>Feature sequence001 3272 1287 gene locus_tag LOCUS_00010 3272 1287 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_00010 4450 3269 gene locus_tag LOCUS_00020 4450 3269 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_00020 5683 4805 gene locus_tag LOCUS_00030 gene htpX 5683 4805 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_00030 6145 5876 gene locus_tag LOCUS_00040 6145 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7474 6173 gene locus_tag LOCUS_00050 7474 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7592 8461 gene locus_tag LOCUS_00060 7592 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_00060 8482 9687 gene locus_tag LOCUS_00070 8482 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_00070 9714 11036 gene locus_tag LOCUS_00080 9714 11036 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_00080 11158 11859 gene locus_tag LOCUS_00090 11158 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11879 14536 gene locus_tag LOCUS_00100 11879 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14529 15353 gene locus_tag LOCUS_00110 14529 15353 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_00110 17393 15384 gene locus_tag LOCUS_00120 gene nosR 17393 15384 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL3 protein_id gnl|my_center|LOCUS_00120 18334 17447 gene locus_tag LOCUS_00130 18334 17447 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_00130 18450 19082 gene locus_tag LOCUS_00140 18450 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19079 19834 gene locus_tag LOCUS_00150 gene lpsC 19079 19834 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207637.1 protein_id gnl|my_center|LOCUS_00150 21069 19861 gene locus_tag LOCUS_00160 21069 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_00160 21093 21398 gene locus_tag LOCUS_00170 21093 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22110 21358 gene locus_tag LOCUS_00180 22110 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22268 23104 gene locus_tag LOCUS_00190 22268 23104 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_00190 23214 23390 gene locus_tag LOCUS_00200 23214 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23523 23861 gene locus_tag LOCUS_00210 23523 23861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886906.1 protein_id gnl|my_center|LOCUS_00210 23848 25116 gene locus_tag LOCUS_00220 23848 25116 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_00220 25704 25390 gene locus_tag LOCUS_00230 25704 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26035 25709 gene locus_tag LOCUS_00240 26035 25709 CDS product addiction module killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_00240 26672 26596 gene locus_tag LOCUS_t00010 26672 26596 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26957 29158 gene locus_tag LOCUS_00250 gene gcd-1 26957 29158 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_00250 29207 29746 gene locus_tag LOCUS_00260 gene tag 29207 29746 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_00260 29743 30120 gene locus_tag LOCUS_00270 29743 30120 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_00270 30831 30265 gene locus_tag LOCUS_00280 30831 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31322 30834 gene locus_tag LOCUS_00290 31322 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32047 31349 gene locus_tag LOCUS_00300 32047 31349 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_00300 32789 32064 gene locus_tag LOCUS_00310 32789 32064 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_00310 34231 32807 gene locus_tag LOCUS_00320 34231 32807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_00320 34447 34758 gene locus_tag LOCUS_00330 34447 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035467.1 protein_id gnl|my_center|LOCUS_00330 35048 38029 gene locus_tag LOCUS_00340 35048 38029 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_00340 39438 38188 gene locus_tag LOCUS_00350 39438 38188 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_00350 39586 40329 gene locus_tag LOCUS_00360 gene fpr 39586 40329 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175876.1 protein_id gnl|my_center|LOCUS_00360 42029 40320 gene locus_tag LOCUS_00370 gene gatA 42029 40320 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_00370 43392 42022 gene locus_tag LOCUS_00380 43392 42022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_00380 44119 43373 gene locus_tag LOCUS_00390 44119 43373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_00390 46295 44124 gene locus_tag LOCUS_00400 46295 44124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47985 46285 gene locus_tag LOCUS_00410 47985 46285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48198 48587 gene locus_tag LOCUS_00420 48198 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48674 51643 gene locus_tag LOCUS_00430 48674 51643 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_00430 51640 52575 gene locus_tag LOCUS_00440 51640 52575 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594318.1 protein_id gnl|my_center|LOCUS_00440 52578 53441 gene locus_tag LOCUS_00450 52578 53441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53438 54397 gene locus_tag LOCUS_00460 53438 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54415 55992 gene locus_tag LOCUS_00470 54415 55992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55989 57650 gene locus_tag LOCUS_00480 55989 57650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57683 58009 gene locus_tag LOCUS_00490 57683 58009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58009 58887 gene locus_tag LOCUS_00500 58009 58887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59946 58888 gene locus_tag LOCUS_00510 59946 58888 CDS product glycosyl transferase family 9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence002 2992 983 gene locus_tag LOCUS_00520 gene asnB 2992 983 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_00520 4104 3034 gene locus_tag LOCUS_00530 gene pyrB 4104 3034 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_00530 5653 4235 gene locus_tag LOCUS_00540 gene dur3 5653 4235 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_00540 6108 5650 gene locus_tag LOCUS_00550 6108 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6942 6286 gene locus_tag LOCUS_00560 6942 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7061 9268 gene locus_tag LOCUS_00570 7061 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 protein_id gnl|my_center|LOCUS_00570 9316 11613 gene locus_tag LOCUS_00580 9316 11613 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088923.1 protein_id gnl|my_center|LOCUS_00580 11674 11892 gene locus_tag LOCUS_00590 11674 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12287 11889 gene locus_tag LOCUS_00600 12287 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 12275 13732 gene locus_tag LOCUS_00610 12275 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_00610 14908 13736 gene locus_tag LOCUS_00620 14908 13736 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_00620 15799 14966 gene locus_tag LOCUS_00630 15799 14966 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388336.1 protein_id gnl|my_center|LOCUS_00630 17305 15893 gene locus_tag LOCUS_00640 17305 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_00640 17602 18879 gene locus_tag LOCUS_00650 17602 18879 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_00650 18960 19682 gene locus_tag LOCUS_00660 gene ycfV 18960 19682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_00660 19695 21005 gene locus_tag LOCUS_00670 gene ybjZ 19695 21005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_00670 21030 22241 gene locus_tag LOCUS_00680 gene ybjZ 21030 22241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_00680 23684 22293 gene locus_tag LOCUS_00690 23684 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117990.1 protein_id gnl|my_center|LOCUS_00690 25041 23704 gene locus_tag LOCUS_00700 25041 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_00700 27551 25038 gene locus_tag LOCUS_00710 27551 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 28312 27695 gene locus_tag LOCUS_00720 gene leuD 28312 27695 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083247.1 protein_id gnl|my_center|LOCUS_00720 29799 28309 gene locus_tag LOCUS_00730 gene leuC1 29799 28309 CDS product 3-isopropylmalate dehydratase large subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X98 protein_id gnl|my_center|LOCUS_00730 30027 31142 gene locus_tag LOCUS_00740 30027 31142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 34065 31252 gene locus_tag LOCUS_00750 34065 31252 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_00750 34776 35600 gene locus_tag LOCUS_00760 34776 35600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 35626 36969 gene locus_tag LOCUS_00770 35626 36969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 37007 39151 gene locus_tag LOCUS_00780 37007 39151 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_00780 39221 41278 gene locus_tag LOCUS_00790 39221 41278 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_00790 41313 42092 gene locus_tag LOCUS_00800 41313 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 42186 42776 gene locus_tag LOCUS_00810 42186 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_00810 42870 44417 gene locus_tag LOCUS_00820 gene yacK 42870 44417 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815585.1 protein_id gnl|my_center|LOCUS_00820 44424 46100 gene locus_tag LOCUS_00830 44424 46100 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705127.1 protein_id gnl|my_center|LOCUS_00830 47240 46161 gene locus_tag LOCUS_00840 47240 46161 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence003 266 1114 gene locus_tag LOCUS_00850 gene ispE 266 1114 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_00850 1172 1246 gene locus_tag LOCUS_t00020 1172 1246 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1331 2281 gene locus_tag LOCUS_00860 gene prs 1331 2281 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_00860 2284 3060 gene locus_tag LOCUS_00870 gene rplY 2284 3060 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_00870 3103 3699 gene locus_tag LOCUS_00880 gene pth 3103 3699 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_00880 3696 4787 gene locus_tag LOCUS_00890 gene ychF 3696 4787 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_00890 4864 4940 gene locus_tag LOCUS_t00030 4864 4940 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7172 5040 gene locus_tag LOCUS_00900 7172 5040 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141907.1 protein_id gnl|my_center|LOCUS_00900 7686 7279 gene locus_tag LOCUS_00910 7686 7279 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930904.1 protein_id gnl|my_center|LOCUS_00910 9660 7717 gene locus_tag LOCUS_00920 9660 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10686 9778 gene locus_tag LOCUS_00930 10686 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 10956 13580 gene locus_tag LOCUS_00940 10956 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 14531 14166 gene locus_tag LOCUS_00950 14531 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 14640 15152 gene locus_tag LOCUS_00960 14640 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16145 15156 gene locus_tag LOCUS_00970 16145 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404655.1 protein_id gnl|my_center|LOCUS_00970 19367 16164 gene locus_tag LOCUS_00980 19367 16164 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_00980 20549 19377 gene locus_tag LOCUS_00990 20549 19377 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_00990 21274 20546 gene locus_tag LOCUS_01000 21274 20546 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525327.1 protein_id gnl|my_center|LOCUS_01000 21651 23645 gene locus_tag LOCUS_01010 21651 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 24327 23671 gene locus_tag LOCUS_01020 24327 23671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 25056 24436 gene locus_tag LOCUS_01030 25056 24436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 25164 25928 gene locus_tag LOCUS_01040 25164 25928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 25932 26357 gene locus_tag LOCUS_01050 25932 26357 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_01050 27365 26364 gene locus_tag LOCUS_01060 27365 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 29665 27419 gene locus_tag LOCUS_01070 29665 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_01070 33297 29743 gene locus_tag LOCUS_01080 gene ytfN 33297 29743 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060812.1 protein_id gnl|my_center|LOCUS_01080 35090 33330 gene locus_tag LOCUS_01090 35090 33330 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_01090 35254 35703 gene locus_tag LOCUS_01100 35254 35703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 35801 36292 gene locus_tag LOCUS_01110 35801 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 36378 36905 gene locus_tag LOCUS_01120 36378 36905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 36905 37618 gene locus_tag LOCUS_01130 36905 37618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_01130 37634 38224 gene locus_tag LOCUS_01140 37634 38224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 38837 38370 gene locus_tag LOCUS_01150 38837 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 39831 38941 gene locus_tag LOCUS_01160 39831 38941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 40375 40046 gene locus_tag LOCUS_01170 40375 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01170 40650 40303 gene locus_tag LOCUS_01180 40650 40303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 41054 40680 gene locus_tag LOCUS_01190 41054 40680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 42466 41120 gene locus_tag LOCUS_01200 42466 41120 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_01200 <43570 42469 gene locus_tag LOCUS_01210 <43570 42469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531857.1:GMC family oxidoreductase >Feature sequence004 <1 1867 gene locus_tag LOCUS_01220 <1 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545101.1:adenylate/guanylate cyclase domain-containing protein 1877 2548 gene locus_tag LOCUS_01230 1877 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2603 3277 gene locus_tag LOCUS_01240 2603 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3600 7649 gene locus_tag LOCUS_01250 3600 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7796 8581 gene locus_tag LOCUS_01260 7796 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 8646 10157 gene locus_tag LOCUS_01270 8646 10157 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 protein_id gnl|my_center|LOCUS_01270 10242 10943 gene locus_tag LOCUS_01280 10242 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10961 11806 gene locus_tag LOCUS_01290 10961 11806 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204069.1 protein_id gnl|my_center|LOCUS_01290 11881 12087 gene locus_tag LOCUS_01300 11881 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 12084 12461 gene locus_tag LOCUS_01310 12084 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12488 13435 gene locus_tag LOCUS_01320 12488 13435 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_01320 13457 14329 gene locus_tag LOCUS_01330 gene rfbA 13457 14329 CDS product glucose-1-phosphate thymidylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37779 protein_id gnl|my_center|LOCUS_01330 14340 14885 gene locus_tag LOCUS_01340 14340 14885 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344923.1 protein_id gnl|my_center|LOCUS_01340 14882 15796 gene locus_tag LOCUS_01350 gene rfbD 14882 15796 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_01350 15793 16896 gene locus_tag LOCUS_01360 gene rfbB 15793 16896 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_01360 16929 18395 gene locus_tag LOCUS_01370 16929 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 18523 19023 gene locus_tag LOCUS_01380 18523 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01380 19056 19451 gene locus_tag LOCUS_01390 19056 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 19590 21095 gene locus_tag LOCUS_01400 19590 21095 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_01400 21363 21070 gene locus_tag LOCUS_01410 21363 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 21628 21966 gene locus_tag LOCUS_01420 gene glnK 21628 21966 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_01420 22029 23300 gene locus_tag LOCUS_01430 gene amtB 22029 23300 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_01430 23527 24813 gene locus_tag LOCUS_01440 23527 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 25529 24810 gene locus_tag LOCUS_01450 25529 24810 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_01450 26382 25531 gene locus_tag LOCUS_01460 gene metF 26382 25531 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 protein_id gnl|my_center|LOCUS_01460 27793 26384 gene locus_tag LOCUS_01470 gene ahcY 27793 26384 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 protein_id gnl|my_center|LOCUS_01470 28991 27831 gene locus_tag LOCUS_01480 gene metK 28991 27831 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX3 protein_id gnl|my_center|LOCUS_01480 30017 29052 gene locus_tag LOCUS_01490 30017 29052 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316359.1 protein_id gnl|my_center|LOCUS_01490 30266 32263 gene locus_tag LOCUS_01500 gene tktA 30266 32263 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3V6 protein_id gnl|my_center|LOCUS_01500 32297 33325 gene locus_tag LOCUS_01510 gene epd 32297 33325 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_01510 33337 34491 gene locus_tag LOCUS_01520 gene pgk 33337 34491 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y4 protein_id gnl|my_center|LOCUS_01520 34530 35579 gene locus_tag LOCUS_01530 gene fba 34530 35579 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_01530 35604 36569 gene locus_tag LOCUS_01540 35604 36569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_01540 37795 36566 gene locus_tag LOCUS_01550 gene serA 37795 36566 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_01550 37944 39368 gene locus_tag LOCUS_01560 37944 39368 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_01560 39397 39762 gene locus_tag LOCUS_01570 39397 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 40576 39905 gene locus_tag LOCUS_01580 gene rpiA 40576 39905 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLU8 protein_id gnl|my_center|LOCUS_01580 <41209 40641 gene locus_tag LOCUS_01590 <41209 40641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUK8:phosphatidylserine decarboxylase proenzyme >Feature sequence005 310 2583 gene locus_tag LOCUS_01600 310 2583 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_01600 3377 2589 gene locus_tag LOCUS_01610 3377 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_01610 3503 3742 gene locus_tag LOCUS_01620 3503 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4187 4978 gene locus_tag LOCUS_01630 gene lgt 4187 4978 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_01630 4993 5826 gene locus_tag LOCUS_01640 gene thyA 4993 5826 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_01640 5848 6351 gene locus_tag LOCUS_01650 5848 6351 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM58 protein_id gnl|my_center|LOCUS_01650 7786 6461 gene locus_tag LOCUS_01660 gene argA 7786 6461 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU5 protein_id gnl|my_center|LOCUS_01660 9015 7858 gene locus_tag LOCUS_01670 gene argE 9015 7858 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_01670 9421 9068 gene locus_tag LOCUS_01680 9421 9068 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_01680 10561 9422 gene locus_tag LOCUS_01690 10561 9422 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_01690 11148 10540 gene locus_tag LOCUS_01700 gene rdgB 11148 10540 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGJ7 protein_id gnl|my_center|LOCUS_01700 11741 11148 gene locus_tag LOCUS_01710 11741 11148 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_01710 12918 11731 gene locus_tag LOCUS_01720 gene metX 12918 11731 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_01720 13211 12915 gene locus_tag LOCUS_01730 13211 12915 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ3 protein_id gnl|my_center|LOCUS_01730 13829 13230 gene locus_tag LOCUS_01740 13829 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_01740 14647 13862 gene locus_tag LOCUS_01750 gene proC 14647 13862 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_01750 15452 14769 gene locus_tag LOCUS_01760 15452 14769 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_01760 15531 16565 gene locus_tag LOCUS_01770 gene pilT 15531 16565 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_01770 17024 16578 gene locus_tag LOCUS_01780 gene yqgF 17024 16578 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHG2 protein_id gnl|my_center|LOCUS_01780 17634 17053 gene locus_tag LOCUS_01790 17634 17053 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_01790 18598 17657 gene locus_tag LOCUS_01800 gene tonB3 18598 17657 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_01800 19521 18562 gene locus_tag LOCUS_01810 gene gshB 19521 18562 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_01810 19647 20147 gene locus_tag LOCUS_01820 19647 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 20152 21045 gene locus_tag LOCUS_01830 gene rfbQ 20152 21045 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_01830 21049 21975 gene locus_tag LOCUS_01840 21049 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 25229 21972 gene locus_tag LOCUS_01850 25229 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 25985 25266 gene locus_tag LOCUS_01860 25985 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 26824 25982 gene locus_tag LOCUS_01870 gene dapF 26824 25982 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_01870 28118 26871 gene locus_tag LOCUS_01880 gene lysA 28118 26871 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_01880 28461 29387 gene locus_tag LOCUS_01890 28461 29387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_01890 29415 30149 gene locus_tag LOCUS_01900 29415 30149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_01900 30151 32133 gene locus_tag LOCUS_01910 30151 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_01910 33461 32130 gene locus_tag LOCUS_01920 gene cpxA 33461 32130 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_01920 34159 33458 gene locus_tag LOCUS_01930 34159 33458 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_01930 34315 36231 gene locus_tag LOCUS_01940 34315 36231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_01940 36281 37354 gene locus_tag LOCUS_01950 gene degP 36281 37354 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_01950 38779 37379 gene locus_tag LOCUS_01960 gene argH 38779 37379 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_01960 38919 39848 gene locus_tag LOCUS_01970 gene hemC 38919 39848 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVM1 protein_id gnl|my_center|LOCUS_01970 39863 40639 gene locus_tag LOCUS_01980 gene hemD 39863 40639 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_01980 >Feature sequence006 644 288 gene locus_tag LOCUS_01990 644 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1195 710 gene locus_tag LOCUS_02000 1195 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3053 1350 gene locus_tag LOCUS_02010 3053 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109316.1 protein_id gnl|my_center|LOCUS_02010 5248 3329 gene locus_tag LOCUS_02020 5248 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204822.1 protein_id gnl|my_center|LOCUS_02020 5696 5238 gene locus_tag LOCUS_02030 5696 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204823.1 protein_id gnl|my_center|LOCUS_02030 6249 5749 gene locus_tag LOCUS_02040 6249 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6615 6286 gene locus_tag LOCUS_02050 6615 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7011 6802 gene locus_tag LOCUS_02060 7011 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7270 7001 gene locus_tag LOCUS_02070 7270 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_02070 7583 8605 gene locus_tag LOCUS_02080 7583 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8660 9709 gene locus_tag LOCUS_02090 8660 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_02090 10353 9742 gene locus_tag LOCUS_02100 10353 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 10567 10734 gene locus_tag LOCUS_02110 10567 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12065 10704 gene locus_tag LOCUS_02120 12065 10704 CDS product organophopsphate acid anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729793.1 protein_id gnl|my_center|LOCUS_02120 14082 12217 gene locus_tag LOCUS_02130 14082 12217 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 protein_id gnl|my_center|LOCUS_02130 14390 14199 gene locus_tag LOCUS_02140 14390 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14492 16099 gene locus_tag LOCUS_02150 gene ybiT 14492 16099 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_02150 16236 18065 gene locus_tag LOCUS_02160 16236 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_02160 18083 19357 gene locus_tag LOCUS_02170 18083 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_02170 19422 20201 gene locus_tag LOCUS_02180 19422 20201 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919230.1 protein_id gnl|my_center|LOCUS_02180 20658 20218 gene locus_tag LOCUS_02190 gene pilA 20658 20218 CDS product type IV-A pilin protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769527.1 protein_id gnl|my_center|LOCUS_02190 22148 20868 gene locus_tag LOCUS_02200 22148 20868 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_02200 22314 22583 gene locus_tag LOCUS_02210 22314 22583 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E847 protein_id gnl|my_center|LOCUS_02210 22570 22863 gene locus_tag LOCUS_02220 22570 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23049 22973 gene locus_tag LOCUS_t00040 23049 22973 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25007 23148 gene locus_tag LOCUS_02230 gene rpoD 25007 23148 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_02230 26965 25136 gene locus_tag LOCUS_02240 gene dnaG 26965 25136 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_02240 27519 27067 gene locus_tag LOCUS_02250 27519 27067 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_02250 27762 27547 gene locus_tag LOCUS_02260 gene rpsU 27762 27547 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_02260 27883 28911 gene locus_tag LOCUS_02270 gene tsaD 27883 28911 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_02270 28921 29286 gene locus_tag LOCUS_02280 28921 29286 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF6 protein_id gnl|my_center|LOCUS_02280 30509 29283 gene locus_tag LOCUS_02290 gene cca 30509 29283 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7ND45 protein_id gnl|my_center|LOCUS_02290 31327 30512 gene locus_tag LOCUS_02300 gene apaH 31327 30512 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_02300 32227 31406 gene locus_tag LOCUS_02310 gene rsmA 32227 31406 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A46 protein_id gnl|my_center|LOCUS_02310 33222 32224 gene locus_tag LOCUS_02320 gene pdxA 33222 32224 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19624 protein_id gnl|my_center|LOCUS_02320 34539 33232 gene locus_tag LOCUS_02330 gene surA 34539 33232 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A44 protein_id gnl|my_center|LOCUS_02330 37169 34551 gene locus_tag LOCUS_02340 gene lptD 37169 34551 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_02340 37309 38388 gene locus_tag LOCUS_02350 37309 38388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_02350 38376 39077 gene locus_tag LOCUS_02360 38376 39077 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_02360 39113 39793 gene locus_tag LOCUS_02370 gene rpe 39113 39793 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC9 protein_id gnl|my_center|LOCUS_02370 >Feature sequence007 2024 84 gene locus_tag LOCUS_02380 gene gcd-1 2024 84 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_02380 3117 2200 gene locus_tag LOCUS_02390 3117 2200 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086663.1 protein_id gnl|my_center|LOCUS_02390 3271 4272 gene locus_tag LOCUS_02400 gene mshM 3271 4272 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_02400 4282 5880 gene locus_tag LOCUS_02410 4282 5880 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_02410 5880 7766 gene locus_tag LOCUS_02420 5880 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7770 9485 gene locus_tag LOCUS_02430 7770 9485 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_02430 9494 10699 gene locus_tag LOCUS_02440 9494 10699 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_02440 10706 12256 gene locus_tag LOCUS_02450 10706 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12253 12903 gene locus_tag LOCUS_02460 12253 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12914 13408 gene locus_tag LOCUS_02470 12914 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13441 14331 gene locus_tag LOCUS_02480 13441 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14325 15068 gene locus_tag LOCUS_02490 14325 15068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15070 15726 gene locus_tag LOCUS_02500 15070 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 15719 16777 gene locus_tag LOCUS_02510 15719 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 16910 17581 gene locus_tag LOCUS_02520 16910 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18118 17624 gene locus_tag LOCUS_02530 18118 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 18187 18432 gene locus_tag LOCUS_02540 18187 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 19275 18457 gene locus_tag LOCUS_02550 19275 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 19883 19293 gene locus_tag LOCUS_02560 19883 19293 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241888.1 protein_id gnl|my_center|LOCUS_02560 21381 19885 gene locus_tag LOCUS_02570 gene glpK1 21381 19885 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_02570 21557 23068 gene locus_tag LOCUS_02580 21557 23068 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPI5 protein_id gnl|my_center|LOCUS_02580 23119 24489 gene locus_tag LOCUS_02590 23119 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_02590 24962 24486 gene locus_tag LOCUS_02600 24962 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 25992 24970 gene locus_tag LOCUS_02610 25992 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 26742 26023 gene locus_tag LOCUS_02620 26742 26023 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_02620 27270 26827 gene locus_tag LOCUS_02630 27270 26827 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056732.1 protein_id gnl|my_center|LOCUS_02630 27389 28900 gene locus_tag LOCUS_02640 27389 28900 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_02640 28928 30208 gene locus_tag LOCUS_02650 28928 30208 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_02650 30480 30692 gene locus_tag LOCUS_02660 30480 30692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 30772 31038 gene locus_tag LOCUS_02670 30772 31038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 31621 31091 gene locus_tag LOCUS_02680 31621 31091 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_02680 32879 31608 gene locus_tag LOCUS_02690 32879 31608 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_02690 33000 33977 gene locus_tag LOCUS_02700 33000 33977 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_02700 34010 35011 gene locus_tag LOCUS_02710 34010 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_02710 35781 35020 gene locus_tag LOCUS_02720 35781 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_02720 35956 37443 gene locus_tag LOCUS_02730 35956 37443 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_02730 37963 37430 gene locus_tag LOCUS_02740 37963 37430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 38298 38885 gene locus_tag LOCUS_02750 38298 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_02750 <39572 38981 gene locus_tag LOCUS_02760 <39572 38981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence008 <1 1030 gene locus_tag LOCUS_02770 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114538.1:3-deoxy-D-manno-octulosonic acid transferase 2417 1041 gene locus_tag LOCUS_02780 gene pepQ 2417 1041 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL3 protein_id gnl|my_center|LOCUS_02780 2569 2889 gene locus_tag LOCUS_02790 2569 2889 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLD9 protein_id gnl|my_center|LOCUS_02790 2980 3831 gene locus_tag LOCUS_02800 2980 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_02800 3833 5131 gene locus_tag LOCUS_02810 3833 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5160 5411 gene locus_tag LOCUS_02820 5160 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5471 7624 gene locus_tag LOCUS_02830 5471 7624 CDS product toxin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 protein_id gnl|my_center|LOCUS_02830 7626 8441 gene locus_tag LOCUS_02840 7626 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 8470 9207 gene locus_tag LOCUS_02850 8470 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_02850 9173 10135 gene locus_tag LOCUS_02860 9173 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 13067 10182 gene locus_tag LOCUS_02870 gene gcvP2 13067 10182 CDS product glycine dehydrogenase (decarboxylating) 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX7 protein_id gnl|my_center|LOCUS_02870 13460 13071 gene locus_tag LOCUS_02880 gene gcvH 13460 13071 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6U2 protein_id gnl|my_center|LOCUS_02880 14585 13494 gene locus_tag LOCUS_02890 gene gcvT 14585 13494 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_02890 16911 14659 gene locus_tag LOCUS_02900 16911 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_02900 17665 17072 gene locus_tag LOCUS_02910 17665 17072 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_02910 18412 17744 gene locus_tag LOCUS_02920 18412 17744 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_02920 18520 22968 gene locus_tag LOCUS_02930 18520 22968 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_02930 24069 23710 gene locus_tag LOCUS_02940 24069 23710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24139 25041 gene locus_tag LOCUS_02950 24139 25041 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 protein_id gnl|my_center|LOCUS_02950 25935 25036 gene locus_tag LOCUS_02960 25935 25036 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_02960 26168 25992 gene locus_tag LOCUS_02970 26168 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 26510 26301 gene locus_tag LOCUS_02980 26510 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 29245 26930 gene locus_tag LOCUS_02990 29245 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 30659 29421 gene locus_tag LOCUS_03000 30659 29421 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_03000 31153 30659 gene locus_tag LOCUS_03010 31153 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 31266 32429 gene locus_tag LOCUS_03020 31266 32429 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_03020 32438 34819 gene locus_tag LOCUS_03030 gene polB 32438 34819 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2L1 protein_id gnl|my_center|LOCUS_03030 34851 35363 gene locus_tag LOCUS_03040 34851 35363 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_03040 36600 35386 gene locus_tag LOCUS_03050 36600 35386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 37324 36665 gene locus_tag LOCUS_03060 37324 36665 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence009 386 973 gene locus_tag LOCUS_03070 gene trpG 386 973 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_03070 996 2024 gene locus_tag LOCUS_03080 gene trpD 996 2024 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DC9 protein_id gnl|my_center|LOCUS_03080 2047 2850 gene locus_tag LOCUS_03090 gene trpC 2047 2850 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_03090 2843 3259 gene locus_tag LOCUS_03100 gene dgkA 2843 3259 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF39 protein_id gnl|my_center|LOCUS_03100 3899 3264 gene locus_tag LOCUS_03110 gene vfr 3899 3264 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_03110 4085 4546 gene locus_tag LOCUS_03120 4085 4546 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_03120 5172 4543 gene locus_tag LOCUS_03130 gene coq7 5172 4543 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_03130 6496 5210 gene locus_tag LOCUS_03140 gene purD 6496 5210 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5D9 protein_id gnl|my_center|LOCUS_03140 8102 6510 gene locus_tag LOCUS_03150 gene purH 8102 6510 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERP1 protein_id gnl|my_center|LOCUS_03150 8436 8131 gene locus_tag LOCUS_03160 8436 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9449 8433 gene locus_tag LOCUS_03170 gene dusB 9449 8433 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_03170 10523 9543 gene locus_tag LOCUS_03180 10523 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11436 10552 gene locus_tag LOCUS_03190 gene prmA 11436 10552 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_03190 12776 11436 gene locus_tag LOCUS_03200 gene accC 12776 11436 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_03200 13254 12799 gene locus_tag LOCUS_03210 gene accB 13254 12799 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 protein_id gnl|my_center|LOCUS_03210 13737 13297 gene locus_tag LOCUS_03220 gene aroQ 13737 13297 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN43 protein_id gnl|my_center|LOCUS_03220 14314 13835 gene locus_tag LOCUS_03230 14314 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 15507 14314 gene locus_tag LOCUS_03240 gene fabB 15507 14314 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_03240 16185 15565 gene locus_tag LOCUS_03250 gene fabA 16185 15565 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK2 protein_id gnl|my_center|LOCUS_03250 16369 17790 gene locus_tag LOCUS_03260 gene manC 16369 17790 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348016.1 protein_id gnl|my_center|LOCUS_03260 17810 18643 gene locus_tag LOCUS_03270 gene galU 17810 18643 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_03270 18665 20014 gene locus_tag LOCUS_03280 18665 20014 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_03280 20019 20564 gene locus_tag LOCUS_03290 20019 20564 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_03290 21541 20627 gene locus_tag LOCUS_03300 gene rimK 21541 20627 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_03300 21691 22191 gene locus_tag LOCUS_03310 gene copG 21691 22191 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_03310 22265 23686 gene locus_tag LOCUS_03320 22265 23686 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_03320 23748 26690 gene locus_tag LOCUS_03330 23748 26690 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_03330 26695 28002 gene locus_tag LOCUS_03340 26695 28002 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_03340 28036 28806 gene locus_tag LOCUS_03350 gene gcd1 28036 28806 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_03350 28803 29861 gene locus_tag LOCUS_03360 gene rfbG 28803 29861 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_03360 29858 31093 gene locus_tag LOCUS_03370 29858 31093 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887438.1 protein_id gnl|my_center|LOCUS_03370 31090 31638 gene locus_tag LOCUS_03380 gene rfbD 31090 31638 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037176.1 protein_id gnl|my_center|LOCUS_03380 31642 32379 gene locus_tag LOCUS_03390 31642 32379 CDS product cephalosporin hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_03390 33528 32398 gene locus_tag LOCUS_03400 33528 32398 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_03400 34376 33525 gene locus_tag LOCUS_03410 34376 33525 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_03410 35244 34384 gene locus_tag LOCUS_03420 35244 34384 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_03420 35686 35246 gene locus_tag LOCUS_03430 35686 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 37099 35693 gene locus_tag LOCUS_03440 gene rimK 37099 35693 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_03440 <37707 37092 gene locus_tag LOCUS_03450 <37707 37092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZY88:glucose-6-phosphate isomerase >Feature sequence010 3314 381 gene locus_tag LOCUS_03460 gene glnE 3314 381 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_03460 5154 3361 gene locus_tag LOCUS_03470 5154 3361 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_03470 6736 5246 gene locus_tag LOCUS_03480 6736 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_03480 7397 6756 gene locus_tag LOCUS_03490 7397 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8139 7501 gene locus_tag LOCUS_03500 8139 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9143 8142 gene locus_tag LOCUS_03510 9143 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10234 9140 gene locus_tag LOCUS_03520 10234 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11597 10221 gene locus_tag LOCUS_03530 11597 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12409 11594 gene locus_tag LOCUS_03540 12409 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12707 12447 gene locus_tag LOCUS_03550 12707 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 14790 12712 gene locus_tag LOCUS_03560 14790 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 16336 14795 gene locus_tag LOCUS_03570 16336 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 17568 16387 gene locus_tag LOCUS_03580 17568 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 17987 17571 gene locus_tag LOCUS_03590 17987 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 18283 18633 gene locus_tag LOCUS_03600 18283 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 20022 18781 gene locus_tag LOCUS_03610 20022 18781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 19906 20211 gene locus_tag LOCUS_03620 19906 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 22300 20300 gene locus_tag LOCUS_03630 gene hyuA 22300 20300 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_03630 22383 23198 gene locus_tag LOCUS_03640 gene mutM 22383 23198 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_03640 23668 23195 gene locus_tag LOCUS_03650 gene coaD 23668 23195 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_03650 24740 23736 gene locus_tag LOCUS_03660 24740 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_03660 25300 24737 gene locus_tag LOCUS_03670 25300 24737 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AI7 protein_id gnl|my_center|LOCUS_03670 25440 26414 gene locus_tag LOCUS_03680 25440 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 26411 27097 gene locus_tag LOCUS_03690 gene ftsE 26411 27097 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_03690 27094 28089 gene locus_tag LOCUS_03700 gene ftsX 27094 28089 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_03700 28363 29226 gene locus_tag LOCUS_03710 gene rpoH 28363 29226 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_03710 29294 29677 gene locus_tag LOCUS_03720 29294 29677 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_03720 29692 29892 gene locus_tag LOCUS_03730 29692 29892 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_03730 29889 30686 gene locus_tag LOCUS_03740 gene thiG 29889 30686 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_03740 30691 31374 gene locus_tag LOCUS_03750 gene trmB 30691 31374 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHE9 protein_id gnl|my_center|LOCUS_03750 32096 31368 gene locus_tag LOCUS_03760 32096 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_03760 32235 32969 gene locus_tag LOCUS_03770 gene cmoA 32235 32969 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSU2 protein_id gnl|my_center|LOCUS_03770 32980 33942 gene locus_tag LOCUS_03780 gene cmoB 32980 33942 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE5 protein_id gnl|my_center|LOCUS_03780 34178 35146 gene locus_tag LOCUS_03790 34178 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 35368 35213 gene locus_tag LOCUS_03800 gene rpmG 35368 35213 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_03800 35609 35388 gene locus_tag LOCUS_03810 gene rpmB 35609 35388 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM9 protein_id gnl|my_center|LOCUS_03810 36450 35776 gene locus_tag LOCUS_03820 36450 35776 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8M5 protein_id gnl|my_center|LOCUS_03820 36595 37407 gene locus_tag LOCUS_03830 36595 37407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence011 9734 10030 gene locus_tag LOCUS_03840 9734 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10413 10027 gene locus_tag LOCUS_03850 10413 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11344 10472 gene locus_tag LOCUS_03860 gene mshO 11344 10472 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_03860 11967 11365 gene locus_tag LOCUS_03870 gene mshD 11967 11365 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_03870 12496 11960 gene locus_tag LOCUS_03880 12496 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14130 12493 gene locus_tag LOCUS_03890 14130 12493 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481013.1 protein_id gnl|my_center|LOCUS_03890 14879 14334 gene locus_tag LOCUS_03900 14879 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 15818 15171 gene locus_tag LOCUS_03910 15818 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 17133 15856 gene locus_tag LOCUS_03920 17133 15856 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_03920 18887 17154 gene locus_tag LOCUS_03930 18887 17154 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_03930 20052 18889 gene locus_tag LOCUS_03940 20052 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 20963 20049 gene locus_tag LOCUS_03950 gene mshM 20963 20049 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_03950 22754 20982 gene locus_tag LOCUS_03960 gene mshL 22754 20982 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_03960 23143 22769 gene locus_tag LOCUS_03970 23143 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 23855 23136 gene locus_tag LOCUS_03980 23855 23136 CDS product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 protein_id gnl|my_center|LOCUS_03980 24454 23852 gene locus_tag LOCUS_03990 24454 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 25413 24451 gene locus_tag LOCUS_04000 25413 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 25680 26144 gene locus_tag LOCUS_04010 gene trmL 25680 26144 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTZ2 protein_id gnl|my_center|LOCUS_04010 26678 26154 gene locus_tag LOCUS_04020 gene secB 26678 26154 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_04020 26979 26692 gene locus_tag LOCUS_04030 26979 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 27265 28842 gene locus_tag LOCUS_04040 gene gpmI 27265 28842 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_04040 28904 30034 gene locus_tag LOCUS_04050 28904 30034 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_04050 30114 31448 gene locus_tag LOCUS_04060 30114 31448 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_04060 32236 31463 gene locus_tag LOCUS_04070 gene hisF1 32236 31463 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_04070 32978 32238 gene locus_tag LOCUS_04080 gene hisA 32978 32238 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_04080 33631 32975 gene locus_tag LOCUS_04090 gene hisH1 33631 32975 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_04090 34257 33667 gene locus_tag LOCUS_04100 gene hisB 34257 33667 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_04100 34434 36518 gene locus_tag LOCUS_04110 34434 36518 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105433.