>Feature sequence01 555 1901 gene locus_tag LOCUS_00010 gene fleS 555 1901 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_00010 1898 3349 gene locus_tag LOCUS_00020 gene fleR 1898 3349 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_00020 3346 3723 gene locus_tag LOCUS_00030 gene fliE 3346 3723 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT2 protein_id gnl|my_center|LOCUS_00030 3825 5537 gene locus_tag LOCUS_00040 gene fliF 3825 5537 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884X8 protein_id gnl|my_center|LOCUS_00040 5530 6555 gene locus_tag LOCUS_00050 gene fliG 5530 6555 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_00050 6557 7600 gene locus_tag LOCUS_00060 6557 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7600 9069 gene locus_tag LOCUS_00070 gene fliI 7600 9069 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268440.1 protein_id gnl|my_center|LOCUS_00070 9066 9512 gene locus_tag LOCUS_00080 9066 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9575 11545 gene locus_tag LOCUS_00090 9575 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11742 12239 gene locus_tag LOCUS_00100 11742 12239 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_00100 12258 13226 gene locus_tag LOCUS_00110 gene fliM 12258 13226 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_00110 13237 13614 gene locus_tag LOCUS_00120 gene fliN 13237 13614 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W6 protein_id gnl|my_center|LOCUS_00120 13714 14055 gene locus_tag LOCUS_00130 13714 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14057 14881 gene locus_tag LOCUS_00140 gene fliP 14057 14881 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_00140 14886 15155 gene locus_tag LOCUS_00150 gene fliQ 14886 15155 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_00150 15160 15933 gene locus_tag LOCUS_00160 gene fliR 15160 15933 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_00160 15944 17083 gene locus_tag LOCUS_00170 gene flhB 15944 17083 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_00170 17299 19422 gene locus_tag LOCUS_00180 gene flhA 17299 19422 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_00180 19484 20635 gene locus_tag LOCUS_00190 gene flhF 19484 20635 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_00190 20656 21462 gene locus_tag LOCUS_00200 gene fleN 20656 21462 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 protein_id gnl|my_center|LOCUS_00200 21466 22188 gene locus_tag LOCUS_00210 gene fliA 21466 22188 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29248 protein_id gnl|my_center|LOCUS_00210 22389 22781 gene locus_tag LOCUS_00220 gene cheY 22389 22781 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_00220 22794 23486 gene locus_tag LOCUS_00230 gene cheZ 22794 23486 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51434 protein_id gnl|my_center|LOCUS_00230 23538 25652 gene locus_tag LOCUS_00240 23538 25652 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_00240 25668 26753 gene locus_tag LOCUS_00250 gene cheB1 25668 26753 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_00250 26755 27564 gene locus_tag LOCUS_00260 26755 27564 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766970.1 protein_id gnl|my_center|LOCUS_00260 27557 28258 gene locus_tag LOCUS_00270 27557 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28465 28950 gene locus_tag LOCUS_00280 28465 28950 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370201.1 protein_id gnl|my_center|LOCUS_00280 28973 29362 gene locus_tag LOCUS_00290 28973 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083101.1 protein_id gnl|my_center|LOCUS_00290 29462 30139 gene locus_tag LOCUS_00300 gene ccmA 29462 30139 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_00300 30136 30849 gene locus_tag LOCUS_00310 gene ccmB 30136 30849 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_00310 30940 31680 gene locus_tag LOCUS_00320 gene ccmC 30940 31680 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_00320 31694 31924 gene locus_tag LOCUS_00330 31694 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31940 32395 gene locus_tag LOCUS_00340 gene ccmE 31940 32395 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_00340 32395 34410 gene locus_tag LOCUS_00350 32395 34410 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_00350 34407 34979 gene locus_tag LOCUS_00360 gene ccmG 34407 34979 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_00360 34976 35473 gene locus_tag LOCUS_00370 gene ccmH 34976 35473 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_00370 35485 36771 gene locus_tag LOCUS_00380 gene cycH 35485 36771 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_00380 36771 37841 gene locus_tag LOCUS_00390 gene moaA 36771 37841 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_00390 37846 38364 gene locus_tag LOCUS_00400 gene moaB2 37846 38364 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_00400 38921 39685 gene locus_tag LOCUS_00410 gene exoA 38921 39685 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_00410 39753 40337 gene locus_tag LOCUS_00420 gene ppiB 39753 40337 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_00420 40642 40343 gene locus_tag LOCUS_00430 40642 40343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_00430 40847 40620 gene locus_tag LOCUS_00440 40847 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 40805 41425 gene locus_tag LOCUS_00450 40805 41425 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268524.1 protein_id gnl|my_center|LOCUS_00450 41512 42687 gene locus_tag LOCUS_00460 gene trpS-1 41512 42687 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_00460 42687 43523 gene locus_tag LOCUS_00470 42687 43523 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_00470 43536 44363 gene locus_tag LOCUS_00480 43536 44363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44356 45162 gene locus_tag LOCUS_00490 44356 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00490 45607 45209 gene locus_tag LOCUS_00500 45607 45209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 46574 45657 gene locus_tag LOCUS_00510 46574 45657 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_00510 47540 46776 gene locus_tag LOCUS_00520 47540 46776 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_00520 48248 47550 gene locus_tag LOCUS_00530 gene gph2 48248 47550 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_00530 48997 48245 gene locus_tag LOCUS_00540 gene ubiG 48997 48245 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ90 protein_id gnl|my_center|LOCUS_00540 50331 48994 gene locus_tag LOCUS_00550 50331 48994 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_00550 50507 53107 gene locus_tag LOCUS_00560 gene gyrA 50507 53107 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRA9 protein_id gnl|my_center|LOCUS_00560 53100 53963 gene locus_tag LOCUS_00570 53100 53963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53950 55797 gene locus_tag LOCUS_00580 53950 55797 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103694.1 protein_id gnl|my_center|LOCUS_00580 55837 56502 gene locus_tag LOCUS_00590 gene cmk 55837 56502 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_00590 56690 58366 gene locus_tag LOCUS_00600 gene rpsA 56690 58366 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_00600 58385 58675 gene locus_tag LOCUS_00610 gene ihfB 58385 58675 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_00610 58796 59509 gene locus_tag LOCUS_00620 gene pyrF 58796 59509 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58643 protein_id gnl|my_center|LOCUS_00620 59606 59962 gene locus_tag LOCUS_00630 59606 59962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57134 protein_id gnl|my_center|LOCUS_00630 60046 61095 gene locus_tag LOCUS_00640 60046 61095 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_00640 61092 63041 gene locus_tag LOCUS_00650 gene wbfY 61092 63041 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_00650 63799 63098 gene locus_tag LOCUS_00660 63799 63098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63976 63902 gene locus_tag LOCUS_t00010 63976 63902 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 64140 66203 gene locus_tag LOCUS_00670 gene uvrB 64140 66203 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_00670 66304 66380 gene locus_tag LOCUS_t00020 66304 66380 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 66446 68365 gene locus_tag LOCUS_00680 gene thrS 66446 68365 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_00680 68420 68950 gene locus_tag LOCUS_00690 gene infC 68420 68950 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_00690 69020 69214 gene locus_tag LOCUS_00700 gene rpmI 69020 69214 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A1 protein_id gnl|my_center|LOCUS_00700 69240 69599 gene locus_tag LOCUS_00710 gene rplT 69240 69599 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A159 protein_id gnl|my_center|LOCUS_00710 69709 70887 gene locus_tag LOCUS_00720 69709 70887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 70925 73324 gene locus_tag LOCUS_00730 gene pheT 70925 73324 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 protein_id gnl|my_center|LOCUS_00730 73327 73632 gene locus_tag LOCUS_00740 gene ihfA 73327 73632 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG1 protein_id gnl|my_center|LOCUS_00740 73616 73969 gene locus_tag LOCUS_00750 73616 73969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_00750 74214 77123 gene locus_tag LOCUS_00760 74214 77123 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_00760 77264 77340 gene locus_tag LOCUS_t00030 77264 77340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 77507 78766 gene locus_tag LOCUS_00770 77507 78766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 78759 79262 gene locus_tag LOCUS_00780 78759 79262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 79268 79753 gene locus_tag LOCUS_00790 79268 79753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968939.1 protein_id gnl|my_center|LOCUS_00790 79780 80967 gene locus_tag LOCUS_00800 79780 80967 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_00800 80974 82590 gene locus_tag LOCUS_00810 80974 82590 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F8 protein_id gnl|my_center|LOCUS_00810 82803 83972 gene locus_tag LOCUS_00820 82803 83972 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_00820 84035 87172 gene locus_tag LOCUS_00830 84035 87172 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_00830 87203 87799 gene locus_tag LOCUS_00840 87203 87799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_00840 87818 89770 gene locus_tag LOCUS_00850 87818 89770 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_00850 90735 89782 gene locus_tag LOCUS_00860 90735 89782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 90808 91077 gene locus_tag LOCUS_00870 90808 91077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_00870 91371 91631 gene locus_tag LOCUS_00880 91371 91631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93224 91581 gene locus_tag LOCUS_00890 gene nadB 93224 91581 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_00890 93356 93934 gene locus_tag LOCUS_00900 gene algU 93356 93934 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_00900 94067 94702 gene locus_tag LOCUS_00910 94067 94702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 94874 96313 gene locus_tag LOCUS_00920 gene mucD 94874 96313 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_00920 96407 98206 gene locus_tag LOCUS_00930 gene lepA 96407 98206 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF8 protein_id gnl|my_center|LOCUS_00930 98206 98979 gene locus_tag LOCUS_00940 gene lepB 98206 98979 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_00940 98988 99692 gene locus_tag LOCUS_00950 gene rnc 98988 99692 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E314 protein_id gnl|my_center|LOCUS_00950 99685 100584 gene locus_tag LOCUS_00960 gene era 99685 100584 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_00960 100617 101372 gene locus_tag LOCUS_00970 gene recO 100617 101372 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E316 protein_id gnl|my_center|LOCUS_00970 101423 102322 gene locus_tag LOCUS_00980 101423 102322 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_00980 102332 103720 gene locus_tag LOCUS_00990 gene rlmD 102332 103720 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_00990 103734 105776 gene locus_tag LOCUS_01000 gene relA 103734 105776 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_01000 105769 106617 gene locus_tag LOCUS_01010 gene mazG 105769 106617 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_01010 106645 107295 gene locus_tag LOCUS_01020 gene adk 106645 107295 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_01020 107464 108444 gene locus_tag LOCUS_01030 107464 108444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 108504 109220 gene locus_tag LOCUS_01040 gene tsaB 108504 109220 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD1 protein_id