl|my_center|LOCUS_48830 1848 1141 gene locus_tag LOCUS_48840 1848 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 2327 1845 gene locus_tag LOCUS_48850 2327 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 3133 2330 gene locus_tag LOCUS_48860 3133 2330 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600639.1 protein_id gnl|my_center|LOCUS_48860 6230 4527 gene locus_tag LOCUS_48870 6230 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 8270 6672 gene locus_tag LOCUS_48880 8270 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 10414 8672 gene locus_tag LOCUS_48890 10414 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 11848 11297 gene locus_tag LOCUS_48900 11848 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 12071 11859 gene locus_tag LOCUS_48910 12071 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 >Feature sequence56 126 701 gene locus_tag LOCUS_48920 126 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 902 1243 gene locus_tag LOCUS_48930 902 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 1469 2758 gene locus_tag LOCUS_48940 1469 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 3538 4821 gene locus_tag LOCUS_48950 3538 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 8897 5307 gene locus_tag LOCUS_48960 8897 5307 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_48960 10073 8898 gene locus_tag LOCUS_48970 10073 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 >Feature sequence57 1002 346 gene locus_tag LOCUS_48980 1002 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 2332 1607 gene locus_tag LOCUS_48990 2332 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705544.1 protein_id gnl|my_center|LOCUS_48990 3450 2335 gene locus_tag LOCUS_49000 3450 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 4180 3452 gene locus_tag LOCUS_49010 4180 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 8177 4623 gene locus_tag LOCUS_49020 8177 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence58 <1 1353 gene locus_tag LOCUS_49030 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000260080.1:DEAD/DEAH box helicase note possible pseudo, frameshifted 1563 2525 gene locus_tag LOCUS_49040 1563 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 2895 3245 gene locus_tag LOCUS_49050 2895 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 3518 3739 gene locus_tag LOCUS_49060 3518 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5985 3841 gene locus_tag LOCUS_49070 5985 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119909.1 protein_id gnl|my_center|LOCUS_49070 6921 6616 gene locus_tag LOCUS_49080 6921 6616 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_49080 7067 7249 gene locus_tag LOCUS_49090 7067 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence59 140 1105 gene locus_tag LOCUS_49100 140 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 1233 2702 gene locus_tag LOCUS_49110 1233 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 2699 5026 gene locus_tag LOCUS_49120 2699 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5129 5827 gene locus_tag LOCUS_49130 5129 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 5865 6341 gene locus_tag LOCUS_49140 5865 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 6519 7043 gene locus_tag LOCUS_49150 6519 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence60 503 1828 gene locus_tag LOCUS_49160 503 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 2074 2283 gene locus_tag LOCUS_49170 2074 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2280 2867 gene locus_tag LOCUS_49180 2280 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49180 3030 3191 gene locus_tag LOCUS_49190 3030 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 3598 4752 gene locus_tag LOCUS_49200 3598 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 4919 6250 gene locus_tag LOCUS_49210 4919 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence61 2002 758 gene locus_tag LOCUS_49220 2002 758 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 protein_id gnl|my_center|LOCUS_49220 3482 2307 gene locus_tag LOCUS_49230 3482 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 3709 4947 gene locus_tag LOCUS_49240 3709 4947 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_49240 >Feature sequence62 1133 309 gene locus_tag LOCUS_49250 1133 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 1661 1458 gene locus_tag LOCUS_49260 1661 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 3427 1817 gene locus_tag LOCUS_49270 3427 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 3687 3448 gene locus_tag LOCUS_49280 3687 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_49280 >Feature sequence63 1243 1037 gene locus_tag LOCUS_49290 1243 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 1665 1970 gene locus_tag LOCUS_49300 1665 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 2171 3298 gene locus_tag LOCUS_49310 2171 3298 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_49310 3302 3832 gene locus_tag LOCUS_49320 3302 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 >Feature sequence64 942 2696 gene locus_tag LOCUS_49330 942 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_49330 >Feature sequence65 1173 541 gene locus_tag LOCUS_49340 1173 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 3589 2060 gene locus_tag LOCUS_49350 3589 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202573.1 protein_id gnl|my_center|LOCUS_49350 >Feature sequence66 130 1038 gene locus_tag LOCUS_49360 130 1038 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_49360 1468 1608 gene locus_tag LOCUS_49370 1468 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 1696 1839 gene locus_tag LOCUS_49380 1696 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 1814 3103 gene locus_tag LOCUS_49390 1814 3103 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_49390 >Feature sequence67 <1 1619 gene locus_tag LOCUS_49400 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter 1616 2863 gene locus_tag LOCUS_49410 1616 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 >Feature sequence68 <1 1619 gene locus_tag LOCUS_49420 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter 1616 2863 gene locus_tag LOCUS_49430 1616 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 >Feature sequence69 752 994 gene locus_tag LOCUS_49440 752 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 991 1389 gene locus_tag LOCUS_49450 gene vapC 991 1389 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3Y7 protein_id gnl|my_center|LOCUS_49450 1636 2031 gene locus_tag LOCUS_49460 1636 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_49460 >Feature sequence70 153 854 gene locus_tag LOCUS_49470 153 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 870 1781 gene locus_tag LOCUS_49480 870 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 1884 2453 gene locus_tag LOCUS_49490 1884 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 >Feature sequence71 423 85 gene locus_tag LOCUS_49500 423 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 1947 700 gene locus_tag LOCUS_49510 1947 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405198.1 protein_id gnl|my_center|LOCUS_49510 >Feature sequence72 1015 671 gene locus_tag LOCUS_49520 1015 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 1581 1327 gene locus_tag LOCUS_49530 1581 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 >Feature sequence73 1240 845 gene locus_tag LOCUS_49540 1240 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_49540 >Feature sequence74 273 848 gene locus_tag LOCUS_49550 273 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 829 1908 gene locus_tag LOCUS_49560 829 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 >Feature sequence75 >Feature sequence76 <1814 291 gene locus_tag LOCUS_49570 <1814 291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962407.1:metalloprotease Fpp1 >Feature sequence77 >Feature sequence78 418 684 gene locus_tag LOCUS_49580 418 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 >Feature sequence79 514 1323 gene locus_tag LOCUS_49590 gene nagD 514 1323 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_49590 >Feature sequence80 >Feature sequence81 >Feature sequence82 >Feature sequence83 >Feature sequence84 160 483 gene locus_tag LOCUS_49600 160 483 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_49600 452 793 gene locus_tag LOCUS_49610 452 793 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_49610