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence012 <1 701 gene locus_tag LOCUS_04120 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261048.1:UDP-2-acetamido-2,6-dideoxy-beta-L-talose 4-dehydrogenase 703 1830 gene locus_tag LOCUS_04130 gene wecB 703 1830 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734455.1 protein_id gnl|my_center|LOCUS_04130 1835 3034 gene locus_tag LOCUS_04140 1835 3034 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686571.1 protein_id gnl|my_center|LOCUS_04140 4056 3031 gene locus_tag LOCUS_04150 gene wecA 4056 3031 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45341 protein_id gnl|my_center|LOCUS_04150 6534 4105 gene locus_tag LOCUS_04160 6534 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7274 6693 gene locus_tag LOCUS_04170 7274 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 7838 7386 gene locus_tag LOCUS_04180 7838 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 7919 11497 gene locus_tag LOCUS_04190 gene smc 7919 11497 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_04190 11886 11650 gene locus_tag LOCUS_04200 11886 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11782 13422 gene locus_tag LOCUS_04210 11782 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 13452 15515 gene locus_tag LOCUS_04220 gene ligA 13452 15515 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZK4 protein_id gnl|my_center|LOCUS_04220 15599 16186 gene locus_tag LOCUS_04230 15599 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_04230 17293 16175 gene locus_tag LOCUS_04240 gene czcD.2 17293 16175 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_04240 20470 17528 gene locus_tag LOCUS_04250 gene preP2 20470 17528 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_04250 21348 20473 gene locus_tag LOCUS_04260 21348 20473 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLZ4 protein_id gnl|my_center|LOCUS_04260 21447 21764 gene locus_tag LOCUS_04270 gene bolA 21447 21764 CDS product DNA-binding transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43780 protein_id gnl|my_center|LOCUS_04270 21918 22760 gene locus_tag LOCUS_04280 21918 22760 CDS product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_04280 23813 22770 gene locus_tag LOCUS_04290 23813 22770 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_04290 23958 26123 gene locus_tag LOCUS_04300 gene fadB 23958 26123 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_04300 26135 27310 gene locus_tag LOCUS_04310 gene fadA 26135 27310 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA1 protein_id gnl|my_center|LOCUS_04310 27314 28144 gene locus_tag LOCUS_04320 gene ttcA 27314 28144 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_04320 28159 28365 gene locus_tag LOCUS_04330 gene yheU 28159 28365 CDS product UPF0270 protein YheU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67626 protein_id gnl|my_center|LOCUS_04330 28380 28652 gene locus_tag LOCUS_04340 gene tusA 28380 28652 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_04340 28652 29590 gene locus_tag LOCUS_04350 28652 29590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 29595 30743 gene locus_tag LOCUS_04360 gene pdxB 29595 30743 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R9 protein_id gnl|my_center|LOCUS_04360 31951 30740 gene locus_tag LOCUS_04370 31951 30740 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314686.1 protein_id gnl|my_center|LOCUS_04370 32043 32438 gene locus_tag LOCUS_04380 gene msrB 32043 32438 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_04380 37112 32439 gene locus_tag LOCUS_04390 37112 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence013 848 1315 gene locus_tag LOCUS_04400 848 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1820 1416 gene locus_tag LOCUS_04410 1820 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2032 2850 gene locus_tag LOCUS_04420 2032 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_04420 3010 5028 gene locus_tag LOCUS_04430 3010 5028 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_04430 5320 6072 gene locus_tag LOCUS_04440 5320 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6811 6104 gene locus_tag LOCUS_04450 6811 6104 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_04450 8073 6853 gene locus_tag LOCUS_04460 8073 6853 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_04460 8153 8863 gene locus_tag LOCUS_04470 8153 8863 CDS product prolyl 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_04470 9039 10109 gene locus_tag LOCUS_04480 gene gap 9039 10109 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_04480 10109 10777 gene locus_tag LOCUS_04490 10109 10777 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_04490 10774 11685 gene locus_tag LOCUS_04500 10774 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12351 11707 gene locus_tag LOCUS_04510 12351 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970314.1 protein_id gnl|my_center|LOCUS_04510 12759 12373 gene locus_tag LOCUS_04520 12759 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 13942 13352 gene locus_tag LOCUS_04530 13942 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14199 14044 gene locus_tag LOCUS_04540 14199 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 14561 14196 gene locus_tag LOCUS_04550 14561 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16096 14600 gene locus_tag LOCUS_04560 16096 14600 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_04560 16294 16100 gene locus_tag LOCUS_04570 16294 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 19355 16266 gene locus_tag LOCUS_04580 19355 16266 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 protein_id gnl|my_center|LOCUS_04580 20805 19348 gene locus_tag LOCUS_04590 gene hsdS 20805 19348 CDS product type I restriction enzyme EcoEI specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122924.1 protein_id gnl|my_center|LOCUS_04590 21431 20886 gene locus_tag LOCUS_04600 21431 20886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_04600 24344 21477 gene locus_tag LOCUS_04610 24344 21477 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_04610 24769 24422 gene locus_tag LOCUS_04620 24769 24422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 24858 25394 gene locus_tag LOCUS_04630 24858 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 25394 25600 gene locus_tag LOCUS_04640 25394 25600 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096753.1 protein_id gnl|my_center|LOCUS_04640 25776 25564 gene locus_tag LOCUS_04650 25776 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 25982 25773 gene locus_tag LOCUS_04660 25982 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 26222 27568 gene locus_tag LOCUS_04670 26222 27568 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202732.1 protein_id gnl|my_center|LOCUS_04670 27600 28751 gene locus_tag LOCUS_04680 gene hisC 27600 28751 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038377.1 protein_id gnl|my_center|LOCUS_04680 29594 30007 gene locus_tag LOCUS_04690 gene zntR 29594 30007 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_04690 30004 31059 gene locus_tag LOCUS_04700 30004 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_04700 31937 31038 gene locus_tag LOCUS_04710 31937 31038 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_04710 32036 33196 gene locus_tag LOCUS_04720 32036 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 33108 33782 gene locus_tag LOCUS_04730 33108 33782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 33890 35359 gene locus_tag LOCUS_04740 gene zwf 33890 35359 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE98 protein_id gnl|my_center|LOCUS_04740 35356 36057 gene locus_tag LOCUS_04750 gene pgl 35356 36057 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence014 968 2152 gene locus_tag LOCUS_04760 gene rlmI 968 2152 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR8 protein_id gnl|my_center|LOCUS_04760 2183 2800 gene locus_tag LOCUS_04770 gene ychE 2183 2800 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF54 protein_id gnl|my_center|LOCUS_04770 4020 2797 gene locus_tag LOCUS_04780 4020 2797 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_04780 4821 4057 gene locus_tag LOCUS_04790 4821 4057 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_04790 5639 4818 gene locus_tag LOCUS_04800 5639 4818 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_04800 6666 5644 gene locus_tag LOCUS_04810 6666 5644 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086750.1 protein_id gnl|my_center|LOCUS_04810 7946 6708 gene locus_tag LOCUS_04820 7946 6708 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_04820 8412 8236 gene locus_tag LOCUS_04830 8412 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 9279 8428 gene locus_tag LOCUS_04840 9279 8428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768963.1 protein_id gnl|my_center|LOCUS_04840 10135 9272 gene locus_tag LOCUS_04850 gene nodI 10135 9272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_04850 10518 10132 gene locus_tag LOCUS_04860 10518 10132 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_04860 11803 10598 gene locus_tag LOCUS_04870 11803 10598 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_04870 12887 11913 gene locus_tag LOCUS_04880 gene rpoS 12887 11913 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_04880 13501 13013 gene locus_tag LOCUS_04890 13501 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14520 13558 gene locus_tag LOCUS_04900 gene oprF 14520 13558 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 protein_id gnl|my_center|LOCUS_04900 14777 15487 gene locus_tag LOCUS_04910 gene phoB 14777 15487 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_04910 15596 16930 gene locus_tag LOCUS_04920 gene phoR 15596 16930 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_04920 17691 16957 gene locus_tag LOCUS_04930 17691 16957 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA8 protein_id gnl|my_center|LOCUS_04930 18602 17757 gene locus_tag LOCUS_04940 gene pstB2 18602 17757 CDS product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA7 protein_id gnl|my_center|LOCUS_04940 20340 18655 gene locus_tag LOCUS_04950 20340 18655 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA6 protein_id gnl|my_center|LOCUS_04950 22547 20337 gene locus_tag LOCUS_04960 22547 20337 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_04960 23723 22752 gene locus_tag LOCUS_04970 gene pstS 23723 22752 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_04970 24820 23858 gene locus_tag LOCUS_04980 24820 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 25355 24891 gene locus_tag LOCUS_04990 gene bfrB 25355 24891 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_04990 25644 25456 gene locus_tag LOCUS_05000 25644 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 26250 28190 gene locus_tag LOCUS_05010 26250 28190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036212.1 protein_id gnl|my_center|LOCUS_05010 29166 28177 gene locus_tag LOCUS_05020 29166 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 29414 32731 gene locus_tag LOCUS_05030 29414 32731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 32837 33697 gene locus_tag LOCUS_05040 32837 33697 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_05040 33755 34552 gene locus_tag LOCUS_05050 gene cysE 33755 34552 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_05050 35686 34556 gene locus_tag LOCUS_05060 35686 34556 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence015 <1 1390 gene locus_tag LOCUS_05070 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003366703.1:2-oxoglutarate dehydrogenase subunit E1 1419 2654 gene locus_tag LOCUS_05080 gene sucB 1419 2654 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_05080 2681 4132 gene locus_tag LOCUS_05090 gene lpdG 2681 4132 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_05090 4178 5347 gene locus_tag LOCUS_05100 gene sucC 4178 5347 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_05100 5344 6216 gene locus_tag LOCUS_05110 gene sucD 5344 6216 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_05110 6570 7373 gene locus_tag LOCUS_05120 6570 7373 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_05120 7373 8764 gene locus_tag LOCUS_05130 gene ttpC 7373 8764 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_05130 8787 9317 gene locus_tag LOCUS_05140 gene exbB 8787 9317 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_05140 9386 9793 gene locus_tag LOCUS_05150 9386 9793 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_05150 9825 10418 gene locus_tag LOCUS_05160 9825 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10418 11767 gene locus_tag LOCUS_05170 10418 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11900 13816 gene locus_tag LOCUS_05180 gene htpG 11900 13816 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_05180 15583 13844 gene locus_tag LOCUS_05190 gene argS 15583 13844 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F835 protein_id gnl|my_center|LOCUS_05190 15675 16637 gene locus_tag LOCUS_05200 15675 16637 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_05200 16709 17245 gene locus_tag LOCUS_05210 16709 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390869.1 protein_id gnl|my_center|LOCUS_05210 17305 17484 gene locus_tag LOCUS_05220 gene rpmF 17305 17484 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_05220 17518 18540 gene locus_tag LOCUS_05230 gene plsX 17518 18540 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 protein_id gnl|my_center|LOCUS_05230 18577 19515 gene locus_tag LOCUS_05240 gene fabD 18577 19515 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN69 protein_id gnl|my_center|LOCUS_05240 19584 20327 gene locus_tag LOCUS_05250 gene fabG 19584 20327 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_05250 20525 20758 gene locus_tag LOCUS_05260 gene acpP 20525 20758 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80923 protein_id gnl|my_center|LOCUS_05260 20896 22104 gene locus_tag LOCUS_05270 20896 22104 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX5 protein_id gnl|my_center|LOCUS_05270 22108 22929 gene locus_tag LOCUS_05280 22108 22929 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_05280 22926 23945 gene locus_tag LOCUS_05290 22926 23945 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 protein_id gnl|my_center|LOCUS_05290 23947 24576 gene locus_tag LOCUS_05300 gene tmk 23947 24576 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_05300 24576 25592 gene locus_tag LOCUS_05310 gene holB 24576 25592 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770613.1 protein_id gnl|my_center|LOCUS_05310 25663 25983 gene locus_tag LOCUS_05320 gene pilZ 25663 25983 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_05320 27118 25961 gene locus_tag LOCUS_05330 27118 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_05330 27807 27151 gene locus_tag LOCUS_05340 27807 27151 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_05340 27890 29254 gene locus_tag LOCUS_05350 gene gor 27890 29254 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_05350 30068 29313 gene locus_tag LOCUS_05360 30068 29313 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_05360 31134 30127 gene locus_tag LOCUS_05370 31134 30127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 31336 32127 gene locus_tag LOCUS_05380 gene modE 31336 32127 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_05380 33026 32196 gene locus_tag LOCUS_05390 gene modC 33026 32196 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_05390 33937 33254 gene locus_tag LOCUS_05400 gene modC 33937 33254 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence016 1152 388 gene locus_tag LOCUS_05410 1152 388 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 protein_id gnl|my_center|LOCUS_05410 1606 1241 gene locus_tag LOCUS_05420 gene rplS 1606 1241 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U9 protein_id gnl|my_center|LOCUS_05420 2414 1647 gene locus_tag LOCUS_05430 gene trmD 2414 1647 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPE4 protein_id gnl|my_center|LOCUS_05430 2942 2430 gene locus_tag LOCUS_05440 gene rimM 2942 2430 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_05440 3270 3010 gene locus_tag LOCUS_05450 gene rpsP 3270 3010 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_05450 4811 3420 gene locus_tag LOCUS_05460 gene ffh 4811 3420 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 protein_id gnl|my_center|LOCUS_05460 5113 4871 gene locus_tag LOCUS_05470 5113 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5051 5725 gene locus_tag LOCUS_05480 5051 5725 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_05480 5753 7051 gene locus_tag LOCUS_05490 gene corB 5753 7051 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261309.1 protein_id gnl|my_center|LOCUS_05490 7841 7020 gene locus_tag LOCUS_05500 7841 7020 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_05500 8608 7829 gene locus_tag LOCUS_05510 8608 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8710 9318 gene locus_tag LOCUS_05520 8710 9318 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_05520 10238 9324 gene locus_tag LOCUS_05530 10238 9324 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_05530 10392 10811 gene locus_tag LOCUS_05540 10392 10811 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_05540 10888 12210 gene locus_tag LOCUS_05550 10888 12210 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_05550 12268 12849 gene locus_tag LOCUS_05560 12268 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_05560 13084 14319 gene locus_tag LOCUS_05570 13084 14319 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088189.1 protein_id gnl|my_center|LOCUS_05570 15395 14373 gene locus_tag LOCUS_05580 15395 14373 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_05580 15646 16302 gene locus_tag LOCUS_05590 gene pspA 15646 16302 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_05590 16316 16591 gene locus_tag LOCUS_05600 16316 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 16551 17324 gene locus_tag LOCUS_05610 16551 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 17331 17942 gene locus_tag LOCUS_05620 17331 17942 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_05620 18287 17934 gene locus_tag LOCUS_05630 18287 17934 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769887.1 protein_id gnl|my_center|LOCUS_05630 22204 18287 gene locus_tag LOCUS_05640 gene purL 22204 18287 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_05640 22742 22212 gene locus_tag LOCUS_05650 22742 22212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 23203 22742 gene locus_tag LOCUS_05660 gene yfhC 23203 22742 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_05660 24796 23216 gene locus_tag LOCUS_05670 gene guaA 24796 23216 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 protein_id gnl|my_center|LOCUS_05670 26282 24813 gene locus_tag LOCUS_05680 gene guaB 26282 24813 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_05680 26554 27366 gene locus_tag LOCUS_05690 26554 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 27366 28403 gene locus_tag LOCUS_05700 27366 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 28849 28409 gene locus_tag LOCUS_05710 28849 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 29007 29948 gene locus_tag LOCUS_05720 29007 29948 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_05720 30227 30397 gene locus_tag LOCUS_05730 30227 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence017 <1 594 gene locus_tag LOCUS_05740 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z7Q5:methionyl-tRNA formyltransferase 3832 641 gene locus_tag LOCUS_05750 3832 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4152 5285 gene locus_tag LOCUS_05760 4152 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5285 6262 gene locus_tag LOCUS_05770 5285 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6653 6276 gene locus_tag LOCUS_05780 6653 6276 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_05780 7763 6726 gene locus_tag LOCUS_05790 7763 6726 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_05790 8473 7760 gene locus_tag LOCUS_05800 8473 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05800 9116 8451 gene locus_tag LOCUS_05810 9116 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05810 9239 11125 gene locus_tag LOCUS_05820 9239 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12837 11158 gene locus_tag LOCUS_05830 12837 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_05830 13780 12881 gene locus_tag LOCUS_05840 13780 12881 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_05840 14608 13781 gene locus_tag LOCUS_05850 14608 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 16037 14652 gene locus_tag LOCUS_05860 gene sthA 16037 14652 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_05860 16215 16030 gene locus_tag LOCUS_05870 16215 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 17302 16232 gene locus_tag LOCUS_05880 gene apbE 17302 16232 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV3 protein_id gnl|my_center|LOCUS_05880 18528 17299 gene locus_tag LOCUS_05890 gene nqrF 18528 17299 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_05890 19153 18545 gene locus_tag LOCUS_05900 gene nqrE 19153 18545 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_05900 19803 19153 gene locus_tag LOCUS_05910 gene nqrD 19803 19153 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_05910 20606 19821 gene locus_tag LOCUS_05920 gene nqrC 20606 19821 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_05920 21840 20593 gene locus_tag LOCUS_05930 gene nqrB 21840 20593 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_05930 23120 21852 gene locus_tag LOCUS_05940 gene nqrA 23120 21852 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_05940 24883 23417 gene locus_tag LOCUS_05950 gene gap-2 24883 23417 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884J0 protein_id gnl|my_center|LOCUS_05950 24993 28454 gene locus_tag LOCUS_05960 gene mfd 24993 28454 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_05960 28486 29397 gene locus_tag LOCUS_05970 28486 29397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 30109 29339 gene locus_tag LOCUS_05980 30109 29339 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_05980 30270 31208 gene locus_tag LOCUS_05990 30270 31208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence018 493 32 gene locus_tag LOCUS_06000 493 32 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970650.1 protein_id gnl|my_center|LOCUS_06000 763 560 gene locus_tag LOCUS_06010 763 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1258 773 gene locus_tag LOCUS_06020 1258 773 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140245.1 protein_id gnl|my_center|LOCUS_06020 1842 1441 gene locus_tag LOCUS_06030 1842 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2951 2115 gene locus_tag LOCUS_06040 2951 2115 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921287.1 protein_id gnl|my_center|LOCUS_06040 3387 3028 gene locus_tag LOCUS_06050 3387 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4173 3442 gene locus_tag LOCUS_06060 4173 3442 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646306.1 protein_id gnl|my_center|LOCUS_06060 4485 4198 gene locus_tag LOCUS_06070 4485 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4969 4541 gene locus_tag LOCUS_06080 4969 4541 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729083.1 protein_id gnl|my_center|LOCUS_06080 5903 5145 gene locus_tag LOCUS_06090 gene map 5903 5145 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UI28 protein_id gnl|my_center|LOCUS_06090 7572 6412 gene locus_tag LOCUS_06100 7572 6412 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_06100 8699 7734 gene locus_tag LOCUS_06110 gene yrbG 8699 7734 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_06110 8826 9065 gene locus_tag LOCUS_06120 8826 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 9858 9028 gene locus_tag LOCUS_06130 9858 9028 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_06130 10134 9958 gene locus_tag LOCUS_06140 10134 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 10477 10280 gene locus_tag LOCUS_06150 10477 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 11323 10856 gene locus_tag LOCUS_06160 11323 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 11684 11463 gene locus_tag LOCUS_06170 11684 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 11911 11681 gene locus_tag LOCUS_06180 11911 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 12396 12136 gene locus_tag LOCUS_06190 12396 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12679 12398 gene locus_tag LOCUS_06200 12679 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 13018 12791 gene locus_tag LOCUS_06210 13018 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_06210 13271 13008 gene locus_tag LOCUS_06220 13271 13008 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_06220 13671 13384 gene locus_tag LOCUS_06230 13671 13384 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_06230 13975 13658 gene locus_tag LOCUS_06240 13975 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_06240 15755 14166 gene locus_tag LOCUS_06250 15755 14166 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021076.1 protein_id gnl|my_center|LOCUS_06250 16452 15925 gene locus_tag LOCUS_06260 16452 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 17191 16463 gene locus_tag LOCUS_06270 17191 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 17658 17263 gene locus_tag LOCUS_06280 17658 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 18947 17808 gene locus_tag LOCUS_06290 18947 17808 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950614.1 protein_id gnl|my_center|LOCUS_06290 19714 18947 gene locus_tag LOCUS_06300 19714 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 20753 19740 gene locus_tag LOCUS_06310 20753 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 20927 21505 gene locus_tag LOCUS_06320 20927 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 21502 23181 gene locus_tag LOCUS_06330 21502 23181 CDS product gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706179.1 protein_id gnl|my_center|LOCUS_06330 24117 23263 gene locus_tag LOCUS_06340 24117 23263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_06340 24153 25367 gene locus_tag LOCUS_06350 24153 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 25364 26461 gene locus_tag LOCUS_06360 25364 26461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 28843 26507 gene locus_tag LOCUS_06370 28843 26507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 28968 29765 gene locus_tag LOCUS_06380 28968 29765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 29837 30445 gene locus_tag LOCUS_06390 29837 30445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 31402 30464 gene locus_tag LOCUS_06400 31402 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence019 476 2023 gene locus_tag LOCUS_06410 476 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2155 2610 gene locus_tag LOCUS_06420 2155 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4861 2618 gene locus_tag LOCUS_06430 4861 2618 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707557.1 protein_id gnl|my_center|LOCUS_06430 6211 4871 gene locus_tag LOCUS_06440 6211 4871 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_06440 6332 7369 gene locus_tag LOCUS_06450 6332 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7548 8387 gene locus_tag LOCUS_06460 7548 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8417 9283 gene locus_tag LOCUS_06470 8417 9283 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_06470 11614 9725 gene locus_tag LOCUS_06480 11614 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 12689 12318 gene locus_tag LOCUS_06490 12689 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 14563 13685 gene locus_tag LOCUS_06500 14563 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 15975 14788 gene locus_tag LOCUS_06510 15975 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_06510 16155 16457 gene locus_tag LOCUS_06520 16155 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 16671 17693 gene locus_tag LOCUS_06530 16671 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 19415 17763 gene locus_tag LOCUS_06540 19415 17763 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976074.1 protein_id gnl|my_center|LOCUS_06540 22630 19490 gene locus_tag LOCUS_06550 gene putA 22630 19490 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_06550 22777 23796 gene locus_tag LOCUS_06560 22777 23796 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSJ7 protein_id gnl|my_center|LOCUS_06560 23844 24974 gene locus_tag LOCUS_06570 23844 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 25208 24978 gene locus_tag LOCUS_06580 25208 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 25382 27280 gene locus_tag LOCUS_06590 gene korA 25382 27280 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_06590 27277 28278 gene locus_tag LOCUS_06600 27277 28278 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_06600 28305 29882 gene locus_tag LOCUS_06610 28305 29882 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_06610 29946 30656 gene locus_tag LOCUS_06620 29946 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence020 1031 627 gene locus_tag LOCUS_06630 1031 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207479.1 protein_id gnl|my_center|LOCUS_06630 2394 1069 gene locus_tag LOCUS_06640 gene hslU 2394 1069 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_06640 2980 2441 gene locus_tag LOCUS_06650 gene hslV 2980 2441 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_06650 3725 3096 gene locus_tag LOCUS_06660 3725 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6058 3800 gene locus_tag LOCUS_06670 gene priA 6058 3800 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_06670 6249 6545 gene locus_tag LOCUS_06680 6249 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6616 6825 gene locus_tag LOCUS_06690 gene rpmE 6616 6825 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_06690 9237 6853 gene locus_tag LOCUS_06700 gene ponA 9237 6853 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_06700 9780 10850 gene locus_tag LOCUS_06710 9780 10850 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_06710 10850 11425 gene locus_tag LOCUS_06720 gene pilN 10850 11425 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_06720 11446 12066 gene locus_tag LOCUS_06730 gene pilO 11446 12066 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_06730 12063 12617 gene locus_tag LOCUS_06740 gene pilP 12063 12617 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_06740 12693 14951 gene locus_tag LOCUS_06750 gene pilQ 12693 14951 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_06750 15131 15643 gene locus_tag LOCUS_06760 gene aroK 15131 15643 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZE4 protein_id gnl|my_center|LOCUS_06760 15643 16734 gene locus_tag LOCUS_06770 gene aroB 15643 16734 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_06770 16771 18243 gene locus_tag LOCUS_06780 16771 18243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148292.1 protein_id gnl|my_center|LOCUS_06780 18321 19385 gene locus_tag LOCUS_06790 gene hemE 18321 19385 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_06790 19491 19306 gene locus_tag LOCUS_06800 19491 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 19782 19528 gene locus_tag LOCUS_06810 19782 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 20096 21016 gene locus_tag LOCUS_06820 20096 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 21730 21227 gene locus_tag LOCUS_06830 21730 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 21743 21997 gene locus_tag LOCUS_06840 21743 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 22082 23875 gene locus_tag LOCUS_06850 22082 23875 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_06850 24641 23886 gene locus_tag LOCUS_06860 24641 23886 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880850.1 protein_id gnl|my_center|LOCUS_06860 25191 24634 gene locus_tag LOCUS_06870 25191 24634 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK70 protein_id gnl|my_center|LOCUS_06870 25450 26217 gene locus_tag LOCUS_06880 gene dapB 25450 26217 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_06880 26392 27528 gene locus_tag LOCUS_06890 gene carA 26392 27528 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP3 protein_id gnl|my_center|LOCUS_06890 27561 30779 gene locus_tag LOCUS_06900 gene carB 27561 30779 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38100 protein_id gnl|my_center|LOCUS_06900 >Feature sequence021 1044 283 gene locus_tag LOCUS_06910 1044 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06910 1213 1290 gene locus_tag LOCUS_t00050 1213 1290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1321 2373 gene locus_tag LOCUS_06920 1321 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3606 2443 gene locus_tag LOCUS_06930 3606 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_06930 3866 4666 gene locus_tag LOCUS_06940 3866 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4698 5576 gene locus_tag LOCUS_06950 gene fox2 4698 5576 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_06950 5652 6026 gene locus_tag LOCUS_06960 5652 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7157 6309 gene locus_tag LOCUS_06970 7157 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7241 8119 gene locus_tag LOCUS_06980 gene dhaA 7241 8119 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_06980 8116 10875 gene locus_tag LOCUS_06990 8116 10875 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_06990 10872 12323 gene locus_tag LOCUS_07000 10872 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 12618 13532 gene locus_tag LOCUS_07010 12618 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14927 13539 gene locus_tag LOCUS_07020 14927 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 15628 15260 gene locus_tag LOCUS_07030 15628 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15852 16259 gene locus_tag LOCUS_07040 15852 16259 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_07040 16296 18599 gene locus_tag LOCUS_07050 gene yyaL 16296 18599 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941831.1 protein_id gnl|my_center|LOCUS_07050 18599 20503 gene locus_tag LOCUS_07060 18599 20503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_07060 21236 20505 gene locus_tag LOCUS_07070 gene cobB 21236 20505 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2F3 protein_id gnl|my_center|LOCUS_07070 21331 21804 gene locus_tag LOCUS_07080 21331 21804 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_07080 21817 22605 gene locus_tag LOCUS_07090 21817 22605 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_07090 22602 23342 gene locus_tag LOCUS_07100 gene pdxJ 22602 23342 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_07100 23411 24085 gene locus_tag LOCUS_07110 23411 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 24100 24858 gene locus_tag LOCUS_07120 24100 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 24869 26140 gene locus_tag LOCUS_07130 24869 26140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_07130 26206 26592 gene locus_tag LOCUS_07140 26206 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 27242 26589 gene locus_tag LOCUS_07150 27242 26589 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_07150 27387 28070 gene locus_tag LOCUS_07160 27387 28070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_07160 28063 30690 gene locus_tag LOCUS_07170 28063 30690 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence022 215 1438 gene locus_tag LOCUS_07180 215 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1438 2190 gene locus_tag LOCUS_07190 1438 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2183 2878 gene locus_tag LOCUS_07200 2183 2878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930656.1 protein_id gnl|my_center|LOCUS_07200 2897 3946 gene locus_tag LOCUS_07210 2897 3946 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_07210 4826 3954 gene locus_tag LOCUS_07220 gene hslO 4826 3954 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_07220 7082 4839 gene locus_tag LOCUS_07230 7082 4839 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_07230 8017 7310 gene locus_tag LOCUS_07240 8017 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122952.1 protein_id gnl|my_center|LOCUS_07240 8435 8064 gene locus_tag LOCUS_07250 8435 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_07250 9121 8438 gene locus_tag LOCUS_07260 9121 8438 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181855.1 protein_id gnl|my_center|LOCUS_07260 10269 9130 gene locus_tag LOCUS_07270 10269 9130 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_07270 11511 10291 gene locus_tag LOCUS_07280 11511 10291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_07280 12462 11608 gene locus_tag LOCUS_07290 12462 11608 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_07290 13439 12459 gene locus_tag LOCUS_07300 13439 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_07300 14503 13457 gene locus_tag LOCUS_07310 14503 13457 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 protein_id gnl|my_center|LOCUS_07310 15595 14555 gene locus_tag LOCUS_07320 15595 14555 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_07320 17726 15618 gene locus_tag LOCUS_07330 17726 15618 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_07330 18966 17746 gene locus_tag LOCUS_07340 18966 17746 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098466.1 protein_id gnl|my_center|LOCUS_07340 19171 20319 gene locus_tag LOCUS_07350 gene dcaA 19171 20319 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_07350 20797 20327 gene locus_tag LOCUS_07360 20797 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21025 21468 gene locus_tag LOCUS_07370 gene hspC 21025 21468 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087990.1 protein_id gnl|my_center|LOCUS_07370 21554 22468 gene locus_tag LOCUS_07380 21554 22468 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 protein_id gnl|my_center|LOCUS_07380 22470 23300 gene locus_tag LOCUS_07390 22470 23300 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_07390 23887 23297 gene locus_tag LOCUS_07400 23887 23297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_07400 24855 23950 gene locus_tag LOCUS_07410 24855 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_07410 25207 24878 gene locus_tag LOCUS_07420 25207 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 25329 26075 gene locus_tag LOCUS_07430 25329 26075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946218.1 protein_id gnl|my_center|LOCUS_07430 26101 27504 gene locus_tag LOCUS_07440 gene cls 26101 27504 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_07440 27630 28067 gene locus_tag LOCUS_07450 gene uspA1 27630 28067 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AC1 protein_id gnl|my_center|LOCUS_07450 28980 28075 gene locus_tag LOCUS_07460 28980 28075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence023 207 76 gene locus_tag LOCUS_07470 207 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 382 720 gene locus_tag LOCUS_07480 gene csaA 382 720 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810814.1 protein_id gnl|my_center|LOCUS_07480 1348 965 gene locus_tag LOCUS_07490 1348 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1444 3276 gene locus_tag LOCUS_07500 1444 3276 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_07500 3455 4477 gene locus_tag LOCUS_07510 3455 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5549 4626 gene locus_tag LOCUS_07520 5549 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5792 6190 gene locus_tag LOCUS_07530 5792 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087706.1 protein_id gnl|my_center|LOCUS_07530 8587 6200 gene locus_tag LOCUS_07540 8587 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8990 8592 gene locus_tag LOCUS_07550 8990 8592 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_07550 9610 9164 gene locus_tag LOCUS_07560 9610 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808356.1 protein_id gnl|my_center|LOCUS_07560 9720 10622 gene locus_tag LOCUS_07570 9720 10622 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391214.1 protein_id gnl|my_center|LOCUS_07570 10606 11856 gene locus_tag LOCUS_07580 gene rocD 10606 11856 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RB7 protein_id gnl|my_center|LOCUS_07580 12111 13277 gene locus_tag LOCUS_07590 12111 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13434 14039 gene locus_tag LOCUS_07600 13434 14039 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_07600 16683 14041 gene locus_tag LOCUS_07610 16683 14041 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_07610 17052 16696 gene locus_tag LOCUS_07620 gene nirD 17052 16696 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_07620 19595 17052 gene locus_tag LOCUS_07630 19595 17052 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268219.1 protein_id gnl|my_center|LOCUS_07630 20825 19611 gene locus_tag LOCUS_07640 20825 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 21677 20829 gene locus_tag LOCUS_07650 21677 20829 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707174.1 protein_id gnl|my_center|LOCUS_07650 22687 21689 gene locus_tag LOCUS_07660 22687 21689 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_07660 24113 22731 gene locus_tag LOCUS_07670 24113 22731 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_07670 25499 24312 gene locus_tag LOCUS_07680 25499 24312 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_07680 26074 25511 gene locus_tag LOCUS_07690 26074 25511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_07690 27416 26184 gene locus_tag LOCUS_07700 27416 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_07700 27728 28369 gene locus_tag LOCUS_07710 gene mobA 27728 28369 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence024 <1 1123 gene locus_tag LOCUS_07720 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942351.1:2,4-diaminobutyrate decarboxylase note possible pseudo, internal stop codon 1127 1354 gene locus_tag LOCUS_07730 1127 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07730 2327 1365 gene locus_tag LOCUS_07740 gene secF 2327 1365 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_07740 4213 2327 gene locus_tag LOCUS_07750 gene secD 4213 2327 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_07750 4542 4219 gene locus_tag LOCUS_07760 4542 4219 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_07760 5816 4650 gene locus_tag LOCUS_07770 gene tgt 5816 4650 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_07770 7446 5860 gene locus_tag LOCUS_07780 gene prfC 7446 5860 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_07780 7621 8781 gene locus_tag LOCUS_07790 7621 8781 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_07790 8792 9697 gene locus_tag LOCUS_07800 8792 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 10326 9691 gene locus_tag LOCUS_07810 10326 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10893 11360 gene locus_tag LOCUS_07820 10893 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11706 11383 gene locus_tag LOCUS_07830 11706 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 14191 11885 gene locus_tag LOCUS_07840 14191 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 13059 13137 gene locus_tag LOCUS_t00060 13059 13137 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14304 15143 gene locus_tag LOCUS_07850 14304 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 15223 16299 gene locus_tag LOCUS_07860 gene hisC 15223 16299 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 protein_id gnl|my_center|LOCUS_07860 16296 16748 gene locus_tag LOCUS_07870 16296 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 16729 16986 gene locus_tag LOCUS_07880 16729 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17400 16972 gene locus_tag LOCUS_07890 gene rimI 17400 16972 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_07890 18273 17488 gene locus_tag LOCUS_07900 18273 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266672.1 protein_id gnl|my_center|LOCUS_07900 18457 19443 gene locus_tag LOCUS_07910 18457 19443 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_07910 19450 21189 gene locus_tag LOCUS_07920 19450 21189 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_07920 21390 21629 gene locus_tag LOCUS_07930 21390 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 22338 21652 gene locus_tag LOCUS_07940 22338 21652 CDS product fumarylpyruvate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_07940 23166 22351 gene locus_tag LOCUS_07950 23166 22351 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_07950 24088 23156 gene locus_tag LOCUS_07960 24088 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 25151 24132 gene locus_tag LOCUS_07970 gene tas 25151 24132 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023116.1 protein_id gnl|my_center|LOCUS_07970 26271 25207 gene locus_tag LOCUS_07980 26271 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 26743 26345 gene locus_tag LOCUS_07990 26743 26345 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_07990 27800 26757 gene locus_tag LOCUS_08000 27800 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 28873 27803 gene locus_tag LOCUS_08010 28873 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084186.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence025 54 932 gene locus_tag LOCUS_08020 54 932 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_08020 961 3297 gene locus_tag LOCUS_08030 961 3297 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_08030 3349 5175 gene locus_tag LOCUS_08040 3349 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5221 5730 gene locus_tag LOCUS_08050 5221 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5889 6863 gene locus_tag LOCUS_08060 5889 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8648 6927 gene locus_tag LOCUS_08070 8648 6927 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_08070 9619 8798 gene locus_tag LOCUS_08080 9619 8798 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705600.1 protein_id gnl|my_center|LOCUS_08080 9754 11082 gene locus_tag LOCUS_08090 9754 11082 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_08090 11079 11840 gene locus_tag LOCUS_08100 11079 11840 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 protein_id gnl|my_center|LOCUS_08100 12131 13054 gene locus_tag LOCUS_08110 gene secF 12131 13054 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_08110 14645 13068 gene locus_tag LOCUS_08120 14645 13068 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 protein_id gnl|my_center|LOCUS_08120 17385 14746 gene locus_tag LOCUS_08130 gene ndvB 17385 14746 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_08130 17679 19016 gene locus_tag LOCUS_08140 gene nhaD 17679 19016 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_08140 19052 19999 gene locus_tag LOCUS_08150 gene yrbG 19052 19999 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_08150 22004 20007 gene locus_tag LOCUS_08160 22004 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22512 22324 gene locus_tag LOCUS_08170 22512 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 22436 24562 gene locus_tag LOCUS_08180 22436 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 25896 24565 gene locus_tag LOCUS_08190 25896 24565 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 protein_id gnl|my_center|LOCUS_08190 26774 25875 gene locus_tag LOCUS_08200 26774 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence026 705 145 gene locus_tag LOCUS_08210 gene pgsA 705 145 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_08210 2700 838 gene locus_tag LOCUS_08220 gene uvrC 2700 838 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_08220 3412 2714 gene locus_tag LOCUS_08230 gene gacA 3412 2714 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_08230 4593 3556 gene locus_tag LOCUS_08240 gene murB 4593 3556 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_08240 5108 4590 gene locus_tag LOCUS_08250 gene ptpA 5108 4590 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_08250 5850 5110 gene locus_tag LOCUS_08260 gene kdsB 5850 5110 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_08260 6038 5850 gene locus_tag LOCUS_08270 6038 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7083 6031 gene locus_tag LOCUS_08280 gene lpxK 7083 6031 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLY1 protein_id gnl|my_center|LOCUS_08280 8855 7083 gene locus_tag LOCUS_08290 gene msbA 8855 7083 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_08290 9309 8872 gene locus_tag LOCUS_08300 9309 8872 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_08300 9905 9306 gene locus_tag LOCUS_08310 9905 9306 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_08310 12315 9994 gene locus_tag LOCUS_08320 12315 9994 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113988.1 protein_id gnl|my_center|LOCUS_08320 13644 12400 gene locus_tag LOCUS_08330 gene lolC 13644 12400 CDS product lipoprotein releasing system protein LolC/E family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957945.1 protein_id gnl|my_center|LOCUS_08330 14389 13649 gene locus_tag LOCUS_08340 gene lolD 14389 13649 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_08340 15624 14386 gene locus_tag LOCUS_08350 15624 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_08350 16356 15676 gene locus_tag LOCUS_08360 16356 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 17290 20103 gene locus_tag LOCUS_08370 gene rne 17290 20103 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_08370 21094 20168 gene locus_tag LOCUS_08380 21094 20168 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_08380 21854 21105 gene locus_tag LOCUS_08390 gene etfB 21854 21105 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_08390 22383 21916 gene locus_tag LOCUS_08400 22383 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 protein_id gnl|my_center|LOCUS_08400 22723 23778 gene locus_tag LOCUS_08410 gene selU 22723 23778 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG6 protein_id gnl|my_center|LOCUS_08410 23783 26503 gene locus_tag LOCUS_08420 23783 26503 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence027 <1 558 gene locus_tag LOCUS_08430 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339002.1:LysR family transcriptional regulator 2588 555 gene locus_tag LOCUS_08440 gene gcd-1 2588 555 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_08440 4556 2691 gene locus_tag LOCUS_08450 4556 2691 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 protein_id gnl|my_center|LOCUS_08450 4663 5133 gene locus_tag LOCUS_08460 4663 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_08460 5126 7315 gene locus_tag LOCUS_08470 gene glcB 5126 7315 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_08470 7460 8212 gene locus_tag LOCUS_08480 7460 8212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_08480 8206 10587 gene locus_tag LOCUS_08490 8206 10587 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_08490 10594 11763 gene locus_tag LOCUS_08500 10594 11763 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 protein_id gnl|my_center|LOCUS_08500 11978 12460 gene locus_tag LOCUS_08510 11978 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 13211 12546 gene locus_tag LOCUS_08520 13211 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 14972 13356 gene locus_tag LOCUS_08530 14972 13356 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_08530 17097 15064 gene locus_tag LOCUS_08540 17097 15064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975516.1 protein_id gnl|my_center|LOCUS_08540 18553 17168 gene locus_tag LOCUS_08550 18553 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 19734 18550 gene locus_tag LOCUS_08560 19734 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 21443 19773 gene locus_tag LOCUS_08570 21443 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_08570 21846 22481 gene locus_tag LOCUS_08580 21846 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 23320 22463 gene locus_tag LOCUS_08590 gene cobB 23320 22463 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L2 protein_id gnl|my_center|LOCUS_08590 23411 24223 gene locus_tag LOCUS_08600 23411 24223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 24220 25002 gene locus_tag LOCUS_08610 24220 25002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 25049 25942 gene locus_tag LOCUS_08620 25049 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 26143 27705 gene locus_tag LOCUS_08630 26143 27705 CDS product putative acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704783.