gnl|my_center|LOCUS_01040 109220 109954 gene locus_tag LOCUS_01050 gene rsmJ 109220 109954 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AW6 protein_id gnl|my_center|LOCUS_01050 111171 109960 gene locus_tag LOCUS_01060 gene dapE 111171 109960 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_01060 112212 111181 gene locus_tag LOCUS_01070 gene dapD 112212 111181 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_01070 112593 112252 gene locus_tag LOCUS_01080 112593 112252 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 protein_id gnl|my_center|LOCUS_01080 115271 112590 gene locus_tag LOCUS_01090 gene glnD 115271 112590 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_01090 116159 115386 gene locus_tag LOCUS_01100 gene map-1 116159 115386 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P4 protein_id gnl|my_center|LOCUS_01100 117397 116261 gene locus_tag LOCUS_01110 117397 116261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_01110 117445 118416 gene locus_tag LOCUS_01120 117445 118416 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_01120 118416 119399 gene locus_tag LOCUS_01130 gene cysB 118416 119399 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_01130 120122 119400 gene locus_tag LOCUS_01140 gene cysH 120122 119400 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_01140 120255 120872 gene locus_tag LOCUS_01150 gene thrH 120255 120872 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_01150 122315 120864 gene locus_tag LOCUS_01160 gene pabB 122315 120864 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_01160 123016 122315 gene locus_tag LOCUS_01170 123016 122315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 124251 123076 gene locus_tag LOCUS_01180 124251 123076 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_01180 125702 124335 gene locus_tag LOCUS_01190 125702 124335 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_01190 126408 125716 gene locus_tag LOCUS_01200 gene hflD 126408 125716 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44796 protein_id gnl|my_center|LOCUS_01200 127489 126389 gene locus_tag LOCUS_01210 gene mnmA 127489 126389 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_01210 127962 127486 gene locus_tag LOCUS_01220 127962 127486 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_01220 128124 128672 gene locus_tag LOCUS_01230 gene moaC 128124 128672 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_01230 128666 128917 gene locus_tag LOCUS_01240 gene moaD 128666 128917 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UW6 protein_id gnl|my_center|LOCUS_01240 128920 129417 gene locus_tag LOCUS_01250 gene moaE 128920 129417 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT77 protein_id gnl|my_center|LOCUS_01250 131074 129431 gene locus_tag LOCUS_01260 131074 129431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 133326 131086 gene locus_tag LOCUS_01270 133326 131086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188913.1 protein_id gnl|my_center|LOCUS_01270 133325 133489 gene locus_tag LOCUS_01280 133325 133489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 134064 133492 gene locus_tag LOCUS_01290 134064 133492 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_01290 134141 135394 gene locus_tag LOCUS_01300 gene icd 134141 135394 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_01300 135680 135462 gene locus_tag LOCUS_01310 135680 135462 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_01310 135937 136293 gene locus_tag LOCUS_01320 gene clpS 135937 136293 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_01320 136304 138595 gene locus_tag LOCUS_01330 gene clpA 136304 138595 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_01330 138934 138716 gene locus_tag LOCUS_01340 gene infA 138934 138716 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_01340 139728 139012 gene locus_tag LOCUS_01350 gene aat 139728 139012 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_01350 140680 139733 gene locus_tag LOCUS_01360 gene trxB1 140680 139733 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_01360 140900 143221 gene locus_tag LOCUS_01370 gene ftsK 140900 143221 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS5 protein_id gnl|my_center|LOCUS_01370 143257 143952 gene locus_tag LOCUS_01380 gene lolA 143257 143952 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_01380 143959 145317 gene locus_tag LOCUS_01390 143959 145317 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_01390 145314 145706 gene locus_tag LOCUS_01400 gene crcB 145314 145706 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_01400 145747 147030 gene locus_tag LOCUS_01410 gene serS 145747 147030 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A8L4 protein_id gnl|my_center|LOCUS_01410 147033 148418 gene locus_tag LOCUS_01420 gene cysG 147033 148418 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_01420 149779 148424 gene locus_tag LOCUS_01430 149779 148424 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_01430 150632 149772 gene locus_tag LOCUS_01440 150632 149772 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_01440 151787 150684 gene locus_tag LOCUS_01450 gene purC 151787 150684 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q87 protein_id gnl|my_center|LOCUS_01450 152202 151864 gene locus_tag LOCUS_01460 152202 151864 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_01460 152521 152207 gene locus_tag LOCUS_01470 gene dsrH 152521 152207 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_01470 152883 152518 gene locus_tag LOCUS_01480 152883 152518 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104502.1 protein_id gnl|my_center|LOCUS_01480 153272 152880 gene locus_tag LOCUS_01490 gene tusD 153272 152880 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_01490 154046 153378 gene locus_tag LOCUS_01500 154046 153378 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_01500 154229 154319 gene locus_tag LOCUS_t00040 154229 154319 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 155437 154442 gene locus_tag LOCUS_01510 155437 154442 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 protein_id gnl|my_center|LOCUS_01510 156444 155428 gene locus_tag LOCUS_01520 156444 155428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 156579 158015 gene locus_tag LOCUS_01530 156579 158015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804006.1 protein_id gnl|my_center|LOCUS_01530 159369 158023 gene locus_tag LOCUS_01540 159369 158023 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_01540 160732 159377 gene locus_tag LOCUS_01550 160732 159377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_01550 161049 163328 gene locus_tag LOCUS_01560 161049 163328 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_01560 164783 163356 gene locus_tag LOCUS_01570 164783 163356 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_01570 164985 166172 gene locus_tag LOCUS_01580 164985 166172 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_01580 168528 166198 gene locus_tag LOCUS_01590 gene prc 168528 166198 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_01590 169884 168655 gene locus_tag LOCUS_01600 169884 168655 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_01600 170019 171317 gene locus_tag LOCUS_01610 170019 171317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 171411 171959 gene locus_tag LOCUS_01620 171411 171959 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084031.1 protein_id gnl|my_center|LOCUS_01620 171956 173035 gene locus_tag LOCUS_01630 171956 173035 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_01630 173048 176116 gene locus_tag LOCUS_01640 173048 176116 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881459.1 protein_id gnl|my_center|LOCUS_01640 176121 176711 gene locus_tag LOCUS_01650 176121 176711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 177145 177348 gene locus_tag LOCUS_01660 177145 177348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 177429 178811 gene locus_tag LOCUS_01670 177429 178811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 178804 180099 gene locus_tag LOCUS_01680 178804 180099 CDS product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 protein_id gnl|my_center|LOCUS_01680 181073 180036 gene locus_tag LOCUS_01690 181073 180036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 182434 181070 gene locus_tag LOCUS_01700 gene gor 182434 181070 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812173.1 protein_id gnl|my_center|LOCUS_01700 182567 184252 gene locus_tag LOCUS_01710 182567 184252 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_01710 184274 185422 gene locus_tag LOCUS_01720 184274 185422 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_01720 185965 185453 gene locus_tag LOCUS_01730 185965 185453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 186367 185996 gene locus_tag LOCUS_01740 gene pilZ 186367 185996 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_01740 187326 186331 gene locus_tag LOCUS_01750 gene holB 187326 186331 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_01750 188020 187319 gene locus_tag LOCUS_01760 gene tmk 188020 187319 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_01760 189068 188028 gene locus_tag LOCUS_01770 189068 188028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_01770 189942 189073 gene locus_tag LOCUS_01780 gene pabC 189942 189073 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_01780 191177 189960 gene locus_tag LOCUS_01790 gene fabF 191177 189960 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG8 protein_id gnl|my_center|LOCUS_01790 191539 191306 gene locus_tag LOCUS_01800 gene acpP 191539 191306 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80923 protein_id gnl|my_center|LOCUS_01800 192496 191750 gene locus_tag LOCUS_01810 gene fabG 192496 191750 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_01810 193465 192530 gene locus_tag LOCUS_01820 gene fabD 193465 192530 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAW8 protein_id gnl|my_center|LOCUS_01820 194533 193478 gene locus_tag LOCUS_01830 gene plsX 194533 193478 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH0 protein_id gnl|my_center|LOCUS_01830 194715 194536 gene locus_tag LOCUS_01840 gene rpmF 194715 194536 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44368 protein_id gnl|my_center|LOCUS_01840 195320 194760 gene locus_tag LOCUS_01850 195320 194760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_01850 196390 195413 gene locus_tag LOCUS_01860 196390 195413 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_01860 196534 198270 gene locus_tag LOCUS_01870 gene argS 196534 198270 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF5 protein_id gnl|my_center|LOCUS_01870 200310 198400 gene locus_tag LOCUS_01880 gene htpG 200310 198400 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y9 protein_id gnl|my_center|LOCUS_01880 201799 200444 gene locus_tag LOCUS_01890 201799 200444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 202414 201806 gene locus_tag LOCUS_01900 202414 201806 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_01900 202813 202418 gene locus_tag LOCUS_01910 202813 202418 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_01910 203380 202859 gene locus_tag LOCUS_01920 gene exbB 203380 202859 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_01920 204792 203392 gene locus_tag LOCUS_01930 204792 203392 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_01930 205580 204789 gene locus_tag LOCUS_01940 205580 204789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 206833 205961 gene locus_tag LOCUS_01950 gene sucD 206833 205961 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_01950 207999 206833 gene locus_tag LOCUS_01960 gene sucC 207999 206833 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_01960 209483 208032 gene locus_tag LOCUS_01970 gene lpdA 209483 208032 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Z5 protein_id gnl|my_center|LOCUS_01970 210871 209606 gene locus_tag LOCUS_01980 gene sucB 210871 209606 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_01980 213763 210920 gene locus_tag LOCUS_01990 gene sucA 213763 210920 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_01990 214558 213854 gene locus_tag LOCUS_02000 gene sdhB 214558 213854 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 protein_id gnl|my_center|LOCUS_02000 216359 214587 gene locus_tag LOCUS_02010 gene sdhA 216359 214587 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_02010 216737 216360 gene locus_tag LOCUS_02020 216737 216360 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 protein_id gnl|my_center|LOCUS_02020 217183 216731 gene locus_tag LOCUS_02030 217183 216731 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_02030 217549 218829 gene locus_tag LOCUS_02040 gene gltA 217549 218829 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A2 protein_id gnl|my_center|LOCUS_02040 218992 218917 gene locus_tag LOCUS_t00050 218992 218917 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 220610 219087 gene locus_tag LOCUS_02050 gene gltX 220610 