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence028 1303 200 gene locus_tag LOCUS_08640 1303 200 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267930.1 protein_id gnl|my_center|LOCUS_08640 2495 1329 gene locus_tag LOCUS_08650 2495 1329 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730125.1 protein_id gnl|my_center|LOCUS_08650 3406 2510 gene locus_tag LOCUS_08660 3406 2510 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089536.1 protein_id gnl|my_center|LOCUS_08660 3855 3403 gene locus_tag LOCUS_08670 3855 3403 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_08670 3967 5685 gene locus_tag LOCUS_08680 3967 5685 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 protein_id gnl|my_center|LOCUS_08680 5697 6905 gene locus_tag LOCUS_08690 5697 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6921 7895 gene locus_tag LOCUS_08700 6921 7895 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_08700 7906 8883 gene locus_tag LOCUS_08710 7906 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_08710 9405 10724 gene locus_tag LOCUS_08720 9405 10724 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_08720 10733 11974 gene locus_tag LOCUS_08730 10733 11974 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_08730 12032 12925 gene locus_tag LOCUS_08740 12032 12925 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_08740 12928 16533 gene locus_tag LOCUS_08750 12928 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_08750 16742 18874 gene locus_tag LOCUS_08760 16742 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 20979 18967 gene locus_tag LOCUS_08770 20979 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 21266 22768 gene locus_tag LOCUS_08780 21266 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 22792 23106 gene locus_tag LOCUS_08790 22792 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_08790 23147 23524 gene locus_tag LOCUS_08800 23147 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 protein_id gnl|my_center|LOCUS_08800 23524 24294 gene locus_tag LOCUS_08810 23524 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 24321 25994 gene locus_tag LOCUS_08820 gene exaA 24321 25994 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_08820 26162 27094 gene locus_tag LOCUS_08830 26162 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence029 576 2033 gene locus_tag LOCUS_08840 gene leuC 576 2033 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_08840 2030 2686 gene locus_tag LOCUS_08850 gene leuD 2030 2686 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_08850 2738 3757 gene locus_tag LOCUS_08860 gene asd 2738 3757 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_08860 3837 6686 gene locus_tag LOCUS_08870 3837 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6676 7497 gene locus_tag LOCUS_08880 gene truA 6676 7497 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z500 protein_id gnl|my_center|LOCUS_08880 7523 8191 gene locus_tag LOCUS_08890 gene trpF 7523 8191 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_08890 8198 9430 gene locus_tag LOCUS_08900 gene trpB 8198 9430 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_08900 9441 10262 gene locus_tag LOCUS_08910 gene trpA 9441 10262 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_08910 10353 11216 gene locus_tag LOCUS_08920 gene accD 10353 11216 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN6 protein_id gnl|my_center|LOCUS_08920 11236 12531 gene locus_tag LOCUS_08930 gene folC 11236 12531 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_08930 12528 13166 gene locus_tag LOCUS_08940 12528 13166 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_08940 13191 13691 gene locus_tag LOCUS_08950 13191 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_08950 13734 15260 gene locus_tag LOCUS_08960 gene purF 13734 15260 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_08960 15286 16287 gene locus_tag LOCUS_08970 15286 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_08970 16274 17290 gene locus_tag LOCUS_08980 16274 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_08980 17280 19313 gene locus_tag LOCUS_08990 gene tgpA 17280 19313 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_08990 20805 19342 gene locus_tag LOCUS_09000 20805 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 21819 20935 gene locus_tag LOCUS_09010 21819 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 22597 21836 gene locus_tag LOCUS_09020 22597 21836 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 protein_id gnl|my_center|LOCUS_09020 23390 22584 gene locus_tag LOCUS_09030 23390 22584 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_09030 23711 23484 gene locus_tag LOCUS_09040 23711 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 23891 24775 gene locus_tag LOCUS_09050 23891 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 24822 26003 gene locus_tag LOCUS_09060 24822 26003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 26691 26011 gene locus_tag LOCUS_09070 26691 26011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence030 1079 447 gene locus_tag LOCUS_09080 1079 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1827 1156 gene locus_tag LOCUS_09090 1827 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2950 1958 gene locus_tag LOCUS_09100 2950 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_09100 3071 4966 gene locus_tag LOCUS_09110 3071 4966 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 protein_id gnl|my_center|LOCUS_09110 6035 5106 gene locus_tag LOCUS_09120 6035 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 6668 6216 gene locus_tag LOCUS_09130 6668 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7816 6698 gene locus_tag LOCUS_09140 7816 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8634 7834 gene locus_tag LOCUS_09150 8634 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9876 8899 gene locus_tag LOCUS_09160 9876 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 10585 10163 gene locus_tag LOCUS_09170 10585 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12371 10593 gene locus_tag LOCUS_09180 12371 10593 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_09180 12563 13804 gene locus_tag LOCUS_09190 12563 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 16420 13844 gene locus_tag LOCUS_09200 16420 13844 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_09200 16639 16448 gene locus_tag LOCUS_09210 16639 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 18203 16557 gene locus_tag LOCUS_09220 18203 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 19177 18212 gene locus_tag LOCUS_09230 19177 18212 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_09230 19250 19915 gene locus_tag LOCUS_09240 19250 19915 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_09240 21859 21605 gene locus_tag LOCUS_09250 21859 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 22808 22302 gene locus_tag LOCUS_09260 22808 22302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 23014 24249 gene locus_tag LOCUS_09270 23014 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_09270 24331 26136 gene locus_tag LOCUS_09280 24331 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence031 178 2199 gene locus_tag LOCUS_09290 gene fadH1 178 2199 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_09290 3057 2206 gene locus_tag LOCUS_09300 3057 2206 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886781.1 protein_id gnl|my_center|LOCUS_09300 4019 3096 gene locus_tag LOCUS_09310 4019 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4659 4009 gene locus_tag LOCUS_09320 4659 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6226 4766 gene locus_tag LOCUS_09330 6226 4766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_09330 6375 7169 gene locus_tag LOCUS_09340 6375 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_09340 8285 7194 gene locus_tag LOCUS_09350 8285 7194 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_09350 9016 8309 gene locus_tag LOCUS_09360 9016 8309 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_09360 10153 9020 gene locus_tag LOCUS_09370 10153 9020 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_09370 11317 10175 gene locus_tag LOCUS_09380 11317 10175 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_09380 12119 11595 gene locus_tag LOCUS_09390 12119 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 12347 12778 gene locus_tag LOCUS_09400 12347 12778 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_09400 12775 13209 gene locus_tag LOCUS_09410 12775 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 13344 13883 gene locus_tag LOCUS_09420 13344 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 15284 13971 gene locus_tag LOCUS_09430 15284 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 15680 16708 gene locus_tag LOCUS_09440 15680 16708 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_09440 16705 18270 gene locus_tag LOCUS_09450 gene ilvB 16705 18270 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_09450 18373 18969 gene locus_tag LOCUS_09460 18373 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 18966 19328 gene locus_tag LOCUS_09470 18966 19328 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932854.1 protein_id gnl|my_center|LOCUS_09470 19360 20616 gene locus_tag LOCUS_09480 19360 20616 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_09480 21102 20626 gene locus_tag LOCUS_09490 21102 20626 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_09490 22169 21099 gene locus_tag LOCUS_09500 22169 21099 CDS product hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_09500 22232 22612 gene locus_tag LOCUS_09510 22232 22612 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266252.1 protein_id gnl|my_center|LOCUS_09510 23252 22653 gene locus_tag LOCUS_09520 23252 22653 CDS product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_09520 23522 24553 gene locus_tag LOCUS_09530 23522 24553 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_09530 24966 24547 gene locus_tag LOCUS_09540 24966 24547 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_09540 25505 24963 gene locus_tag LOCUS_09550 25505 24963 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_09550 26581 25502 gene locus_tag LOCUS_09560 26581 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence032 3 239 gene locus_tag LOCUS_09570 3 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1403 246 gene locus_tag LOCUS_09580 1403 246 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529846.1 protein_id gnl|my_center|LOCUS_09580 1941 1471 gene locus_tag LOCUS_09590 1941 1471 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327407.1 protein_id gnl|my_center|LOCUS_09590 2189 3610 gene locus_tag LOCUS_09600 2189 3610 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_09600 3616 4371 gene locus_tag LOCUS_09610 3616 4371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_09610 5180 4419 gene locus_tag LOCUS_09620 5180 4419 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FX0 protein_id gnl|my_center|LOCUS_09620 6112 5177 gene locus_tag LOCUS_09630 6112 5177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_09630 6236 7549 gene locus_tag LOCUS_09640 6236 7549 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267549.1 protein_id gnl|my_center|LOCUS_09640 8226 7555 gene locus_tag LOCUS_09650 8226 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9629 8256 gene locus_tag LOCUS_09660 gene radA 9629 8256 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M29 protein_id gnl|my_center|LOCUS_09660 10796 9645 gene locus_tag LOCUS_09670 gene alr1 10796 9645 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY6 protein_id gnl|my_center|LOCUS_09670 12221 10839 gene locus_tag LOCUS_09680 12221 10839 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 protein_id gnl|my_center|LOCUS_09680 12819 12322 gene locus_tag LOCUS_09690 gene rplI 12819 12322 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_09690 13697 12861 gene locus_tag LOCUS_09700 13697 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_09700 13943 13713 gene locus_tag LOCUS_09710 gene rpsR 13943 13713 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_09710 14447 13998 gene locus_tag LOCUS_09720 gene rpsF 14447 13998 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L72 protein_id gnl|my_center|LOCUS_09720 15356 14598 gene locus_tag LOCUS_09730 gene rlmB 15356 14598 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX2 protein_id gnl|my_center|LOCUS_09730 17839 15356 gene locus_tag LOCUS_09740 gene rnr 17839 15356 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_09740 17972 18058 gene locus_tag LOCUS_t00070 17972 18058 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18700 18323 gene locus_tag LOCUS_09750 18700 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19102 18914 gene locus_tag LOCUS_09760 19102 18914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 20655 19570 gene locus_tag LOCUS_09770 20655 19570 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 protein_id gnl|my_center|LOCUS_09770 22081 20804 gene locus_tag LOCUS_09780 gene purA 22081 20804 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_09780 23350 22154 gene locus_tag LOCUS_09790 gene hisZ 23350 22154 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX6 protein_id gnl|my_center|LOCUS_09790 23564 23379 gene locus_tag LOCUS_09800 23564 23379 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368629.1 protein_id gnl|my_center|LOCUS_09800 24548 23682 gene locus_tag LOCUS_09810 24548 23682 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_09810 25746 24550 gene locus_tag LOCUS_09820 25746 24550 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_09820 <27060 25791 gene locus_tag LOCUS_09830 <27060 25791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYX9:GTPase HflX >Feature sequence033 1870 464 gene locus_tag LOCUS_09840 1870 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2043 2744 gene locus_tag LOCUS_09850 2043 2744 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257441.1 protein_id gnl|my_center|LOCUS_09850 2935 4623 gene locus_tag LOCUS_09860 2935 4623 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_09860 4653 5993 gene locus_tag LOCUS_09870 4653 5993 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_09870 5996 7339 gene locus_tag LOCUS_09880 5996 7339 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_09880 7348 7848 gene locus_tag LOCUS_09890 7348 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8587 7868 gene locus_tag LOCUS_09900 8587 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8727 9533 gene locus_tag LOCUS_09910 8727 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9545 10792 gene locus_tag LOCUS_09920 9545 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 11875 10796 gene locus_tag LOCUS_09930 11875 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 12546 11872 gene locus_tag LOCUS_09940 12546 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12925 12548 gene locus_tag LOCUS_09950 12925 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13425 12925 gene locus_tag LOCUS_09960 13425 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 13810 13403 gene locus_tag LOCUS_09970 13810 13403 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_09970 15962 13821 gene locus_tag LOCUS_09980 15962 13821 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_09980 17176 15971 gene locus_tag LOCUS_09990 gene xpsF 17176 15971 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31744 protein_id gnl|my_center|LOCUS_09990 18630 17173 gene locus_tag LOCUS_10000 18630 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 19200 18631 gene locus_tag LOCUS_10010 19200 18631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 20499 19204 gene locus_tag LOCUS_10020 20499 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 21314 20661 gene locus_tag LOCUS_10030 gene dsbA 21314 20661 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_10030 22043 21435 gene locus_tag LOCUS_10040 gene cc4 22043 21435 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_10040 22168 22791 gene locus_tag LOCUS_10050 gene engB 22168 22791 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT81 protein_id gnl|my_center|LOCUS_10050 25519 22769 gene locus_tag LOCUS_10060 gene polA 25519 22769 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_10060 26496 25516 gene locus_tag LOCUS_10070 26496 25516 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence034 <1 1257 gene locus_tag LOCUS_10080 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RI12:selenide, water dikinase 1319 2038 gene locus_tag LOCUS_10090 1319 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2076 2705 gene locus_tag LOCUS_10100 2076 2705 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_10100 3879 2749 gene locus_tag LOCUS_10110 gene uptC 3879 2749 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_10110 6267 3922 gene locus_tag LOCUS_10120 6267 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 8412 6268 gene locus_tag LOCUS_10130 gene ppk 8412 6268 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S51 protein_id gnl|my_center|LOCUS_10130 8606 8533 gene locus_tag LOCUS_t00080 8606 8533 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9604 8627 gene locus_tag LOCUS_10140 9604 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 9895 9620 gene locus_tag LOCUS_10150 9895 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 11036 9960 gene locus_tag LOCUS_10160 11036 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084186.1 protein_id gnl|my_center|LOCUS_10160 13294 11120 gene locus_tag LOCUS_10170 13294 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 14496 13411 gene locus_tag LOCUS_10180 14496 13411 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_10180 15278 14508 gene locus_tag LOCUS_10190 15278 14508 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_10190 15281 15667 gene locus_tag LOCUS_10200 15281 15667 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66536 protein_id gnl|my_center|LOCUS_10200 16752 15673 gene locus_tag LOCUS_10210 gene mtnA 16752 15673 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_10210 18760 16784 gene locus_tag LOCUS_10220 18760 16784 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_10220 19267 18845 gene locus_tag LOCUS_10230 19267 18845 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_10230 20008 19418 gene locus_tag LOCUS_10240 20008 19418 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_10240 21108 20362 gene locus_tag LOCUS_10250 21108 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_10250 21996 21127 gene locus_tag LOCUS_10260 21996 21127 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268866.1 protein_id gnl|my_center|LOCUS_10260 26079 22012 gene locus_tag LOCUS_10270 26079 22012 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_10270 <26884 26170 gene locus_tag LOCUS_10280 <26884 26170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094386.1:axial filament protein >Feature sequence035 824 219 gene locus_tag LOCUS_10290 824 219 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_10290 1420 1106 gene locus_tag LOCUS_10300 gene zapA 1420 1106 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_10300 1641 1435 gene locus_tag LOCUS_10310 1641 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1861 3183 gene locus_tag LOCUS_10320 gene pepP 1861 3183 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_10320 3188 4414 gene locus_tag LOCUS_10330 3188 4414 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266319.1 protein_id gnl|my_center|LOCUS_10330 4855 4427 gene locus_tag LOCUS_10340 4855 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_10340 5330 4848 gene locus_tag LOCUS_10350 5330 4848 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066960.1 protein_id gnl|my_center|LOCUS_10350 5437 6681 gene locus_tag LOCUS_10360 5437 6681 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_10360 7361 6675 gene locus_tag LOCUS_10370 7361 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 8773 7394 gene locus_tag LOCUS_10380 8773 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9659 8817 gene locus_tag LOCUS_10390 9659 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_10390 11977 9656 gene locus_tag LOCUS_10400 11977 9656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_10400 12232 12420 gene locus_tag LOCUS_10410 12232 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 12550 13266 gene locus_tag LOCUS_10420 12550 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 13349 15205 gene locus_tag LOCUS_10430 13349 15205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_10430 15202 15522 gene locus_tag LOCUS_10440 15202 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 17109 15529 gene locus_tag LOCUS_10450 17109 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_10450 18041 17106 gene locus_tag LOCUS_10460 18041 17106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_10460 18638 18051 gene locus_tag LOCUS_10470 gene yceI 18638 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_10470 18759 20162 gene locus_tag LOCUS_10480 18759 20162 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729025.1 protein_id gnl|my_center|LOCUS_10480 21620 20184 gene locus_tag LOCUS_10490 gene gltD 21620 20184 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_10490 26237 21675 gene locus_tag LOCUS_10500 gene gltB 26237 21675 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence036 <1 640 gene locus_tag LOCUS_10510 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073109.1:flagellum-specific ATP synthase FliI 668 1081 gene locus_tag LOCUS_10520 668 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1155 2870 gene locus_tag LOCUS_10530 1155 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2882 3454 gene locus_tag LOCUS_10540 2882 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3483 4481 gene locus_tag LOCUS_10550 gene fliM 3483 4481 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSW7 protein_id gnl|my_center|LOCUS_10550 4478 4813 gene locus_tag LOCUS_10560 4478 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4853 5125 gene locus_tag LOCUS_10570 4853 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5335 5117 gene locus_tag LOCUS_10580 5335 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5223 5894 gene locus_tag LOCUS_10590 gene fliP 5223 5894 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V864 protein_id gnl|my_center|LOCUS_10590 5899 6168 gene locus_tag LOCUS_10600 gene fliQ 5899 6168 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_10600 6165 6947 gene locus_tag LOCUS_10610 gene fliR 6165 6947 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYF6 protein_id gnl|my_center|LOCUS_10610 6937 8100 gene locus_tag LOCUS_10620 gene flhB 6937 8100 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_10620 8097 8756 gene locus_tag LOCUS_10630 8097 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9744 8767 gene locus_tag LOCUS_10640 9744 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9949 10419 gene locus_tag LOCUS_10650 9949 10419 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_10650 10779 11228 gene locus_tag LOCUS_10660 10779 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11225 11866 gene locus_tag LOCUS_10670 gene nuoB 11225 11866 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XXZ6 protein_id gnl|my_center|LOCUS_10670 11926 13713 gene locus_tag LOCUS_10680 gene nuoC 11926 13713 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J9 protein_id gnl|my_center|LOCUS_10680 13729 14256 gene locus_tag LOCUS_10690 13729 14256 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 protein_id gnl|my_center|LOCUS_10690 14253 15572 gene locus_tag LOCUS_10700 14253 15572 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789507.1 protein_id gnl|my_center|LOCUS_10700 15572 18340 gene locus_tag LOCUS_10710 gene nuoG 15572 18340 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J6 protein_id gnl|my_center|LOCUS_10710 18337 19296 gene locus_tag LOCUS_10720 gene nuoH 18337 19296 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ61 protein_id gnl|my_center|LOCUS_10720 19296 19835 gene locus_tag LOCUS_10730 gene nuoI 19296 19835 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI6 protein_id gnl|my_center|LOCUS_10730 19832 20314 gene locus_tag LOCUS_10740 19832 20314 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500212.1 protein_id gnl|my_center|LOCUS_10740 20334 20642 gene locus_tag LOCUS_10750 gene nuoK 20334 20642 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J2 protein_id gnl|my_center|LOCUS_10750 20650 22512 gene locus_tag LOCUS_10760 gene nuoL 20650 22512 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J1 protein_id gnl|my_center|LOCUS_10760 22509 23993 gene locus_tag LOCUS_10770 22509 23993 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554022.1 protein_id gnl|my_center|LOCUS_10770 23993 25462 gene locus_tag LOCUS_10780 gene nuoN 23993 25462 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_10780 25541 26155 gene locus_tag LOCUS_10790 25541 26155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence037 <1 1398 gene locus_tag LOCUS_10800 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071899.1:membrane protein 1885 1412 gene locus_tag LOCUS_10810 gene tdcF 1885 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368469.1 protein_id gnl|my_center|LOCUS_10810 2544 1918 gene locus_tag LOCUS_10820 2544 1918 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_10820 3089 2541 gene locus_tag LOCUS_10830 3089 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10830 4124 3090 gene locus_tag LOCUS_10840 4124 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10840 6827 4293 gene locus_tag LOCUS_10850 gene bfeA 6827 4293 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_10850 7190 9238 gene locus_tag LOCUS_10860 7190 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 10375 9260 gene locus_tag LOCUS_10870 gene serC 10375 9260 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80862 protein_id gnl|my_center|LOCUS_10870 11560 10379 gene locus_tag LOCUS_10880 11560 10379 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_10880 11691 12536 gene locus_tag LOCUS_10890 11691 12536 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_10890 12533 12808 gene locus_tag LOCUS_10900 12533 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 12884 13372 gene locus_tag LOCUS_10910 12884 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 13381 14325 gene locus_tag LOCUS_10920 13381 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_10920 14328 14738 gene locus_tag LOCUS_10930 14328 14738 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_10930 16234 14750 gene locus_tag LOCUS_10940 16234 14750 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_10940 16365 17624 gene locus_tag LOCUS_10950 gene proA 16365 17624 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_10950 17795 18277 gene locus_tag LOCUS_10960 17795 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 18307 18663 gene locus_tag LOCUS_10970 18307 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 18660 19130 gene locus_tag LOCUS_10980 gene rlmH 18660 19130 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP8 protein_id gnl|my_center|LOCUS_10980 19294 21267 gene locus_tag LOCUS_10990 gene pbpA 19294 21267 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10990 21264 22409 gene locus_tag LOCUS_11000 gene rodA 21264 22409 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_11000 22542 23399 gene locus_tag LOCUS_11010 gene rlpA 22542 23399 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V6 protein_id gnl|my_center|LOCUS_11010 23483 24676 gene locus_tag LOCUS_11020 gene dacC 23483 24676 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_11020 24676 24972 gene locus_tag LOCUS_11030 24676 24972 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_11030 24989 25693 gene locus_tag LOCUS_11040 gene lipB 24989 25693 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF8 protein_id gnl|my_center|LOCUS_11040 >Feature sequence038 1906 557 gene locus_tag LOCUS_11050 gene rimO 1906 557 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_11050 2120 3523 gene locus_tag LOCUS_11060 gene phrB 2120 3523 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_11060 4605 3502 gene locus_tag LOCUS_11070 4605 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4897 4821 gene locus_tag LOCUS_t00090 4897 4821 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5022 6014 gene locus_tag LOCUS_11080 5022 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11080 6016 6618 gene locus_tag LOCUS_11090 6016 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11090 7243 6713 gene locus_tag LOCUS_11100 7243 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 8265 7351 gene locus_tag LOCUS_11110 8265 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 protein_id gnl|my_center|LOCUS_11110 9218 8319 gene locus_tag LOCUS_11120 9218 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9363 9273 gene locus_tag LOCUS_t00100 9363 9273 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9636 9430 gene locus_tag LOCUS_11130 gene csrA 9636 9430 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_11130 10927 9671 gene locus_tag LOCUS_11140 10927 9671 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_11140 13603 11003 gene locus_tag LOCUS_11150 gene alaS 13603 11003 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4D5 protein_id gnl|my_center|LOCUS_11150 14720 13644 gene locus_tag LOCUS_11160 14720 13644 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_11160 14874 16703 gene locus_tag LOCUS_11170 14874 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 17670 16708 gene locus_tag LOCUS_11180 17670 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 20710 17804 gene locus_tag LOCUS_11190 20710 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 22598 20841 gene locus_tag LOCUS_11200 gene recJ 22598 20841 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_11200 24017 22623 gene locus_tag LOCUS_11210 gene thrC 24017 22623 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103569.1 protein_id gnl|my_center|LOCUS_11210 <25320 24053 gene locus_tag LOCUS_11220 <25320 24053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29365:homoserine dehydrogenase >Feature sequence039 123 542 gene locus_tag LOCUS_11230 123 542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_11230 542 1357 gene locus_tag LOCUS_11240 gene thiD 542 1357 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_11240 1359 2027 gene locus_tag LOCUS_11250 gene thiE 1359 2027 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_11250 2036 3343 gene locus_tag LOCUS_11260 gene hemL 2036 3343 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_11260 3362 4366 gene locus_tag LOCUS_11270 3362 4366 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_11270 5521 4397 gene locus_tag LOCUS_11280 gene dnaJ 5521 4397 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_11280 7579 5636 gene locus_tag LOCUS_11290 gene dnaK 7579 5636 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_11290 8282 7713 gene locus_tag LOCUS_11300 gene grpE 8282 7713 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI7 protein_id gnl|my_center|LOCUS_11300 8389 10065 gene locus_tag LOCUS_11310 gene recN 8389 10065 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_11310 10566 10144 gene locus_tag LOCUS_11320 gene fur 10566 10144 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_11320 10665 11042 gene locus_tag LOCUS_11330 10665 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 13191 11047 gene locus_tag LOCUS_11340 13191 11047 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_11340 13574 13293 gene locus_tag LOCUS_11350 13574 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 14568 13567 gene locus_tag LOCUS_11360 14568 13567 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_11360 14903 14559 gene locus_tag LOCUS_11370 14903 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15460 14903 gene locus_tag LOCUS_11380 15460 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16146 15838 gene locus_tag LOCUS_11390 16146 15838 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_11390 16577 16146 gene locus_tag LOCUS_11400 16577 16146 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_11400 18024 16600 gene locus_tag LOCUS_11410 18024 16600 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_11410 18106 18582 gene locus_tag LOCUS_11420 gene smpB 18106 18582 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_11420 20418 18589 gene locus_tag LOCUS_11430 20418 18589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21723 20542 gene locus_tag LOCUS_11440 21723 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 22459 21713 gene locus_tag LOCUS_11450 22459 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 24606 22456 gene locus_tag LOCUS_11460 24606 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 23510 23593 gene locus_tag LOCUS_t00110 23510 23593 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 1812 436 gene locus_tag LOCUS_11470 1812 436 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_11470 3212 1809 gene locus_tag LOCUS_11480 gene fumC2 3212 1809 CDS product fumarate hydratase class II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I587 protein_id gnl|my_center|LOCUS_11480 5880 3235 gene locus_tag LOCUS_11490 5880 3235 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQY6 protein_id gnl|my_center|LOCUS_11490 6088 8331 gene locus_tag LOCUS_11500 6088 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 8548 8766 gene locus_tag LOCUS_11510 8548 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 8770 9090 gene locus_tag LOCUS_11520 8770 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10213 9179 gene locus_tag LOCUS_11530 10213 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11379 10426 gene locus_tag LOCUS_11540 11379 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_11540 11454 12452 gene locus_tag LOCUS_11550 11454 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 protein_id gnl|my_center|LOCUS_11550 12539 13510 gene locus_tag LOCUS_11560 gene corA 12539 13510 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE82 protein_id gnl|my_center|LOCUS_11560 13544 14461 gene locus_tag LOCUS_11570 13544 14461 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463614.1 protein_id gnl|my_center|LOCUS_11570 15024 14458 gene locus_tag LOCUS_11580 15024 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 16065 15085 gene locus_tag LOCUS_11590 16065 15085 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_11590 16499 16083 gene locus_tag LOCUS_11600 16499 16083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_11600 16636 17628 gene locus_tag LOCUS_11610 16636 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 17800 19083 gene locus_tag LOCUS_11620 17800 19083 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_11620 19268 20278 gene locus_tag LOCUS_11630 19268 20278 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_11630 21791 20301 gene locus_tag LOCUS_11640 21791 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_11640 21991 23850 gene locus_tag LOCUS_11650 gene gatAX 21991 23850 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence041 629 69 gene locus_tag LOCUS_11660 629 69 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083166.1 protein_id gnl|my_center|LOCUS_11660 2190 817 gene locus_tag LOCUS_11670 2190 817 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_11670 2419 4695 gene locus_tag LOCUS_11680 2419 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_11680 4720 5586 gene locus_tag LOCUS_11690 4720 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_11690 5583 6062 gene locus_tag LOCUS_11700 5583 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11700 6063 6818 gene locus_tag LOCUS_11710 6063 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11710 7353 6892 gene locus_tag LOCUS_11720 7353 6892 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_11720 7578 8015 gene locus_tag LOCUS_11730 7578 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8282 11332 gene locus_tag LOCUS_11740 8282 11332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_11740 12851 11448 gene locus_tag LOCUS_11750 12851 11448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_11750 12996 14387 gene locus_tag LOCUS_11760 12996 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 14668 14402 gene locus_tag LOCUS_11770 14668 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 14606 15343 gene locus_tag LOCUS_11780 14606 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 15382 16389 gene locus_tag LOCUS_11790 15382 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808527.1 protein_id gnl|my_center|LOCUS_11790 16396 17886 gene locus_tag LOCUS_11800 16396 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 17888 18334 gene locus_tag LOCUS_11810 17888 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 19032 18304 gene locus_tag LOCUS_11820 19032 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19166 19543 gene locus_tag LOCUS_11830 19166 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 19618 20829 gene locus_tag LOCUS_11840 19618 20829 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389396.1 protein_id gnl|my_center|LOCUS_11840 20857 21831 gene locus_tag LOCUS_11850 20857 21831 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204804.1 protein_id gnl|my_center|LOCUS_11850 23978 21837 gene locus_tag LOCUS_11860 23978 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence042 883 524 gene locus_tag LOCUS_11870 883 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545636.1 protein_id gnl|my_center|LOCUS_11870 4021 896 gene locus_tag LOCUS_11880 4021 896 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_11880 5313 4075 gene locus_tag LOCUS_11890 5313 4075 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_11890 6430 5321 gene locus_tag LOCUS_11900 6430 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6912 6589 gene locus_tag LOCUS_11910 6912 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7485 6946 gene locus_tag LOCUS_11920 7485 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_11920 8238 7531 gene locus_tag LOCUS_11930 8238 7531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_11930 9239 8271 gene locus_tag LOCUS_11940 9239 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 9676 9236 gene locus_tag LOCUS_11950 9676 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9841 10557 gene locus_tag LOCUS_11960 9841 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11006 13105 gene locus_tag LOCUS_11970 11006 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 13289 14800 gene locus_tag LOCUS_11980 13289 14800 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 protein_id gnl|my_center|LOCUS_11980 15120 15671 gene locus_tag LOCUS_11990 15120 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 16105 15716 gene locus_tag LOCUS_12000 16105 15716 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_12000 16273 16653 gene locus_tag LOCUS_12010 16273 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 17053 17238 gene locus_tag LOCUS_12020 17053 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 17696 17253 gene locus_tag LOCUS_12030 gene hmrR2 17696 17253 CDS product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 protein_id gnl|my_center|LOCUS_12030 19181 17784 gene locus_tag LOCUS_12040 gene oprN 19181 17784 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_12040 22326 19174 gene locus_tag LOCUS_12050 22326 19174 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_12050 23232 22339 gene locus_tag LOCUS_12060 gene mexE 23232 22339 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073334.1 protein_id gnl|my_center|LOCUS_12060 23529 23377 gene locus_tag LOCUS_12070 23529 23377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence043 678 2483 gene locus_tag LOCUS_12080 678 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2694 5249 gene locus_tag LOCUS_12090 gene fecA 2694 5249 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_12090 5574 5939 gene locus_tag LOCUS_12100 5574 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6917 5952 gene locus_tag LOCUS_12110 6917 5952 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_12110 7098 7304 gene locus_tag LOCUS_12120 7098 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7744 7352 gene locus_tag LOCUS_12130 7744 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9465 7783 gene locus_tag LOCUS_12140 gene nadB 9465 7783 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_12140 9740 10315 gene locus_tag LOCUS_12150 gene algU 9740 10315 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_12150 10352 10951 gene locus_tag LOCUS_12160 gene mucA 10352 10951 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246812.1 protein_id gnl|my_center|LOCUS_12160 11067 12509 gene locus_tag LOCUS_12170 gene mucD 11067 12509 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_12170 12614 14413 gene locus_tag LOCUS_12180 gene lepA 12614 14413 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_12180 14413 15252 gene locus_tag LOCUS_12190 14413 15252 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD9 protein_id gnl|my_center|LOCUS_12190 15335 15712 gene locus_tag LOCUS_12200 15335 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 15713 16393 gene locus_tag LOCUS_12210 gene rnc 15713 16393 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPB0 protein_id gnl|my_center|LOCUS_12210 16390 17307 gene locus_tag LOCUS_12220 gene era 16390 17307 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE2 protein_id gnl|my_center|LOCUS_12220 17322 18053 gene locus_tag LOCUS_12230 gene recO 17322 18053 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51838 protein_id gnl|my_center|LOCUS_12230 18110 18997 gene locus_tag LOCUS_12240 gene cysM 18110 18997 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_12240 19005 20378 gene locus_tag LOCUS_12250 gene rlmD 19005 20378 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_12250 20449 21258 gene locus_tag LOCUS_12260 gene mazG 20449 21258 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_12260 21294 21944 gene locus_tag LOCUS_12270 gene adk 21294 21944 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_12270 22277 22894 gene locus_tag LOCUS_12280 22277 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 23107 23433 gene locus_tag LOCUS_12290 23107 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence044 <1 2420 gene locus_tag LOCUS_12300 <1 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405434.1:aminopeptidase 2582 2430 gene locus_tag LOCUS_12310 2582 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2793 3815 gene locus_tag LOCUS_12320 gene glpQ 2793 3815 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705544.1 protein_id gnl|my_center|LOCUS_12320 3843 4535 gene locus_tag LOCUS_12330 3843 4535 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_12330 4693 5244 gene locus_tag LOCUS_12340 4693 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_12340 5256 6485 gene locus_tag LOCUS_12350 5256 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7773 6493 gene locus_tag LOCUS_12360 7773 6493 CDS product organophopsphate acid anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729793.1 protein_id gnl|my_center|LOCUS_12360 7956 9977 gene locus_tag LOCUS_12370 7956 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_12370 10749 9988 gene locus_tag LOCUS_12380 gene madM 10749 9988 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765415.1 protein_id gnl|my_center|LOCUS_12380 11144 10749 gene locus_tag LOCUS_12390 11144 10749 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_12390 11358 13007 gene locus_tag LOCUS_12400 11358 13007 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_12400 13031 13795 gene locus_tag LOCUS_12410 13031 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 13893 14369 gene locus_tag LOCUS_12420 13893 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 15104 14373 gene locus_tag LOCUS_12430 15104 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 16149 15325 gene locus_tag LOCUS_12440 16149 15325 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_12440 17060 16146 gene locus_tag LOCUS_12450 17060 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 17641 17147 gene locus_tag LOCUS_12460 17641 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 18619 17732 gene locus_tag LOCUS_12470 18619 17732 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_12470 18689 19363 gene locus_tag LOCUS_12480 gene azoR 18689 19363 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E990 protein_id gnl|my_center|LOCUS_12480 19420 20247 gene locus_tag LOCUS_12490 19420 20247 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_12490 20311 21267 gene locus_tag LOCUS_12500 gene cysK 20311 21267 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P600 protein_id gnl|my_center|LOCUS_12500 21761 21288 gene locus_tag LOCUS_12510 21761 21288 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_12510 22138 21758 gene locus_tag LOCUS_12520 22138 21758 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_12520 22430 22125 gene locus_tag LOCUS_12530 22430 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 22548 23801 gene locus_tag LOCUS_12540 22548 23801 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence045 2148 235 gene locus_tag LOCUS_12550 2148 235 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_12550 2308 2796 gene locus_tag LOCUS_12560 2308 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_12560 2809 3297 gene locus_tag LOCUS_12570 2809 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3457 4842 gene locus_tag LOCUS_12580 3457 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5130 5417 gene locus_tag LOCUS_12590 5130 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6893 5451 gene locus_tag LOCUS_12600 6893 5451 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_12600 7462 6980 gene locus_tag LOCUS_12610 7462 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 protein_id gnl|my_center|LOCUS_12610 8550 7546 gene locus_tag LOCUS_12620 8550 7546 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_12620 8808 9419 gene locus_tag LOCUS_12630 8808 9419 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919980.1 protein_id gnl|my_center|LOCUS_12630 9924 9424 gene locus_tag LOCUS_12640 9924 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 11288 10047 gene locus_tag LOCUS_12650 11288 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 11966 11343 gene locus_tag LOCUS_12660 11966 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 13337 12150 gene locus_tag LOCUS_12670 13337 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_12670 14334 13411 gene locus_tag LOCUS_12680 14334 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 15880 14531 gene locus_tag LOCUS_12690 15880 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 16412 17386 gene locus_tag LOCUS_12700 16412 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 17747 17514 gene locus_tag LOCUS_12710 17747 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 17843 19081 gene locus_tag LOCUS_12720 17843 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 19135 20976 gene locus_tag LOCUS_12730 19135 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_12730 20994 21410 gene locus_tag LOCUS_12740 20994 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21421 21642 gene locus_tag LOCUS_12750 21421 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 protein_id gnl|my_center|LOCUS_12750 21916 22725 gene locus_tag LOCUS_12760 21916 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23608 22856 gene locus_tag LOCUS_12770 23608 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence046 3 308 gene locus_tag LOCUS_12780 3 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 345 1418 gene locus_tag LOCUS_12790 345 1418 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023682.1 protein_id gnl|my_center|LOCUS_12790 2750 1455 gene locus_tag LOCUS_12800 2750 1455 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_12800 2861 3823 gene locus_tag LOCUS_12810 2861 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3831 4856 gene locus_tag LOCUS_12820 3831 4856 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142461.1 protein_id gnl|my_center|LOCUS_12820 4959 5996 gene locus_tag LOCUS_12830 4959 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5993 7318 gene locus_tag LOCUS_12840 5993 7318 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_12840 8026 7307 gene locus_tag LOCUS_12850 8026 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8665 8027 gene locus_tag LOCUS_12860 8665 8027 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_12860 8729 9907 gene locus_tag LOCUS_12870 8729 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11023 9911 gene locus_tag LOCUS_12880 11023 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403560.1 protein_id gnl|my_center|LOCUS_12880 12009 11041 gene locus_tag LOCUS_12890 12009 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12603 12025 gene locus_tag LOCUS_12900 12603 12025 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_12900 16053 12790 gene locus_tag LOCUS_12910 gene mcm 16053 12790 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_12910 16231 16869 gene locus_tag LOCUS_12920 16231 16869 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225575.1 protein_id gnl|my_center|LOCUS_12920 16866 19049 gene locus_tag LOCUS_12930 16866 19049 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_12930 19046 20032 gene locus_tag LOCUS_12940 19046 20032 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_12940 20046 20411 gene locus_tag LOCUS_12950 20046 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 20411 20755 gene locus_tag LOCUS_12960 20411 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 21895 20768 gene locus_tag LOCUS_12970 21895 20768 CDS product vtpJ-therm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878319.1 protein_id gnl|my_center|LOCUS_12970 22144 23415 gene locus_tag LOCUS_12980 22144 23415 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence047 3114 2206 gene locus_tag LOCUS_12990 3114 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4402 3269 gene locus_tag LOCUS_13000 4402 3269 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_13000 5517 4819 gene locus_tag LOCUS_13010 5517 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_13010 6039 5518 gene locus_tag LOCUS_13020 6039 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6243 7427 gene locus_tag LOCUS_13030 6243 7427 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228406.1 protein_id gnl|my_center|LOCUS_13030 7807 7547 gene locus_tag LOCUS_13040 7807 7547 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_13040 8098 8889 gene locus_tag LOCUS_13050 8098 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8979 13859 gene locus_tag LOCUS_13060 8979 13859 CDS product DNA damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939452.1 protein_id gnl|my_center|LOCUS_13060 13884 14525 gene locus_tag LOCUS_13070 13884 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_13070 14528 15571 gene locus_tag LOCUS_13080 14528 15571 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_13080 17237 15828 gene locus_tag LOCUS_13090 17237 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17875 17291 gene locus_tag LOCUS_13100 17875 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 18189 17872 gene locus_tag LOCUS_13110 18189 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 18597 18848 gene locus_tag LOCUS_13120 18597 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 18823 20010 gene locus_tag LOCUS_13130 18823 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_13130 20000 20410 gene locus_tag LOCUS_13140 20000 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 21310 20447 gene locus_tag LOCUS_13150 21310 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 21549 22838 gene locus_tag LOCUS_13160 21549 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence048 1648 98 gene locus_tag LOCUS_13170 1648 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1934 2926 gene locus_tag LOCUS_13180 1934 2926 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_13180 3184 5601 gene locus_tag LOCUS_13190 3184 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5931 6263 gene locus_tag LOCUS_13200 5931 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 9707 6306 gene locus_tag LOCUS_13210 9707 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13487 10092 gene locus_tag LOCUS_13220 13487 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17135 13755 gene locus_tag LOCUS_13230 17135 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 19318 17411 gene locus_tag LOCUS_13240 gene speA 19318 17411 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_13240 21646 19448 gene locus_tag LOCUS_13250 21646 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21956 22450 gene locus_tag LOCUS_13260 21956 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13260 22466 23092 gene locus_tag LOCUS_13270 22466 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence049 398 2446 gene locus_tag LOCUS_13280 gene mnmC 398 2446 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_13280 3745 2447 gene locus_tag LOCUS_13290 gene apeB 3745 2447 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_13290 4453 3755 gene locus_tag LOCUS_13300 4453 3755 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI7 protein_id gnl|my_center|LOCUS_13300 4609 5127 gene locus_tag LOCUS_13310 4609 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5245 5880 gene locus_tag LOCUS_13320 5245 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6494 5877 gene locus_tag LOCUS_13330 gene miaE 6494 5877 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_13330 7885 6494 gene locus_tag LOCUS_13340 7885 6494 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404259.1 protein_id gnl|my_center|LOCUS_13340 8965 7910 gene locus_tag LOCUS_13350 8965 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_13350 9871 8981 gene locus_tag LOCUS_13360 gene dapA 9871 8981 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_13360 11052 9970 gene locus_tag LOCUS_13370 11052 9970 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_13370 11311 11066 gene locus_tag LOCUS_13380 11311 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_13380 11464 12525 gene locus_tag LOCUS_13390 11464 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 12533 12916 gene locus_tag LOCUS_13400 12533 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 13325 12966 gene locus_tag LOCUS_13410 13325 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 16459 13349 gene locus_tag LOCUS_13420 16459 13349 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_13420 17748 16507 gene locus_tag LOCUS_13430 17748 16507 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_13430 19006 17756 gene locus_tag LOCUS_13440 gene czcC 19006 17756 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_13440 19425 19078 gene locus_tag LOCUS_13450 19425 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 19938 19465 gene locus_tag LOCUS_13460 19938 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_13460 20685 20029 gene locus_tag LOCUS_13470 20685 20029 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_13470 21763 20774 gene locus_tag LOCUS_13480 21763 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 22130 21735 gene locus_tag LOCUS_13490 22130 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 <22935 22237 gene locus_tag LOCUS_13500 <22935 22237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4W9:quinolinate synthase A >Feature sequence050 1797 1123 gene locus_tag LOCUS_13510 1797 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13510 2136 1807 gene locus_tag LOCUS_13520 2136 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13520 2249 3670 gene locus_tag LOCUS_13530 gene sbcB 2249 3670 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_13530 3761 4915 gene locus_tag LOCUS_13540 3761 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_13540 7721 4953 gene locus_tag LOCUS_13550 7721 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7605 7925 gene locus_tag LOCUS_13560 7605 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7919 10078 gene locus_tag LOCUS_13570 7919 10078 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_13570 10958 10095 gene locus_tag LOCUS_13580 10958 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 11656 11039 gene locus_tag LOCUS_13590 11656 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12051 11704 gene locus_tag LOCUS_13600 12051 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 13414 12089 gene locus_tag LOCUS_13610 gene nrdB 13414 12089 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I2 protein_id gnl|my_center|LOCUS_13610 16258 13505 gene locus_tag LOCUS_13620 gene nrdA 16258 13505 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_13620 17815 16928 gene locus_tag LOCUS_13630 gene argF 17815 16928 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_13630 17997 19562 gene locus_tag LOCUS_13640 gene hyuB 17997 19562 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_13640 19634 19957 gene locus_tag LOCUS_13650 19634 19957 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_13650 20347 21108 gene locus_tag LOCUS_13660 20347 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 21880 21218 gene locus_tag LOCUS_13670 gene rnt 21880 21218 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_13670 <22887 21877 gene locus_tag LOCUS_13680 <22887 21877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EB40:dihydroorotase >Feature sequence051 872 426 gene locus_tag LOCUS_13690 872 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1533 997 gene locus_tag LOCUS_13700 1533 997 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776841.1 protein_id gnl|my_center|LOCUS_13700 2482 1520 gene locus_tag LOCUS_13710 2482 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_13710 4248 2482 gene locus_tag LOCUS_13720 4248 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4989 4411 gene locus_tag LOCUS_13730 4989 4411 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_13730 5217 6167 gene locus_tag LOCUS_13740 5217 6167 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_13740 6817 6194 gene locus_tag LOCUS_13750 gene pgsA 6817 6194 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123161.1 protein_id gnl|my_center|LOCUS_13750 7803 6814 gene locus_tag LOCUS_13760 7803 6814 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 protein_id gnl|my_center|LOCUS_13760 8555 7800 gene locus_tag LOCUS_13770 8555 7800 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123163.1 protein_id gnl|my_center|LOCUS_13770 9445 8552 gene locus_tag LOCUS_13780 gene cpdA 9445 8552 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_13780 10030 9518 gene locus_tag LOCUS_13790 10030 9518 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_13790 11856 10462 gene locus_tag LOCUS_13800 11856 10462 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_13800 12051 12647 gene locus_tag LOCUS_13810 12051 12647 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708540.1 protein_id gnl|my_center|LOCUS_13810 13592 12717 gene locus_tag LOCUS_13820 13592 12717 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW2 protein_id gnl|my_center|LOCUS_13820 13881 16070 gene locus_tag LOCUS_13830 13881 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 16118 17278 gene locus_tag LOCUS_13840 16118 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 17686 17300 gene locus_tag LOCUS_13850 gene yurT 17686 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 protein_id gnl|my_center|LOCUS_13850 18113 17856 gene locus_tag LOCUS_13860 18113 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 18495 18283 gene locus_tag LOCUS_13870 18495 18283 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_13870 20383 18848 gene locus_tag LOCUS_13880 20383 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 20921 20406 gene locus_tag LOCUS_13890 20921 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 21650 20982 gene locus_tag LOCUS_13900 21650 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 21975 21751 gene locus_tag LOCUS_13910 21975 21751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 22570 22094 gene locus_tag LOCUS_13920 22570 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence052 <1 523 gene locus_tag LOCUS_13930 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086564.1:cytochrome-c oxidase 568 1242 gene locus_tag LOCUS_13940 gene coxP 568 1242 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_13940 1257 1649 gene locus_tag LOCUS_13950 1257 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3789 1735 gene locus_tag LOCUS_13960 3789 1735 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_13960 4618 3800 gene locus_tag LOCUS_13970 gene aroE 4618 3800 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX8 protein_id gnl|my_center|LOCUS_13970 5581 4670 gene locus_tag LOCUS_13980 gene hemF 5581 4670 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_13980 7064 5946 gene locus_tag LOCUS_13990 gene smf 7064 5946 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_13990 8203 7109 gene locus_tag LOCUS_14000 8203 7109 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266133.1 protein_id gnl|my_center|LOCUS_14000 8317 8823 gene locus_tag LOCUS_14010 gene def1 8317 8823 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B43 protein_id gnl|my_center|LOCUS_14010 8829 9791 gene locus_tag LOCUS_14020 gene fmt 8829 9791 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 protein_id gnl|my_center|LOCUS_14020 9788 11086 gene locus_tag LOCUS_14030 gene rsmB 9788 11086 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_14030 11120 12505 gene locus_tag LOCUS_14040 gene trkA 11120 12505 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_14040 12513 13964 gene locus_tag LOCUS_14050 gene trkH 12513 13964 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_14050 14729 13965 gene locus_tag LOCUS_14060 gene htrB 14729 13965 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_14060 15032 16003 gene locus_tag LOCUS_14070 gene glyQ 15032 16003 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_14070 16019 18100 gene locus_tag LOCUS_14080 gene glyS 16019 18100 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_14080 18106 18672 gene locus_tag LOCUS_14090 18106 18672 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_14090 18672 19391 gene locus_tag LOCUS_14100 gene lptA 18672 19391 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_14100 21909 19486 gene locus_tag LOCUS_14110 gene gyrB 21909 19486 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_14110 22613 21936 gene locus_tag LOCUS_14120 22613 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence053 <1 756 gene locus_tag LOCUS_14130 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093161.1:ion transporter 1947 799 gene locus_tag LOCUS_14140 1947 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2069 4552 gene locus_tag LOCUS_14150 gene leuS 2069 4552 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_14150 4569 5096 gene locus_tag LOCUS_14160 gene lptE 4569 5096 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN89 protein_id gnl|my_center|LOCUS_14160 5093 6154 gene locus_tag LOCUS_14170 gene holA 5093 6154 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_14170 6154 8559 gene locus_tag LOCUS_14180 6154 8559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_14180 8844 8560 gene locus_tag LOCUS_14190 8844 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11009 8841 gene locus_tag LOCUS_14200 gene dcp 11009 8841 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 protein_id gnl|my_center|LOCUS_14200 11260 13170 gene locus_tag LOCUS_14210 11260 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13974 13174 gene locus_tag LOCUS_14220 gene dehII 13974 13174 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553610.1 protein_id gnl|my_center|LOCUS_14220 14567 13977 gene locus_tag LOCUS_14230 gene gmhA 14567 13977 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP02 protein_id gnl|my_center|LOCUS_14230 14681 15865 gene locus_tag LOCUS_14240 14681 15865 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404020.1 protein_id gnl|my_center|LOCUS_14240 17203 15851 gene locus_tag LOCUS_14250 17203 15851 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_14250 18136 17228 gene locus_tag LOCUS_14260 18136 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18415 19890 gene locus_tag LOCUS_14270 18415 19890 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968998.1 protein_id gnl|my_center|LOCUS_14270 20548 19871 gene locus_tag LOCUS_14280 20548 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21392 20643 gene locus_tag LOCUS_14290 21392 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 <22372 21396 gene locus_tag LOCUS_14300 <22372 21396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HX25:lipoyl synthase >Feature sequence054 866 1432 gene locus_tag LOCUS_14310 866 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1567 1448 gene locus_tag LOCUS_14320 1567 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2416 1583 gene locus_tag LOCUS_14330 gene rrmA 2416 1583 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_14330 3448 2525 gene locus_tag LOCUS_14340 3448 2525 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090615.1 protein_id gnl|my_center|LOCUS_14340 3805 5097 gene locus_tag LOCUS_14350 3805 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5308 6549 gene locus_tag LOCUS_14360 5308 6549 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088393.1 protein_id gnl|my_center|LOCUS_14360 9095 6639 gene locus_tag LOCUS_14370 9095 6639 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_14370 10403 9336 gene locus_tag LOCUS_14380 10403 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13888 10586 gene locus_tag LOCUS_14390 gene kefA 13888 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706846.1 protein_id gnl|my_center|LOCUS_14390 14351 14563 gene locus_tag LOCUS_14400 14351 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 14654 15415 gene locus_tag LOCUS_14410 14654 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 15696 16631 gene locus_tag LOCUS_14420 15696 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_14420 17017 16595 gene locus_tag LOCUS_14430 17017 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 17118 17552 gene locus_tag LOCUS_14440 17118 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18273 17665 gene locus_tag LOCUS_14450 18273 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 18691 18437 gene locus_tag LOCUS_14460 18691 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 19235 19732 gene locus_tag LOCUS_14470 19235 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958465.1 protein_id gnl|my_center|LOCUS_14470 19729 20256 gene locus_tag LOCUS_14480 19729 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_14480 20469 20699 gene locus_tag LOCUS_14490 20469 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 21440 20772 gene locus_tag LOCUS_14500 gene hly3 21440 20772 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence055 2949 892 gene locus_tag LOCUS_14510 2949 892 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M89 protein_id gnl|my_center|LOCUS_14510 4948 2933 gene locus_tag LOCUS_14520 4948 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5774 5031 gene locus_tag LOCUS_14530 5774 5031 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_14530 7155 5788 gene locus_tag LOCUS_14540 7155 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_14540 7706 7152 gene locus_tag LOCUS_14550 7706 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 9961 8015 gene locus_tag LOCUS_14560 9961 8015 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_14560 10280 10032 gene locus_tag LOCUS_14570 10280 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 10523 11773 gene locus_tag LOCUS_14580 10523 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 12401 11781 gene locus_tag LOCUS_14590 12401 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 13929 12982 gene locus_tag LOCUS_14600 13929 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 14164 13919 gene locus_tag LOCUS_14610 14164 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 15118 14618 gene locus_tag LOCUS_14620 15118 14618 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR57 protein_id gnl|my_center|LOCUS_14620 16399 15353 gene locus_tag LOCUS_14630 16399 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17097 16396 gene locus_tag LOCUS_14640 17097 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 17675 17094 gene locus_tag LOCUS_14650 17675 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 19249 18038 gene locus_tag LOCUS_14660 19249 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 19547 19311 gene locus_tag LOCUS_14670 19547 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 19801 19562 gene locus_tag LOCUS_14680 19801 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 20039 20218 gene locus_tag LOCUS_14690 20039 20218 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 protein_id gnl|my_center|LOCUS_14690 20583 20368 gene locus_tag LOCUS_14700 20583 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence056 240 1103 gene locus_tag LOCUS_14710 240 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 protein_id gnl|my_center|LOCUS_14710 1165 2016 gene locus_tag LOCUS_14720 1165 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2085 2339 gene locus_tag LOCUS_14730 2085 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2463 2774 gene locus_tag LOCUS_14740 2463 2774 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388820.1 protein_id gnl|my_center|LOCUS_14740 2872 3213 gene locus_tag LOCUS_14750 2872 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920089.1 protein_id gnl|my_center|LOCUS_14750 3553 3981 gene locus_tag LOCUS_14760 3553 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3971 4369 gene locus_tag LOCUS_14770 3971 4369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919492.1 protein_id gnl|my_center|LOCUS_14770 4424 4963 gene locus_tag LOCUS_14780 4424 4963 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 protein_id gnl|my_center|LOCUS_14780 5074 5235 gene locus_tag LOCUS_14790 5074 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5237 5776 gene locus_tag LOCUS_14800 5237 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5982 7268 gene locus_tag LOCUS_14810 5982 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7272 8573 gene locus_tag LOCUS_14820 gene chrA 7272 8573 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968790.1 protein_id gnl|my_center|LOCUS_14820 8608 9027 gene locus_tag LOCUS_14830 8608 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9017 9658 gene locus_tag LOCUS_14840 gene tpm 9017 9658 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q4 protein_id gnl|my_center|LOCUS_14840 10357 9668 gene locus_tag LOCUS_14850 10357 9668 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_14850 10816 11232 gene locus_tag LOCUS_14860 10816 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 11216 11482 gene locus_tag LOCUS_14870 11216 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11503 12009 gene locus_tag LOCUS_14880 11503 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262912.1 protein_id gnl|my_center|LOCUS_14880 12009 12509 gene locus_tag LOCUS_14890 12009 12509 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_14890 12548 13036 gene locus_tag LOCUS_14900 12548 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 13168 13710 gene locus_tag LOCUS_14910 13168 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 13710 14000 gene locus_tag LOCUS_14920 13710 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 14152 14577 gene locus_tag LOCUS_14930 14152 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_14930 14717 15325 gene locus_tag LOCUS_14940 14717 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 15476 16375 gene locus_tag LOCUS_14950 gene mipA 15476 16375 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_14950 16386 16775 gene locus_tag LOCUS_14960 16386 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 16775 17512 gene locus_tag LOCUS_14970 gene parR 16775 17512 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 protein_id gnl|my_center|LOCUS_14970 17519 18883 gene locus_tag LOCUS_14980 17519 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 19022 19519 gene locus_tag LOCUS_14990 19022 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 19753 20376 gene locus_tag LOCUS_15000 19753 20376 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 protein_id gnl|my_center|LOCUS_15000 20684 20439 gene locus_tag LOCUS_15010 gene grx 20684 20439 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence057 59 430 gene locus_tag LOCUS_15020 59 430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_15020 427 2763 gene locus_tag LOCUS_15030 427 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2832 3155 gene locus_tag LOCUS_15040 2832 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3215 4264 gene locus_tag LOCUS_15050 3215 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4283 5218 gene locus_tag LOCUS_15060 4283 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 6916 5246 gene locus_tag LOCUS_15070 6916 5246 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_15070 8568 7240 gene locus_tag LOCUS_15080 8568 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 8929 8579 gene locus_tag LOCUS_15090 8929 8579 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_15090 9797 9045 gene locus_tag LOCUS_15100 9797 9045 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_15100 11279 9921 gene locus_tag LOCUS_15110 11279 9921 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_15110 11428 13806 gene locus_tag LOCUS_15120 11428 13806 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920010.1 protein_id gnl|my_center|LOCUS_15120 14157 14891 gene locus_tag LOCUS_15130 14157 14891 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136101.1 protein_id gnl|my_center|LOCUS_15130 16060 14903 gene locus_tag LOCUS_15140 gene ycaQ 16060 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_15140 16216 17916 gene locus_tag LOCUS_15150 gene kefB 16216 17916 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_15150 18741 17974 gene locus_tag LOCUS_15160 18741 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 19861 19064 gene locus_tag LOCUS_15170 gene djlA 19861 19064 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_15170 20401 21009 gene locus_tag LOCUS_15180 20401 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence058 1076 1528 gene locus_tag LOCUS_15190 gene mraZ 1076 1528 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_15190 1545 2480 gene locus_tag LOCUS_15200 gene rsmH 1545 2480 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY2 protein_id gnl|my_center|LOCUS_15200 2509 2871 gene locus_tag LOCUS_15210 2509 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2861 4585 gene locus_tag LOCUS_15220 gene ftsI 2861 4585 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_15220 4590 6122 gene locus_tag LOCUS_15230 gene murE 4590 6122 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_15230 6142 7509 gene locus_tag LOCUS_15240 gene murF 6142 7509 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_15240 7503 8585 gene locus_tag LOCUS_15250 gene mraY 7503 8585 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_15250 8587 9963 gene locus_tag LOCUS_15260 gene murD 8587 9963 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_15260 9960 11132 gene locus_tag LOCUS_15270 gene ftsW 9960 11132 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY4 protein_id gnl|my_center|LOCUS_15270 11129 12226 gene locus_tag LOCUS_15280 gene murG 11129 12226 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_15280 12234 13640 gene locus_tag LOCUS_15290 gene murC 12234 13640 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ1 protein_id gnl|my_center|LOCUS_15290 13701 14633 gene locus_tag LOCUS_15300 gene ddlB 13701 14633 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_15300 14636 15469 gene locus_tag LOCUS_15310 14636 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 15549 16760 gene locus_tag LOCUS_15320 gene ftsA 15549 16760 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_15320 16779 17942 gene locus_tag LOCUS_15330 gene ftsZ 16779 17942 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ5 protein_id gnl|my_center|LOCUS_15330 18093 19004 gene locus_tag LOCUS_15340 gene lpxC 18093 19004 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_15340 19219 20064 gene locus_tag LOCUS_15350 19219 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence059 744 58 gene locus_tag LOCUS_15360 gene flgD 744 58 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A1 protein_id gnl|my_center|LOCUS_15360 1206 781 gene locus_tag LOCUS_15370 gene flgC 1206 781 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C750 protein_id gnl|my_center|LOCUS_15370 1602 1210 gene locus_tag LOCUS_15380 gene flgB 1602 1210 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S6 protein_id gnl|my_center|LOCUS_15380 1953 2972 gene locus_tag LOCUS_15390 1953 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3073 3375 gene locus_tag LOCUS_15400 3073 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3389 3811 gene locus_tag LOCUS_15410 3389 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4087 3797 gene locus_tag LOCUS_15420 4087 3797 CDS product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 protein_id gnl|my_center|LOCUS_15420 4977 4084 gene locus_tag LOCUS_15430 4977 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5480 5007 gene locus_tag LOCUS_15440 5480 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6709 5507 gene locus_tag LOCUS_15450 6709 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7184 6717 gene locus_tag LOCUS_15460 7184 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7450 9516 gene locus_tag LOCUS_15470 gene flhA 7450 9516 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881783.1 protein_id gnl|my_center|LOCUS_15470 9538 10725 gene locus_tag LOCUS_15480 9538 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 10749 11552 gene locus_tag LOCUS_15490 gene flhG 10749 11552 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD2 protein_id gnl|my_center|LOCUS_15490 11579 12310 gene locus_tag LOCUS_15500 gene fliA 11579 12310 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MK3 protein_id gnl|my_center|LOCUS_15500 14042 12336 gene locus_tag LOCUS_15510 14042 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 14517 14059 gene locus_tag LOCUS_15520 14517 14059 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_15520 17219 14646 gene locus_tag LOCUS_15530 17219 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 17648 18898 gene locus_tag LOCUS_15540 17648 18898 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_15540 18921 19955 gene locus_tag LOCUS_15550 18921 19955 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 protein_id gnl|my_center|LOCUS_15550 20687 20037 gene locus_tag LOCUS_15560 20687 20037 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence060 348 995 gene locus_tag LOCUS_15570 348 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1129 1248 gene locus_tag LOCUS_15580 1129 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1260 2114 gene locus_tag LOCUS_15590 1260 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2125 2394 gene locus_tag LOCUS_15600 2125 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2404 2571 gene locus_tag LOCUS_15610 2404 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2568 2789 gene locus_tag LOCUS_15620 2568 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2791 3627 gene locus_tag LOCUS_15630 2791 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3737 4387 gene locus_tag LOCUS_15640 3737 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4392 5471 gene locus_tag LOCUS_15650 4392 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5471 5716 gene locus_tag LOCUS_15660 5471 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 5724 6215 gene locus_tag LOCUS_15670 5724 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 6226 6603 gene locus_tag LOCUS_15680 6226 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6606 6797 gene locus_tag LOCUS_15690 6606 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 8208 7435 gene locus_tag LOCUS_15700 8208 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 8419 9435 gene locus_tag LOCUS_15710 8419 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9463 10599 gene locus_tag LOCUS_15720 9463 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10802 11320 gene locus_tag LOCUS_15730 10802 11320 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890258.1 protein_id gnl|my_center|LOCUS_15730 12108 11500 gene locus_tag LOCUS_15740 12108 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12561 12295 gene locus_tag LOCUS_15750 12561 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 13812 12871 gene locus_tag LOCUS_15760 13812 12871 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_15760 17118 13906 gene locus_tag LOCUS_15770 17118 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_15770 18533 17388 gene locus_tag LOCUS_15780 18533 17388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_15780 18633 19730 gene locus_tag LOCUS_15790 18633 19730 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_15790 <20801 19684 gene locus_tag LOCUS_15800 <20801 19684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UUZ7:ATP-dependent zinc metalloprotease FtsH 1 >Feature sequence061 <1 1662 gene locus_tag LOCUS_15810 <1 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122099.1:membrane protein 1713 2744 gene locus_tag LOCUS_15820 1713 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2731 5430 gene locus_tag LOCUS_15830 2731 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_15830 5505 6311 gene locus_tag LOCUS_15840 5505 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6330 7370 gene locus_tag LOCUS_15850 gene moxR 6330 7370 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_15850 7392 8285 gene locus_tag LOCUS_15860 7392 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_15860 8286 10304 gene locus_tag LOCUS_15870 8286 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_15870 13751 10587 gene locus_tag LOCUS_15880 13751 10587 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_15880 14881 13757 gene locus_tag LOCUS_15890 14881 13757 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_15890 15302 16093 gene locus_tag LOCUS_15900 15302 16093 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_15900 16104 16532 gene locus_tag LOCUS_15910 16104 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17082 16549 gene locus_tag LOCUS_15920 gene roxR 17082 16549 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_15920 18529 17075 gene locus_tag LOCUS_15930 gene roxS 18529 17075 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_15930 18528 20096 gene locus_tag LOCUS_15940 18528 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence062 42 659 gene locus_tag LOCUS_15950 42 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2798 702 gene locus_tag LOCUS_15960 2798 702 CDS product fatty-acid oxidation protein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085215.1 protein_id gnl|my_center|LOCUS_15960 4130 2811 gene locus_tag LOCUS_15970 4130 2811 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085214.1 protein_id gnl|my_center|LOCUS_15970 6571 4274 gene locus_tag LOCUS_15980 6571 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7227 6772 gene locus_tag LOCUS_15990 7227 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 7866 7318 gene locus_tag LOCUS_16000 7866 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8876 7866 gene locus_tag LOCUS_16010 8876 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 9775 8879 gene locus_tag LOCUS_16020 9775 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 12290 9852 gene locus_tag LOCUS_16030 gene fbiC 12290 9852 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U0G9 protein_id gnl|my_center|LOCUS_16030 13468 12338 gene locus_tag LOCUS_16040 13468 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 13653 14198 gene locus_tag LOCUS_16050 13653 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 14269 15639 gene locus_tag LOCUS_16060 14269 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804006.1 protein_id gnl|my_center|LOCUS_16060 15699 16439 gene locus_tag LOCUS_16070 15699 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16519 16677 gene locus_tag LOCUS_16080 16519 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 18754 16697 gene locus_tag LOCUS_16090 18754 16697 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence063 1526 636 gene locus_tag LOCUS_16100 gene fixP 1526 636 CDS product cytochrome c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244268.1 protein_id gnl|my_center|LOCUS_16100 1665 1519 gene locus_tag LOCUS_16110 1665 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2317 1667 gene locus_tag LOCUS_16120 2317 1667 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 protein_id gnl|my_center|LOCUS_16120 3753 2314 gene locus_tag LOCUS_16130 gene ccoN2 3753 2314 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_16130 4386 3769 gene locus_tag LOCUS_16140 4386 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5714 4455 gene locus_tag LOCUS_16150 5714 4455 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_16150 6668 5769 gene locus_tag LOCUS_16160 6668 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_16160 6892 8220 gene locus_tag LOCUS_16170 6892 8220 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266169.1 protein_id gnl|my_center|LOCUS_16170 9319 8315 gene locus_tag LOCUS_16180 9319 8315 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861478.1 protein_id gnl|my_center|LOCUS_16180 9660 10646 gene locus_tag LOCUS_16190 9660 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10683 12122 gene locus_tag LOCUS_16200 10683 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12119 14011 gene locus_tag LOCUS_16210 12119 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 16172 14043 gene locus_tag LOCUS_16220 16172 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 16476 19364 gene locus_tag LOCUS_16230 16476 19364 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_16230 19697 19431 gene locus_tag LOCUS_16240 19697 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence064 376 561 gene locus_tag LOCUS_16250 376 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1184 558 gene locus_tag LOCUS_16260 gene thrH 1184 558 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_16260 1654 2205 gene locus_tag LOCUS_16270 1654 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3193 2219 gene locus_tag LOCUS_16280 gene cysB 3193 2219 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_16280 3341 4147 gene locus_tag LOCUS_16290 3341 4147 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WK2 protein_id gnl|my_center|LOCUS_16290 5086 4187 gene locus_tag LOCUS_16300 5086 4187 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_16300 5213 6364 gene locus_tag LOCUS_16310 5213 6364 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_16310 6993 6349 gene locus_tag LOCUS_16320 gene msrA 6993 6349 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_16320 7089 8267 gene locus_tag LOCUS_16330 gene argD 7089 8267 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 protein_id gnl|my_center|LOCUS_16330 8264 9499 gene locus_tag LOCUS_16340 8264 9499 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_16340 9539 11119 gene locus_tag LOCUS_16350 9539 11119 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 protein_id gnl|my_center|LOCUS_16350 11212 12027 gene locus_tag LOCUS_16360 11212 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 12211 13725 gene locus_tag LOCUS_16370 12211 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 13737 14480 gene locus_tag LOCUS_16380 gene gacA 13737 14480 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_16380 15214 14540 gene locus_tag LOCUS_16390 gene chrR 15214 14540 CDS product anti-ECF sigma factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072075.1 protein_id gnl|my_center|LOCUS_16390 15843 15211 gene locus_tag LOCUS_16400 15843 15211 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707772.1 protein_id gnl|my_center|LOCUS_16400 16004 16477 gene locus_tag LOCUS_16410 16004 16477 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_16410 16474 17754 gene locus_tag LOCUS_16420 16474 17754 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889265.1 protein_id gnl|my_center|LOCUS_16420 17757 18545 gene locus_tag LOCUS_16430 17757 18545 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence065 169 1029 gene locus_tag LOCUS_16440 169 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1286 1465 gene locus_tag LOCUS_16450 1286 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1712 3088 gene locus_tag LOCUS_16460 1712 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4204 3131 gene locus_tag LOCUS_16470 gene corA 4204 3131 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_16470 5111 4215 gene locus_tag LOCUS_16480 5111 4215 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_16480 5211 5684 gene locus_tag LOCUS_16490 5211 5684 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_16490 5865 6617 gene locus_tag LOCUS_16500 5865 6617 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_16500 7583 6603 gene locus_tag LOCUS_16510 7583 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_16510 9052 7586 gene locus_tag LOCUS_16520 9052 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_16520 9080 12343 gene locus_tag LOCUS_16530 9080 12343 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_16530 13690 12347 gene locus_tag LOCUS_16540 13690 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705704.1 protein_id gnl|my_center|LOCUS_16540 14564 13731 gene locus_tag LOCUS_16550 14564 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 16407 14578 gene locus_tag LOCUS_16560 16407 14578 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_16560 18389 16410 gene locus_tag LOCUS_16570 gene selB 18389 16410 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967006.1 protein_id gnl|my_center|LOCUS_16570 <19037 18417 gene locus_tag LOCUS_16580 <19037 18417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811125.1:lactate permease >Feature sequence066 842 396 gene locus_tag LOCUS_16590 gene holC 842 396 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_16590 2345 858 gene locus_tag LOCUS_16600 gene pepA 2345 858 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_16600 2528 2971 gene locus_tag LOCUS_16610 2528 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3018 4118 gene locus_tag LOCUS_16620 3018 4118 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_16620 4118 5194 gene locus_tag LOCUS_16630 4118 5194 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 protein_id gnl|my_center|LOCUS_16630 5251 6483 gene locus_tag LOCUS_16640 5251 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6506 8701 gene locus_tag LOCUS_16650 6506 8701 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_16650 10428 8725 gene locus_tag LOCUS_16660 gene ggtA 10428 8725 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_16660 11368 10472 gene locus_tag LOCUS_16670 11368 10472 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090323.1 protein_id gnl|my_center|LOCUS_16670 11888 11394 gene locus_tag LOCUS_16680 11888 11394 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_16680 13351 11927 gene locus_tag LOCUS_16690 gene pntB 13351 11927 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AE4 protein_id gnl|my_center|LOCUS_16690 13651 13352 gene locus_tag LOCUS_16700 13651 13352 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_16700 14789 13653 gene locus_tag LOCUS_16710 gene pntA 14789 13653 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_16710 14990 16564 gene locus_tag LOCUS_16720 gene leuA 14990 16564 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_16720 17737 16634 gene locus_tag LOCUS_16730 gene leuB 17737 16634 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ26 protein_id gnl|my_center|LOCUS_16730 17969 17826 gene locus_tag LOCUS_16740 17969 17826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 18159 18073 gene locus_tag LOCUS_t00120 18159 18073 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence067 228 1313 gene locus_tag LOCUS_16750 228 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2417 1419 gene locus_tag LOCUS_16760 2417 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2566 4074 gene locus_tag LOCUS_16770 gene fleQ 2566 4074 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_16770 4808 4077 gene locus_tag LOCUS_16780 4808 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5446 4805 gene locus_tag LOCUS_16790 gene purN 5446 4805 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKZ6 protein_id gnl|my_center|LOCUS_16790 6530 5469 gene locus_tag LOCUS_16800 gene purM 6530 5469 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_16800 6647 7768 gene locus_tag LOCUS_16810 6647 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_16810 7772 8473 gene locus_tag LOCUS_16820 7772 8473 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268586.1 protein_id gnl|my_center|LOCUS_16820 8881 8483 gene locus_tag LOCUS_16830 8881 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9473 8871 gene locus_tag LOCUS_16840 9473 8871 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_16840 9865 9470 gene locus_tag LOCUS_16850 9865 9470 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_16850 11217 9862 gene locus_tag LOCUS_16860 11217 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 11220 11597 gene locus_tag LOCUS_16870 11220 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 13329 11587 gene locus_tag LOCUS_16880 gene proS 13329 11587 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP53 protein_id gnl|my_center|LOCUS_16880 13795 13409 gene locus_tag LOCUS_16890 13795 13409 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_16890 14231 14614 gene locus_tag LOCUS_16900 14231 14614 CDS product regulatory protein, FmdB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 protein_id gnl|my_center|LOCUS_16900 14701 16488 gene locus_tag LOCUS_16910 gene aspS 14701 16488 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 protein_id gnl|my_center|LOCUS_16910 16494 17015 gene locus_tag LOCUS_16920 gene ruvC 16494 17015 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR00 protein_id gnl|my_center|LOCUS_16920 17027 17632 gene locus_tag LOCUS_16930 gene ruvA 17027 17632 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA3 protein_id gnl|my_center|LOCUS_16930 >Feature sequence068 <1 445 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctacgcggcagtgaac 1141 575 gene locus_tag LOCUS_16940 1141 575 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 protein_id gnl|my_center|LOCUS_16940 2168 1146 gene locus_tag LOCUS_16950 2168 1146 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_16950 3152 2184 gene locus_tag LOCUS_16960 3152 2184 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_16960 4489 3149 gene locus_tag LOCUS_16970 4489 3149 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_16970 8007 4546 gene locus_tag LOCUS_16980 8007 4546 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_16980 8777 8004 gene locus_tag LOCUS_16990 8777 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16990 9190 9017 gene locus_tag LOCUS_17000 9190 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9327 9617 gene locus_tag LOCUS_17010 9327 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9622 9861 gene locus_tag