219087 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_02050 220812 221774 gene locus_tag LOCUS_02060 gene dusA 220812 221774 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_02060 221771 222247 gene locus_tag LOCUS_02070 221771 222247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105839.1 protein_id gnl|my_center|LOCUS_02070 222957 222244 gene locus_tag LOCUS_02080 222957 222244 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_02080 226753 222992 gene locus_tag LOCUS_02090 226753 222992 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_02090 228421 226757 gene locus_tag LOCUS_02100 228421 226757 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268682.1 protein_id gnl|my_center|LOCUS_02100 229625 228447 gene locus_tag LOCUS_02110 229625 228447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_02110 230472 229630 gene locus_tag LOCUS_02120 230472 229630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_02120 230815 230483 gene locus_tag LOCUS_02130 230815 230483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 231317 230853 gene locus_tag LOCUS_02140 231317 230853 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_02140 232473 231310 gene locus_tag LOCUS_02150 gene rnd 232473 231310 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_02150 233092 232496 gene locus_tag LOCUS_02160 gene recR 233092 232496 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT49 protein_id gnl|my_center|LOCUS_02160 233452 233132 gene locus_tag LOCUS_02170 233452 233132 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_02170 235292 233439 gene locus_tag LOCUS_02180 235292 233439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 237494 235614 gene locus_tag LOCUS_02190 237494 235614 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_02190 239403 237508 gene locus_tag LOCUS_02200 239403 237508 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_02200 240130 240043 gene locus_tag LOCUS_t00060 240130 240043 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 241234 240386 gene locus_tag LOCUS_02210 gene queF 241234 240386 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV71 protein_id gnl|my_center|LOCUS_02210 242009 241236 gene locus_tag LOCUS_02220 242009 241236 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_02220 242964 242032 gene locus_tag LOCUS_02230 242964 242032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_02230 243130 243055 gene locus_tag LOCUS_t00070 243130 243055 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 243362 243108 gene locus_tag LOCUS_02240 243362 243108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 243454 244203 gene locus_tag LOCUS_02250 243454 244203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 244411 244677 gene locus_tag LOCUS_02260 244411 244677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 244730 245365 gene locus_tag LOCUS_02270 gene dut 244730 245365 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_02270 245967 245386 gene locus_tag LOCUS_02280 gene nfuA 245967 245386 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_02280 246147 249857 gene locus_tag LOCUS_02290 gene metH 246147 249857 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_02290 249881 250090 gene locus_tag LOCUS_02300 249881 250090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 250310 250095 gene locus_tag LOCUS_02310 250310 250095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 250445 252079 gene locus_tag LOCUS_02320 gene cysI 250445 252079 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_02320 252133 252657 gene locus_tag LOCUS_02330 252133 252657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_02330 253704 252661 gene locus_tag LOCUS_02340 253704 252661 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_02340 254786 253743 gene locus_tag LOCUS_02350 254786 253743 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_02350 255589 254801 gene locus_tag LOCUS_02360 gene nudC 255589 254801 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882A9 protein_id gnl|my_center|LOCUS_02360 256311 255586 gene locus_tag LOCUS_02370 gene dnaQ 256311 255586 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_02370 256690 256313 gene locus_tag LOCUS_02380 gene rnhA 256690 256313 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_02380 257642 256770 gene locus_tag LOCUS_02390 257642 256770 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 protein_id gnl|my_center|LOCUS_02390 257743 258522 gene locus_tag LOCUS_02400 gene gloB 257743 258522 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUA5 protein_id gnl|my_center|LOCUS_02400 258564 259967 gene locus_tag LOCUS_02410 258564 259967 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_02410 261702 260008 gene locus_tag LOCUS_02420 261702 260008 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_02420 262045 261689 gene locus_tag LOCUS_02430 262045 261689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 263511 262045 gene locus_tag LOCUS_02440 263511 262045 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389324.1 protein_id gnl|my_center|LOCUS_02440 264986 263508 gene locus_tag LOCUS_02450 264986 263508 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02450 265339 264986 gene locus_tag LOCUS_02460 265339 264986 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02460 265758 265336 gene locus_tag LOCUS_02470 265758 265336 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_02470 266308 265751 gene locus_tag LOCUS_02480 266308 265751 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_02480 266634 266305 gene locus_tag LOCUS_02490 266634 266305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 266947 266639 gene locus_tag LOCUS_02500 266947 266639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 267423 266944 gene locus_tag LOCUS_02510 267423 266944 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_02510 269529 267664 gene locus_tag LOCUS_02520 gene ppiD 269529 267664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_02520 269941 269666 gene locus_tag LOCUS_02530 gene hupB 269941 269666 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_02530 272604 270169 gene locus_tag LOCUS_02540 gene lon 272604 270169 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_02540 274003 272720 gene locus_tag LOCUS_02550 gene clpX 274003 272720 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_02550 274673 274035 gene locus_tag LOCUS_02560 gene clpP 274673 274035 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 protein_id gnl|my_center|LOCUS_02560 276038 274686 gene locus_tag LOCUS_02570 gene tig 276038 274686 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_02570 276381 276659 gene locus_tag LOCUS_02580 276381 276659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 277587 276634 gene locus_tag LOCUS_02590 277587 276634 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_02590 277699 278619 gene locus_tag LOCUS_02600 277699 278619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_02600 278612 279502 gene locus_tag LOCUS_02610 278612 279502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 280283 279540 gene locus_tag LOCUS_02620 280283 279540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 280732 280337 gene locus_tag LOCUS_02630 gene msrB 280732 280337 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_02630 280821 282041 gene locus_tag LOCUS_02640 280821 282041 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179458.1 protein_id gnl|my_center|LOCUS_02640 283234 282062 gene locus_tag LOCUS_02650 gene pdxB 283234 282062 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_02650 284186 283239 gene locus_tag LOCUS_02660 284186 283239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 284425 284183 gene locus_tag LOCUS_02670 gene tusA 284425 284183 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_02670 284658 284449 gene locus_tag LOCUS_02680 284658 284449 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ0 protein_id gnl|my_center|LOCUS_02680 285554 284661 gene locus_tag LOCUS_02690 gene ttcA 285554 284661 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKM7 protein_id gnl|my_center|LOCUS_02690 287707 285566 gene locus_tag LOCUS_02700 gene fadB 287707 285566 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_02700 288842 287760 gene locus_tag LOCUS_02710 gene rffG 288842 287760 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI74 protein_id gnl|my_center|LOCUS_02710 289971 288862 gene locus_tag LOCUS_02720 289971 288862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 291917 289968 gene locus_tag LOCUS_02730 291917 289968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 292146 292021 gene locus_tag LOCUS_02740 292146 292021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 292177 292656 gene locus_tag LOCUS_02750 292177 292656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 292656 293546 gene locus_tag LOCUS_02760 292656 293546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_02760 293543 293962 gene locus_tag LOCUS_02770 293543 293962 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_02770 294456 293959 gene locus_tag LOCUS_02780 gene recX 294456 293959 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XY8 protein_id gnl|my_center|LOCUS_02780 295507 294449 gene locus_tag LOCUS_02790 gene recA 295507 294449 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_02790 296191 295625 gene locus_tag LOCUS_02800 296191 295625 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766018.1 protein_id gnl|my_center|LOCUS_02800 296227 297681 gene locus_tag LOCUS_02810 gene sdaA 296227 297681 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86564 protein_id gnl|my_center|LOCUS_02810 297778 300399 gene locus_tag LOCUS_02820 gene mutS 297778 300399 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_02820 300496 300822 gene locus_tag LOCUS_02830 gene fdxA 300496 300822 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_02830 301746 300877 gene locus_tag LOCUS_02840 gene rpoS 301746 300877 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKE3 protein_id gnl|my_center|LOCUS_02840 302896 301862 gene locus_tag LOCUS_02850 302896 301862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 303773 302919 gene locus_tag LOCUS_02860 303773 302919 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_02860 304460 303774 gene locus_tag LOCUS_02870 gene pcm 304460 303774 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_02870 305606 304485 gene locus_tag LOCUS_02880 gene truD 305606 304485 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_02880 306093 305596 gene locus_tag LOCUS_02890 gene ispF 306093 305596 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A0 protein_id gnl|my_center|LOCUS_02890 306859 306119 gene locus_tag LOCUS_02900 gene ispD 306859 306119 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPU8 protein_id gnl|my_center|LOCUS_02900 307178 306909 gene locus_tag LOCUS_02910 gene ftsB 307178 306909 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_02910 308545 307250 gene locus_tag LOCUS_02920 gene eno 308545 307250 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_02920 309450 308593 gene locus_tag LOCUS_02930 gene kdsA 309450 308593 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFK4 protein_id gnl|my_center|LOCUS_02930 311081 309447 gene locus_tag LOCUS_02940 gene pyrG 311081 309447 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_02940 312560 311172 gene locus_tag LOCUS_02950 gene tilS 312560 311172 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_02950 313566 312613 gene locus_tag LOCUS_02960 gene accA 313566 312613 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR2 protein_id gnl|my_center|LOCUS_02960 317222 313647 gene locus_tag LOCUS_02970 gene dnaE 317222 313647 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_02970 317879 317244 gene locus_tag LOCUS_02980 gene rnhB 317879 317244 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M9 protein_id gnl|my_center|LOCUS_02980 319051 317879 gene locus_tag LOCUS_02990 gene lpxB 319051 317879 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_02990 319893 319123 gene locus_tag LOCUS_03000 gene lpxA 319893 319123 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR6 protein_id gnl|my_center|LOCUS_03000 320333 319890 gene locus_tag LOCUS_03010 gene fabZ 320333 319890 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_03010 321412 320336 gene locus_tag LOCUS_03020 gene lpxD 321412 320336 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR8 protein_id gnl|my_center|LOCUS_03020 321944 321435 gene locus_tag LOCUS_03030 321944 321435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 324700 322028 gene locus_tag LOCUS_03040 gene bamA 324700 322028 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_03040 326237 324801 gene locus_tag LOCUS_03050 326237 324801 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N6 protein_id gnl|my_center|LOCUS_03050 327476 326259 gene locus_tag LOCUS_03060 gene dxr 327476 326259 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD0 protein_id gnl|my_center|LOCUS_03060 328327 327473 gene locus_tag LOCUS_03070 gene cdsA 328327 