LOCUS_17020 9622 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 10958 9993 gene locus_tag LOCUS_17030 10958 9993 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_17030 11124 12071 gene locus_tag LOCUS_17040 11124 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 12068 14230 gene locus_tag LOCUS_17050 12068 14230 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF0 protein_id gnl|my_center|LOCUS_17050 14230 16458 gene locus_tag LOCUS_17060 gene glgB 14230 16458 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU7 protein_id gnl|my_center|LOCUS_17060 >Feature sequence069 784 95 gene locus_tag LOCUS_17070 784 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1062 2333 gene locus_tag LOCUS_17080 gene rhmD 1062 2333 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z548 protein_id gnl|my_center|LOCUS_17080 3143 2670 gene locus_tag LOCUS_17090 3143 2670 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886959.1 protein_id gnl|my_center|LOCUS_17090 4627 3230 gene locus_tag LOCUS_17100 gene oprN 4627 3230 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_17100 7772 4620 gene locus_tag LOCUS_17110 7772 4620 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_17110 8675 7785 gene locus_tag LOCUS_17120 8675 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10923 9139 gene locus_tag LOCUS_17130 10923 9139 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967569.1 protein_id gnl|my_center|LOCUS_17130 11834 11388 gene locus_tag LOCUS_17140 gene zntR 11834 11388 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 protein_id gnl|my_center|LOCUS_17140 12265 12906 gene locus_tag LOCUS_17150 12265 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 13092 12832 gene locus_tag LOCUS_17160 13092 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 13506 13099 gene locus_tag LOCUS_17170 13506 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813690.1 protein_id gnl|my_center|LOCUS_17170 13998 13540 gene locus_tag LOCUS_17180 13998 13540 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG90 protein_id gnl|my_center|LOCUS_17180 14906 14094 gene locus_tag LOCUS_17190 14906 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 15494 15036 gene locus_tag LOCUS_17200 15494 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 16475 15495 gene locus_tag LOCUS_17210 16475 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 16783 17796 gene locus_tag LOCUS_17220 16783 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence070 73 1026 gene locus_tag LOCUS_17230 73 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 protein_id gnl|my_center|LOCUS_17230 1116 3254 gene locus_tag LOCUS_17240 1116 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3467 3258 gene locus_tag LOCUS_17250 gene yacG 3467 3258 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2R0 protein_id gnl|my_center|LOCUS_17250 4067 3468 gene locus_tag LOCUS_17260 gene coaE 4067 3468 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U3 protein_id gnl|my_center|LOCUS_17260 4994 4092 gene locus_tag LOCUS_17270 4994 4092 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_17270 6227 5010 gene locus_tag LOCUS_17280 6227 5010 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_17280 7982 6276 gene locus_tag LOCUS_17290 gene pilB 7982 6276 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_17290 8109 8852 gene locus_tag LOCUS_17300 8109 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9268 8840 gene locus_tag LOCUS_17310 9268 8840 CDS product pilin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_17310 9876 9463 gene locus_tag LOCUS_17320 gene ppdD 9876 9463 CDS product prepilin peptidase-dependent protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44623 protein_id gnl|my_center|LOCUS_17320 10277 12169 gene locus_tag LOCUS_17330 10277 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 12187 13041 gene locus_tag LOCUS_17340 12187 13041 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_17340 14000 13038 gene locus_tag LOCUS_17350 14000 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14324 14719 gene locus_tag LOCUS_17360 14324 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15482 14748 gene locus_tag LOCUS_17370 15482 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 16411 15572 gene locus_tag LOCUS_17380 gene nadC 16411 15572 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_17380 >Feature sequence071 448 557 gene locus_tag LOCUS_r00010 448 557 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1299 664 gene locus_tag LOCUS_17390 1299 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1761 2546 gene locus_tag LOCUS_17400 1761 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3011 3934 gene locus_tag LOCUS_17410 3011 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4029 5864 gene locus_tag LOCUS_17420 gene recQ 4029 5864 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_17420 5971 6879 gene locus_tag LOCUS_17430 gene rdgC 5971 6879 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP9 protein_id gnl|my_center|LOCUS_17430 7193 8476 gene locus_tag LOCUS_17440 7193 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_17440 9893 8499 gene locus_tag LOCUS_17450 9893 8499 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_17450 10047 11471 gene locus_tag LOCUS_17460 gene dbpA 10047 11471 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_17460 13383 11533 gene locus_tag LOCUS_17470 13383 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13653 14627 gene locus_tag LOCUS_17480 13653 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14667 16115 gene locus_tag LOCUS_17490 14667 16115 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_17490 17831 16128 gene locus_tag LOCUS_17500 17831 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence072 <1 891 gene locus_tag LOCUS_17510 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704440.1:heme biosynthesis operon protein HemX 884 2143 gene locus_tag LOCUS_17520 884 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_17520 2577 2152 gene locus_tag LOCUS_17530 2577 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17530 3618 2593 gene locus_tag LOCUS_17540 3618 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17540 4911 3652 gene locus_tag LOCUS_17550 gene rho 4911 3652 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_17550 5575 5249 gene locus_tag LOCUS_17560 gene trxA 5575 5249 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7V6 protein_id gnl|my_center|LOCUS_17560 6674 5715 gene locus_tag LOCUS_17570 gene hemB 6674 5715 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_17570 6837 9005 gene locus_tag LOCUS_17580 6837 9005 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_17580 9524 9018 gene locus_tag LOCUS_17590 gene dsbB1 9524 9018 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_17590 11113 9545 gene locus_tag LOCUS_17600 gene gshA 11113 9545 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_17600 12751 11195 gene locus_tag LOCUS_17610 gene pckA 12751 11195 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500D1 protein_id gnl|my_center|LOCUS_17610 13318 12908 gene locus_tag LOCUS_17620 13318 12908 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_17620 14016 13315 gene locus_tag LOCUS_17630 14016 13315 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_17630 14064 14954 gene locus_tag LOCUS_17640 gene cysQ 14064 14954 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_17640 15054 16322 gene locus_tag LOCUS_17650 15054 16322 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_17650 16326 16970 gene locus_tag LOCUS_17660 16326 16970 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_17660 >Feature sequence073 2003 3283 gene locus_tag LOCUS_17670 2003 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4221 3322 gene locus_tag LOCUS_17680 4221 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5025 4276 gene locus_tag LOCUS_17690 5025 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5773 5060 gene locus_tag LOCUS_17700 5773 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6237 6974 gene locus_tag LOCUS_17710 6237 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 7625 7125 gene locus_tag LOCUS_17720 7625 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 7900 10326 gene locus_tag LOCUS_17730 7900 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11139 10432 gene locus_tag LOCUS_17740 11139 10432 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_17740 11363 12346 gene locus_tag LOCUS_17750 11363 12346 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919060.1 protein_id gnl|my_center|LOCUS_17750 13051 12485 gene locus_tag LOCUS_17760 13051 12485 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_17760 13093 13299 gene locus_tag LOCUS_17770 13093 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 13536 14549 gene locus_tag LOCUS_17780 13536 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 14753 15505 gene locus_tag LOCUS_17790 14753 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 15670 16668 gene locus_tag LOCUS_17800 15670 16668 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390392.1 protein_id gnl|my_center|LOCUS_17800 16779 17354 gene locus_tag LOCUS_17810 16779 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence074 <1 536 gene locus_tag LOCUS_17820 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I5G4:flagellin 664 1395 gene locus_tag LOCUS_17830 664 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2730 1570 gene locus_tag LOCUS_17840 gene motB 2730 1570 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338090.1 protein_id gnl|my_center|LOCUS_17840 3917 2736 gene locus_tag LOCUS_17850 gene motB 3917 2736 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338090.1 protein_id gnl|my_center|LOCUS_17850 4680 3925 gene locus_tag LOCUS_17860 4680 3925 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_17860 5088 4828 gene locus_tag LOCUS_17870 5088 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5326 5066 gene locus_tag LOCUS_17880 5326 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6768 5338 gene locus_tag LOCUS_17890 gene fliD 6768 5338 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIC9 protein_id gnl|my_center|LOCUS_17890 7717 6797 gene locus_tag LOCUS_17900 7717 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10683 7735 gene locus_tag LOCUS_17910 10683 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11036 10680 gene locus_tag LOCUS_17920 11036 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 12190 11036 gene locus_tag LOCUS_17930 gene flgI1 12190 11036 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1T3 protein_id gnl|my_center|LOCUS_17930 12918 12205 gene locus_tag LOCUS_17940 gene flgH 12918 12205 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM39 protein_id gnl|my_center|LOCUS_17940 13735 12944 gene locus_tag LOCUS_17950 gene flgG 13735 12944 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW66 protein_id gnl|my_center|LOCUS_17950 14528 13764 gene locus_tag LOCUS_17960 gene flgF 14528 13764 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHB5 protein_id gnl|my_center|LOCUS_17960 <17411 14541 gene locus_tag LOCUS_17970 <17411 14541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J1S9:flagellar hook protein FlgE >Feature sequence075 2946 931 gene locus_tag LOCUS_17980 2946 931 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895468.1 protein_id gnl|my_center|LOCUS_17980 3978 2965 gene locus_tag LOCUS_17990 3978 2965 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882992.1 protein_id gnl|my_center|LOCUS_17990 4558 5586 gene locus_tag LOCUS_18000 4558 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5825 7387 gene locus_tag LOCUS_18010 5825 7387 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_18010 7969 10956 gene locus_tag LOCUS_18020 7969 10956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_18020 11085 14042 gene locus_tag LOCUS_18030 11085 14042 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229807.1 protein_id gnl|my_center|LOCUS_18030 14039 15841 gene locus_tag LOCUS_18040 14039 15841 CDS product glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064201.1 protein_id gnl|my_center|LOCUS_18040 15858 16430 gene locus_tag LOCUS_18050 15858 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence076 1957 605 gene locus_tag LOCUS_18060 1957 605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_18060 2608 2123 gene locus_tag LOCUS_18070 2608 2123 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_18070 3458 2613 gene locus_tag LOCUS_18080 3458 2613 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNU5 protein_id gnl|my_center|LOCUS_18080 4579 3470 gene locus_tag LOCUS_18090 4579 3470 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KES6 protein_id gnl|my_center|LOCUS_18090 5903 4653 gene locus_tag LOCUS_18100 5903 4653 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 protein_id gnl|my_center|LOCUS_18100 6151 5900 gene locus_tag LOCUS_18110 6151 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6771 6313 gene locus_tag LOCUS_18120 6771 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 8347 6932 gene locus_tag LOCUS_18130 8347 6932 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_18130 8438 9565 gene locus_tag LOCUS_18140 8438 9565 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_18140 9562 10071 gene locus_tag LOCUS_18150 gene aspG 9562 10071 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_18150 10701 10180 gene locus_tag LOCUS_18160 10701 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 10901 13078 gene locus_tag LOCUS_18170 10901 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13143 14303 gene locus_tag LOCUS_18180 13143 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 14643 15569 gene locus_tag LOCUS_18190 14643 15569 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_18190 16003 15677 gene locus_tag LOCUS_18200 16003 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 16484 16155 gene locus_tag LOCUS_18210 16484 16155 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719728.1 protein_id gnl|my_center|LOCUS_18210 16900 16472 gene locus_tag LOCUS_18220 16900 16472 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence077 2262 1690 gene locus_tag LOCUS_18230 2262 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3463 2309 gene locus_tag LOCUS_18240 3463 2309 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_18240 3984 3472 gene locus_tag LOCUS_18250 3984 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4520 3975 gene locus_tag LOCUS_18260 4520 3975 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_18260 4795 5553 gene locus_tag LOCUS_18270 4795 5553 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_18270 6957 5557 gene locus_tag LOCUS_18280 gene phoQ 6957 5557 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_18280 7629 6958 gene locus_tag LOCUS_18290 gene phoP 7629 6958 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_18290 8011 7688 gene locus_tag LOCUS_18300 8011 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8596 8069 gene locus_tag LOCUS_18310 8596 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 8805 9242 gene locus_tag LOCUS_18320 8805 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 9300 10448 gene locus_tag LOCUS_18330 9300 10448 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_18330 10598 11119 gene locus_tag LOCUS_18340 10598 11119 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_18340 11116 11334 gene locus_tag LOCUS_18350 11116 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 11367 12524 gene locus_tag LOCUS_18360 11367 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932751.1 protein_id gnl|my_center|LOCUS_18360 12539 13465 gene locus_tag LOCUS_18370 12539 13465 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH6 protein_id gnl|my_center|LOCUS_18370 14451 13462 gene locus_tag LOCUS_18380 gene srkA 14451 13462 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_18380 14519 15793 gene locus_tag LOCUS_18390 14519 15793 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_18390 16147 15803 gene locus_tag LOCUS_18400 16147 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence078 <1 606 gene locus_tag LOCUS_18410 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453865.1:sterol desaturase 628 1083 gene locus_tag LOCUS_18420 628 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1138 2385 gene locus_tag LOCUS_18430 1138 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701628.1 protein_id gnl|my_center|LOCUS_18430 2504 3484 gene locus_tag LOCUS_18440 2504 3484 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_18440 3494 4318 gene locus_tag LOCUS_18450 gene phnC 3494 4318 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_18450 4315 5139 gene locus_tag LOCUS_18460 4315 5139 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_18460 5168 5995 gene locus_tag LOCUS_18470 5168 5995 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_18470 7710 5989 gene locus_tag LOCUS_18480 7710 5989 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_18480 8338 7763 gene locus_tag LOCUS_18490 8338 7763 CDS product Rieske iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_18490 8410 9096 gene locus_tag LOCUS_18500 8410 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_18500 9278 11170 gene locus_tag LOCUS_18510 9278 11170 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_18510 12075 11557 gene locus_tag LOCUS_18520 12075 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 13591 12422 gene locus_tag LOCUS_18530 13591 12422 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_18530 13904 14974 gene locus_tag LOCUS_18540 13904 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 15758 14994 gene locus_tag LOCUS_18550 15758 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence079 290 45 gene locus_tag LOCUS_18560 gene ccdA 290 45 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_18560 1745 399 gene locus_tag LOCUS_18570 1745 399 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169305.1 protein_id gnl|my_center|LOCUS_18570 2014 2547 gene locus_tag LOCUS_18580 gene rfaH 2014 2547 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DB2 protein_id gnl|my_center|LOCUS_18580 2540 2956 gene locus_tag LOCUS_18590 2540 2956 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_18590 2940 3263 gene locus_tag LOCUS_18600 2940 3263 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_18600 3283 3600 gene locus_tag LOCUS_18610 3283 3600 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968012.1 protein_id gnl|my_center|LOCUS_18610 3692 6556 gene locus_tag LOCUS_18620 gene wza 3692 6556 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073080.1 protein_id gnl|my_center|LOCUS_18620 6558 7424 gene locus_tag LOCUS_18630 gene wzz 6558 7424 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_18630 7421 8506 gene locus_tag LOCUS_18640 gene gmd 7421 8506 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7K5 protein_id gnl|my_center|LOCUS_18640 8503 9456 gene locus_tag LOCUS_18650 gene fcl 8503 9456 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EKG8 protein_id gnl|my_center|LOCUS_18650 9449 10507 gene locus_tag LOCUS_18660 gene wlbA 9449 10507 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927319.1 protein_id gnl|my_center|LOCUS_18660 10509 11090 gene locus_tag LOCUS_18670 gene wbpD 10509 11090 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_18670 11087 12193 gene locus_tag LOCUS_18680 gene wlbC 11087 12193 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_18680 12233 13234 gene locus_tag LOCUS_18690 12233 13234 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_18690 13249 14415 gene locus_tag LOCUS_18700 13249 14415 CDS product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_18700 14654 16219 gene locus_tag LOCUS_18710 gene mdlB 14654 16219 CDS product multidrug ABC transporter ATPase/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125483.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence080 3 1097 gene locus_tag LOCUS_18720 3 1097 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_18720 1110 2246 gene locus_tag LOCUS_18730 1110 2246 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_18730 3297 2257 gene locus_tag LOCUS_18740 3297 2257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_18740 3525 4184 gene locus_tag LOCUS_18750 3525 4184 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_18750 4417 5229 gene locus_tag LOCUS_18760 4417 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973735.1 protein_id gnl|my_center|LOCUS_18760 5586 5230 gene locus_tag LOCUS_18770 5586 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7515 5743 gene locus_tag LOCUS_18780 7515 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7617 8492 gene locus_tag LOCUS_18790 gene garR 7617 8492 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_18790 8825 10552 gene locus_tag LOCUS_18800 8825 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_18800 10667 11707 gene locus_tag LOCUS_18810 10667 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 12730 11741 gene locus_tag LOCUS_18820 12730 11741 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920211.1 protein_id gnl|my_center|LOCUS_18820 12821 14578 gene locus_tag LOCUS_18830 12821 14578 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_18830 16272 14593 gene locus_tag LOCUS_18840 gene exaA 16272 14593 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence081 1574 465 gene locus_tag LOCUS_18850 gene dnaN 1574 465 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_18850 3033 1615 gene locus_tag LOCUS_18860 gene dnaA 3033 1615 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U7 protein_id gnl|my_center|LOCUS_18860 3659 4057 gene locus_tag LOCUS_18870 gene rnpA 3659 4057 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_18870 4062 4313 gene locus_tag LOCUS_18880 4062 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4324 6018 gene locus_tag LOCUS_18890 gene yidC 4324 6018 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_18890 6055 7449 gene locus_tag LOCUS_18900 gene mnmE 6055 7449 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NR09 protein_id gnl|my_center|LOCUS_18900 7917 9818 gene locus_tag LOCUS_18910 gene mnmG 7917 9818 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_18910 9830 10471 gene locus_tag LOCUS_18920 gene rsmG 9830 10471 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 protein_id gnl|my_center|LOCUS_18920 10468 11256 gene locus_tag LOCUS_18930 gene parA 10468 11256 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_18930 11253 12236 gene locus_tag LOCUS_18940 11253 12236 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_18940 12430 12738 gene locus_tag LOCUS_18950 12430 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 12751 13614 gene locus_tag LOCUS_18960 gene atpB 12751 13614 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_18960 13662 13904 gene locus_tag LOCUS_18970 gene atpE 13662 13904 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH0 protein_id gnl|my_center|LOCUS_18970 13965 14435 gene locus_tag LOCUS_18980 gene atpF 13965 14435 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_18980 14450 14986 gene locus_tag LOCUS_18990 gene atpH 14450 14986 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 protein_id gnl|my_center|LOCUS_18990 >Feature sequence082 2299 221 gene locus_tag LOCUS_19000 gene fusA 2299 221 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP6 protein_id gnl|my_center|LOCUS_19000 2829 2359 gene locus_tag LOCUS_19010 gene rpsG 2829 2359 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X5 protein_id gnl|my_center|LOCUS_19010 3457 3083 gene locus_tag LOCUS_19020 gene rpsL 3457 3083 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_19020 7772 3543 gene locus_tag LOCUS_19030 gene rpoC 7772 3543 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_19030 11964 7870 gene locus_tag LOCUS_19040 gene rpoB 11964 7870 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_19040 12500 12123 gene locus_tag LOCUS_19050 gene rplL 12500 12123 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X1 protein_id gnl|my_center|LOCUS_19050 13076 12549 gene locus_tag LOCUS_19060 gene rplJ 13076 12549 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 protein_id gnl|my_center|LOCUS_19060 13975 13280 gene locus_tag LOCUS_19070 gene rplA 13975 13280 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 protein_id gnl|my_center|LOCUS_19070 14412 13978 gene locus_tag LOCUS_19080 gene rplK 14412 13978 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GJ3 protein_id gnl|my_center|LOCUS_19080 15115 14582 gene locus_tag LOCUS_19090 gene nusG 15115 14582 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_19090 15493 15125 gene locus_tag LOCUS_19100 gene secE 15493 15125 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC3 protein_id gnl|my_center|LOCUS_19100 15627 15552 gene locus_tag LOCUS_t00130 15627 15552 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence083 348 1157 gene locus_tag LOCUS_19110 gene uppP1 348 1157 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_19110 1183 1944 gene locus_tag LOCUS_19120 gene rsmJ 1183 1944 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU6 protein_id gnl|my_center|LOCUS_19120 3086 1941 gene locus_tag LOCUS_19130 gene dapE 3086 1941 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ52 protein_id gnl|my_center|LOCUS_19130 4139 3096 gene locus_tag LOCUS_19140 gene dapD 4139 3096 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7C5 protein_id gnl|my_center|LOCUS_19140 6879 4177 gene locus_tag LOCUS_19150 gene glnD 6879 4177 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_19150 7672 6893 gene locus_tag LOCUS_19160 gene map 7672 6893 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BV1 protein_id gnl|my_center|LOCUS_19160 7933 8859 gene locus_tag LOCUS_19170 gene rpsB 7933 8859 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_19170 8936 9814 gene locus_tag LOCUS_19180 gene tsf 8936 9814 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_19180 9841 10563 gene locus_tag LOCUS_19190 gene pyrH 9841 10563 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_19190 10587 11144 gene locus_tag LOCUS_19200 gene frr 10587 11144 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_19200 11202 11954 gene locus_tag LOCUS_19210 gene uppS 11202 11954 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_19210 11947 12813 gene locus_tag LOCUS_19220 gene cdsA 11947 12813 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_19220 12810 14012 gene locus_tag LOCUS_19230 gene dxr 12810 14012 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS2 protein_id gnl|my_center|LOCUS_19230 14052 15449 gene locus_tag LOCUS_19240 14052 15449 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_19240 >Feature sequence084 1579 446 gene locus_tag LOCUS_19250 1579 446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_19250 1689 4922 gene locus_tag LOCUS_19260 1689 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4927 5469 gene locus_tag LOCUS_19270 4927 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5514 5897 gene locus_tag LOCUS_19280 5514 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880355.1 protein_id gnl|my_center|LOCUS_19280 5908 7338 gene locus_tag LOCUS_19290 5908 7338 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_19290 9921 7345 gene locus_tag LOCUS_19300 9921 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 10005 11021 gene locus_tag LOCUS_19310 10005 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 11875 11270 gene locus_tag LOCUS_19320 11875 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12691 12047 gene locus_tag LOCUS_19330 12691 12047 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_19330 12804 14642 gene locus_tag LOCUS_19340 12804 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 15169 14645 gene locus_tag LOCUS_19350 15169 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 15576 15500 gene locus_tag LOCUS_t00140 15576 15500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 3080 1224 gene locus_tag LOCUS_19360 3080 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3333 5090 gene locus_tag LOCUS_19370 3333 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6089 5124 gene locus_tag LOCUS_19380 6089 5124 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_19380 7122 6076 gene locus_tag LOCUS_19390 7122 6076 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_19390 8806 7106 gene locus_tag LOCUS_19400 8806 7106 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_19400 9822 8818 gene locus_tag LOCUS_19410 gene idiA 9822 8818 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_19410 11181 10012 gene locus_tag LOCUS_19420 11181 10012 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337089.1 protein_id gnl|my_center|LOCUS_19420 12109 11174 gene locus_tag LOCUS_19430 12109 11174 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975640.1 protein_id gnl|my_center|LOCUS_19430 12906 12106 gene locus_tag LOCUS_19440 12906 12106 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_19440 15276 12925 gene locus_tag LOCUS_19450 15276 12925 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_19450 15749 15273 gene locus_tag LOCUS_19460 15749 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence086 672 217 gene locus_tag LOCUS_19470 672 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 771 1736 gene locus_tag LOCUS_19480 gene ispB 771 1736 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_19480 2938 1745 gene locus_tag LOCUS_19490 2938 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4440 2992 gene locus_tag LOCUS_19500 4440 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5962 4418 gene locus_tag LOCUS_19510 5962 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 7633 5975 gene locus_tag LOCUS_19520 gene etfQ 7633 5975 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_19520 7875 10058 gene locus_tag LOCUS_19530 7875 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 10415 12643 gene locus_tag LOCUS_19540 10415 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 13393 12674 gene locus_tag LOCUS_19550 13393 12674 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_19550 13706 13530 gene locus_tag LOCUS_19560 13706 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 13960 15144 gene locus_tag LOCUS_19570 13960 15144 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence087 1404 211 gene locus_tag LOCUS_19580 1404 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_19580 1660 2274 gene locus_tag LOCUS_19590 1660 2274 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_19590 2271 4013 gene locus_tag LOCUS_19600 2271 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 7111 4094 gene locus_tag LOCUS_19610 7111 4094 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_19610 7785 7435 gene locus_tag LOCUS_19620 7785 7435 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_19620 8601 7786 gene locus_tag LOCUS_19630 gene phhA 8601 7786 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_19630 8771 9235 gene locus_tag LOCUS_19640 8771 9235 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 protein_id gnl|my_center|LOCUS_19640 9795 9253 gene locus_tag LOCUS_19650 9795 9253 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_19650 9858 10949 gene locus_tag LOCUS_19660 9858 10949 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 protein_id gnl|my_center|LOCUS_19660 11093 11626 gene locus_tag LOCUS_19670 11093 11626 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_19670 11628 12608 gene locus_tag LOCUS_19680 11628 12608 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709492.1 protein_id gnl|my_center|LOCUS_19680 12598 13275 gene locus_tag LOCUS_19690 gene maiA 12598 13275 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_19690 15193 13655 gene locus_tag LOCUS_19700 15193 13655 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_19700 15714 15526 gene locus_tag LOCUS_19710 15714 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence088 1273 389 gene locus_tag LOCUS_19720 1273 389 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_19720 1413 2744 gene locus_tag LOCUS_19730 1413 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2748 4886 gene locus_tag LOCUS_19740 2748 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4922 5989 gene locus_tag LOCUS_19750 4922 5989 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_19750 5986 8052 gene locus_tag LOCUS_19760 5986 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8049 9263 gene locus_tag LOCUS_19770 8049 9263 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 protein_id gnl|my_center|LOCUS_19770 10708 9260 gene locus_tag LOCUS_19780 gene selA 10708 9260 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58226 protein_id gnl|my_center|LOCUS_19780 10875 11825 gene locus_tag LOCUS_19790 10875 11825 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973912.1 protein_id gnl|my_center|LOCUS_19790 12649 11822 gene locus_tag LOCUS_19800 12649 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 13973 14608 gene locus_tag LOCUS_19810 13973 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <15541 14672 gene locus_tag LOCUS_19820 <15541 14672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000019456.1:IS5 family transposase >Feature sequence089 1191 2222 gene locus_tag LOCUS_19830 gene ltaA 1191 2222 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816022.1 protein_id gnl|my_center|LOCUS_19830 2542 3564 gene locus_tag LOCUS_19840 2542 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5764 3650 gene locus_tag LOCUS_19850 5764 3650 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_19850 6970 5921 gene locus_tag LOCUS_19860 6970 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_19860 7970 7302 gene locus_tag LOCUS_19870 7970 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 10895 8145 gene locus_tag LOCUS_19880 10895 8145 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_19880 12190 11111 gene locus_tag LOCUS_19890 12190 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 12391 13032 gene locus_tag LOCUS_19900 12391 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 13459 13127 gene locus_tag LOCUS_19910 13459 13127 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143579.1 protein_id gnl|my_center|LOCUS_19910 13581 14066 gene locus_tag LOCUS_19920 13581 14066 CDS product cytochrome P460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530718.1 protein_id gnl|my_center|LOCUS_19920 14353 14129 gene locus_tag LOCUS_19930 14353 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence090 1077 1418 gene locus_tag LOCUS_19940 1077 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2151 1438 gene locus_tag LOCUS_19950 gene sfsA 2151 1438 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRD4 protein_id gnl|my_center|LOCUS_19950 3291 2155 gene locus_tag LOCUS_19960 3291 2155 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_19960 3452 3895 gene locus_tag LOCUS_19970 gene dksA 3452 3895 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_19970 3946 4791 gene locus_tag LOCUS_19980 gene gluQ 3946 4791 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_19980 4810 4983 gene locus_tag LOCUS_19990 4810 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4973 7951 gene locus_tag LOCUS_20000 gene cbrA 4973 7951 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_20000 8026 9351 gene locus_tag LOCUS_20010 gene cbrB 8026 9351 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_20010 9798 11258 gene locus_tag LOCUS_20020 gene pcnB 9798 11258 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_20020 11255 11914 gene locus_tag LOCUS_20030 11255 11914 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_20030 11920 12732 gene locus_tag LOCUS_20040 gene panB 11920 12732 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_20040 12753 13604 gene locus_tag LOCUS_20050 gene panC 12753 13604 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_20050 >Feature sequence091 1625 1161 gene locus_tag LOCUS_20060 1625 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1902 2348 gene locus_tag LOCUS_20070 1902 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3180 2437 gene locus_tag LOCUS_20080 3180 2437 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566203.1 protein_id gnl|my_center|LOCUS_20080 4388 3300 gene locus_tag LOCUS_20090 4388 3300 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_20090 5043 4555 gene locus_tag LOCUS_20100 5043 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 5458 5231 gene locus_tag LOCUS_20110 5458 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6093 5599 gene locus_tag LOCUS_20120 6093 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8530 8258 gene locus_tag LOCUS_20130 8530 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8791 8534 gene locus_tag LOCUS_20140 8791 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 9757 9050 gene locus_tag LOCUS_20150 9757 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 10224 9757 gene locus_tag LOCUS_20160 10224 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 12067 10268 gene locus_tag LOCUS_20170 12067 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 13836 12061 gene locus_tag LOCUS_20180 13836 12061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769148.1 protein_id gnl|my_center|LOCUS_20180 14894 13836 gene locus_tag LOCUS_20190 gene batA 14894 13836 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence092 808 500 gene locus_tag LOCUS_20200 808 500 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766760.1 protein_id gnl|my_center|LOCUS_20200 1605 892 gene locus_tag LOCUS_20210 gene pyrF 1605 892 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z6 protein_id gnl|my_center|LOCUS_20210 2851 1655 gene locus_tag LOCUS_20220 gene lapB 2851 1655 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_20220 3159 2848 gene locus_tag LOCUS_20230 3159 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3506 3201 gene locus_tag LOCUS_20240 gene ihfB 3506 3201 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_20240 5271 3595 gene locus_tag LOCUS_20250 gene rpsA 5271 3595 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_20250 6092 5424 gene locus_tag LOCUS_20260 gene cmk 6092 5424 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P4 protein_id gnl|my_center|LOCUS_20260 8362 6089 gene locus_tag LOCUS_20270 gene aroA 8362 6089 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_20270 9211 8372 gene locus_tag LOCUS_20280 9211 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11831 9213 gene locus_tag LOCUS_20290 gene gyrA 11831 9213 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T6 protein_id gnl|my_center|LOCUS_20290 12075 13436 gene locus_tag LOCUS_20300 12075 13436 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_20300 13433 14146 gene locus_tag LOCUS_20310 gene ubiG 13433 14146 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_20310 >Feature sequence093 <1 1047 gene locus_tag LOCUS_20320 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:histidine kinase 1130 3022 gene locus_tag LOCUS_20330 gene gcd 1130 3022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537475.1 protein_id gnl|my_center|LOCUS_20330 3095 3697 gene locus_tag LOCUS_20340 3095 3697 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD41 protein_id gnl|my_center|LOCUS_20340 3690 4205 gene locus_tag LOCUS_20350 3690 4205 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_20350 4529 4350 gene locus_tag LOCUS_20360 4529 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5205 4747 gene locus_tag LOCUS_20370 5205 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 6243 5287 gene locus_tag LOCUS_20380 6243 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 6632 6240 gene locus_tag LOCUS_20390 6632 6240 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_20390 6592 6795 gene locus_tag LOCUS_20400 6592 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 6792 7229 gene locus_tag LOCUS_20410 6792 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 7817 7251 gene locus_tag LOCUS_20420 7817 7251 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_20420 8135 7821 gene locus_tag LOCUS_20430 8135 7821 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_20430 8402 9145 gene locus_tag LOCUS_20440 gene modA 8402 9145 CDS product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_20440 9837 12116 gene locus_tag LOCUS_20450 9837 12116 CDS product siderophore receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_20450 12118 13746 gene locus_tag LOCUS_20460 12118 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence094 <1 862 gene locus_tag LOCUS_20470 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXI8:cysteine desulfurase IscS 877 1263 gene locus_tag LOCUS_20480 gene iscU 877 1263 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_20480 1274 1597 gene locus_tag LOCUS_20490 1274 1597 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S26 protein_id gnl|my_center|LOCUS_20490 1639 2172 gene locus_tag LOCUS_20500 gene hscB 1639 2172 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN4 protein_id gnl|my_center|LOCUS_20500 2175 4034 gene locus_tag LOCUS_20510 gene hscA 2175 4034 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6B3 protein_id gnl|my_center|LOCUS_20510 4036 4374 gene locus_tag LOCUS_20520 gene fdx 4036 4374 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 protein_id gnl|my_center|LOCUS_20520 4386 4583 gene locus_tag LOCUS_20530 4386 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_20530 4680 5105 gene locus_tag LOCUS_20540 gene ndk 4680 5105 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_20540 5134 6303 gene locus_tag LOCUS_20550 gene rlmN 5134 6303 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX26 protein_id gnl|my_center|LOCUS_20550 6308 7147 gene locus_tag LOCUS_20560 gene pilF 6308 7147 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_20560 7137 8198 gene locus_tag LOCUS_20570 gene rodZ 7137 8198 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS68 protein_id gnl|my_center|LOCUS_20570 8205 9332 gene locus_tag LOCUS_20580 gene ispG 8205 9332 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_20580 9403 10656 gene locus_tag LOCUS_20590 gene hisS 9403 10656 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_20590 10761 11423 gene locus_tag LOCUS_20600 gene yfgM 10761 11423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_20600 11420 12589 gene locus_tag LOCUS_20610 gene bamB 11420 12589 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_20610 12641 14230 gene locus_tag LOCUS_20620 gene der 12641 14230 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_20620 >Feature sequence095 2195 1368 gene locus_tag LOCUS_20630 2195 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_20630 2437 2183 gene locus_tag LOCUS_20640 2437 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3298 2438 gene locus_tag LOCUS_20650 3298 2438 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_20650 4198 3305 gene locus_tag LOCUS_20660 gene nadK 4198 3305 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_20660 4292 5299 gene locus_tag LOCUS_20670 4292 5299 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_20670 7542 5296 gene locus_tag LOCUS_20680 7542 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 8535 7657 gene locus_tag LOCUS_20690 gene dcyD 8535 7657 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_20690 8656 8580 gene locus_tag LOCUS_t00150 8656 8580 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8759 8684 gene locus_tag LOCUS_t00160 8759 8684 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11186 8832 gene locus_tag LOCUS_20700 11186 8832 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_20700 11318 11677 gene locus_tag LOCUS_20710 11318 11677 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NI5 protein_id gnl|my_center|LOCUS_20710 12378 11674 gene locus_tag LOCUS_20720 gene ung 12378 11674 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XE2 protein_id gnl|my_center|LOCUS_20720 13892 12390 gene locus_tag LOCUS_20730 gene lysS 13892 12390 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWW0 protein_id gnl|my_center|LOCUS_20730 <14754 13898 gene locus_tag LOCUS_20740 <14754 13898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUL5:peptide chain release factor 2 >Feature sequence096 472 945 gene locus_tag LOCUS_20750 472 945 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_20750 2656 1409 gene locus_tag LOCUS_20760 2656 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_20760 4608 2677 gene locus_tag LOCUS_20770 4608 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 5288 4611 gene locus_tag LOCUS_20780 5288 4611 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_20780 6230 5292 gene locus_tag LOCUS_20790 6230 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 6778 6293 gene locus_tag LOCUS_20800 gene recX 6778 6293 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XY8 protein_id gnl|my_center|LOCUS_20800 7899 6796 gene locus_tag LOCUS_20810 gene recA 7899 6796 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_20810 8851 8327 gene locus_tag LOCUS_20820 8851 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_20820 10849 8993 gene locus_tag LOCUS_20830 10849 8993 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_20830 10972 13515 gene locus_tag LOCUS_20840 gene mutS 10972 13515 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XW6 protein_id gnl|my_center|LOCUS_20840 13610 13933 gene locus_tag LOCUS_20850 gene fdxA 13610 13933 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_20850 <14685 14034 gene locus_tag LOCUS_20860 <14685 14034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45682:lipoprotein NlpD/LppB >Feature sequence097 197 937 gene locus_tag LOCUS_20870 197 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 947 2335 gene locus_tag LOCUS_20880 947 2335 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_20880 2353 3555 gene locus_tag LOCUS_20890 2353 3555 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_20890 3623 6139 gene locus_tag LOCUS_20900 3623 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7541 6162 gene locus_tag LOCUS_20910 7541 6162 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_20910 8379 7732 gene locus_tag LOCUS_20920 8379 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8691 9821 gene locus_tag LOCUS_20930 8691 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11045 9915 gene locus_tag LOCUS_20940 gene purK 11045 9915 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY0 protein_id gnl|my_center|LOCUS_20940 11527 11045 gene locus_tag LOCUS_20950 gene purE 11527 11045 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 protein_id gnl|my_center|LOCUS_20950 12486 11554 gene locus_tag LOCUS_20960 12486 11554 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_20960 12720 12490 gene locus_tag LOCUS_20970 12720 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 12845 13786 gene locus_tag LOCUS_20980 12845 13786 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_20980 14387 13824 gene locus_tag LOCUS_20990 14387 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence098 3149 1860 gene locus_tag LOCUS_21000 gene clpX 3149 1860 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_21000 3866 3225 gene locus_tag LOCUS_21010 gene clpP 3866 3225 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS6 protein_id gnl|my_center|LOCUS_21010 5214 3883 gene locus_tag LOCUS_21020 gene tig 5214 3883 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_21020 5677 5868 gene locus_tag LOCUS_21030 5677 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5931 7922 gene locus_tag LOCUS_21040 5931 7922 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_21040 8914 7952 gene locus_tag LOCUS_21050 8914 7952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_21050 9018 9998 gene locus_tag LOCUS_21060 9018 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_21060 9991 10770 gene locus_tag LOCUS_21070 9991 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 11546 10779 gene locus_tag LOCUS_21080 11546 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 11937 13223 gene locus_tag LOCUS_21090 11937 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence099 130 43 gene locus_tag LOCUS_t00170 130 43 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1055 237 gene locus_tag LOCUS_21100 gene queF 1055 237 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F02 protein_id gnl|my_center|LOCUS_21100 1863 1081 gene locus_tag LOCUS_21110 1863 1081 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_21110 2793 1876 gene locus_tag LOCUS_21120 2793 1876 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267141.1 protein_id gnl|my_center|LOCUS_21120 2916 2841 gene locus_tag LOCUS_t00180 2916 2841 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3117 3857 gene locus_tag LOCUS_21130 3117 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3956 4303 gene locus_tag LOCUS_21140 3956 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4364 5020 gene locus_tag LOCUS_21150 4364 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5611 5030 gene locus_tag LOCUS_21160 gene nfuA 5611 5030 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_21160 5793 9479 gene locus_tag LOCUS_21170 gene metH 5793 9479 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_21170 9522 11228 gene locus_tag LOCUS_21180 gene cysI 9522 11228 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_21180 11212 11730 gene locus_tag LOCUS_21190 11212 11730 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 protein_id gnl|my_center|LOCUS_21190 12722 11727 gene locus_tag LOCUS_21200 12722 11727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_21200 13785 12736 gene locus_tag LOCUS_21210 13785 12736 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_21210 <14557 13810 gene locus_tag LOCUS_21220 <14557 13810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O86062:NADH pyrophosphatase >Feature sequence100 1521 1270 gene locus_tag LOCUS_21230 1521 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2009 1527 gene locus_tag LOCUS_21240 2009 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2262 2166 gene locus_tag LOCUS_t00190 2262 2166 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3106 2285 gene locus_tag LOCUS_21250 3106 2285 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_21250 3221 4303 gene locus_tag LOCUS_21260 gene fabH 3221 4303 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH32 protein_id gnl|my_center|LOCUS_21260 4394 5551 gene locus_tag LOCUS_21270 4394 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5640 5957 gene locus_tag LOCUS_21280 5640 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6112 7134 gene locus_tag LOCUS_21290 gene cbpA 6112 7134 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VN8 protein_id gnl|my_center|LOCUS_21290 7145 7447 gene locus_tag LOCUS_21300 7145 7447 CDS product chaperone-modulator protein CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173425.1 protein_id gnl|my_center|LOCUS_21300 7472 8089 gene locus_tag LOCUS_21310 7472 8089 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704478.1 protein_id gnl|my_center|LOCUS_21310 8177 8935 gene locus_tag LOCUS_21320 8177 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 8970 10148 gene locus_tag LOCUS_21330 8970 10148 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405551.1 protein_id gnl|my_center|LOCUS_21330 10158 10859 gene locus_tag LOCUS_21340 10158 10859 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_21340 10861 12087 gene locus_tag LOCUS_21350 10861 12087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence101 630 292 gene locus_tag LOCUS_21360 630 292 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_21360 1988 789 gene locus_tag LOCUS_21370 1988 789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_21370 3323 2364 gene locus_tag LOCUS_21380 3323 2364 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_21380 3593 3901 gene locus_tag LOCUS_21390 3593 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 4565 3921 gene locus_tag LOCUS_21400 4565 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4813 5397 gene locus_tag LOCUS_21410 4813 5397 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404452.1 protein_id gnl|my_center|LOCUS_21410 5390 6040 gene locus_tag LOCUS_21420 5390 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6094 6663 gene locus_tag LOCUS_21430 6094 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7036 6668 gene locus_tag LOCUS_21440 7036 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7166 8290 gene locus_tag LOCUS_21450 7166 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_21450 8302 10053 gene locus_tag LOCUS_21460 8302 10053 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233035.2 protein_id gnl|my_center|LOCUS_21460 10066 10317 gene locus_tag LOCUS_21470 10066 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 10295 11227 gene locus_tag LOCUS_21480 gene ribF 10295 11227 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_21480 11295 14114 gene locus_tag LOCUS_21490 gene ileS 11295 14114 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_21490 >Feature sequence102 447 2192 gene locus_tag LOCUS_21500 447 2192 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 protein_id gnl|my_center|LOCUS_21500 3285 2209 gene locus_tag LOCUS_21510 3285 2209 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_21510 3418 5124 gene locus_tag LOCUS_21520 3418 5124 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_21520 5127 7271 gene locus_tag LOCUS_21530 5127 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 7541 9475 gene locus_tag LOCUS_21540 7541 9475 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972965.1 protein_id gnl|my_center|LOCUS_21540 9569 10666 gene locus_tag LOCUS_21550 gene ackA 9569 10666 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAH2 protein_id gnl|my_center|LOCUS_21550 10729 13110 gene locus_tag LOCUS_21560 10729 13110 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 protein_id gnl|my_center|LOCUS_21560 13873 13190 gene locus_tag LOCUS_21570 13873 13190 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence103 3058 371 gene locus_tag LOCUS_21580 gene sbcC 3058 371 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124854.1 protein_id gnl|my_center|LOCUS_21580 4234 3062 gene locus_tag LOCUS_21590 gene sbcD 4234 3062 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_21590 5487 4750 gene locus_tag LOCUS_21600 5487 4750 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_21600 6624 5515 gene locus_tag LOCUS_21610 6624 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 8257 6872 gene locus_tag LOCUS_21620 gene degQ 8257 6872 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 protein_id gnl|my_center|LOCUS_21620 8486 9439 gene locus_tag LOCUS_21630 8486 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 10390 9476 gene locus_tag LOCUS_21640 10390 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 10834 10400 gene locus_tag LOCUS_21650 10834 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11007 12425 gene locus_tag LOCUS_21660 11007 12425 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_21660 12415 13761 gene locus_tag LOCUS_21670 12415 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence104 187 969 gene locus_tag LOCUS_21680 gene trmJ 187 969 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP6 protein_id gnl|my_center|LOCUS_21680 1145 3019 gene locus_tag LOCUS_21690 1145 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 5124 3016 gene locus_tag LOCUS_21700 5124 3016 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_21700 5816 5133 gene locus_tag LOCUS_21710 5816 5133 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 protein_id gnl|my_center|LOCUS_21710 5885 7357 gene locus_tag LOCUS_21720 gene putP 5885 7357 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 protein_id gnl|my_center|LOCUS_21720 7833 7354 gene locus_tag LOCUS_21730 7833 7354 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_21730 7882 7957 gene locus_tag LOCUS_t00200 7882 7957 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8118 9371 gene locus_tag LOCUS_21740 8118 9371 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107728.1 protein_id gnl|my_center|LOCUS_21740 9443 9772 gene locus_tag LOCUS_21750 9443 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 9860 10522 gene locus_tag LOCUS_21760 9860 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10657 10881 gene locus_tag LOCUS_21770 10657 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 10890 11225 gene locus_tag LOCUS_21780 10890 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204960.1 protein_id gnl|my_center|LOCUS_21780 11222 11467 gene locus_tag LOCUS_21790 11222 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 11583 12482 gene locus_tag LOCUS_21800 11583 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 12538 12975 gene locus_tag LOCUS_21810 12538 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 13850 13572 gene locus_tag LOCUS_21820 13850 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence105 1960 239 gene locus_tag LOCUS_21830 1960 239 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_21830 3450 2101 gene locus_tag LOCUS_21840 3450 2101 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_21840 3574 4626 gene locus_tag LOCUS_21850 3574 4626 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167652.1 protein_id gnl|my_center|LOCUS_21850 4915 7878 gene locus_tag LOCUS_21860 4915 7878 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_21860 8391 11360 gene locus_tag LOCUS_21870 8391 11360 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_21870 11823 11539 gene locus_tag LOCUS_21880 11823 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 13127 11847 gene locus_tag LOCUS_21890 13127 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 13245 13721 gene locus_tag LOCUS_21900 13245 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence106 1638 733 gene locus_tag LOCUS_21910 gene btuF 1638 733 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_21910 2249 1638 gene locus_tag LOCUS_21920 gene cobO 2249 1638 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_21920 4183 2285 gene locus_tag LOCUS_21930 gene dxs 4183 2285 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_21930 5174 4272 gene locus_tag LOCUS_21940 gene ispA 5174 4272 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_21940 5433 5167 gene locus_tag LOCUS_21950 gene xseB 5433 5167 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889P9 protein_id gnl|my_center|LOCUS_21950 5565 6335 gene locus_tag LOCUS_21960 5565 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6363 6746 gene locus_tag LOCUS_21970 6363 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6883 7428 gene locus_tag LOCUS_21980 6883 7428 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_21980 7499 9241 gene locus_tag LOCUS_21990 7499 9241 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110294.1 protein_id gnl|my_center|LOCUS_21990 9245 10177 gene locus_tag LOCUS_22000 gene oppB 9245 10177 CDS product oligopeptide transport system permease protein OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24138 protein_id gnl|my_center|LOCUS_22000 10177 11544 gene locus_tag LOCUS_22010 10177 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 11541 12590 gene locus_tag LOCUS_22020 gene oppD 11541 12590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_22020 12587 13546 gene locus_tag LOCUS_22030 gene oppF 12587 13546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence107 1706 750 gene locus_tag LOCUS_22040 gene copB 1706 750 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815300.1 protein_id gnl|my_center|LOCUS_22040 3442 1748 gene locus_tag LOCUS_22050 3442 1748 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918848.1 protein_id gnl|my_center|LOCUS_22050 3974 3549 gene locus_tag LOCUS_22060 3974 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4118 4579 gene locus_tag LOCUS_22070 4118 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5061 4639 gene locus_tag LOCUS_22080 gene mscL 5061 4639 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749E9 protein_id gnl|my_center|LOCUS_22080 5186 5695 gene locus_tag LOCUS_22090 5186 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 6409 5681 gene locus_tag LOCUS_22100 6409 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 6649 7770 gene locus_tag LOCUS_22110 6649 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_22110 8528 7773 gene locus_tag LOCUS_22120 8528 7773 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707541.1 protein_id gnl|my_center|LOCUS_22120 8922 8518 gene locus_tag LOCUS_22130 8922 8518 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071074.1 protein_id gnl|my_center|LOCUS_22130 10641 8983 gene locus_tag LOCUS_22140 10641 8983 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_22140 10788 11372 gene locus_tag LOCUS_22150 10788 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 12358 11384 gene locus_tag LOCUS_22160 gene qor 12358 11384 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence108 157 1161 gene locus_tag LOCUS_22170 157 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1158 2153 gene locus_tag LOCUS_22180 1158 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_22180 2153 2401 gene locus_tag LOCUS_22190 2153 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4850 2403 gene locus_tag LOCUS_22200 4850 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5428 4892 gene locus_tag LOCUS_22210 5428 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 6713 5832 gene locus_tag LOCUS_22220 6713 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6841 7677 gene locus_tag LOCUS_22230 6841 7677 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921287.1 protein_id gnl|my_center|LOCUS_22230 7832 8758 gene locus_tag LOCUS_22240 7832 8758 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_22240 9689 8829 gene locus_tag LOCUS_22250 9689 8829 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_22250 12150 9796 gene locus_tag LOCUS_22260 12150 9796 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence109 1043 24 gene locus_tag LOCUS_22270 1043 24 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_22270 1477 2352 gene locus_tag LOCUS_22280 1477 2352 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_22280 2841 2359 gene locus_tag LOCUS_22290 2841 2359 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_22290 3100 3342 gene locus_tag LOCUS_22300 3100 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3984 3355 gene locus_tag LOCUS_22310 3984 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_22310 4666 3998 gene locus_tag LOCUS_22320 4666 3998 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_22320 4547 4846 gene locus_tag LOCUS_22330 4547 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5084 5323 gene locus_tag LOCUS_22340 5084 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5486 5920 gene locus_tag LOCUS_22350 5486 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5929 6147 gene locus_tag LOCUS_22360 5929 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103440.1 protein_id gnl|my_center|LOCUS_22360 6848 7501 gene locus_tag LOCUS_22370 6848 7501 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_22370 8339 7470 gene locus_tag LOCUS_22380 8339 7470 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_22380 8584 8429 gene locus_tag LOCUS_22390 8584 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 10138 8669 gene locus_tag LOCUS_22400 10138 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22400 10284 11921 gene locus_tag LOCUS_22410 10284 11921 CDS product putative medium chain fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702815.1 protein_id gnl|my_center|LOCUS_22410 12982 11957 gene locus_tag LOCUS_22420 12982 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence110 1921 1229 gene locus_tag LOCUS_22430 1921 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3080 1956 gene locus_tag LOCUS_22440 3080 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4310 3138 gene locus_tag LOCUS_22450 4310 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5756 4323 gene locus_tag LOCUS_22460 5756 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 6021 5860 gene locus_tag LOCUS_22470 6021 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6285 7298 gene locus_tag LOCUS_22480 6285 7298 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_22480 7441 9786 gene locus_tag LOCUS_22490 7441 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 9875 10393 gene locus_tag LOCUS_22500 9875 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 10413 10541 gene locus_tag LOCUS_22510 10413 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 12307 10625 gene locus_tag LOCUS_22520 12307 10625 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_22520 12617 12300 gene locus_tag LOCUS_22530 12617 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence111 141 326 gene locus_tag LOCUS_22540 141 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 417 776 gene locus_tag LOCUS_22550 417 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 807 1121 gene locus_tag LOCUS_22560 807 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1142 1585 gene locus_tag LOCUS_22570 1142 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1615 1941 gene locus_tag LOCUS_22580 1615 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1952 2464 gene locus_tag LOCUS_22590 1952 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2476 2679 gene locus_tag LOCUS_22600 2476 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3274 2666 gene locus_tag LOCUS_22610 3274 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3996 3277 gene locus_tag LOCUS_22620 3996 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_22620 5228 3993 gene locus_tag LOCUS_22630 5228 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6056 5247 gene locus_tag LOCUS_22640 6056 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 6269 6084 gene locus_tag LOCUS_22650 6269 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6217 7011 gene locus_tag LOCUS_22660 6217 7011 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_22660 7212 8669 gene locus_tag LOCUS_22670 7212 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8669 9691 gene locus_tag LOCUS_22680 8669 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9754 10716 gene locus_tag LOCUS_22690 9754 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 11424 10840 gene locus_tag LOCUS_22700 11424 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 11511 12323 gene locus_tag LOCUS_22710 11511 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_22710 12359 12847 gene locus_tag LOCUS_22720 12359 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence112 854 1456 gene locus_tag LOCUS_22730 854 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1473 1712 gene locus_tag LOCUS_22740 1473 1712 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_22740 1740 3002 gene locus_tag LOCUS_22750 gene murA 1740 3002 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_22750 3034 3711 gene locus_tag LOCUS_22760 gene hisG 3034 3711 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_22760 3708 5036 gene locus_tag LOCUS_22770 gene hisD 3708 5036 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_22770 6111 5038 gene locus_tag LOCUS_22780 gene degS 6111 5038 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073685.1 protein_id gnl|my_center|LOCUS_22780 8218 6311 gene locus_tag LOCUS_22790 gene cysNC 8218 6311 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_22790 9139 8231 gene locus_tag LOCUS_22800 gene cysD 9139 8231 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP36 protein_id gnl|my_center|LOCUS_22800 9616 9167 gene locus_tag LOCUS_22810 9616 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9783 10880 gene locus_tag LOCUS_22820 gene zapE 9783 10880 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_22820 11024 11407 gene locus_tag LOCUS_22830 gene rplM 11024 11407 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ3 protein_id gnl|my_center|LOCUS_22830 11424 11816 gene locus_tag LOCUS_22840 gene rpsI 11424 11816 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_22840 12175 12699 gene locus_tag LOCUS_22850 12175 12699 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_22850 >Feature sequence113 73 507 gene locus_tag LOCUS_22860 73 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 580 1557 gene locus_tag LOCUS_22870 gene mdh 580 1557 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_22870 1580 2707 gene locus_tag LOCUS_22880 1580 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2718 3518 gene locus_tag LOCUS_22890 2718 3518 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_22890 4053 3520 gene locus_tag LOCUS_22900 4053 3520 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_22900 4276 5946 gene locus_tag LOCUS_22910 gene leuA-2 4276 5946 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_22910 6116 6688 gene locus_tag LOCUS_22920 6116 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 6675 7382 gene locus_tag LOCUS_22930 6675 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 7394 8422 gene locus_tag LOCUS_22940 7394 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 9286 8474 gene locus_tag LOCUS_22950 9286 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 9510 9896 gene locus_tag LOCUS_22960 9510 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_22960 10750 9914 gene locus_tag LOCUS_22970 10750 9914 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706722.1 protein_id gnl|my_center|LOCUS_22970 10926 11438 gene locus_tag LOCUS_22980 10926 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_22980 11504 11998 gene locus_tag LOCUS_22990 11504 11998 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence114 <1 748 gene locus_tag LOCUS_23000 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52022:DNA polymerase III subunit alpha 760 1713 gene locus_tag LOCUS_23010 gene accA 760 1713 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M7 protein_id gnl|my_center|LOCUS_23010 1731 3068 gene locus_tag LOCUS_23020 gene tilS 1731 3068 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_23020 3147 4853 gene locus_tag LOCUS_23030 gene pyrG 3147 4853 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_23030 4887 5732 gene locus_tag LOCUS_23040 gene kdsA 4887 5732 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_23040 6340 7638 gene locus_tag LOCUS_23050 gene eno 6340 7638 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_23050 7638 7910 gene locus_tag LOCUS_23060 gene ftsB 7638 7910 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_23060 8014 8667 gene locus_tag LOCUS_23070 gene ispD 8014 8667 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_23070 8664 9185 gene locus_tag LOCUS_23080 gene ispF 8664 9185 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH6 protein_id gnl|my_center|LOCUS_23080 9182 10312 gene locus_tag LOCUS_23090 gene truD 9182 10312 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L6 protein_id gnl|my_center|LOCUS_23090 10309 10977 gene locus_tag LOCUS_23100 gene pcm 10309 10977 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_23100 10988 11950 gene locus_tag LOCUS_23110 10988 11950 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence115 1846 95 gene locus_tag LOCUS_23120 1846 95 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537605.1 protein_id gnl|my_center|LOCUS_23120 2148 1939 gene locus_tag LOCUS_23130 2148 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2462 2145 gene locus_tag LOCUS_23140 2462 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3239 2493 gene locus_tag LOCUS_23150 gene ygaJ 3239 2493 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_23150 4601 3294 gene locus_tag LOCUS_23160 4601 3294 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_23160 4948 4598 gene locus_tag LOCUS_23170 4948 4598 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_23170 6215 5169 gene locus_tag LOCUS_23180 6215 5169 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_23180 8485 6257 gene locus_tag LOCUS_23190 8485 6257 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_23190 8832 8623 gene locus_tag LOCUS_23200 8832 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 9794 8829 gene locus_tag LOCUS_23210 gene epmA 9794 8829 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 protein_id gnl|my_center|LOCUS_23210 10344 9808 gene locus_tag LOCUS_23220 gene efp 10344 9808 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_23220 10446 11507 gene locus_tag LOCUS_23230 10446 11507 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence116 <1 1603 gene locus_tag LOCUS_23240 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919618.1:TonB-dependent receptor 1722 2756 gene locus_tag LOCUS_23250 1722 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2851 3720 gene locus_tag LOCUS_23260 2851 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4931 4113 gene locus_tag LOCUS_23270 4931 4113 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_23270 5866 5018 gene locus_tag LOCUS_23280 5866 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 6993 6007 gene locus_tag LOCUS_23290 6993 6007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_23290 7986 6997 gene locus_tag LOCUS_23300 7986 6997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_23300 9949 7991 gene locus_tag LOCUS_23310 9949 7991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_23310 11053 9980 gene locus_tag LOCUS_23320 gene yejE 11053 9980 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 protein_id gnl|my_center|LOCUS_23320 12080 11058 gene locus_tag LOCUS_23330 gene yejB 12080 11058 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence117 163 837 gene locus_tag LOCUS_23340 163 837 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_23340 2589 856 gene locus_tag LOCUS_23350 2589 856 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_23350 3590 2586 gene locus_tag LOCUS_23360 3590 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_23360 4314 3577 gene locus_tag LOCUS_23370 4314 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5556 4339 gene locus_tag LOCUS_23380 gene moeA1 5556 4339 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_23380 6515 5562 gene locus_tag LOCUS_23390 6515 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113045.1 protein_id gnl|my_center|LOCUS_23390 6983 6522 gene locus_tag LOCUS_23400 gene ssb 6983 6522 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_23400 7272 10103 gene locus_tag LOCUS_23410 gene uvrA 7272 10103 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_23410 10341 10931 gene locus_tag LOCUS_23420 10341 10931 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence118 1517 993 gene locus_tag LOCUS_23430 1517 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1778 3517 gene locus_tag LOCUS_23440 1778 3517 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537605.1 protein_id gnl|my_center|LOCUS_23440 4796 3582 gene locus_tag LOCUS_23450 4796 3582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_23450 5171 6463 gene locus_tag LOCUS_23460 5171 6463 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_23460 8316 6487 gene locus_tag LOCUS_23470 8316 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 10323 8569 gene locus_tag LOCUS_23480 10323 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 10637 10320 gene locus_tag LOCUS_23490 10637 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 11790 10630 gene locus_tag LOCUS_23500 11790 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence119 963 1925 gene locus_tag LOCUS_23510 963 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2608 1946 gene locus_tag LOCUS_23520 2608 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3102 2614 gene locus_tag LOCUS_23530 gene slyD 3102 2614 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A3 protein_id gnl|my_center|LOCUS_23530 3906 3115 gene locus_tag LOCUS_23540 3906 3115 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_23540 4898 3921 gene locus_tag LOCUS_23550 4898 3921 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_23550 5080 7128 gene locus_tag LOCUS_23560 gene yncD 5080 7128 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689374.1 protein_id gnl|my_center|LOCUS_23560 7135 7782 gene locus_tag LOCUS_23570 7135 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8418 7783 gene locus_tag LOCUS_23580 8418 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 10244 8550 gene locus_tag LOCUS_23590 10244 8550 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_23590 11008 10295 gene locus_tag LOCUS_23600 11008 10295 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_23600 11542 11063 gene locus_tag LOCUS_23610 11542 11063 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence120 835 32 gene locus_tag LOCUS_23620 gene mreC 835 32 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_23620 1965 925 gene locus_tag LOCUS_23630 1965 925 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_23630 2277 2564 gene locus_tag LOCUS_23640 gene gatC 2277 2564 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_23640 2567 4036 gene locus_tag LOCUS_23650 gene gatA 2567 4036 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_23650 4033 5463 gene locus_tag LOCUS_23660 gene gatB 4033 5463 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_23660 5460 5795 gene locus_tag LOCUS_23670 5460 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 6907 5816 gene locus_tag LOCUS_23680 6907 5816 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_23680 8221 7175 gene locus_tag LOCUS_23690 8221 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 8132 8485 gene locus_tag LOCUS_23700 8132 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 8470 9699 gene locus_tag LOCUS_23710 gene mntH 8470 9699 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_23710 11036 9747 gene locus_tag LOCUS_23720 gene rhlB 11036 9747 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_23720 <11689 11097 gene locus_tag LOCUS_23730 <11689 11097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807436.1:adenylyltransferase >Feature sequence121 4000 2336 gene locus_tag LOCUS_23740 gene fadD2 4000 2336 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_23740 5216 4035 gene locus_tag LOCUS_23750 5216 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_23750 6058 5216 gene locus_tag LOCUS_23760 6058 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_23760 6762 6097 gene locus_tag LOCUS_23770 6762 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 7247 6891 gene locus_tag LOCUS_23780 7247 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 7693 7247 gene locus_tag LOCUS_23790 7693 7247 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_23790 8885 7683 gene locus_tag LOCUS_23800 gene rnd 8885 7683 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 protein_id gnl|my_center|LOCUS_23800 9487 8882 gene locus_tag LOCUS_23810 gene recR 9487 8882 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7H9 protein_id gnl|my_center|LOCUS_23810 9825 9505 gene locus_tag LOCUS_23820 9825 9505 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_23820 11379 9835 gene locus_tag LOCUS_23830 11379 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence122 <1 530 gene locus_tag LOCUS_23840 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404038.1:amino acid transporter 2215 527 gene locus_tag LOCUS_23850 2215 527 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_23850 2487 2212 gene locus_tag LOCUS_23860 2487 2212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_23860 3124 2624 gene locus_tag LOCUS_23870 3124 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4491 3133 gene locus_tag LOCUS_23880 4491 3133 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_23880 4821 4543 gene locus_tag LOCUS_23890 gene ptsH 4821 4543 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_23890 5679 4822 gene locus_tag LOCUS_23900 5679 4822 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_23900 6162 5713 gene locus_tag LOCUS_23910 6162 5713 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_23910 7731 6232 gene locus_tag LOCUS_23920 gene rpoN 7731 6232 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_23920 8586 7861 gene locus_tag LOCUS_23930 8586 7861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_23930 9050 8586 gene locus_tag LOCUS_23940 9050 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9708 9091 gene locus_tag LOCUS_23950 9708 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 10239 9724 gene locus_tag LOCUS_23960 10239 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_23960 11078 10257 gene locus_tag LOCUS_23970 gene kdsD 11078 10257 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_23970 10983 11219 gene locus_tag LOCUS_23980 10983 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence123 1426 1551 gene locus_tag LOCUS_23990 1426 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 1930 1676 gene locus_tag LOCUS_24000 1930 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2059 2331 gene locus_tag LOCUS_24010 2059 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2425 2961 gene locus_tag LOCUS_24020 2425 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2983 4080 gene locus_tag LOCUS_24030 2983 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703827.1 protein_id gnl|my_center|LOCUS_24030 4130 5011 gene locus_tag LOCUS_24040 4130 5011 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 protein_id gnl|my_center|LOCUS_24040 5111 5827 gene locus_tag LOCUS_24050 5111 5827 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_24050 5921 6517 gene locus_tag LOCUS_24060 5921 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_24060 6521 8428 gene locus_tag LOCUS_24070 6521 8428 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_24070 11179 8441 gene locus_tag LOCUS_24080 gene ppd 11179 8441 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence124 <1 518 gene locus_tag LOCUS_24090 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068267.1:ABC transporter ATP-binding protein 515 3181 gene locus_tag LOCUS_24100 515 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3710 3240 gene locus_tag LOCUS_24110 3710 3240 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 protein_id gnl|my_center|LOCUS_24110 4799 3876 gene locus_tag LOCUS_24120 4799 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6124 4796 gene locus_tag LOCUS_24130 6124 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 6698 8101 gene locus_tag LOCUS_24140 6698 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 8188 8532 gene locus_tag LOCUS_24150 8188 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 8577 9017 gene locus_tag LOCUS_24160 8577 9017 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_24160 9094 10140 gene locus_tag LOCUS_24170 9094 10140 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_24170 11274 10150 gene locus_tag LOCUS_24180 11274 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence125 56 832 gene locus_tag LOCUS_24190 56 832 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_24190 1601 858 gene locus_tag LOCUS_24200 1601 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24200 2499 1594 gene locus_tag LOCUS_24210 2499 1594 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ43 protein_id gnl|my_center|LOCUS_24210 3353 2532 gene locus_tag LOCUS_24220 3353 2532 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_24220 4633 3419 gene locus_tag LOCUS_24230 gene trpS 4633 3419 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SR0 protein_id gnl|my_center|LOCUS_24230 5309 4692 gene locus_tag LOCUS_24240 5309 4692 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_24240 5373 5999 gene locus_tag LOCUS_24250 5373 5999 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885M2 protein_id gnl|my_center|LOCUS_24250 6029 6328 gene locus_tag LOCUS_24260 gene yciL 6029 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_24260 6942 6337 gene locus_tag LOCUS_24270 gene ppiB 6942 6337 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_24270 7715 6939 gene locus_tag LOCUS_24280 gene xth 7715 6939 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_24280 8613 7735 gene locus_tag LOCUS_24290 8613 7735 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_24290 9151 8654 gene locus_tag LOCUS_24300 gene moaB1 9151 8654 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX98 protein_id gnl|my_center|LOCUS_24300 10216 9182 gene locus_tag LOCUS_24310 gene moaA2 10216 9182 CDS product GTP 3',8-cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3K7 protein_id gnl|my_center|LOCUS_24310 10876 10244 gene locus_tag LOCUS_24320 10876 10244 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence126 576 1751 gene locus_tag LOCUS_24330 576 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_24330 1748 2548 gene locus_tag LOCUS_24340 1748 2548 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_24340 3988 2549 gene locus_tag LOCUS_24350 gene hldE 3988 2549 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ15 protein_id gnl|my_center|LOCUS_24350 4175 5092 gene locus_tag LOCUS_24360 gene lpxL 4175 5092 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_24360 5085 6590 gene locus_tag LOCUS_24370 5085 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 8358 6607 gene locus_tag LOCUS_24380 8358 6607 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 protein_id gnl|my_center|LOCUS_24380 9553 8387 gene locus_tag LOCUS_24390 gene waaG 9553 8387 CDS product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_24390 10620 9550 gene locus_tag LOCUS_24400 gene waaC 10620 9550 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_24400 <11417 10644 gene locus_tag LOCUS_24410 <11417 10644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266459.1:lipopolysaccharide heptosyltransferase II >Feature sequence127 1820 75 gene locus_tag LOCUS_24420 1820 75 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_24420 3303 1837 gene locus_tag LOCUS_24430 3303 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4152 3535 gene locus_tag LOCUS_24440 4152 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4596 7619 gene locus_tag LOCUS_24450 4596 7619 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_24450 7671 10136 gene locus_tag LOCUS_24460 7671 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_24460 <11372 10267 gene locus_tag LOCUS_24470 <11372 10267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640267.1:aminobenzoyl-glutamate utilization protein B >Feature sequence128 2508 1369 gene locus_tag LOCUS_24480 2508 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3395 2862 gene locus_tag LOCUS_24490 3395 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3746 4834 gene locus_tag LOCUS_24500 3746 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 6380 4941 gene locus_tag LOCUS_24510 6380 4941 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_24510 6508 6807 gene locus_tag LOCUS_24520 6508 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_24520 6794 7063 gene locus_tag LOCUS_24530 6794 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887084.1 protein_id gnl|my_center|LOCUS_24530 7581 7162 gene locus_tag LOCUS_24540 7581 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 9337 8447 gene locus_tag LOCUS_24550 9337 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 9688 9506 gene locus_tag LOCUS_24560 9688 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 9990 9697 gene locus_tag LOCUS_24570 9990 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 <11315 10158 gene locus_tag LOCUS_24580 <11315 10158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066386.1:IS5/IS1182 family transposase >Feature sequence129 3 779 gene locus_tag LOCUS_24590 3 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1703 846 gene locus_tag LOCUS_24600 1703 846 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_24600 2819 1731 gene locus_tag LOCUS_24610 gene ephA 2819 1731 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_24610 4661 2982 gene locus_tag LOCUS_24620 4661 2982 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_24620 4901 6781 gene locus_tag LOCUS_24630 4901 6781 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_24630 6878 7291 gene locus_tag LOCUS_24640 6878 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 7413 8393 gene locus_tag LOCUS_24650 7413 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 9435 8350 gene locus_tag LOCUS_24660 9435 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 10203 9451 gene locus_tag LOCUS_24670 10203 9451 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence130 <1 1046 gene locus_tag LOCUS_24680 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q500B0:ammonium transporter 1433 1200 gene locus_tag LOCUS_24690 1433 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2285 1839 gene locus_tag LOCUS_24700 2285 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3374 2289 gene locus_tag LOCUS_24710 3374 2289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_24710 4396 3434 gene locus_tag LOCUS_24720 4396 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4820 4389 gene locus_tag LOCUS_24730 4820 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5008 7068 gene locus_tag LOCUS_24740 gene nicT 5008 7068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_24740 7358 8668 gene locus_tag LOCUS_24750 gene rhlE 7358 8668 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV8 protein_id gnl|my_center|LOCUS_24750 8898 9629 gene locus_tag LOCUS_24760 8898 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_24760 10185 9634 gene locus_tag LOCUS_24770 10185 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 11115 10228 gene locus_tag LOCUS_24780 11115 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence131 2710 953 gene locus_tag LOCUS_24790 2710 953 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_24790 2982 4046 gene locus_tag LOCUS_24800 2982 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4147 4920 gene locus_tag LOCUS_24810 4147 4920 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_24810 5470 4928 gene locus_tag LOCUS_24820 5470 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6720 5527 gene locus_tag LOCUS_24830 6720 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_24830 8079 6886 gene locus_tag LOCUS_24840 8079 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_24840 8214 9608 gene locus_tag LOCUS_24850 8214 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence132 1194 901 gene locus_tag LOCUS_24860 gene higA 1194 901 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403401.1 protein_id gnl|my_center|LOCUS_24860 1475 1197 gene locus_tag LOCUS_24870 1475 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_24870 1985 1590 gene locus_tag LOCUS_24880 1985 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2113 2346 gene locus_tag LOCUS_24890 2113 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2667 3623 gene locus_tag LOCUS_24900 gene intI 2667 3623 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_24900 3718 4272 gene locus_tag LOCUS_24910 3718 4272 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_24910 4276 5643 gene locus_tag LOCUS_24920 4276 5643 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_24920 5666 6070 gene locus_tag LOCUS_24930 gene yciA 5666 6070 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_24930 7247 6138 gene locus_tag LOCUS_24940 7247 6138 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_24940 9471 7252 gene locus_tag LOCUS_24950 gene uvrD 9471 7252 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_24950 9577 10764 gene locus_tag LOCUS_24960 gene gcdH 9577 10764 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_24960 11070 10843 gene locus_tag LOCUS_24970 11070 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence133 1022 321 gene locus_tag LOCUS_24980 1022 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2098 1019 gene locus_tag LOCUS_24990 2098 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3135 2095 gene locus_tag LOCUS_25000 3135 2095 CDS product O-antigen-related glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525450.1 protein_id gnl|my_center|LOCUS_25000 4910 3132 gene locus_tag LOCUS_25010 4910 3132 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_25010 5930 5040 gene locus_tag LOCUS_25020 5930 5040 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_25020 6606 5998 gene locus_tag LOCUS_25030 6606 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8545 6776 gene locus_tag LOCUS_25040 gene nodU 8545 6776 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_25040 8862 8539 gene locus_tag LOCUS_25050 8862 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence134 232 1392 gene locus_tag LOCUS_25060 gene obg 232 1392 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_25060 1416 2531 gene locus_tag LOCUS_25070 gene proB 1416 2531 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_25070 2801 2535 gene locus_tag LOCUS_25080 gene rpsT 2801 2535 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_25080 2885 4459 gene locus_tag LOCUS_25090 gene murJ 2885 4459 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_25090 4501 5223 gene locus_tag LOCUS_25100 4501 5223 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_25100 5220 5972 gene locus_tag LOCUS_25110 5220 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 6019 7098 gene locus_tag LOCUS_25120 6019 7098 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_25120 7167 7607 gene locus_tag LOCUS_25130 7167 7607 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_25130 8798 7608 gene locus_tag LOCUS_25140 gene aspC 8798 7608 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_25140 9681 8803 gene locus_tag LOCUS_25150 gene folD 9681 8803 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_25150 10213 9794 gene locus_tag LOCUS_25160 10213 9794 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence135 1475 294 gene locus_tag LOCUS_25170 1475 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2664 1492 gene locus_tag LOCUS_25180 2664 1492 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_25180 3946 2681 gene locus_tag LOCUS_25190 3946 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4811 4074 gene locus_tag LOCUS_25200 4811 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 6358 4841 gene locus_tag LOCUS_25210 6358 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 6908 6432 gene locus_tag LOCUS_25220 6908 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 7311 8306 gene locus_tag LOCUS_25230 7311 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 8815 10233 gene locus_tag LOCUS_25240 8815 10233 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence136 <1 715 gene locus_tag LOCUS_25250 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2T9:Lon protease 899 1174 gene locus_tag LOCUS_25260 gene hupB 899 1174 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_25260 1287 3194 gene locus_tag LOCUS_25270 1287 3194 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_25270 3996 3208 gene locus_tag LOCUS_25280 3996 3208 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_25280 5531 4059 gene locus_tag LOCUS_25290 5531 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 7257 5647 gene locus_tag LOCUS_25300 7257 5647 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_25300 8058 7270 gene locus_tag LOCUS_25310 gene gloB 8058 7270 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_25310 8211 9002 gene locus_tag LOCUS_25320 8211 9002 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104690.1 protein_id gnl|my_center|LOCUS_25320 9020 9445 gene locus_tag LOCUS_25330 gene rnhA 9020 9445 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_25330 9475 10191 gene locus_tag LOCUS_25340 gene dnaQ 9475 10191 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence137 679 1422 gene locus_tag LOCUS_25350 679 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1796 3352 gene locus_tag LOCUS_25360 1796 3352 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_25360 3423 4838 gene locus_tag LOCUS_25370 gene ycbK 3423 4838 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905209.1 protein_id gnl|my_center|LOCUS_25370 4919 6118 gene locus_tag LOCUS_25380 4919 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 6143 7207 gene locus_tag LOCUS_25390 6143 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 8682 7237 gene locus_tag LOCUS_25400 8682 7237 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_25400 9101 8679 gene locus_tag LOCUS_25410 9101 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931865.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence138 656 1222 gene locus_tag LOCUS_25420 656 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1407 2420 gene locus_tag LOCUS_25430 1407 2420 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_25430 2490 3071 gene locus_tag LOCUS_25440 2490 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3083 3538 gene locus_tag LOCUS_25450 3083 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 4393 3569 gene locus_tag LOCUS_25460 4393 3569 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 protein_id gnl|my_center|LOCUS_25460 6583 4421 gene locus_tag LOCUS_25470 6583 4421 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_25470 6718 7092 gene locus_tag LOCUS_25480 6718 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 7951 7082 gene locus_tag LOCUS_25490 7951 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_25490 8060 9499 gene locus_tag LOCUS_25500 8060 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 9537 9815 gene locus_tag LOCUS_25510 9537 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 9837 10058 gene locus_tag LOCUS_25520 9837 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence139 2129 348 gene locus_tag LOCUS_25530 2129 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3932 2229 gene locus_tag LOCUS_25540 3932 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4577 4035 gene locus_tag LOCUS_25550 4577 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 7199 5250 gene locus_tag LOCUS_25560 7199 5250 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_25560 8560 7196 gene locus_tag LOCUS_25570 8560 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 9924 8722 gene locus_tag LOCUS_25580 9924 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence140 43 1458 gene locus_tag LOCUS_25590 43 1458 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_25590 1614 1489 gene locus_tag LOCUS_25600 1614 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2338 1631 gene locus_tag LOCUS_25610 2338 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_25610 2849 2310 gene locus_tag LOCUS_25620 2849 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_25620 3320 6454 gene locus_tag LOCUS_25630 3320 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 7366 6467 gene locus_tag LOCUS_25640 7366 6467 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_25640 7898 7359 gene locus_tag LOCUS_25650 7898 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106026.