327473 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_03070 329131 328361 gene locus_tag LOCUS_03080 gene uppS 329131 328361 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N9 protein_id gnl|my_center|LOCUS_03080 329706 329149 gene locus_tag LOCUS_03090 gene frr 329706 329149 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_03090 330456 329719 gene locus_tag LOCUS_03100 gene pyrH 330456 329719 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P1 protein_id gnl|my_center|LOCUS_03100 331383 330502 gene locus_tag LOCUS_03110 gene tsf 331383 330502 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_03110 332342 331527 gene locus_tag LOCUS_03120 gene rpsB 332342 331527 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_03120 332640 333770 gene locus_tag LOCUS_03130 332640 333770 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_03130 334650 333802 gene locus_tag LOCUS_03140 334650 333802 CDS product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_03140 335209 334901 gene locus_tag LOCUS_03150 gene bolA 335209 334901 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348065.1 protein_id gnl|my_center|LOCUS_03150 335309 336244 gene locus_tag LOCUS_03160 gene rbgA 335309 336244 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_03160 336241 339021 gene locus_tag LOCUS_03170 gene hepA 336241 339021 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_03170 339077 342055 gene locus_tag LOCUS_03180 gene preP2 339077 342055 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_03180 343819 342050 gene locus_tag LOCUS_03190 343819 342050 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706363.1 protein_id gnl|my_center|LOCUS_03190 343902 344075 gene locus_tag LOCUS_03200 343902 344075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 344622 344218 gene locus_tag LOCUS_03210 344622 344218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 345698 344646 gene locus_tag LOCUS_03220 345698 344646 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_03220 346041 345727 gene locus_tag LOCUS_03230 346041 345727 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV60 protein_id gnl|my_center|LOCUS_03230 346199 347101 gene locus_tag LOCUS_03240 gene argF 346199 347101 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 protein_id gnl|my_center|LOCUS_03240 347189 349039 gene locus_tag LOCUS_03250 347189 349039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 349197 352052 gene locus_tag LOCUS_03260 gene nrdA 349197 352052 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_03260 352078 353508 gene locus_tag LOCUS_03270 352078 353508 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ19 protein_id gnl|my_center|LOCUS_03270 353646 354239 gene locus_tag LOCUS_03280 353646 354239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104132.1 protein_id gnl|my_center|LOCUS_03280 354241 355113 gene locus_tag LOCUS_03290 354241 355113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 355168 355386 gene locus_tag LOCUS_03300 355168 355386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 357579 355387 gene locus_tag LOCUS_03310 357579 355387 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_03310 357969 359684 gene locus_tag LOCUS_03320 357969 359684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 360865 359696 gene locus_tag LOCUS_03330 360865 359696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_03330 362452 360947 gene locus_tag LOCUS_03340 gene sbcB 362452 360947 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG2 protein_id gnl|my_center|LOCUS_03340 362564 363577 gene locus_tag LOCUS_03350 gene pyrB 362564 363577 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_03350 363626 364759 gene locus_tag LOCUS_03360 363626 364759 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_03360 365956 364802 gene locus_tag LOCUS_03370 365956 364802 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_03370 366740 365970 gene locus_tag LOCUS_03380 366740 365970 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 protein_id gnl|my_center|LOCUS_03380 366877 367995 gene locus_tag LOCUS_03390 366877 367995 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_03390 367989 369413 gene locus_tag LOCUS_03400 367989 369413 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_03400 369503 370123 gene locus_tag LOCUS_03410 gene ppa 369503 370123 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_03410 371120 370143 gene locus_tag LOCUS_03420 371120 370143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_03420 372555 371155 gene locus_tag LOCUS_03430 372555 371155 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_03430 372749 373711 gene locus_tag LOCUS_03440 gene cheC 372749 373711 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_03440 373708 374685 gene locus_tag LOCUS_03450 373708 374685 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_03450 375223 374726 gene locus_tag LOCUS_03460 375223 374726 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_03460 377405 375228 gene locus_tag LOCUS_03470 377405 375228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 379290 377449 gene locus_tag LOCUS_03480 379290 377449 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_03480 379499 381187 gene locus_tag LOCUS_03490 gene ilvD 379499 381187 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_03490 381181 382131 gene locus_tag LOCUS_03500 gene corA 381181 382131 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2R9 protein_id gnl|my_center|LOCUS_03500 382254 383630 gene locus_tag LOCUS_03510 382254 383630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_03510 384219 383680 gene locus_tag LOCUS_03520 384219 383680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 385465 384326 gene locus_tag LOCUS_03530 385465 384326 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_03530 386782 385502 gene locus_tag LOCUS_03540 386782 385502 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_03540 387107 387313 gene locus_tag LOCUS_03550 387107 387313 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_03550 389230 387404 gene locus_tag LOCUS_03560 gene acaD9 389230 387404 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_03560 389918 389256 gene locus_tag LOCUS_03570 389918 389256 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405490.1 protein_id gnl|my_center|LOCUS_03570 390232 391176 gene locus_tag LOCUS_03580 390232 391176 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106260.1 protein_id gnl|my_center|LOCUS_03580 391173 394232 gene locus_tag LOCUS_03590 391173 394232 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_03590 396523 394883 gene locus_tag LOCUS_03600 396523 394883 CDS product putative medium chain fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702815.1 protein_id gnl|my_center|LOCUS_03600 397151 396747 gene locus_tag LOCUS_03610 397151 396747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 398811 397240 gene locus_tag LOCUS_03620 398811 397240 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_03620 399278 401491 gene locus_tag LOCUS_03630 399278 401491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 401716 404259 gene locus_tag LOCUS_03640 gene bfeA 401716 404259 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035650.1 protein_id gnl|my_center|LOCUS_03640 404333 404965 gene locus_tag LOCUS_03650 404333 404965 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_03650 404986 405504 gene locus_tag LOCUS_03660 gene tdcF 404986 405504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 protein_id gnl|my_center|LOCUS_03660 405530 406114 gene locus_tag LOCUS_03670 405530 406114 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066960.1 protein_id gnl|my_center|LOCUS_03670 407753 406131 gene locus_tag LOCUS_03680 407753 406131 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_03680 408755 407799 gene locus_tag LOCUS_03690 408755 407799 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_03690 409806 408811 gene locus_tag LOCUS_03700 409806 408811 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_03700 410356 409907 gene locus_tag LOCUS_03710 gene hspL 410356 409907 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973403.1 protein_id gnl|my_center|LOCUS_03710 410890 412176 gene locus_tag LOCUS_03720 410890 412176 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_03720 412216 413166 gene locus_tag LOCUS_03730 412216 413166 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_03730 413166 414404 gene locus_tag LOCUS_03740 413166 414404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 414401 415153 gene locus_tag LOCUS_03750 414401 415153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 415146 415841 gene locus_tag LOCUS_03760 415146 415841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930656.1 protein_id gnl|my_center|LOCUS_03760 415881 416648 gene locus_tag LOCUS_03770 415881 416648 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_03770 416768 418657 gene locus_tag LOCUS_03780 416768 418657 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 protein_id gnl|my_center|LOCUS_03780 418647 419744 gene locus_tag LOCUS_03790 418647 419744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 420349 420170 gene locus_tag LOCUS_03800 420349 420170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 420348 421502 gene locus_tag LOCUS_03810 420348 421502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 423030 421444 gene locus_tag LOCUS_03820 423030 421444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 424294 423062 gene locus_tag LOCUS_03830 gene purT 424294 423062 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ4 protein_id gnl|my_center|LOCUS_03830 424406 425281 gene locus_tag LOCUS_03840 424406 425281 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_03840 425278 425787 gene locus_tag LOCUS_03850 425278 425787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 425894 427165 gene locus_tag LOCUS_03860 425894 427165 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919955.1 protein_id gnl|my_center|LOCUS_03860 428903 427185 gene locus_tag LOCUS_03870 428903 427185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085229.1 protein_id gnl|my_center|LOCUS_03870 429209 428928 gene locus_tag LOCUS_03880 429209 428928 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709587.1 protein_id gnl|my_center|LOCUS_03880 430046 429222 gene locus_tag LOCUS_03890 430046 429222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709586.1 protein_id gnl|my_center|LOCUS_03890 430936 430043 gene locus_tag LOCUS_03900 430936 430043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709585.1 protein_id gnl|my_center|LOCUS_03900 432006 430933 gene locus_tag LOCUS_03910 432006 430933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067117.1 protein_id gnl|my_center|LOCUS_03910 433082 431994 gene locus_tag LOCUS_03920 433082 431994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531812.1 protein_id gnl|my_center|LOCUS_03920 434954 433083 gene locus_tag LOCUS_03930 434954 433083 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_03930 437441 435036 gene locus_tag LOCUS_03940 437441 435036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 439216 437540 gene locus_tag LOCUS_03950 439216 437540 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_03950 439344 439790 gene locus_tag LOCUS_03960 gene grp 439344 439790 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814558.1 protein_id gnl|my_center|LOCUS_03960 439918 440154 gene locus_tag LOCUS_03970 439918 440154 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462432.1 protein_id gnl|my_center|LOCUS_03970 441341 440151 gene locus_tag LOCUS_03980 441341 440151 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_03980 443943 441331 gene locus_tag LOCUS_03990 gene acnA 443943 441331 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065152.1 protein_id gnl|my_center|LOCUS_03990 445072 443945 gene locus_tag LOCUS_04000 gene prpC 445072 443945 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_04000 446001 445114 gene locus_tag LOCUS_04010 gene prpB 446001 445114 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_04010 446742 446005 gene locus_tag LOCUS_04020 446742 446005 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_04020 447576 446809 gene locus_tag LOCUS_04030 447576 446809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_04030 447693 449288 gene locus_tag LOCUS_04040 447693 449288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 449309 450085 gene locus_tag LOCUS_04050 449309 450085 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_04050 450176 450517 gene locus_tag LOCUS_04060 450176 450517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 450617 451102 gene locus_tag LOCUS_04070 gene tdcF 450617 451102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368469.1 protein_id gnl|my_center|LOCUS_04070 451131 452105 gene locus_tag LOCUS_04080 451131 452105 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 protein_id gnl|my_center|LOCUS_04080 452112 453452 gene locus_tag LOCUS_04090 452112 453452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 protein_id gnl|my_center|LOCUS_04090 453524 455107 gene locus_tag LOCUS_04100 453524 455107 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_04100 456196 455117 gene locus_tag LOCUS_04110 456196 455117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 458532 456313 gene locus_tag LOCUS_04120 458532 456313 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_04120 458597 460363 gene locus_tag LOCUS_04130 gene ggt 458597 460363 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 protein_id gnl|my_center|LOCUS_04130 460940 460395 gene locus_tag LOCUS_04140 460940 460395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 461220 461930 gene locus_tag LOCUS_04150 461220 461930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 462648 461953 gene locus_tag LOCUS_04160 gene yobE 462648 461953 CDS product putative SOS response-associated peptidase YobE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34915 protein_id gnl|my_center|LOCUS_04160 462879 463184 gene locus_tag LOCUS_04170 462879 463184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 463452 463249 gene locus_tag LOCUS_04180 463452 463249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 464368 463538 gene locus_tag LOCUS_04190 464368 463538 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702129.1 protein_id gnl|my_center|LOCUS_04190 464856 464386 gene locus_tag LOCUS_04200 464856 464386 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_04200 464983 465345 gene locus_tag LOCUS_04210 gene dgkA 464983 465345 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFY6 protein_id gnl|my_center|LOCUS_04210 465333 466907 gene locus_tag LOCUS_04220 465333 466907 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169462.1 protein_id gnl|my_center|LOCUS_04220 466968 467417 gene locus_tag LOCUS_04230 466968 467417 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_04230 467485 468531 gene locus_tag LOCUS_04240 467485 468531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337337.1 protein_id gnl|my_center|LOCUS_04240 468547 470076 gene locus_tag LOCUS_04250 468547 470076 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 protein_id gnl|my_center|LOCUS_04250 470147 471412 gene locus_tag LOCUS_04260 470147 471412 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_04260 473330 471498 gene locus_tag LOCUS_04270 473330 471498 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_04270 475344 473479 gene locus_tag LOCUS_04280 475344 473479 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390411.1 protein_id gnl|my_center|LOCUS_04280 475536 476981 gene locus_tag LOCUS_04290 475536 476981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 476993 477274 gene locus_tag LOCUS_04300 476993 477274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 477296 477532 gene locus_tag LOCUS_04310 477296 477532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 477554 478957 gene locus_tag LOCUS_04320 gene selA 477554 478957 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JQ3 protein_id gnl|my_center|LOCUS_04320 478954 480849 gene locus_tag LOCUS_04330 gene selB 478954 480849 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967006.1 protein_id gnl|my_center|LOCUS_04330 480862 480956 gene locus_tag LOCUS_t00080 480862 480956 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 481038 481508 gene locus_tag LOCUS_04340 481038 481508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 481501 483330 gene locus_tag LOCUS_04350 481501 483330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889506.1 protein_id gnl|my_center|LOCUS_04350 484465 483365 gene locus_tag LOCUS_04360 484465 483365 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192972.1 protein_id gnl|my_center|LOCUS_04360 485983 484481 gene locus_tag LOCUS_04370 485983 484481 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338852.1 protein_id gnl|my_center|LOCUS_04370 487744 486200 gene locus_tag LOCUS_04380 487744 486200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 489070 487820 gene locus_tag LOCUS_04390 489070 487820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 489903 489730 gene locus_tag LOCUS_04400 489903 489730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 489948 491600 gene locus_tag LOCUS_04410 489948 491600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 491974 491594 gene locus_tag LOCUS_04420 491974 491594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence02 511 2601 gene locus_tag LOCUS_04430 511 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2598 3461 gene locus_tag LOCUS_04440 2598 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3518 4717 gene locus_tag LOCUS_04450 3518 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4916 6949 gene locus_tag LOCUS_04460 4916 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04460 6946 7338 gene locus_tag LOCUS_04470 6946 7338 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_04470 7346 9256 gene locus_tag LOCUS_04480 7346 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9902 9192 gene locus_tag LOCUS_04490 9902 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10018 11214 gene locus_tag LOCUS_04500 10018 11214 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_04500 11214 11846 gene locus_tag LOCUS_04510 11214 11846 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 protein_id gnl|my_center|LOCUS_04510 14467 11843 gene locus_tag LOCUS_04520 14467 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 15387 14464 gene locus_tag LOCUS_04530 15387 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 15781 15377 gene locus_tag LOCUS_04540 15781 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15910 16176 gene locus_tag LOCUS_04550 15910 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_04550 16488 17747 gene locus_tag LOCUS_04560 16488 17747 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816748.1 protein_id gnl|my_center|LOCUS_04560 17776 18471 gene locus_tag LOCUS_04570 17776 18471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_04570 18508 20955 gene locus_tag LOCUS_04580 18508 20955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_04580 21051 21329 gene locus_tag LOCUS_04590 gene sdpR 21051 21329 CDS product transcriptional repressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32242 protein_id gnl|my_center|LOCUS_04590 21326 22000 gene locus_tag LOCUS_04600 gene sdpI 21326 22000 CDS product immunity protein SdpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32241 protein_id gnl|my_center|LOCUS_04600 22072 23256 gene locus_tag LOCUS_04610 22072 23256 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_04610 23387 24385 gene locus_tag LOCUS_04620 23387 24385 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_04620 25289 24396 gene locus_tag LOCUS_04630 25289 24396 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_04630 25836 25300 gene locus_tag LOCUS_04640 25836 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120933.1 protein_id gnl|my_center|LOCUS_04640 27733 25847 gene locus_tag LOCUS_04650 27733 25847 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_04650 29370 28204 gene locus_tag LOCUS_04660 29370 28204 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 protein_id gnl|my_center|LOCUS_04660 29744 30469 gene locus_tag LOCUS_04670 29744 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 30525 30977 gene locus_tag LOCUS_04680 30525 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 31820 31101 gene locus_tag LOCUS_04690 31820 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_04690 32101 33156 gene locus_tag LOCUS_04700 32101 33156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 33181 33594 gene locus_tag LOCUS_04710 33181 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 33591 34130 gene locus_tag LOCUS_04720 33591 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 34403 34164 gene locus_tag LOCUS_04730 34403 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 34584 35261 gene locus_tag LOCUS_04740 34584 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 36880 35291 gene locus_tag LOCUS_04750 36880 35291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 37787 36861 gene locus_tag LOCUS_04760 37787 36861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 38835 37819 gene locus_tag LOCUS_04770 38835 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 40165 38882 gene locus_tag LOCUS_04780 40165 38882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 40812 40216 gene locus_tag LOCUS_04790 40812 40216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 41117 40842 gene locus_tag LOCUS_04800 41117 40842 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_04800 41363 43030 gene locus_tag LOCUS_04810 gene yidK 41363 43030 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_04810 43056 44276 gene locus_tag LOCUS_04820 43056 44276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 44276 45253 gene locus_tag LOCUS_04830 44276 45253 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_04830 45246 46259 gene locus_tag LOCUS_04840 45246 46259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_04840 48021 46297 gene locus_tag LOCUS_04850 48021 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 48569 48021 gene locus_tag LOCUS_04860 48569 48021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968864.1 protein_id gnl|my_center|LOCUS_04860 48769 51012 gene locus_tag LOCUS_04870 48769 51012 CDS product 7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403897.1 protein_id gnl|my_center|LOCUS_04870 51185 54139 gene locus_tag LOCUS_04880 51185 54139 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918867.1 protein_id gnl|my_center|LOCUS_04880 54153 54932 gene locus_tag LOCUS_04890 54153 54932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_04890 55713 54958 gene locus_tag LOCUS_04900 55713 54958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 55852 56985 gene locus_tag LOCUS_04910 55852 56985 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_04910 58345 57032 gene locus_tag LOCUS_04920 58345 57032 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545572.1 protein_id gnl|my_center|LOCUS_04920 58750 60000 gene locus_tag LOCUS_04930 58750 60000 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550333.1 protein_id gnl|my_center|LOCUS_04930 60056 60928 gene locus_tag LOCUS_04940 60056 60928 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_04940 61297 60902 gene locus_tag LOCUS_04950 61297 60902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 62174 61266 gene locus_tag LOCUS_04960 gene gcvA 62174 61266 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_04960 62370 63797 gene locus_tag LOCUS_04970 62370 63797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 64431 63877 gene locus_tag LOCUS_04980 64431 63877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 65049 64513 gene locus_tag LOCUS_04990 65049 64513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 65412 65717 gene locus_tag LOCUS_05000 65412 65717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 65717 66973 gene locus_tag LOCUS_05010 65717 66973 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_05010 69130 66995 gene locus_tag LOCUS_05020 gene ppk 69130 66995 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM32 protein_id gnl|my_center|LOCUS_05020 69433 70338 gene locus_tag LOCUS_05030 69433 70338 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_05030 70393 72126 gene locus_tag LOCUS_05040 70393 72126 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_05040 73355 72201 gene locus_tag LOCUS_05050 73355 72201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_05050 73479 74048 gene locus_tag LOCUS_05060 73479 74048 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887576.1 protein_id gnl|my_center|LOCUS_05060 75429 76775 gene locus_tag LOCUS_05070 75429 76775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 77945 76845 gene locus_tag LOCUS_05080 77945 76845 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_05080 78935 77997 gene locus_tag LOCUS_05090 78935 77997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 79135 80928 gene locus_tag LOCUS_05100 79135 80928 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_05100 80928 81647 gene locus_tag LOCUS_05110 80928 81647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 81688 83307 gene locus_tag LOCUS_05120 81688 83307 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918081.1 protein_id gnl|my_center|LOCUS_05120 83856 83524 gene locus_tag LOCUS_05130 83856 83524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_05130 84386 83853 gene locus_tag LOCUS_05140 84386 83853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_05140 88605 84409 gene locus_tag LOCUS_05150 88605 84409 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_05150 90647 88623 gene locus_tag LOCUS_05160 90647 88623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_05160 91900 90986 gene locus_tag LOCUS_05170 91900 90986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392932.1 protein_id gnl|my_center|LOCUS_05170 94058 92019 gene locus_tag LOCUS_05180 94058 92019 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_05180 94257 94634 gene