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 8004 8267 gene locus_tag LOCUS_25660 8004 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 8675 8505 gene locus_tag LOCUS_25670 8675 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 8962 8672 gene locus_tag LOCUS_25680 8962 8672 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_25680 9149 9817 gene locus_tag LOCUS_25690 9149 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence141 <1 897 gene locus_tag LOCUS_25700 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104475.1:lipoprotein 907 1893 gene locus_tag LOCUS_25710 907 1893 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_25710 1925 3367 gene locus_tag LOCUS_25720 1925 3367 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM77 protein_id gnl|my_center|LOCUS_25720 3373 4323 gene locus_tag LOCUS_25730 3373 4323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_25730 4327 5091 gene locus_tag LOCUS_25740 gene guaA 4327 5091 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_25740 5728 5024 gene locus_tag LOCUS_25750 5728 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 6627 5923 gene locus_tag LOCUS_25760 6627 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 7770 6718 gene locus_tag LOCUS_25770 7770 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 7946 8929 gene locus_tag LOCUS_25780 7946 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 8914 10053 gene locus_tag LOCUS_25790 8914 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence142 1927 551 gene locus_tag LOCUS_25800 1927 551 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_25800 3412 2006 gene locus_tag LOCUS_25810 3412 2006 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_25810 4462 3440 gene locus_tag LOCUS_25820 4462 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 6979 4544 gene locus_tag LOCUS_25830 6979 4544 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_25830 7382 7008 gene locus_tag LOCUS_25840 7382 7008 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 protein_id gnl|my_center|LOCUS_25840 8022 7369 gene locus_tag LOCUS_25850 gene nthB 8022 7369 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087268.1 protein_id gnl|my_center|LOCUS_25850 8687 8025 gene locus_tag LOCUS_25860 gene nthA 8687 8025 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_25860 9139 8687 gene locus_tag LOCUS_25870 9139 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 <9997 9362 gene locus_tag LOCUS_25880 <9997 9362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088423.1:histidine kinase >Feature sequence143 <1 568 gene locus_tag LOCUS_25890 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTI5:superoxide dismutase 2370 730 gene locus_tag LOCUS_25900 gene groL 2370 730 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_25900 2715 2425 gene locus_tag LOCUS_25910 gene groS 2715 2425 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X13 protein_id gnl|my_center|LOCUS_25910 3462 2962 gene locus_tag LOCUS_25920 gene fxsA 3462 2962 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_25920 3568 3846 gene locus_tag LOCUS_25930 3568 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5207 3843 gene locus_tag LOCUS_25940 5207 3843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250605.1 protein_id gnl|my_center|LOCUS_25940 5744 5259 gene locus_tag LOCUS_25950 5744 5259 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S5 protein_id gnl|my_center|LOCUS_25950 5887 6846 gene locus_tag LOCUS_25960 5887 6846 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_25960 6843 7610 gene locus_tag LOCUS_25970 6843 7610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_25970 9386 7623 gene locus_tag LOCUS_25980 gene aceF 9386 7623 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59638 protein_id gnl|my_center|LOCUS_25980 >Feature sequence144 <1 1250 gene locus_tag LOCUS_25990 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089359.1:MATE family efflux transporter 1436 2689 gene locus_tag LOCUS_26000 gene glyA 1436 2689 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_26000 2717 3178 gene locus_tag LOCUS_26010 gene nrdR 2717 3178 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_26010 3203 4363 gene locus_tag LOCUS_26020 3203 4363 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY0 protein_id gnl|my_center|LOCUS_26020 4365 5018 gene locus_tag LOCUS_26030 gene ribC 4365 5018 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_26030 5048 6157 gene locus_tag LOCUS_26040 gene ribB 5048 6157 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_26040 6178 6654 gene locus_tag LOCUS_26050 gene ribH1 6178 6654 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q6 protein_id gnl|my_center|LOCUS_26050 6655 7125 gene locus_tag LOCUS_26060 gene nusB 6655 7125 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_26060 7154 8194 gene locus_tag LOCUS_26070 gene thiL 7154 8194 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_26070 8191 8670 gene locus_tag LOCUS_26080 gene pgpA 8191 8670 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_26080 8701 9291 gene locus_tag LOCUS_26090 gene ribA 8701 9291 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY6 protein_id gnl|my_center|LOCUS_26090 >Feature sequence145 1758 40 gene locus_tag LOCUS_26100 gene nhaP2 1758 40 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N3Z7 protein_id gnl|my_center|LOCUS_26100 2680 1826 gene locus_tag LOCUS_26110 gene surE 2680 1826 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT6 protein_id gnl|my_center|LOCUS_26110 2802 3380 gene locus_tag LOCUS_26120 2802 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3539 3955 gene locus_tag LOCUS_26130 3539 3955 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762545.1 protein_id gnl|my_center|LOCUS_26130 3969 5138 gene locus_tag LOCUS_26140 gene liuA 3969 5138 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_26140 5154 6773 gene locus_tag LOCUS_26150 gene liuB 5154 6773 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_26150 7909 6791 gene locus_tag LOCUS_26160 gene ldh 7909 6791 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_26160 <9725 7915 gene locus_tag LOCUS_26170 <9725 7915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104408.1:indolepyruvate ferredoxin oxidoreductase >Feature sequence146 1690 815 gene locus_tag LOCUS_26180 1690 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1900 1712 gene locus_tag LOCUS_26190 1900 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2085 2609 gene locus_tag LOCUS_26200 2085 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2614 2748 gene locus_tag LOCUS_26210 2614 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2794 3675 gene locus_tag LOCUS_26220 gene ars 2794 3675 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_26220 4501 3743 gene locus_tag LOCUS_26230 4501 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4684 6873 gene locus_tag LOCUS_26240 gene katG 4684 6873 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_26240 7860 7069 gene locus_tag LOCUS_26250 7860 7069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070499.1 protein_id gnl|my_center|LOCUS_26250 8026 9159 gene locus_tag LOCUS_26260 8026 9159 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence147 829 200 gene locus_tag LOCUS_26270 gene ccmA 829 200 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_26270 1686 934 gene locus_tag LOCUS_26280 gene fliA 1686 934 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29248 protein_id gnl|my_center|LOCUS_26280 2031 2450 gene locus_tag LOCUS_26290 gene trxC 2031 2450 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_26290 2429 2887 gene locus_tag LOCUS_26300 2429 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384641.1 protein_id gnl|my_center|LOCUS_26300 3114 2914 gene locus_tag LOCUS_26310 3114 2914 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_26310 4593 3349 gene locus_tag LOCUS_26320 4593 3349 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_26320 4990 4586 gene locus_tag LOCUS_26330 4990 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 5616 4987 gene locus_tag LOCUS_26340 5616 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 6236 5643 gene locus_tag LOCUS_26350 gene dcd 6236 5643 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC9 protein_id gnl|my_center|LOCUS_26350 7054 7221 gene locus_tag LOCUS_26360 gene rubA2 7054 7221 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_26360 7230 9308 gene locus_tag LOCUS_26370 gene metG 7230 9308 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_26370 >Feature sequence148 614 177 gene locus_tag LOCUS_26380 614 177 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_26380 736 1839 gene locus_tag LOCUS_26390 736 1839 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 protein_id gnl|my_center|LOCUS_26390 1891 3435 gene locus_tag LOCUS_26400 1891 3435 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 protein_id gnl|my_center|LOCUS_26400 3550 3957 gene locus_tag LOCUS_26410 3550 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5258 3978 gene locus_tag LOCUS_26420 5258 3978 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706422.1 protein_id gnl|my_center|LOCUS_26420 6615 5401 gene locus_tag LOCUS_26430 6615 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence149 4021 3083 gene locus_tag LOCUS_26440 4021 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 5288 4035 gene locus_tag LOCUS_26450 5288 4035 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_26450 5771 5367 gene locus_tag LOCUS_26460 5771 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 6195 6662 gene locus_tag LOCUS_26470 6195 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6742 8052 gene locus_tag LOCUS_26480 6742 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence150 53 895 gene locus_tag LOCUS_26490 53 895 CDS product RIO1 family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211044.1 protein_id gnl|my_center|LOCUS_26490 957 1295 gene locus_tag LOCUS_26500 957 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2854 1382 gene locus_tag LOCUS_26510 2854 1382 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112664.1 protein_id gnl|my_center|LOCUS_26510 3959 2931 gene locus_tag LOCUS_26520 3959 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5194 4022 gene locus_tag LOCUS_26530 5194 4022 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085563.1 protein_id gnl|my_center|LOCUS_26530 5514 6029 gene locus_tag LOCUS_26540 5514 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 6672 6088 gene locus_tag LOCUS_26550 gene yaeQ 6672 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261749.1 protein_id gnl|my_center|LOCUS_26550 6797 9133 gene locus_tag LOCUS_26560 6797 9133 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence151 6 2966 gene locus_tag LOCUS_26570 6 2966 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 protein_id gnl|my_center|LOCUS_26570 3539 3021 gene locus_tag LOCUS_26580 3539 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 6049 3644 gene locus_tag LOCUS_26590 gene xdhA 6049 3644 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861444.1 protein_id gnl|my_center|LOCUS_26590 6712 6801 gene locus_tag LOCUS_t00210 6712 6801 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6834 6909 gene locus_tag LOCUS_t00220 6834 6909 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6940 8079 gene locus_tag LOCUS_26600 6940 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 protein_id gnl|my_center|LOCUS_26600 8138 8680 gene locus_tag LOCUS_26610 8138 8680 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191124.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence152 1242 265 gene locus_tag LOCUS_26620 1242 265 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_26620 3120 1318 gene locus_tag LOCUS_26630 3120 1318 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_26630 4587 3157 gene locus_tag LOCUS_26640 4587 3157 CDS product pyruvate carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_26640 4914 5234 gene locus_tag LOCUS_26650 4914 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5279 6244 gene locus_tag LOCUS_26660 5279 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084186.1 protein_id gnl|my_center|LOCUS_26660 6617 6264 gene locus_tag LOCUS_26670 6617 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 7328 6732 gene locus_tag LOCUS_26680 7328 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 8898 7699 gene locus_tag LOCUS_26690 8898 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26690 >Feature sequence153 708 424 gene locus_tag LOCUS_26700 708 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2602 884 gene locus_tag LOCUS_26710 2602 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2995 2693 gene locus_tag LOCUS_26720 2995 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2994 4094 gene locus_tag LOCUS_26730 2994 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26730 5986 4091 gene locus_tag LOCUS_26740 5986 4091 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_26740 7221 6031 gene locus_tag LOCUS_26750 7221 6031 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_26750 7370 7606 gene locus_tag LOCUS_26760 7370 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 8146 7505 gene locus_tag LOCUS_26770 8146 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 <8947 8143 gene locus_tag LOCUS_26780 <8947 8143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947761.1:ABC transporter substrate-binding protein >Feature sequence154 334 951 gene locus_tag LOCUS_26790 gene rplD 334 951 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY5 protein_id gnl|my_center|LOCUS_26790 948 1247 gene locus_tag LOCUS_26800 gene rplW 948 1247 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_26800 1262 2092 gene locus_tag LOCUS_26810 gene rplB 1262 2092 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W8 protein_id gnl|my_center|LOCUS_26810 2162 2389 gene locus_tag LOCUS_26820 gene rpsS 2162 2389 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_26820 2409 2747 gene locus_tag LOCUS_26830 gene rplV 2409 2747 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_26830 2752 3420 gene locus_tag LOCUS_26840 gene rpsC 2752 3420 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_26840 3433 3846 gene locus_tag LOCUS_26850 gene rplP 3433 3846 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_26850 3846 4043 gene locus_tag LOCUS_26860 gene rpmC 3846 4043 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE3 protein_id gnl|my_center|LOCUS_26860 4046 4318 gene locus_tag LOCUS_26870 gene rpsQ 4046 4318 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_26870 4322 4690 gene locus_tag LOCUS_26880 gene rplN 4322 4690 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE5 protein_id gnl|my_center|LOCUS_26880 4733 5047 gene locus_tag LOCUS_26890 gene rplX 4733 5047 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE6 protein_id gnl|my_center|LOCUS_26890 5082 5660 gene locus_tag LOCUS_26900 gene rplE 5082 5660 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJA0 protein_id gnl|my_center|LOCUS_26900 5653 5958 gene locus_tag LOCUS_26910 gene rpsN 5653 5958 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV5 protein_id gnl|my_center|LOCUS_26910 5973 6368 gene locus_tag LOCUS_26920 gene rpsH 5973 6368 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_26920 6407 6940 gene locus_tag LOCUS_26930 gene rplF 6407 6940 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_26930 6952 7302 gene locus_tag LOCUS_26940 gene rplR 6952 7302 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_26940 7313 7822 gene locus_tag LOCUS_26950 gene rpsE 7313 7822 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_26950 7826 8023 gene locus_tag LOCUS_26960 gene rpmD 7826 8023 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ8 protein_id gnl|my_center|LOCUS_26960 8065 8577 gene locus_tag LOCUS_26970 gene rplO 8065 8577 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ4 protein_id gnl|my_center|LOCUS_26970 >Feature sequence155 1510 467 gene locus_tag LOCUS_26980 gene msrP 1510 467 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_26980 2438 1563 gene locus_tag LOCUS_26990 gene pssA 2438 1563 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_26990 3414 2515 gene locus_tag LOCUS_27000 gene ilvY 3414 2515 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_27000 3566 5035 gene locus_tag LOCUS_27010 gene ilvC 3566 5035 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENF6 protein_id gnl|my_center|LOCUS_27010 5596 5105 gene locus_tag LOCUS_27020 gene ilvH 5596 5105 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_27020 7331 5598 gene locus_tag LOCUS_27030 gene ilvI 7331 5598 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_27030 <8892 7699 gene locus_tag LOCUS_27040 <8892 7699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVN5:chaperone protein ClpB >Feature sequence156 368 775 gene locus_tag LOCUS_27050 368 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 772 1293 gene locus_tag LOCUS_27060 772 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1518 2015 gene locus_tag LOCUS_27070 1518 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_27070 2125 3306 gene locus_tag LOCUS_27080 2125 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_27080 3313 3609 gene locus_tag LOCUS_27090 3313 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_27090 3744 5459 gene locus_tag LOCUS_27100 3744 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5663 5980 gene locus_tag LOCUS_27110 5663 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 6022 6897 gene locus_tag LOCUS_27120 6022 6897 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110291.1 protein_id gnl|my_center|LOCUS_27120 <8836 6972 gene locus_tag LOCUS_27130 <8836 6972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7H2:elongation factor G 2 >Feature sequence157 108 446 gene locus_tag LOCUS_27140 108 446 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706716.1 protein_id gnl|my_center|LOCUS_27140 678 1121 gene locus_tag LOCUS_27150 678 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2911 1415 gene locus_tag LOCUS_27160 2911 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3653 2913 gene locus_tag LOCUS_27170 3653 2913 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_27170 3903 3712 gene locus_tag LOCUS_27180 3903 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 4065 4670 gene locus_tag LOCUS_27190 4065 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4799 5245 gene locus_tag LOCUS_27200 4799 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_27200 5699 5331 gene locus_tag LOCUS_27210 5699 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 6107 5700 gene locus_tag LOCUS_27220 6107 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5994 7199 gene locus_tag LOCUS_27230 5994 7199 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence158 1831 1256 gene locus_tag LOCUS_27240 1831 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2448 1831 gene locus_tag LOCUS_27250 2448 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2978 2454 gene locus_tag LOCUS_27260 2978 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 4122 2986 gene locus_tag LOCUS_27270 4122 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 6516 4501 gene locus_tag LOCUS_27280 6516 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 7592 6513 gene locus_tag LOCUS_27290 7592 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence159 1114 290 gene locus_tag LOCUS_27300 1114 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1379 3628 gene locus_tag LOCUS_27310 1379 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3637 4218 gene locus_tag LOCUS_27320 3637 4218 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 protein_id gnl|my_center|LOCUS_27320 4399 8139 gene locus_tag LOCUS_27330 4399 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence160 2192 984 gene locus_tag LOCUS_27340 2192 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3290 2232 gene locus_tag LOCUS_27350 3290 2232 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_27350 3722 3330 gene locus_tag LOCUS_27360 3722 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4499 3732 gene locus_tag LOCUS_27370 4499 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 5527 4556 gene locus_tag LOCUS_27380 5527 4556 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_27380 7976 5553 gene locus_tag LOCUS_27390 7976 5553 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_27390 <8546 7982 gene locus_tag LOCUS_27400 <8546 7982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267644.1:xanthine dehydrogenase >Feature sequence161 <1 1215 gene locus_tag LOCUS_27410 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump 1344 1520 gene locus_tag LOCUS_27420 1344 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2861 1824 gene locus_tag LOCUS_27430 gene ddlA 2861 1824 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_27430 3895 2858 gene locus_tag LOCUS_27440 3895 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_27440 5973 3961 gene locus_tag LOCUS_27450 gene nicT 5973 3961 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_27450 7936 6101 gene locus_tag LOCUS_27460 gene ggtB 7936 6101 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence162 2136 1117 gene locus_tag LOCUS_27470 2136 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2433 3281 gene locus_tag LOCUS_27480 2433 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4206 3343 gene locus_tag LOCUS_27490 4206 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 5691 4330 gene locus_tag LOCUS_27500 5691 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6140 7279 gene locus_tag LOCUS_27510 6140 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 7293 8060 gene locus_tag LOCUS_27520 7293 8060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence163 4682 2664 gene locus_tag LOCUS_27530 gene uvrB 4682 2664 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_27530 4746 4820 gene locus_tag LOCUS_t00230 4746 4820 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4918 5133 gene locus_tag LOCUS_27540 4918 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 5219 5779 gene locus_tag LOCUS_27550 5219 5779 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER6 protein_id gnl|my_center|LOCUS_27550 7746 5776 gene locus_tag LOCUS_27560 gene wbfY 7746 5776 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_27560 <8473 7743 gene locus_tag LOCUS_27570 <8473 7743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268559.1:glycosyl transferase >Feature sequence164 <1 1222 gene locus_tag LOCUS_27580 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMG0:serine--tRNA ligase 1227 2636 gene locus_tag LOCUS_27590 gene cysG 1227 2636 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_27590 2968 2633 gene locus_tag LOCUS_27600 2968 2633 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_27600 3244 2975 gene locus_tag LOCUS_27610 3244 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090391.1 protein_id gnl|my_center|LOCUS_27610 3609 3241 gene locus_tag LOCUS_27620 gene tusC 3609 3241 CDS product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57194 protein_id gnl|my_center|LOCUS_27620 4004 3615 gene locus_tag LOCUS_27630 4004 3615 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767378.1 protein_id gnl|my_center|LOCUS_27630 4772 4092 gene locus_tag LOCUS_27640 4772 4092 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_27640 4930 5019 gene locus_tag LOCUS_t00240 4930 5019 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7262 5106 gene locus_tag LOCUS_27650 gene prc 7262 5106 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_27650 <8422 7511 gene locus_tag LOCUS_27660 <8422 7511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_819027.1:phage integrase family site specific recombinase >Feature sequence165 1531 3117 gene locus_tag LOCUS_27670 1531 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3186 4277 gene locus_tag LOCUS_27680 gene hemH 3186 4277 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_27680 5623 4238 gene locus_tag LOCUS_27690 5623 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_27690 6908 5946 gene locus_tag LOCUS_27700 6908 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706538.1 protein_id gnl|my_center|LOCUS_27700 <8319 6943 gene locus_tag LOCUS_27710 <8319 6943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083168.1:carbon monoxide dehydrogenase >Feature sequence166 265 89 gene locus_tag LOCUS_27720 265 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 419 976 gene locus_tag LOCUS_27730 419 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 969 1367 gene locus_tag LOCUS_27740 969 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1979 1383 gene locus_tag LOCUS_27750 gene clpP 1979 1383 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG69 protein_id gnl|my_center|LOCUS_27750 2443 2006 gene locus_tag LOCUS_27760 2443 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 5050 2552 gene locus_tag LOCUS_27770 5050 2552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_27770 6201 5194 gene locus_tag LOCUS_27780 6201 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 6566 7162 gene locus_tag LOCUS_27790 6566 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 8070 7300 gene locus_tag LOCUS_27800 gene fpr 8070 7300 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence167 633 1937 gene locus_tag LOCUS_27810 633 1937 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_27810 2474 1926 gene locus_tag LOCUS_27820 2474 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_27820 2711 3826 gene locus_tag LOCUS_27830 2711 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3833 4840 gene locus_tag LOCUS_27840 3833 4840 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_27840 6203 4851 gene locus_tag LOCUS_27850 6203 4851 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_27850 7208 6213 gene locus_tag LOCUS_27860 gene galE 7208 6213 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_27860 <8277 7205 gene locus_tag LOCUS_27870 <8277 7205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073077.1:UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA >Feature sequence168 491 2113 gene locus_tag LOCUS_27880 gene pilS 491 2113 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_27880 2149 3537 gene locus_tag LOCUS_27890 gene pilR 2149 3537 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_27890 4650 3514 gene locus_tag LOCUS_27900 4650 3514 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_27900 4785 5297 gene locus_tag LOCUS_27910 gene fimT 4785 5297 CDS product type 4 fimbrial biogenesis protein FimT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112829.1 protein_id gnl|my_center|LOCUS_27910 5722 5294 gene locus_tag LOCUS_27920 gene pilE 5722 5294 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_27920 6093 5746 gene locus_tag LOCUS_27930 6093 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 8189 6126 gene locus_tag LOCUS_27940 8189 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence169 1075 209 gene locus_tag LOCUS_27950 1075 209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704336.1 protein_id gnl|my_center|LOCUS_27950 1218 1655 gene locus_tag LOCUS_27960 1218 1655 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_27960 1675 2124 gene locus_tag LOCUS_27970 1675 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2144 3136 gene locus_tag LOCUS_27980 2144 3136 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 protein_id gnl|my_center|LOCUS_27980 5062 3335 gene locus_tag LOCUS_27990 5062 3335 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_27990 5978 6139 gene locus_tag LOCUS_28000 5978 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6144 6620 gene locus_tag LOCUS_28010 6144 6620 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_28010 6620 6907 gene locus_tag LOCUS_28020 6620 6907 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_28020 6904 7263 gene locus_tag LOCUS_28030 6904 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence170 <1 2136 gene locus_tag LOCUS_28040 <1 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958091.1:ATP-dependent helicase 2704 2144 gene locus_tag LOCUS_28050 2704 2144 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_28050 3765 2701 gene locus_tag LOCUS_28060 3765 2701 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_28060 4755 3781 gene locus_tag LOCUS_28070 gene nagZ 4755 3781 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC2 protein_id gnl|my_center|LOCUS_28070 4942 5262 gene locus_tag LOCUS_28080 4942 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 5377 5985 gene locus_tag LOCUS_28090 gene lexA 5377 5985 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_28090 <8121 6040 gene locus_tag LOCUS_28100 <8121 6040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZJ5:DNA topoisomerase 1 >Feature sequence171 1 222 gene locus_tag LOCUS_28110 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 425 231 gene locus_tag LOCUS_28120 gene infA 425 231 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_28120 1242 523 gene locus_tag LOCUS_28130 gene ate 1242 523 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_28130 1948 1232 gene locus_tag LOCUS_28140 gene aat 1948 1232 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_28140 2919 1972 gene locus_tag LOCUS_28150 gene trxB1 2919 1972 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM6 protein_id gnl|my_center|LOCUS_28150 3160 5475 gene locus_tag LOCUS_28160 gene ftsK 3160 5475 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 protein_id gnl|my_center|LOCUS_28160 5502 6164 gene locus_tag LOCUS_28170 gene lolA 5502 6164 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U0 protein_id gnl|my_center|LOCUS_28170 6349 7557 gene locus_tag LOCUS_28180 6349 7557 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_28180 7557 7937 gene locus_tag LOCUS_28190 gene crcB 7557 7937 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U893 protein_id gnl|my_center|LOCUS_28190 >Feature sequence172 175 1011 gene locus_tag LOCUS_28200 175 1011 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 protein_id gnl|my_center|LOCUS_28200 1756 998 gene locus_tag LOCUS_28210 1756 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2041 1820 gene locus_tag LOCUS_28220 2041 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2738 2115 gene locus_tag LOCUS_28230 2738 2115 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_28230 4180 2738 gene locus_tag LOCUS_28240 gene mpl 4180 2738 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M0 protein_id gnl|my_center|LOCUS_28240 4787 4218 gene locus_tag LOCUS_28250 gene ubiX 4787 4218 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 protein_id gnl|my_center|LOCUS_28250 4942 6201 gene locus_tag LOCUS_28260 gene pfp 4942 6201 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_28260 6840 6202 gene locus_tag LOCUS_28270 gene pdxH 6840 6202 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FE9 protein_id gnl|my_center|LOCUS_28270 7481 6873 gene locus_tag LOCUS_28280 7481 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence173 565 972 gene locus_tag LOCUS_28290 gene fliS 565 972 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3P3 protein_id gnl|my_center|LOCUS_28290 1127 2266 gene locus_tag LOCUS_28300 1127 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2631 3689 gene locus_tag LOCUS_28310 2631 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3677 4042 gene locus_tag LOCUS_28320 gene fliE 3677 4042 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUN2 protein_id gnl|my_center|LOCUS_28320 4062 5855 gene locus_tag LOCUS_28330 gene fliF1 4062 5855 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V7 protein_id gnl|my_center|LOCUS_28330 5875 6945 gene locus_tag LOCUS_28340 gene fliG 5875 6945 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V6 protein_id gnl|my_center|LOCUS_28340 6938 7795 gene locus_tag LOCUS_28350 6938 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence174 1027 188 gene locus_tag LOCUS_28360 1027 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1754 1032 gene locus_tag LOCUS_28370 1754 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 5446 1820 gene locus_tag LOCUS_28380 5446 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 6513 5932 gene locus_tag LOCUS_28390 6513 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 7224 6658 gene locus_tag LOCUS_28400 7224 6658 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NM1 protein_id gnl|my_center|LOCUS_28400 <7909 7254 gene locus_tag LOCUS_28410 <7909 7254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256013.1:Xaa-Pro aminopeptidase >Feature sequence175 2142 1345 gene locus_tag LOCUS_28420 2142 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2361 3638 gene locus_tag LOCUS_28430 2361 3638 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_28430 3950 3615 gene locus_tag LOCUS_28440 3950 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4637 3984 gene locus_tag LOCUS_28450 4637 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 4727 5989 gene locus_tag LOCUS_28460 4727 5989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083838.1 protein_id gnl|my_center|LOCUS_28460 5982 6224 gene locus_tag LOCUS_28470 gene slyX 5982 6224 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 protein_id gnl|my_center|LOCUS_28470 6420 7364 gene locus_tag LOCUS_28480 6420 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence176 1218 961 gene locus_tag LOCUS_28490 1218 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3140 1218 gene locus_tag LOCUS_28500 gene parE 3140 1218 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_28500 3803 3198 gene locus_tag LOCUS_28510 3803 3198 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 protein_id gnl|my_center|LOCUS_28510 4618 3800 gene locus_tag LOCUS_28520 gene cpdA 4618 3800 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH1 protein_id gnl|my_center|LOCUS_28520 5109 4633 gene locus_tag LOCUS_28530 5109 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377111.1 protein_id gnl|my_center|LOCUS_28530 6296 5220 gene locus_tag LOCUS_28540 6296 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 6487 7050 gene locus_tag LOCUS_28550 6487 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_28550 <7907 7054 gene locus_tag LOCUS_28560 <7907 7054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072224.1:proteobacterial dedicated sortase system histidine kinase >Feature sequence177 <1 1411 gene locus_tag LOCUS_28570 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039506.1:ATP-dependent helicase 1505 2209 gene locus_tag LOCUS_28580 1505 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_28580 2686 2210 gene locus_tag LOCUS_28590 2686 2210 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_28590 3665 2736 gene locus_tag LOCUS_28600 gene dusA 3665 2736 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_28600 3844 5379 gene locus_tag LOCUS_28610 gene gltX 3844 5379 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_28610 5395 5470 gene locus_tag LOCUS_t00250 5395 5470 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6764 5487 gene locus_tag LOCUS_28620 gene gltA 6764 5487 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_28620 7249 7623 gene locus_tag LOCUS_28630 7249 7623 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence178 819 133 gene locus_tag LOCUS_28640 819 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2244 838 gene locus_tag LOCUS_28650 2244 838 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_28650 3344 2232 gene locus_tag LOCUS_28660 3344 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 4255 3329 gene locus_tag LOCUS_28670 4255 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 5588 4263 gene locus_tag LOCUS_28680 5588 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 6961 5585 gene locus_tag LOCUS_28690 6961 5585 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_28690 7037 7633 gene locus_tag LOCUS_28700 7037 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence179 295 2781 gene locus_tag LOCUS_28710 gene glgP 295 2781 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_28710 2789 4054 gene locus_tag LOCUS_28720 gene glgC 2789 4054 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_28720 4060 5610 gene locus_tag LOCUS_28730 gene glgA 4060 5610 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_28730 6252 5611 gene locus_tag LOCUS_28740 6252 5611 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_28740 <7733 6249 gene locus_tag LOCUS_28750 <7733 6249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P31961:phosphogluconate dehydratase >Feature sequence180 1064 420 gene locus_tag LOCUS_28760 gene hflD 1064 420 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44796 protein_id gnl|my_center|LOCUS_28760 2136 1075 gene locus_tag LOCUS_28770 gene mnmA 2136 1075 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFQ5 protein_id gnl|my_center|LOCUS_28770 2656 2198 gene locus_tag LOCUS_28780 2656 2198 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_28780 2788 3267 gene locus_tag LOCUS_28790 gene moaC 2788 3267 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_28790 3203 3526 gene locus_tag LOCUS_28800 gene moaD 3203 3526 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_28800 3535 4014 gene locus_tag LOCUS_28810 gene moaE 3535 4014 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 protein_id gnl|my_center|LOCUS_28810 4518 4033 gene locus_tag LOCUS_28820 4518 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 4990 4703 gene locus_tag LOCUS_28830 4990 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 5226 5558 gene locus_tag LOCUS_28840 gene clpS 5226 5558 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS0 protein_id gnl|my_center|LOCUS_28840 >Feature sequence181 2046 4907 gene locus_tag LOCUS_28850 2046 4907 CDS product TonB system transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266217.1 protein_id gnl|my_center|LOCUS_28850 5020 6108 gene locus_tag LOCUS_28860 5020 6108 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_28860 6503 6150 gene locus_tag LOCUS_28870 gene gfaB 6503 6150 CDS product glutathione-dependent formaldehyde-activating enzyme GfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070494.1 protein_id gnl|my_center|LOCUS_28870 7160 6543 gene locus_tag LOCUS_28880 7160 6543 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_28880 7432 7160 gene locus_tag LOCUS_28890 7432 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence182 135 50 gene locus_tag LOCUS_t00260 135 50 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 558 166 gene locus_tag LOCUS_28900 gene secG 558 166 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_28900 1319 564 gene locus_tag LOCUS_28910 gene tpiA 1319 564 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLD8 protein_id gnl|my_center|LOCUS_28910 2782 1430 gene locus_tag LOCUS_28920 gene glmM 2782 1430 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_28920 3653 2790 gene locus_tag LOCUS_28930 gene folP 3653 2790 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_28930 5620 3689 gene locus_tag LOCUS_28940 gene ftsH 5620 3689 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_28940 6332 5706 gene locus_tag LOCUS_28950 gene rlmE 6332 5706 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM3 protein_id gnl|my_center|LOCUS_28950 6408 6731 gene locus_tag LOCUS_28960 6408 6731 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377487.1 protein_id gnl|my_center|LOCUS_28960 7241 6747 gene locus_tag LOCUS_28970 gene greB 7241 6747 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence183 1188 328 gene locus_tag LOCUS_28980 1188 328 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_28980 1417 2892 gene locus_tag LOCUS_28990 gene Ada 1417 2892 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_28990 2889 3386 gene locus_tag LOCUS_29000 2889 3386 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_29000 4083 3445 gene locus_tag LOCUS_29010 4083 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 4492 5895 gene locus_tag LOCUS_29020 4492 5895 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_29020 5965 6903 gene locus_tag LOCUS_29030 5965 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence184 <1 903 gene locus_tag LOCUS_29040 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807546.1:CoA transferase 2336 927 gene locus_tag LOCUS_29050 2336 927 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_29050 3040 2453 gene locus_tag LOCUS_29060 3040 2453 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM43 protein_id gnl|my_center|LOCUS_29060 3103 4479 gene locus_tag LOCUS_29070 3103 4479 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_29070 4476 5318 gene locus_tag LOCUS_29080 4476 5318 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829328.1 protein_id gnl|my_center|LOCUS_29080 5346 5948 gene locus_tag LOCUS_29090 5346 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 6183 7169 gene locus_tag LOCUS_29100 6183 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence185 152 976 gene locus_tag LOCUS_29110 152 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1175 2557 gene locus_tag LOCUS_29120 1175 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3896 2739 gene locus_tag LOCUS_29130 3896 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 4816 4016 gene locus_tag LOCUS_29140 gene yhiR 4816 4016 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MLW8 protein_id gnl|my_center|LOCUS_29140 5173 4820 gene locus_tag LOCUS_29150 5173 4820 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_29150 6051 5173 gene locus_tag LOCUS_29160 6051 5173 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 protein_id gnl|my_center|LOCUS_29160 6265 7074 gene locus_tag LOCUS_29170 6265 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 7276 7031 gene locus_tag LOCUS_29180 7276 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence186 217 1809 gene locus_tag LOCUS_29190 217 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1954 3258 gene locus_tag LOCUS_29200 1954 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3312 3785 gene locus_tag LOCUS_29210 3312 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089069.1 protein_id gnl|my_center|LOCUS_29210 4726 3833 gene locus_tag LOCUS_29220 4726 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5523 4750 gene locus_tag LOCUS_29230 5523 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 5716 6660 gene locus_tag LOCUS_29240 5716 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 <7296 6758 gene locus_tag LOCUS_29250 <7296 6758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776999.1:glutamine amidotransferase >Feature sequence187 2525 48 gene locus_tag LOCUS_29260 2525 48 CDS product general secretory pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_29260 3448 2561 gene locus_tag LOCUS_29270 3448 2561 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192732.1 protein_id gnl|my_center|LOCUS_29270 4647 3460 gene locus_tag LOCUS_29280 gene agxT 4647 3460 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_29280 5183 4785 gene locus_tag LOCUS_29290 gene rplQ 5183 4785 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_29290 6228 5230 gene locus_tag LOCUS_29300 gene rpoA 6228 5230 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_29300 6880 6260 gene locus_tag LOCUS_29310 gene rpsD 6880 6260 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_29310 7257 6913 gene locus_tag LOCUS_29320 gene rpsK 7257 6913 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR6 protein_id gnl|my_center|LOCUS_29320 >Feature sequence188 1508 420 gene locus_tag LOCUS_29330 1508 420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_29330 2279 1515 gene locus_tag LOCUS_29340 2279 1515 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030256.1 protein_id gnl|my_center|LOCUS_29340 2605 2330 gene locus_tag LOCUS_29350 2605 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3242 2826 gene locus_tag LOCUS_29360 3242 2826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_29360 5243 3252 gene locus_tag LOCUS_29370 gene gcd-1 5243 3252 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_29370 6498 5350 gene locus_tag LOCUS_29380 6498 5350 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence189 355 280 gene locus_tag LOCUS_t00270 355 280 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 444 371 gene locus_tag LOCUS_t00280 444 371 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 559 476 gene locus_tag LOCUS_t00290 559 476 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1306 614 gene locus_tag LOCUS_29390 1306 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2062 1328 gene locus_tag LOCUS_29400 gene coaX 2062 1328 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_29400 2895 2059 gene locus_tag LOCUS_29410 gene birA 2895 2059 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_29410 4752 3043 gene locus_tag LOCUS_29420 gene cstA 4752 3043 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_29420 6564 4873 gene locus_tag LOCUS_29430 6564 4873 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_29430 <7178 6639 gene locus_tag LOCUS_29440 <7178 6639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence190 3 224 gene locus_tag LOCUS_29450 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1211 267 gene locus_tag LOCUS_29460 1211 267 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_29460 1603 1208 gene locus_tag LOCUS_29470 1603 1208 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_29470 1891 3549 gene locus_tag LOCUS_29480 1891 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3708 5246 gene locus_tag LOCUS_29490 3708 5246 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_29490 5689 5450 gene locus_tag LOCUS_29500 5689 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6460 6134 gene locus_tag LOCUS_29510 6460 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 6665 6444 gene locus_tag LOCUS_29520 6665 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence191 1467 487 gene locus_tag LOCUS_29530 gene dhaA 1467 487 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XB14 protein_id gnl|my_center|LOCUS_29530 2562 1627 gene locus_tag LOCUS_29540 2562 1627 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_29540 2785 2597 gene locus_tag LOCUS_29550 2785 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2929 4131 gene locus_tag LOCUS_29560 2929 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 4190 5092 gene locus_tag LOCUS_29570 4190 5092 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_29570 5307 5597 gene locus_tag LOCUS_29580 5307 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 6488 5634 gene locus_tag LOCUS_29590 6488 5634 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence192 <1 1361 gene locus_tag LOCUS_29600 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MJQ8:error-prone DNA polymerase 1813 1427 gene locus_tag LOCUS_29610 1813 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2430 2735 gene locus_tag LOCUS_29620 2430 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3647 2748 gene locus_tag LOCUS_29630 3647 2748 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_29630 3758 4450 gene locus_tag LOCUS_29640 3758 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03268 protein_id gnl|my_center|LOCUS_29640 5161 4784 gene locus_tag LOCUS_29650 5161 4784 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence193 833 1450 gene locus_tag LOCUS_29660 833 1450 CDS product protein hupE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066513.1 protein_id gnl|my_center|LOCUS_29660 1447 2064 gene locus_tag LOCUS_29670 1447 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2329 3321 gene locus_tag LOCUS_29680 2329 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3346 6171 gene locus_tag LOCUS_29690 3346 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence194 1875 85 gene locus_tag LOCUS_29700 gene coxN 1875 85 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH24 protein_id gnl|my_center|LOCUS_29700 3334 1973 gene locus_tag LOCUS_29710 3334 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3941 4867 gene locus_tag LOCUS_29720 gene cyoE1 3941 4867 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_29720 4880 5530 gene locus_tag LOCUS_29730 4880 5530 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_29730 6326 5535 gene locus_tag LOCUS_29740 6326 5535 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341611.