locus_tag LOCUS_05190 94257 94634 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_05190 95783 95100 gene locus_tag LOCUS_05200 95783 95100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 95862 96146 gene locus_tag LOCUS_05210 95862 96146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 96584 96769 gene locus_tag LOCUS_05220 96584 96769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 96892 97542 gene locus_tag LOCUS_05230 96892 97542 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_05230 97677 98666 gene locus_tag LOCUS_05240 97677 98666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 99042 100169 gene locus_tag LOCUS_05250 99042 100169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 100874 100323 gene locus_tag LOCUS_05260 100874 100323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 100966 101145 gene locus_tag LOCUS_05270 100966 101145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 102254 101415 gene locus_tag LOCUS_05280 102254 101415 CDS product putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_395223.1 protein_id gnl|my_center|LOCUS_05280 102541 102275 gene locus_tag LOCUS_05290 102541 102275 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213260.1 protein_id gnl|my_center|LOCUS_05290 103449 104036 gene locus_tag LOCUS_05300 103449 104036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 104732 104016 gene locus_tag LOCUS_05310 104732 104016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 105930 104725 gene locus_tag LOCUS_05320 105930 104725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 106475 105927 gene locus_tag LOCUS_05330 106475 105927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 108600 107350 gene locus_tag LOCUS_05340 108600 107350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 109058 108759 gene locus_tag LOCUS_05350 109058 108759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009890.1 protein_id gnl|my_center|LOCUS_05350 109164 109592 gene locus_tag LOCUS_05360 109164 109592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 109783 109604 gene locus_tag LOCUS_05370 109783 109604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 110956 110042 gene locus_tag LOCUS_05380 110956 110042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 110983 111273 gene locus_tag LOCUS_05390 110983 111273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 111453 112142 gene locus_tag LOCUS_05400 111453 112142 CDS product ISSod1, transposase OrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_720421.1 protein_id gnl|my_center|LOCUS_05400 112326 112117 gene locus_tag LOCUS_05410 112326 112117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 113536 112580 gene locus_tag LOCUS_05420 113536 112580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 114049 113666 gene locus_tag LOCUS_05430 114049 113666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 115429 114215 gene locus_tag LOCUS_05440 115429 114215 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_05440 115839 115501 gene locus_tag LOCUS_05450 115839 115501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 116239 115916 gene locus_tag LOCUS_05460 116239 115916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 117569 116241 gene locus_tag LOCUS_05470 117569 116241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 118571 117702 gene locus_tag LOCUS_05480 118571 117702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 118813 118571 gene locus_tag LOCUS_05490 118813 118571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 119340 118927 gene locus_tag LOCUS_05500 119340 118927 CDS product antirestriction protein YubI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198928.1 protein_id gnl|my_center|LOCUS_05500 119602 119405 gene locus_tag LOCUS_05510 119602 119405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 119767 119633 gene locus_tag LOCUS_05520 119767 119633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 120478 120026 gene locus_tag LOCUS_05530 120478 120026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 120734 122035 gene locus_tag LOCUS_05540 120734 122035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 122207 123604 gene locus_tag LOCUS_05550 122207 123604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 123728 127204 gene locus_tag LOCUS_05560 123728 127204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 128129 127860 gene locus_tag LOCUS_05570 128129 127860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 128780 128199 gene locus_tag LOCUS_05580 128780 128199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 129408 128884 gene locus_tag LOCUS_05590 129408 128884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021572.1 protein_id gnl|my_center|LOCUS_05590 130352 129405 gene locus_tag LOCUS_05600 130352 129405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021573.1 protein_id gnl|my_center|LOCUS_05600 130792 130716 gene locus_tag LOCUS_t00090 130792 130716 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 132301 130871 gene locus_tag LOCUS_05610 132301 130871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_05610 133840 132389 gene locus_tag LOCUS_05620 gene cht1 133840 132389 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_05620 135556 134000 gene locus_tag LOCUS_05630 135556 134000 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215509.1 protein_id gnl|my_center|LOCUS_05630 135658 137847 gene locus_tag LOCUS_05640 135658 137847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 139866 138007 gene locus_tag LOCUS_05650 gene rpoD 139866 138007 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_05650 141784 139958 gene locus_tag LOCUS_05660 gene dnaG 141784 139958 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_05660 142331 141873 gene locus_tag LOCUS_05670 142331 141873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 protein_id gnl|my_center|LOCUS_05670 142580 142365 gene locus_tag LOCUS_05680 gene rpsU 142580 142365 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRV2 protein_id gnl|my_center|LOCUS_05680 142761 143849 gene locus_tag LOCUS_05690 gene tsaD 142761 143849 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_05690 143866 144237 gene locus_tag LOCUS_05700 gene folB 143866 144237 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_05700 144257 144778 gene locus_tag LOCUS_05710 144257 144778 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_05710 146204 144801 gene locus_tag LOCUS_05720 146204 144801 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_05720 146345 148264 gene locus_tag LOCUS_05730 gene ftsH-1 146345 148264 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY5 protein_id gnl|my_center|LOCUS_05730 149039 148266 gene locus_tag LOCUS_05740 gene ptr1 149039 148266 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_05740 150311 149055 gene locus_tag LOCUS_05750 gene cca 150311 149055 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTY6 protein_id gnl|my_center|LOCUS_05750 151146 150325 gene locus_tag LOCUS_05760 gene apaH 151146 150325 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG3 protein_id gnl|my_center|LOCUS_05760 151520 151146 gene locus_tag LOCUS_05770 gene apaG 151520 151146 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_05770 152359 151523 gene locus_tag LOCUS_05780 gene rsmA 152359 151523 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_05780 153438 152356 gene locus_tag LOCUS_05790 gene pdxA 153438 152356 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19624 protein_id gnl|my_center|LOCUS_05790 154760 153435 gene locus_tag LOCUS_05800 gene surA 154760 153435 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_05800 157203 154753 gene locus_tag LOCUS_05810 gene lptD 157203 154753 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_05810 157371 158501 gene locus_tag LOCUS_05820 157371 158501 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_05820 158498 159199 gene locus_tag LOCUS_05830 158498 159199 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_05830 159254 159925 gene locus_tag LOCUS_05840 gene rpe 159254 159925 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN25 protein_id gnl|my_center|LOCUS_05840 159946 161478 gene locus_tag LOCUS_05850 gene trpE 159946 161478 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244435.1 protein_id gnl|my_center|LOCUS_05850 162676 161510 gene locus_tag LOCUS_05860 162676 161510 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_05860 162788 163852 gene locus_tag LOCUS_05870 gene lipA 162788 163852 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_05870 164968 163856 gene locus_tag LOCUS_05880 164968 163856 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 protein_id gnl|my_center|LOCUS_05880 165097 165966 gene locus_tag LOCUS_05890 165097 165966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_05890 165963 167198 gene locus_tag LOCUS_05900 gene kynU 165963 167198 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAK0 protein_id gnl|my_center|LOCUS_05900 167358 168014 gene locus_tag LOCUS_05910 167358 168014 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_05910 169368 167995 gene locus_tag LOCUS_05920 gene phrA 169368 167995 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_05920 169829 169590 gene locus_tag LOCUS_05930 169829 169590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 169850 170647 gene locus_tag LOCUS_05940 gene kch 169850 170647 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125677.1 protein_id gnl|my_center|LOCUS_05940 170670 171632 gene locus_tag LOCUS_05950 170670 171632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 172106 171633 gene locus_tag LOCUS_05960 172106 171633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 172448 172137 gene locus_tag LOCUS_05970 172448 172137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 173403 172456 gene locus_tag LOCUS_05980 173403 172456 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269037.1 protein_id gnl|my_center|LOCUS_05980 173622 174203 gene locus_tag LOCUS_05990 gene trpG 173622 174203 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_05990 174228 175256 gene locus_tag LOCUS_06000 gene trpD 174228 175256 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_06000 175253 176050 gene locus_tag LOCUS_06010 gene trpC 175253 176050 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_06010 176144 176851 gene locus_tag LOCUS_06020 176144 176851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 177501 176866 gene locus_tag LOCUS_06030 gene vfr 177501 176866 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_06030 177750 178172 gene locus_tag LOCUS_06040 177750 178172 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_06040 178998 178174 gene locus_tag LOCUS_06050 178998 178174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 179810 178995 gene locus_tag LOCUS_06060 179810 178995 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_06060 180310 179819 gene locus_tag LOCUS_06070 180310 179819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 181144 180482 gene locus_tag LOCUS_06080 181144 180482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 181929 181144 gene locus_tag LOCUS_06090 gene ubiE 181929 181144 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_06090 182327 181932 gene locus_tag LOCUS_06100 182327 181932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_06100 183667 182327 gene locus_tag LOCUS_06110 gene hslU 183667 182327 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_06110 184077 183664 gene locus_tag LOCUS_06120 184077 183664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 184000 184188 gene locus_tag LOCUS_06130 184000 184188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 184985 184284 gene locus_tag LOCUS_06140 184985 184284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 187025 185091 gene locus_tag LOCUS_06150 gene priA 187025 185091 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_06150 187361 187675 gene locus_tag LOCUS_06160 187361 187675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 187844 188056 gene locus_tag LOCUS_06170 gene rpmE 187844 188056 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_06170 190478 188136 gene locus_tag LOCUS_06180 gene ponA 190478 188136 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_06180 190601 191512 gene locus_tag LOCUS_06190 gene pilM 190601 191512 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_06190 191512 192048 gene locus_tag LOCUS_06200 191512 192048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 192048 192743 gene locus_tag LOCUS_06210 192048 192743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 192785 194029 gene locus_tag LOCUS_06220 192785 194029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 194228 194710 gene locus_tag LOCUS_06230 gene aroK 194228 194710 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_06230 194763 195851 gene locus_tag LOCUS_06240 gene aroB 194763 195851 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_06240 195929 196993 gene locus_tag LOCUS_06250 gene hemE 195929 196993 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V23 protein_id gnl|my_center|LOCUS_06250 196965 197504 gene locus_tag LOCUS_06260 196965 197504 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_06260 197587 198387 gene locus_tag LOCUS_06270 197587 198387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 199202 198462 gene locus_tag LOCUS_06280 199202 198462 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402142.1 protein_id gnl|my_center|LOCUS_06280 199396 200403 gene locus_tag LOCUS_06290 gene bioB 199396 200403 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_06290 200465 202261 gene locus_tag LOCUS_06300 200465 202261 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_06300 203043 202300 gene locus_tag LOCUS_06310 203043 202300 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 protein_id gnl|my_center|LOCUS_06310 203674 203048 gene locus_tag LOCUS_06320 203674 203048 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM1 protein_id gnl|my_center|LOCUS_06320 203802 204605 gene locus_tag LOCUS_06330 gene dapB 203802 204605 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_06330 204740 205945 gene locus_tag LOCUS_06340 gene carA 204740 205945 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP3 protein_id gnl|my_center|LOCUS_06340 205979 209203 gene locus_tag LOCUS_06350 gene carB 205979 209203 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_06350 209361 209822 gene locus_tag LOCUS_06360 gene greA 209361 209822 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43881 protein_id gnl|my_center|LOCUS_06360 210255 209920 gene locus_tag LOCUS_06370 210255 209920 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_06370 210413 210252 gene locus_tag LOCUS_06380 210413 210252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 210516 212450 gene locus_tag LOCUS_06390 gene ftsH 210516 212450 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_06390 212471 213382 gene locus_tag LOCUS_06400 gene folP 212471 213382 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_06400 213394 214752 gene locus_tag LOCUS_06410 gene glmM 213394 214752 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_06410 214847 215602 gene locus_tag LOCUS_06420 gene tpiA 214847 215602 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTK6 protein_id gnl|my_center|LOCUS_06420 215606 215980 gene locus_tag LOCUS_06430 gene secG 215606 215980 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 protein_id gnl|my_center|LOCUS_06430 215989 216074 gene locus_tag LOCUS_t00100 215989 216074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 216215 216291 gene locus_tag LOCUS_t00110 216215 216291 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 216449 216919 gene locus_tag LOCUS_06440 gene rimP 216449 216919 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_06440 216952 218439 gene locus_tag LOCUS_06450 gene nusA 216952 218439 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR1 protein_id gnl|my_center|LOCUS_06450 218471 221065 gene locus_tag LOCUS_06460 gene infB 218471 221065 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_06460 221065 221526 gene locus_tag LOCUS_06470 gene rbfA 221065 221526 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_06470 221528 222454 gene locus_tag LOCUS_06480 gene truB 221528 222454 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE1 protein_id gnl|my_center|LOCUS_06480 222529 222798 gene locus_tag LOCUS_06490 gene rpsO 222529 222798 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBC5 protein_id gnl|my_center|LOCUS_06490 222904 225018 gene locus_tag LOCUS_06500 gene pnp 222904 225018 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_06500 225139 225741 gene locus_tag LOCUS_06510 225139 225741 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766709.1 protein_id gnl|my_center|LOCUS_06510 225744 226082 gene locus_tag LOCUS_06520 225744 226082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_06520 226109 228739 gene locus_tag LOCUS_06530 226109 228739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 229510 228743 gene locus_tag LOCUS_06540 229510 228743 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_06540 229570 230136 gene locus_tag LOCUS_06550 229570 230136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 230258 231202 gene locus_tag LOCUS_06560 230258 231202 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_06560 231242 232066 gene locus_tag LOCUS_06570 gene phnC 231242 232066 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_06570 232162 232929 gene locus_tag LOCUS_06580 232162 232929 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_06580 232929 233741 gene locus_tag LOCUS_06590 232929 233741 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_06590 234945 233755 gene locus_tag LOCUS_06600 234945 233755 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_06600 235319 234945 gene locus_tag LOCUS_06610 235319 234945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 236663 235347 gene locus_tag LOCUS_06620 236663 235347 CDS product organophopsphate acid anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729793.1 protein_id gnl|my_center|LOCUS_06620 236819 237646 gene locus_tag LOCUS_06630 236819 237646 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_06630 237744 238139 gene locus_tag LOCUS_06640 237744 238139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 238136 239002 gene locus_tag LOCUS_06650 238136 239002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_06650 239926 238988 gene locus_tag LOCUS_06660 239926 238988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 240003 241556 gene locus_tag LOCUS_06670 240003 241556 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_06670 242446 241538 gene locus_tag LOCUS_06680 242446 241538 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_06680 242580 243446 gene locus_tag LOCUS_06690 242580 243446 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_06690 243552 245321 gene locus_tag LOCUS_06700 243552 245321 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_06700 247468 245354 gene locus_tag LOCUS_06710 247468 245354 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_06710 247573 251115 gene locus_tag LOCUS_06720 247573 251115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 251161 253398 gene locus_tag LOCUS_06730 251161 253398 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_06730 253455 254075 gene locus_tag LOCUS_06740 253455 254075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 254072 254887 gene locus_tag LOCUS_06750 gene suhB 254072 254887 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_06750 257181 254881 gene locus_tag LOCUS_06760 257181 254881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_06760 258092 257178 gene locus_tag LOCUS_06770 258092 257178 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339525.1 protein_id gnl|my_center|LOCUS_06770 258220 258990 gene locus_tag LOCUS_06780 gene fpr 258220 258990 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_06780 259689 259093 gene locus_tag LOCUS_06790 259689 259093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 259965 262463 gene locus_tag LOCUS_06800 259965 262463 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_06800 262528 263127 gene locus_tag LOCUS_06810 gene clpP3 262528 263127 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFP9 protein_id gnl|my_center|LOCUS_06810 263541 263137 gene locus_tag LOCUS_06820 263541 263137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 263946 264845 gene locus_tag LOCUS_06830 263946 264845 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705410.1 protein_id gnl|my_center|LOCUS_06830 265037 266965 gene locus_tag LOCUS_06840 265037 266965 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_06840 269294 267057 gene locus_tag LOCUS_06850 269294 267057 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_06850 269803 269291 gene locus_tag LOCUS_06860 gene iorA 269803 269291 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194625.1 protein_id gnl|my_center|LOCUS_06860 269855 271114 gene locus_tag LOCUS_06870 269855 271114 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063816.1 protein_id gnl|my_center|LOCUS_06870 271284 271655 gene locus_tag LOCUS_06880 271284 271655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 272004 271741 gene locus_tag LOCUS_06890 272004 271741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 272187 273320 gene locus_tag LOCUS_06900 272187 273320 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_06900 273320 275269 gene locus_tag LOCUS_06910 273320 275269 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_06910 277507 275294 gene locus_tag LOCUS_06920 277507 275294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_06920 277670 278452 gene locus_tag LOCUS_06930 277670 278452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 279333 278446 gene locus_tag LOCUS_06940 279333 278446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_06940 279895 279398 gene locus_tag LOCUS_06950 gene sixA 279895 279398 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_06950 280098 280829 gene locus_tag LOCUS_06960 280098 280829 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770984.1 protein_id gnl|my_center|LOCUS_06960 280844 281716 gene locus_tag LOCUS_06970 280844 281716 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_06970 281713 282231 gene locus_tag LOCUS_06980 281713 282231 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_06980 282228 284519 gene locus_tag LOCUS_06990 282228 284519 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_06990 284644 285084 gene locus_tag LOCUS_07000 284644 285084 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709522.1 protein_id gnl|my_center|LOCUS_07000 285088 286677 gene locus_tag LOCUS_07010 285088 286677 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_07010 286674 287171 gene locus_tag LOCUS_07020 286674 287171 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_07020 287308 288795 gene locus_tag LOCUS_07030 gene amiB 287308 288795 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_07030 288843 290696 gene locus_tag LOCUS_07040 gene mutL 288843 290696 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_07040 290702 291655 gene locus_tag LOCUS_07050 gene miaA 290702 291655 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS0 protein_id gnl|my_center|LOCUS_07050 291726 292001 gene locus_tag LOCUS_07060 gene hfq 291726 292001 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_07060 292015 293283 gene locus_tag LOCUS_07070 gene hflX 292015 293283 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_07070 293413 294615 gene locus_tag LOCUS_07080 gene hflK 293413 294615 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_07080 294621 295487 gene locus_tag LOCUS_07090 gene hflC 294621 295487 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ7 protein_id gnl|my_center|LOCUS_07090 295557 296774 gene locus_tag LOCUS_07100 gene hisZ 295557 296774 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_07100 296838 298130 gene locus_tag LOCUS_07110 gene purA 296838 298130 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_07110 298202 299926 gene locus_tag LOCUS_07120 gene nhaP2 298202 299926 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB2 protein_id gnl|my_center|LOCUS_07120 299990 301030 gene locus_tag LOCUS_07130 299990 301030 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_07130 303938 301092 gene locus_tag LOCUS_07140 303938 301092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 304298 306592 gene locus_tag LOCUS_07150 gene maeB 304298 306592 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638691.2 protein_id gnl|my_center|LOCUS_07150 308140 306593 gene locus_tag LOCUS_07160 gene gatAX 308140 306593 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 protein_id gnl|my_center|LOCUS_07160 309439 308144 gene locus_tag LOCUS_07170 gene yfcY 309439 308144 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_07170 311549 309432 gene locus_tag LOCUS_07180 311549 309432 CDS product fatty-acid oxidation protein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085215.1 protein_id gnl|my_center|LOCUS_07180 313203 311644 gene locus_tag LOCUS_07190 gene phoA 313203 311644 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_07190 313361 315547 gene locus_tag LOCUS_07200 gene fadE 313361 315547 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_07200 315700 316716 gene locus_tag LOCUS_07210 315700 316716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 317884 316724 gene locus_tag LOCUS_07220 317884 316724 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_07220 320254 317888 gene locus_tag LOCUS_07230 320254 317888 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_07230 321009 320248 gene locus_tag LOCUS_07240 321009 320248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_07240 322157 320976 gene locus_tag LOCUS_07250 322157 320976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 323416 322154 gene locus_tag LOCUS_07260 323416 322154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 326680 323543 gene locus_tag LOCUS_07270 326680 323543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 