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence195 2030 198 gene locus_tag LOCUS_29750 gene glmS 2030 198 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT25 protein_id gnl|my_center|LOCUS_29750 3454 2069 gene locus_tag LOCUS_29760 gene glmU 3454 2069 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_29760 3954 3553 gene locus_tag LOCUS_29770 gene atpC 3954 3553 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_29770 5435 4029 gene locus_tag LOCUS_29780 gene atpD 5435 4029 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_29780 6359 5496 gene locus_tag LOCUS_29790 gene atpG 6359 5496 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_29790 >Feature sequence196 1301 375 gene locus_tag LOCUS_29800 gene truB 1301 375 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XV95 protein_id gnl|my_center|LOCUS_29800 1722 1303 gene locus_tag LOCUS_29810 gene rbfA 1722 1303 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_29810 4295 1749 gene locus_tag LOCUS_29820 gene infB 4295 1749 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_29820 5801 4335 gene locus_tag LOCUS_29830 gene nusA 5801 4335 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_29830 6324 5875 gene locus_tag LOCUS_29840 gene rimP 6324 5875 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_29840 6502 6426 gene locus_tag LOCUS_t00300 6502 6426 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence197 2143 71 gene locus_tag LOCUS_29850 2143 71 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_29850 2244 2169 gene locus_tag LOCUS_t00310 2244 2169 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2371 2760 gene locus_tag LOCUS_29860 2371 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2876 3817 gene locus_tag LOCUS_29870 2876 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3865 4464 gene locus_tag LOCUS_29880 3865 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 4461 4886 gene locus_tag LOCUS_29890 4461 4886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975863.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence198 1517 267 gene locus_tag LOCUS_29900 gene tyrS 1517 267 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_29900 1684 3090 gene locus_tag LOCUS_29910 1684 3090 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_29910 3103 4212 gene locus_tag LOCUS_29920 gene anmK 3103 4212 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_29920 4591 4238 gene locus_tag LOCUS_29930 gene erpA 4591 4238 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_29930 5135 4698 gene locus_tag LOCUS_29940 5135 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 5913 5167 gene locus_tag LOCUS_29950 5913 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 <6607 5944 gene locus_tag LOCUS_29960 <6607 5944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5Q9:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence199 <1 1669 gene locus_tag LOCUS_29970 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0A4:phenylalanine--tRNA ligase beta subunit 1684 1995 gene locus_tag LOCUS_29980 gene ihfA 1684 1995 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_29980 1973 2323 gene locus_tag LOCUS_29990 1973 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_29990 2408 2484 gene locus_tag LOCUS_t00320 2408 2484 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3604 2759 gene locus_tag LOCUS_30000 3604 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4759 3767 gene locus_tag LOCUS_30010 gene fabH 4759 3767 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_30010 4952 5308 gene locus_tag LOCUS_30020 4952 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 5605 5985 gene locus_tag LOCUS_30030 5605 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 <6595 5994 gene locus_tag LOCUS_30040 <6595 5994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919707.1:alpha-methylacyl-CoA racemase >Feature sequence200 4439 6271 gene locus_tag LOCUS_30050 4439 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence201 1424 2563 gene locus_tag LOCUS_30060 1424 2563 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_30060 2568 3632 gene locus_tag LOCUS_30070 gene queG 2568 3632 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_30070 4221 3679 gene locus_tag LOCUS_30080 gene orn 4221 3679 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_30080 4333 5340 gene locus_tag LOCUS_30090 gene rsgA 4333 5340 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY9 protein_id gnl|my_center|LOCUS_30090 5400 6224 gene locus_tag LOCUS_30100 gene rhdA 5400 6224 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_30100 >Feature sequence202 1228 578 gene locus_tag LOCUS_30110 1228 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2755 1418 gene locus_tag LOCUS_30120 2755 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 4074 2752 gene locus_tag LOCUS_30130 4074 2752 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_30130 4555 4085 gene locus_tag LOCUS_30140 4555 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4756 5601 gene locus_tag LOCUS_30150 4756 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 5769 6083 gene locus_tag LOCUS_30160 5769 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence203 2034 1786 gene locus_tag LOCUS_30170 2034 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3528 2152 gene locus_tag LOCUS_30180 3528 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3840 3688 gene locus_tag LOCUS_30190 3840 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 4429 3845 gene locus_tag LOCUS_30200 4429 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 5018 4449 gene locus_tag LOCUS_30210 5018 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974763.1 protein_id gnl|my_center|LOCUS_30210 <6345 5275 gene locus_tag LOCUS_30220 <6345 5275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083636.1:transcriptional regulator >Feature sequence204 565 3201 gene locus_tag LOCUS_30230 565 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 5299 3209 gene locus_tag LOCUS_30240 5299 3209 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_30240 <6328 5347 gene locus_tag LOCUS_30250 <6328 5347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189039.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence205 2932 842 gene locus_tag LOCUS_30260 gene recG 2932 842 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_30260 3322 2939 gene locus_tag LOCUS_30270 3322 2939 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_30270 5521 3326 gene locus_tag LOCUS_30280 gene spoT 5521 3326 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_30280 5871 5536 gene locus_tag LOCUS_30290 5871 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence206 1902 2900 gene locus_tag LOCUS_30300 1902 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2966 4555 gene locus_tag LOCUS_30310 2966 4555 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_30310 4568 5554 gene locus_tag LOCUS_30320 4568 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence207 <1 1025 gene locus_tag LOCUS_30330 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106211.1:sodium:proton antiporter 1298 2329 gene locus_tag LOCUS_30340 1298 2329 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_30340 2363 3238 gene locus_tag LOCUS_30350 2363 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3238 4080 gene locus_tag LOCUS_30360 3238 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4088 5419 gene locus_tag LOCUS_30370 4088 5419 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJA6 protein_id gnl|my_center|LOCUS_30370 >Feature sequence208 338 1144 gene locus_tag LOCUS_30380 338 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 1227 1311 gene locus_tag LOCUS_t00330 1227 1311 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1357 2097 gene locus_tag LOCUS_30390 1357 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_30390 2170 2865 gene locus_tag LOCUS_30400 2170 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3648 2875 gene locus_tag LOCUS_30410 3648 2875 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_30410 3733 5259 gene locus_tag LOCUS_30420 3733 5259 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_30420 <6265 5290 gene locus_tag LOCUS_30430 <6265 5290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU15:beta-ketoacyl-[acyl-carrier-protein] synthase FabY >Feature sequence209 2966 2325 gene locus_tag LOCUS_30440 2966 2325 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921221.1 protein_id gnl|my_center|LOCUS_30440 3576 3001 gene locus_tag LOCUS_30450 3576 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947372.1 protein_id gnl|my_center|LOCUS_30450 5536 3602 gene locus_tag LOCUS_30460 gene gcd-1 5536 3602 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_30460 5945 5836 gene locus_tag LOCUS_r00020 5945 5836 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence210 3548 609 gene locus_tag LOCUS_30470 3548 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30470 3671 4630 gene locus_tag LOCUS_30480 3671 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_30480 4645 5622 gene locus_tag LOCUS_30490 4645 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_30490 5601 6134 gene locus_tag LOCUS_30500 5601 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence211 364 822 gene locus_tag LOCUS_30510 364 822 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_30510 1564 827 gene locus_tag LOCUS_30520 gene lpxH 1564 827 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_30520 2080 1577 gene locus_tag LOCUS_30530 gene ppiB 2080 1577 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SS5 protein_id gnl|my_center|LOCUS_30530 2194 3936 gene locus_tag LOCUS_30540 gene glnS 2194 3936 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_30540 3947 5347 gene locus_tag LOCUS_30550 gene cysS 3947 5347 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_30550 5431 5507 gene locus_tag LOCUS_t00340 5431 5507 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5531 5606 gene locus_tag LOCUS_t00350 5531 5606 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5631 5855 gene locus_tag LOCUS_30560 5631 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 5935 6011 gene locus_tag LOCUS_t00360 5935 6011 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 1547 618 gene locus_tag LOCUS_30570 1547 618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121843.1 protein_id gnl|my_center|LOCUS_30570 2445 1753 gene locus_tag LOCUS_30580 gene chrR 2445 1753 CDS product anti-ECF sigma factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072075.1 protein_id gnl|my_center|LOCUS_30580 3025 2438 gene locus_tag LOCUS_30590 3025 2438 CDS product RNA polymerase sigma factor ECF family 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072076.1 protein_id gnl|my_center|LOCUS_30590 3412 4734 gene locus_tag LOCUS_30600 3412 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_30600 4823 6028 gene locus_tag LOCUS_30610 4823 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence213 1 510 gene locus_tag LOCUS_30620 1 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1095 520 gene locus_tag LOCUS_30630 1095 520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_30630 1490 1101 gene locus_tag LOCUS_30640 1490 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 2063 1509 gene locus_tag LOCUS_30650 2063 1509 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_30650 2192 3799 gene locus_tag LOCUS_30660 2192 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 5257 3872 gene locus_tag LOCUS_30670 5257 3872 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_30670 <6031 5276 gene locus_tag LOCUS_30680 <6031 5276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314166.1:inositol monophosphatase >Feature sequence214 2839 1871 gene locus_tag LOCUS_30690 2839 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530486.1 protein_id gnl|my_center|LOCUS_30690 3392 4204 gene locus_tag LOCUS_30700 3392 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 4265 5125 gene locus_tag LOCUS_30710 4265 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence215 2624 4219 gene locus_tag LOCUS_30720 2624 4219 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141198.1 protein_id gnl|my_center|LOCUS_30720 4938 4423 gene locus_tag LOCUS_30730 4938 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_30730 5066 5761 gene locus_tag LOCUS_30740 5066 5761 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence216 844 1557 gene locus_tag LOCUS_30750 844 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_30750 1575 3194 gene locus_tag LOCUS_30760 1575 3194 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_30760 3644 3285 gene locus_tag LOCUS_30770 3644 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 4960 3743 gene locus_tag LOCUS_30780 4960 3743 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083815.1 protein_id gnl|my_center|LOCUS_30780 5105 5617 gene locus_tag LOCUS_30790 5105 5617 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence217 855 2576 gene locus_tag LOCUS_30800 855 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3225 2674 gene locus_tag LOCUS_30810 3225 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 4435 3275 gene locus_tag LOCUS_30820 4435 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 5407 4457 gene locus_tag LOCUS_30830 5407 4457 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence218 <1 1671 gene locus_tag LOCUS_30840 <1 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812261.1:ABC transporter ATP-binding protein 1664 2869 gene locus_tag LOCUS_30850 1664 2869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_30850 2880 3998 gene locus_tag LOCUS_30860 2880 3998 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1L5 protein_id gnl|my_center|LOCUS_30860 4033 5565 gene locus_tag LOCUS_30870 4033 5565 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence219 461 772 gene locus_tag LOCUS_30880 461 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 778 897 gene locus_tag LOCUS_30890 778 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1006 1710 gene locus_tag LOCUS_30900 1006 1710 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066993.1 protein_id gnl|my_center|LOCUS_30900 3423 1723 gene locus_tag LOCUS_30910 gene maeA 3423 1723 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW63 protein_id gnl|my_center|LOCUS_30910 3973 3434 gene locus_tag LOCUS_30920 3973 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 4481 3975 gene locus_tag LOCUS_30930 4481 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 5190 4594 gene locus_tag LOCUS_30940 5190 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence220 3413 1323 gene locus_tag LOCUS_30950 3413 1323 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705124.1 protein_id gnl|my_center|LOCUS_30950 5590 3473 gene locus_tag LOCUS_30960 gene pnp 5590 3473 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_30960 >Feature sequence221 <1 849 gene locus_tag LOCUS_30970 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919441.1:serine hydrolase 3082 932 gene locus_tag LOCUS_30980 3082 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 <5622 3105 gene locus_tag LOCUS_30990 <5622 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088423.1:histidine kinase >Feature sequence222 <1 2178 gene locus_tag LOCUS_31000 <1 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGC9:outer membrane protein assembly factor BamA 2223 2729 gene locus_tag LOCUS_31010 2223 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_31010 2756 3802 gene locus_tag LOCUS_31020 gene lpxD 2756 3802 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_31020 3840 4274 gene locus_tag LOCUS_31030 gene fabZ 3840 4274 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_31030 4276 5046 gene locus_tag LOCUS_31040 gene lpxA 4276 5046 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR6 protein_id gnl|my_center|LOCUS_31040 >Feature sequence223 <1 1556 gene locus_tag LOCUS_31050 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886845.1:copper-translocating P-type ATPase 2011 1568 gene locus_tag LOCUS_31060 2011 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3832 2069 gene locus_tag LOCUS_31070 3832 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3916 4287 gene locus_tag LOCUS_31080 3916 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272895.1 protein_id gnl|my_center|LOCUS_31080 5062 4295 gene locus_tag LOCUS_31090 gene tipA 5062 4295 CDS product HTH-type transcriptional activator TipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4T8 protein_id gnl|my_center|LOCUS_31090 >Feature sequence224 2718 1366 gene locus_tag LOCUS_31100 2718 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3712 2750 gene locus_tag LOCUS_31110 3712 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_31110 4811 3846 gene locus_tag LOCUS_31120 4811 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence225 1372 137 gene locus_tag LOCUS_31130 1372 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 1614 2039 gene locus_tag LOCUS_31140 1614 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2050 2790 gene locus_tag LOCUS_31150 2050 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 2831 3448 gene locus_tag LOCUS_31160 2831 3448 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_31160 3717 4235 gene locus_tag LOCUS_31170 3717 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence226 2308 89 gene locus_tag LOCUS_31180 2308 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2830 3324 gene locus_tag LOCUS_31190 gene sixA 2830 3324 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_31190 3333 3785 gene locus_tag LOCUS_31200 3333 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3782 4711 gene locus_tag LOCUS_31210 3782 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence227 <1 1230 gene locus_tag LOCUS_31220 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073802.1:MSHA biogenesis protein MshQ 2665 1235 gene locus_tag LOCUS_31230 gene ntrC 2665 1235 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_31230 3763 2687 gene locus_tag LOCUS_31240 gene ntrB 3763 2687 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_31240 <5313 4071 gene locus_tag LOCUS_31250 <5313 4071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU65:glutamine synthetase >Feature sequence228 <1 959 gene locus_tag LOCUS_31260 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074094.1:SAM-dependent methyltransferase 2372 963 gene locus_tag LOCUS_31270 2372 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_31270 2584 4383 gene locus_tag LOCUS_31280 gene thiC 2584 4383 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VG1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence229 4396 746 gene locus_tag LOCUS_31290 4396 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 5059 4445 gene locus_tag LOCUS_31300 5059 4445 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence230 1100 258 gene locus_tag LOCUS_31310 1100 258 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_31310 2077 1118 gene locus_tag LOCUS_31320 2077 1118 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_31320 2340 3041 gene locus_tag LOCUS_31330 2340 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3281 3826 gene locus_tag LOCUS_31340 3281 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3910 4932 gene locus_tag LOCUS_31350 3910 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence231 378 1559 gene locus_tag LOCUS_31360 378 1559 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_31360 2697 1579 gene locus_tag LOCUS_31370 gene ald 2697 1579 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_31370 3222 2806 gene locus_tag LOCUS_31380 3222 2806 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_31380 3452 4663 gene locus_tag LOCUS_31390 3452 4663 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204051.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence232 201 548 gene locus_tag LOCUS_31400 201 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1489 575 gene locus_tag LOCUS_31410 1489 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1724 2734 gene locus_tag LOCUS_31420 1724 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 2759 3223 gene locus_tag LOCUS_31430 2759 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3224 4345 gene locus_tag LOCUS_31440 3224 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_31440 >Feature sequence233 857 309 gene locus_tag LOCUS_31450 gene dsbE 857 309 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765251.1 protein_id gnl|my_center|LOCUS_31450 2878 878 gene locus_tag LOCUS_31460 gene ccmF 2878 878 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_31460 3345 2875 gene locus_tag LOCUS_31470 gene ccmE 3345 2875 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_31470 3605 3342 gene locus_tag LOCUS_31480 3605 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 4280 3606 gene locus_tag LOCUS_31490 gene ccmC 4280 3606 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 protein_id gnl|my_center|LOCUS_31490 <4946 4434 gene locus_tag LOCUS_31500 <4946 4434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3N6:heme exporter protein B >Feature sequence234 <1 938 gene locus_tag LOCUS_31510 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:two-component system sensor kinase 2111 951 gene locus_tag LOCUS_31520 2111 951 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_31520 3308 2124 gene locus_tag LOCUS_31530 3308 2124 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_31530 4099 3329 gene locus_tag LOCUS_31540 4099 3329 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence235 <1 2444 gene locus_tag LOCUS_31550 <1 2444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87YP3:aconitate hydratase B 3461 2490 gene locus_tag LOCUS_31560 3461 2490 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_31560 <4843 3485 gene locus_tag LOCUS_31570 <4843 3485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113940.1:aminopeptidase N >Feature sequence236 1005 3056 gene locus_tag LOCUS_31580 1005 3056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_31580 3860 3462 gene locus_tag LOCUS_31590 3860 3462 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_31590 <4841 3867 gene locus_tag LOCUS_31600 <4841 3867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263309.1:cation transporter >Feature sequence237 1324 548 gene locus_tag LOCUS_31610 1324 548 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXK2 protein_id gnl|my_center|LOCUS_31610 1465 1815 gene locus_tag LOCUS_31620 1465 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2098 1796 gene locus_tag LOCUS_31630 2098 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524257.1 protein_id gnl|my_center|LOCUS_31630 2558 2100 gene locus_tag LOCUS_31640 2558 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3053 2577 gene locus_tag LOCUS_31650 3053 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3566 3072 gene locus_tag LOCUS_31660 gene tspO 3566 3072 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_31660 4645 3566 gene locus_tag LOCUS_31670 4645 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence238 158 400 gene locus_tag LOCUS_31680 158 400 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_31680 553 744 gene locus_tag LOCUS_31690 553 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1910 3265 gene locus_tag LOCUS_31700 1910 3265 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_31700 3278 4504 gene locus_tag LOCUS_31710 3278 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence239 90 353 gene locus_tag LOCUS_31720 90 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 4304 3831 gene locus_tag LOCUS_31730 4304 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence240 1927 2406 gene locus_tag LOCUS_31740 1927 2406 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_31740 <4601 2557 gene locus_tag LOCUS_31750 <4601 2557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918977.1:TonB-dependent receptor >Feature sequence241 112 672 gene locus_tag LOCUS_31760 112 672 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702324.1 protein_id gnl|my_center|LOCUS_31760 723 1082 gene locus_tag LOCUS_31770 723 1082 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881362.1 protein_id gnl|my_center|LOCUS_31770 1112 1660 gene locus_tag LOCUS_31780 1112 1660 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_31780 1663 2301 gene locus_tag LOCUS_31790 1663 2301 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087905.1 protein_id gnl|my_center|LOCUS_31790 3713 2298 gene locus_tag LOCUS_31800 3713 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 <4588 3799 gene locus_tag LOCUS_31810 <4588 3799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095680.1:protein FimX >Feature sequence242 <1 1163 gene locus_tag LOCUS_31820 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252933.1:amino acid permease 1436 2407 gene locus_tag LOCUS_31830 1436 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 2418 3287 gene locus_tag LOCUS_31840 2418 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3773 3429 gene locus_tag LOCUS_31850 3773 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 4190 4575 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctacgcggcagtgaac >Feature sequence243 <1 1343 gene locus_tag LOCUS_31860 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125226.1:serine protease 1343 1918 gene locus_tag LOCUS_31870 gene rsxA 1343 1918 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83KY7 protein_id gnl|my_center|LOCUS_31870 1922 2542 gene locus_tag LOCUS_31880 1922 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2542 4158 gene locus_tag LOCUS_31890 2542 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence244 2216 42 gene locus_tag LOCUS_31900 2216 42 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_31900 3572 2223 gene locus_tag LOCUS_31910 3572 2223 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881009.1 protein_id gnl|my_center|LOCUS_31910 4544 3576 gene locus_tag LOCUS_31920 4544 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence245 442 1938 gene locus_tag LOCUS_31930 442 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 2189 3100 gene locus_tag LOCUS_31940 2189 3100 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069683.1 protein_id gnl|my_center|LOCUS_31940 3124 4152 gene locus_tag LOCUS_31950 3124 4152 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475901.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence246 <1 807 gene locus_tag LOCUS_31960 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088947.1:quinoprotein ethanol dehydrogenase 884 2368 gene locus_tag LOCUS_31970 884 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2368 3348 gene locus_tag LOCUS_31980 2368 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 <4484 3511 gene locus_tag LOCUS_31990 <4484 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142975.1:membrane protein >Feature sequence247 354 1223 gene locus_tag LOCUS_32000 354 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 1514 2716 gene locus_tag LOCUS_32010 1514 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence248 31 771 gene locus_tag LOCUS_32020 31 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1510 773 gene locus_tag LOCUS_32030 1510 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2388 1507 gene locus_tag LOCUS_32040 2388 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2933 2520 gene locus_tag LOCUS_32050 2933 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3899 2961 gene locus_tag LOCUS_32060 3899 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence249 <1 1997 gene locus_tag LOCUS_32070 <1 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940876.1:aldehyde oxidase 2104 3627 gene locus_tag LOCUS_32080 2104 3627 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_32080 <4309 3637 gene locus_tag LOCUS_32090 <4309 3637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085430.1:carboxymuconolactone decarboxylase >Feature sequence250 <1 871 gene locus_tag LOCUS_32100 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTN2:acetylglutamate kinase 877 1497 gene locus_tag LOCUS_32110 gene slmA 877 1497 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_32110 2163 1504 gene locus_tag LOCUS_32120 gene pyrE 2163 1504 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_32120 2910 2176 gene locus_tag LOCUS_32130 gene rph 2910 2176 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQU6 protein_id gnl|my_center|LOCUS_32130 3068 3934 gene locus_tag LOCUS_32140 3068 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence251 1340 870 gene locus_tag LOCUS_32150 1340 870 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479576.1 protein_id gnl|my_center|LOCUS_32150 1825 1364 gene locus_tag LOCUS_32160 1825 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 2868 1828 gene locus_tag LOCUS_32170 gene gpsA 2868 1828 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_32170 3087 2968 gene locus_tag LOCUS_32180 3087 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3691 3272 gene locus_tag LOCUS_32190 3691 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3930 3688 gene locus_tag LOCUS_32200 3930 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence252 3719 579 gene locus_tag LOCUS_32210 gene cusA 3719 579 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence253 3 218 gene locus_tag LOCUS_32220 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 291 860 gene locus_tag LOCUS_32230 291 860 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_32230 866 1774 gene locus_tag LOCUS_32240 866 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence254 70 540 gene locus_tag LOCUS_32250 70 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 544 1221 gene locus_tag LOCUS_32260 544 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1928 1215 gene locus_tag LOCUS_32270 1928 1215 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_32270 2821 2138 gene locus_tag LOCUS_32280 gene nth 2821 2138 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_32280 3477 2818 gene locus_tag LOCUS_32290 3477 2818 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_32290 <4230 3453 gene locus_tag LOCUS_32300 <4230 3453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JM66:electron transport complex subunit D >Feature sequence255 2475 1837 gene locus_tag LOCUS_32310 2475 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2666 3985 gene locus_tag LOCUS_32320 2666 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence256 2203 377 gene locus_tag LOCUS_32330 gene bipA 2203 377 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021411.1 protein_id gnl|my_center|LOCUS_32330 3883 2423 gene locus_tag LOCUS_32340 gene thiI 3883 2423 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_32340 >Feature sequence257 379 969 gene locus_tag LOCUS_32350 379 969 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_32350 1424 993 gene locus_tag LOCUS_32360 gene sspB 1424 993 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_32360 2090 1485 gene locus_tag LOCUS_32370 gene sspA 2090 1485 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_32370 <4168 2169 gene locus_tag LOCUS_32380 <4168 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVY5:cytochrome b >Feature sequence258 566 63 gene locus_tag LOCUS_32390 566 63 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_32390 2136 568 gene locus_tag LOCUS_32400 gene nnr 2136 568 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_32400 2587 2144 gene locus_tag LOCUS_32410 2587 2144 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709522.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence259 663 2666 gene locus_tag LOCUS_32420 663 2666 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_32420 2862 3533 gene locus_tag LOCUS_32430 2862 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence260 <1 756 gene locus_tag LOCUS_32440 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33641:outer membrane protein assembly factor BamD 846 1475 gene locus_tag LOCUS_32450 gene rpoE 846 1475 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_32450 1472 1993 gene locus_tag LOCUS_32460 1472 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2001 2270 gene locus_tag LOCUS_32470 2001 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2263 2811 gene locus_tag LOCUS_32480 2263 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 <4119 2838 gene locus_tag LOCUS_32490 <4119 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704658.1:NAD+ synthase >Feature sequence261 2059 1349 gene locus_tag LOCUS_32500 2059 1349 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_32500 2324 2983 gene locus_tag LOCUS_32510 2324 2983 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_32510 3024 3563 gene locus_tag LOCUS_32520 3024 3563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_32520 <4101 3569 gene locus_tag LOCUS_32530 <4101 3569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZUQ6:phospho-2-dehydro-3-deoxyheptonate aldolase >Feature sequence262 2142 1432 gene locus_tag LOCUS_32540 gene sdhB 2142 1432 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_32540 3949 2177 gene locus_tag LOCUS_32550 gene sdhA 3949 2177 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_32550 >Feature sequence263 <1 2463 gene locus_tag LOCUS_32560 <1 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXH0:valine--tRNA ligase 3651 2650 gene locus_tag LOCUS_32570 gene ispH 3651 2650 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_32570 >Feature sequence264 2954 237 gene locus_tag LOCUS_32580 gene aceE 2954 237 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_32580 >Feature sequence265 423 1328 gene locus_tag LOCUS_32590 423 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1884 1489 gene locus_tag LOCUS_32600 1884 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2417 1959 gene locus_tag LOCUS_32610 2417 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477135.1 protein_id gnl|my_center|LOCUS_32610 <3945 2484 gene locus_tag LOCUS_32620 <3945 2484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F219:dihydroxy-acid dehydratase >Feature sequence266 821 258 gene locus_tag LOCUS_32630 821 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 2477 1287 gene locus_tag LOCUS_32640 2477 1287 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_32640 3447 2632 gene locus_tag LOCUS_32650 3447 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3843 3607 gene locus_tag LOCUS_32660 3843 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence267 1395 649 gene locus_tag LOCUS_32670 gene vanA 1395 649 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX22 protein_id gnl|my_center|LOCUS_32670 2947 1397 gene locus_tag LOCUS_32680 2947 1397 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_32680 3897 2992 gene locus_tag LOCUS_32690 3897 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence268 2029 2820 gene locus_tag LOCUS_32700 2029 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence269 1392 340 gene locus_tag LOCUS_32710 1392 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 2366 1449 gene locus_tag LOCUS_32720 2366 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3802 2495 gene locus_tag LOCUS_32730 3802 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence270 427 23 gene locus_tag LOCUS_32740 427 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 831 424 gene locus_tag LOCUS_32750 831 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2335 899 gene locus_tag LOCUS_32760 2335 899 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_32760 2434 3246 gene locus_tag LOCUS_32770 2434 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_32770 3712 3248 gene locus_tag LOCUS_32780 3712 3248 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence271 203 895 gene locus_tag LOCUS_32790 203 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32790 918 1355 gene locus_tag LOCUS_32800 gene dtd 918 1355 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNV3 protein_id gnl|my_center|LOCUS_32800 2141 1356 gene locus_tag LOCUS_32810 gene tatC 2141 1356 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_32810 2484 2095 gene locus_tag LOCUS_32820 2484 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2773 2558 gene locus_tag LOCUS_32830 2773 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3126 2788 gene locus_tag LOCUS_32840 3126 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32840 3534 3136 gene locus_tag LOCUS_32850 gene hisI 3534 3136 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY9 protein_id gnl|my_center|LOCUS_32850 >Feature sequence272 2059 1511 gene locus_tag LOCUS_32860 2059 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3383 3099 gene locus_tag LOCUS_32870 3383 3099 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094527.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence273 1715 1639 gene locus_tag LOCUS_t00370 1715 1639 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3095 1848 gene locus_tag LOCUS_32880 3095 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3379 3140 gene locus_tag LOCUS_32890 3379 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence274 2028 1195 gene locus_tag LOCUS_32900 2028 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 2212 2745 gene locus_tag LOCUS_32910 2212 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 <3496 2811 gene locus_tag LOCUS_32920 <3496 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F641:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence275 <1 504 gene locus_tag LOCUS_32930 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWL1:Holliday junction ATP-dependent DNA helicase RuvB 644 1333 gene locus_tag LOCUS_32940 gene tolQ 644 1333 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_32940 1377 1814 gene locus_tag LOCUS_32950 gene tolR 1377 1814 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_32950 1847 2686 gene locus_tag LOCUS_32960 1847 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence276 901 737 gene locus_tag LOCUS_32970 901 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1786 914 gene locus_tag LOCUS_32980 gene ilvE 1786 914 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32980 1893 2699 gene locus_tag LOCUS_32990 gene mttC 1893 2699 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence277 2448 1138 gene locus_tag LOCUS_33000 2448 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3035 2526 gene locus_tag LOCUS_33010 3035 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence278 1 516 gene locus_tag LOCUS_33020 1 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 584 1114 gene locus_tag LOCUS_33030 gene infC 584 1114 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_33030 1143 1337 gene locus_tag LOCUS_33040 gene rpmI 1143 1337 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG5 protein_id gnl|my_center|LOCUS_33040 1363 1722 gene locus_tag LOCUS_33050 gene rplT 1363 1722 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A2 protein_id gnl|my_center|LOCUS_33050 1750 2766 gene locus_tag LOCUS_33060 gene pheS 1750 2766 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_33060 >Feature sequence279 660 283 gene locus_tag LOCUS_33070 660 283 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL4 protein_id gnl|my_center|LOCUS_33070 2573 696 gene locus_tag LOCUS_33080 2573 696 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence280 387 1358 gene locus_tag LOCUS_33090 gene rluD 387 1358 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_33090 1355 2119 gene locus_tag LOCUS_33100 1355 2119 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_33100 >Feature sequence281 227 589 gene locus_tag LOCUS_33110 227 589 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_33110 586 2088 gene locus_tag LOCUS_33120 586 2088 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence282 219 2297 gene locus_tag LOCUS_33130 gene oprC 219 2297 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence283 1892 138 gene locus_tag LOCUS_33140 1892 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence284 <1 1453 gene locus_tag LOCUS_33150 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZE0:NAD-specific glutamate dehydrogenase 1468 2499 gene locus_tag LOCUS_33160 gene pyrD 1468 2499 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_33160 2499 2735 gene locus_tag LOCUS_33170 2499 2735 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence285 1374 1916 gene locus_tag LOCUS_33180 gene vanY 1374 1916 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023254.1 protein_id gnl|my_center|LOCUS_33180 2030 2425 gene locus_tag LOCUS_33190 2030 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2429 2740 gene locus_tag LOCUS_33200 2429 2740 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence286 335 57 gene locus_tag LOCUS_33210 gene hfq 335 57 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_33210 1357 392 gene locus_tag LOCUS_33220 gene miaA 1357 392 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59197 protein_id gnl|my_center|LOCUS_33220 <2961 1347 gene locus_tag LOCUS_33230 <2961 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUL8:DNA mismatch repair protein MutL >Feature sequence287 <1 1854 gene locus_tag LOCUS_33240 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9LCT3:protein translocase subunit SecA >Feature sequence288 280 2301 gene locus_tag LOCUS_33250 gene btuB 280 2301 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAA1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence289 1660 884 gene locus_tag LOCUS_33260 1660 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 protein_id gnl|my_center|LOCUS_33260 2244 1642 gene locus_tag LOCUS_33270 2244 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 2625 2314 gene locus_tag LOCUS_33280 2625 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence290 >Feature sequence291 640 167 gene locus_tag LOCUS_33290 640 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 845 645 gene locus_tag LOCUS_33300 845 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 1027 848 gene locus_tag LOCUS_33310 1027 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 2248 1496 gene locus_tag LOCUS_33320 2248 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 2524 2291 gene locus_tag LOCUS_33330 2524 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence292 720 187 gene locus_tag LOCUS_33340 720 187 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940873.1 protein_id gnl|my_center|LOCUS_33340 1545 841 gene locus_tag LOCUS_33350 1545 841 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 protein_id gnl|my_center|LOCUS_33350 1657 2649 gene locus_tag LOCUS_33360 1657 2649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence293 1075 368 gene locus_tag LOCUS_33370 1075 368 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_33370 1169 1094 gene locus_tag LOCUS_t00380 1169 1094 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1941 1225 gene locus_tag LOCUS_33380 gene queC 1941 1225 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 protein_id gnl|my_center|LOCUS_33380 2609 1956 gene locus_tag LOCUS_33390 gene queE 2609 1956 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTW7 protein_id gnl|my_center|LOCUS_33390 >Feature sequence294 752 627 gene locus_tag LOCUS_33400 752 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 969 1301 gene locus_tag LOCUS_33410 969 1301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895635.1 protein_id gnl|my_center|LOCUS_33410 1343 1684 gene locus_tag LOCUS_33420 1343 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2020 1817 gene locus_tag LOCUS_33430 2020 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence295 64 507 gene locus_tag LOCUS_33440 64 507 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_33440 523 2643 gene locus_tag LOCUS_33450 523 2643 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence296 1672 224 gene locus_tag LOCUS_33460 1672 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_33460 2414 1701 gene locus_tag LOCUS_33470 2414 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence297 1277 150 gene locus_tag LOCUS_33480 1277 150 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSC1 protein_id gnl|my_center|LOCUS_33480 2176 1277 gene locus_tag LOCUS_33490 gene prpB 2176 1277 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P70 protein_id gnl|my_center|LOCUS_33490 >Feature sequence298 1369 929 gene locus_tag LOCUS_33500 1369 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence299 1010 141 gene locus_tag LOCUS_33510 gene prmC 1010 141 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_33510 2095 1007 gene locus_tag LOCUS_33520 gene prfA 2095 1007 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_33520 >Feature sequence300 410 763 gene locus_tag LOCUS_33530 410 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207525.2 protein_id gnl|my_center|LOCUS_33530 839 1546 gene locus_tag LOCUS_33540 839 1546 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5T2 protein_id gnl|my_center|LOCUS_33540 1636 2016 gene locus_tag LOCUS_33550 1636 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence301 1741 806 gene locus_tag LOCUS_33560 gene dmsE 1741 806 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence302 >Feature sequence303 <1 1569 gene locus_tag LOCUS_33570 <1 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921030.1:TonB-dependent receptor >Feature sequence304 297 1313 gene locus_tag LOCUS_33580 297 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 2276 1317 gene locus_tag LOCUS_33590 2276 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence305 2218 1598 gene locus_tag LOCUS_33600 2218 1598 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403066.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence306 <1 1143 gene locus_tag LOCUS_33610 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_252955.1:elongation factor Tu 1283 1594 gene locus_tag LOCUS_33620 gene rpsJ 1283 1594 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X2 protein_id gnl|my_center|LOCUS_33620 >Feature sequence307 70 279 gene locus_tag LOCUS_33630 70 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1436 276 gene locus_tag LOCUS_33640 1436 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence308 1628 183 gene locus_tag LOCUS_33650 1628 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence309 1328 741 gene locus_tag LOCUS_33660 1328 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933524.1 protein_id gnl|my_center|LOCUS_33660 1502 1948 gene locus_tag LOCUS_33670 1502 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence310 >Feature sequence311 >Feature sequence312 2017 512 gene locus_tag LOCUS_33680 2017 512 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence313 102 1550 gene locus_tag LOCUS_33690 gene prpD 102 1550 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence314 <1 819 gene locus_tag LOCUS_33700 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I534:DNA polymerase IV 823 1326 gene locus_tag LOCUS_33710 gene greB 823 1326 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW4 protein_id gnl|my_center|LOCUS_33710 >Feature sequence315 323 946 gene locus_tag LOCUS_33720 323 946 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_33720 955 1779 gene locus_tag LOCUS_33730 955 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence316 >Feature sequence317 165 238 gene locus_tag LOCUS_t00390 165 238 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 295 383 gene locus_tag LOCUS_t00400 295 383 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1096 572 gene locus_tag LOCUS_33740 1096 572 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263585.1 protein_id gnl|my_center|LOCUS_33740 1601 1083 gene locus_tag LOCUS_33750 1601 1083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence318 161 1195 gene locus_tag LOCUS_33760 gene oprF 161 1195 CDS product outer membrane porin F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13794 protein_id gnl|my_center|LOCUS_33760 >Feature sequence319 1364 759 gene locus_tag LOCUS_33770 1364 759 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_33770 1890 1402 gene locus_tag LOCUS_33780 gene mreD 1890 1402 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_33780 >Feature sequence320 1114 1854 gene locus_tag LOCUS_33790 1114 1854 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence321 <1 1117 gene locus_tag LOCUS_33800 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889V1:protein translocase subunit SecY 1401 1757 gene locus_tag LOCUS_33810 gene rpsM 1401 1757 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_33810 >Feature sequence322 <1 1119 gene locus_tag LOCUS_33820 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400343.1:peptide ABC transporter permease >Feature sequence323 292 1197 gene locus_tag LOCUS_33830 gene prmB 292 1197 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMU9 protein_id gnl|my_center|LOCUS_33830 >Feature sequence324 124 1560 gene locus_tag LOCUS_33840 124 1560 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063717.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence325 >Feature sequence326 <1 854 gene locus_tag LOCUS_33850 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529988.1:alpha-hydroxy-acid oxidizing enzyme 918 1340 gene locus_tag LOCUS_33860 918 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence327 <1 1484 gene locus_tag LOCUS_33870 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123571.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence328 >Feature sequence329 <1597 809 gene locus_tag LOCUS_33880 <1597 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV66:acetyl-coenzyme A synthetase 2 >Feature sequence330 >Feature sequence331 725 12 gene locus_tag LOCUS_33890 725 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence332 1376 843 gene locus_tag LOCUS_33900 1376 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900