327241 326747 gene locus_tag LOCUS_07280 327241 326747 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_07280 327663 327241 gene locus_tag LOCUS_07290 327663 327241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 327742 329715 gene locus_tag LOCUS_07300 327742 329715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 330325 329705 gene locus_tag LOCUS_07310 330325 329705 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_07310 330946 330350 gene locus_tag LOCUS_07320 330946 330350 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_07320 331679 330999 gene locus_tag LOCUS_07330 331679 330999 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261909.1 protein_id gnl|my_center|LOCUS_07330 331894 331679 gene locus_tag LOCUS_07340 331894 331679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 334301 331899 gene locus_tag LOCUS_07350 334301 331899 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361687.1 protein_id gnl|my_center|LOCUS_07350 334843 334301 gene locus_tag LOCUS_07360 334843 334301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 336300 334840 gene locus_tag LOCUS_07370 336300 334840 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_07370 337202 336330 gene locus_tag LOCUS_07380 337202 336330 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQX4 protein_id gnl|my_center|LOCUS_07380 337423 337199 gene locus_tag LOCUS_07390 337423 337199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 338028 337423 gene locus_tag LOCUS_07400 gene ccoO1 338028 337423 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_07400 339482 338025 gene locus_tag LOCUS_07410 gene ccoN2 339482 338025 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_07410 341567 339714 gene locus_tag LOCUS_07420 341567 339714 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_07420 341693 342349 gene locus_tag LOCUS_07430 341693 342349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 343646 342354 gene locus_tag LOCUS_07440 gene rhlE 343646 342354 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV8 protein_id gnl|my_center|LOCUS_07440 343885 346017 gene locus_tag LOCUS_07450 343885 346017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 347452 346076 gene locus_tag LOCUS_07460 347452 346076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_07460 348170 347436 gene locus_tag LOCUS_07470 348170 347436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_07470 350197 348167 gene locus_tag LOCUS_07480 350197 348167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 351954 350200 gene locus_tag LOCUS_07490 351954 350200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 353960 352050 gene locus_tag LOCUS_07500 353960 352050 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193954.1 protein_id gnl|my_center|LOCUS_07500 355088 354108 gene locus_tag LOCUS_07510 355088 354108 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_07510 355566 355162 gene locus_tag LOCUS_07520 355566 355162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 356849 355563 gene locus_tag LOCUS_07530 356849 355563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117833.1 protein_id gnl|my_center|LOCUS_07530 357816 356863 gene locus_tag LOCUS_07540 357816 356863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 359573 357819 gene locus_tag LOCUS_07550 359573 357819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 360344 359577 gene locus_tag LOCUS_07560 360344 359577 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 protein_id gnl|my_center|LOCUS_07560 361665 360358 gene locus_tag LOCUS_07570 361665 360358 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_07570 363089 361659 gene locus_tag LOCUS_07580 363089 361659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_07580 363301 365667 gene locus_tag LOCUS_07590 gene fhuA 363301 365667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_07590 365754 366872 gene locus_tag LOCUS_07600 365754 366872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 366869 367924 gene locus_tag LOCUS_07610 366869 367924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 368015 368602 gene locus_tag LOCUS_07620 368015 368602 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF67 protein_id gnl|my_center|LOCUS_07620 370140 368611 gene locus_tag LOCUS_07630 gene acp 370140 368611 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207419.1 protein_id gnl|my_center|LOCUS_07630 370665 370231 gene locus_tag LOCUS_07640 370665 370231 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_07640 370847 371296 gene locus_tag LOCUS_07650 370847 371296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 371340 372146 gene locus_tag LOCUS_07660 371340 372146 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 protein_id gnl|my_center|LOCUS_07660 372741 372154 gene locus_tag LOCUS_07670 372741 372154 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021421.1 protein_id gnl|my_center|LOCUS_07670 373337 372738 gene locus_tag LOCUS_07680 373337 372738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 374445 373426 gene locus_tag LOCUS_07690 gene tas 374445 373426 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023116.1 protein_id gnl|my_center|LOCUS_07690 374664 375161 gene locus_tag LOCUS_07700 374664 375161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 375233 376687 gene locus_tag LOCUS_07710 gene zwf 375233 376687 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE98 protein_id gnl|my_center|LOCUS_07710 376694 377398 gene locus_tag LOCUS_07720 gene pgl 376694 377398 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_07720 377382 379217 gene locus_tag LOCUS_07730 gene edd 377382 379217 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_07730 379234 379860 gene locus_tag LOCUS_07740 gene eda 379234 379860 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68283 protein_id gnl|my_center|LOCUS_07740 379867 380865 gene locus_tag LOCUS_07750 gene glk 379867 380865 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8Q0 protein_id gnl|my_center|LOCUS_07750 380866 383118 gene locus_tag LOCUS_07760 gene malQ 380866 383118 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU8 protein_id gnl|my_center|LOCUS_07760 383108 385027 gene locus_tag LOCUS_07770 gene glgB 383108 385027 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU7 protein_id gnl|my_center|LOCUS_07770 385066 387192 gene locus_tag LOCUS_07780 gene glgX 385066 387192 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU6 protein_id gnl|my_center|LOCUS_07780 387198 389663 gene locus_tag LOCUS_07790 gene glgP 387198 389663 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_07790 389690 390961 gene locus_tag LOCUS_07800 gene glgC 389690 390961 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_07800 390999 392576 gene locus_tag LOCUS_07810 gene glgA 390999 392576 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_07810 392663 394039 gene locus_tag LOCUS_07820 392663 394039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 394642 394028 gene locus_tag LOCUS_07830 394642 394028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 397211 394716 gene locus_tag LOCUS_07840 397211 394716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 397568 397251 gene locus_tag LOCUS_07850 397568 397251 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389255.1 protein_id gnl|my_center|LOCUS_07850 397803 397997 gene locus_tag LOCUS_07860 397803 397997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 398061 398333 gene locus_tag LOCUS_07870 398061 398333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 398857 401253 gene locus_tag LOCUS_07880 398857 401253 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_07880 401257 402723 gene locus_tag LOCUS_07890 401257 402723 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_07890 402720 405065 gene locus_tag LOCUS_07900 402720 405065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 405165 407105 gene locus_tag LOCUS_07910 405165 407105 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_07910 407273 407016 gene locus_tag LOCUS_07920 407273 407016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 407423 407980 gene locus_tag LOCUS_07930 407423 407980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 407977 409344 gene locus_tag LOCUS_07940 407977 409344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974284.1 protein_id gnl|my_center|LOCUS_07940 409344 410105 gene locus_tag LOCUS_07950 409344 410105 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_07950 410277 411821 gene locus_tag LOCUS_07960 410277 411821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_07960 411811 412860 gene locus_tag LOCUS_07970 411811 412860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889821.1 protein_id gnl|my_center|LOCUS_07970 412857 413198 gene locus_tag LOCUS_07980 412857 413198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 413353 414261 gene locus_tag LOCUS_07990 413353 414261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_07990 414284 415222 gene locus_tag LOCUS_08000 414284 415222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321154.1 protein_id gnl|my_center|LOCUS_08000 415228 416250 gene locus_tag LOCUS_08010 415228 416250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 416398 417702 gene locus_tag LOCUS_08020 416398 417702 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 protein_id gnl|my_center|LOCUS_08020 417706 418254 gene locus_tag LOCUS_08030 417706 418254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268590.1 protein_id gnl|my_center|LOCUS_08030 418288 419157 gene locus_tag LOCUS_08040 418288 419157 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266509.1 protein_id gnl|my_center|LOCUS_08040 419967 419149 gene locus_tag LOCUS_08050 419967 419149 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890564.1 protein_id gnl|my_center|LOCUS_08050 420601 420235 gene locus_tag LOCUS_tm00010 420601 420235 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 421313 420654 gene locus_tag LOCUS_08060 421313 420654 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_08060 421803 421321 gene locus_tag LOCUS_08070 gene smpB 421803 421321 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_08070 421902 423332 gene locus_tag LOCUS_08080 421902 423332 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 protein_id gnl|my_center|LOCUS_08080 423341 423778 gene locus_tag LOCUS_08090 423341 423778 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_08090 423775 424089 gene locus_tag LOCUS_08100 423775 424089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 424086 424364 gene locus_tag LOCUS_08110 424086 424364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 424355 425335 gene locus_tag LOCUS_08120 424355 425335 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_08120 425437 426009 gene locus_tag LOCUS_08130 425437 426009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 426533 426036 gene locus_tag LOCUS_08140 426533 426036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 426907 426548 gene locus_tag LOCUS_08150 426907 426548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 427094 427513 gene locus_tag LOCUS_08160 gene fur 427094 427513 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_08160 429235 427550 gene locus_tag LOCUS_08170 gene recN 429235 427550 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_08170 429355 429966 gene locus_tag LOCUS_08180 gene grpE 429355 429966 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_08180 430110 432035 gene locus_tag LOCUS_08190 gene dnaK 430110 432035 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_08190 432054 433172 gene locus_tag LOCUS_08200 gene dnaJ 432054 433172 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_08200 434231 433227 gene locus_tag LOCUS_08210 434231 433227 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_08210 435569 434259 gene locus_tag LOCUS_08220 gene hemL 435569 434259 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_08220 436279 435593 gene locus_tag LOCUS_08230 gene thiE 436279 435593 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA1 protein_id gnl|my_center|LOCUS_08230 437085 436288 gene locus_tag LOCUS_08240 gene thiD 437085 436288 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_08240 437534 437112 gene locus_tag LOCUS_08250 437534 437112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_08250 437682 438719 gene locus_tag LOCUS_08260 gene argC 437682 438719 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_08260 438785 439528 gene locus_tag LOCUS_08270 438785 439528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707262.1 protein_id gnl|my_center|LOCUS_08270 439532 439945 gene locus_tag LOCUS_08280 439532 439945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 439949 440377 gene locus_tag LOCUS_08290 gene erpA 439949 440377 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_08290 441537 440383 gene locus_tag LOCUS_08300 gene anmK 441537 440383 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_08300 442991 441537 gene locus_tag LOCUS_08310 442991 441537 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_08310 443138 444418 gene locus_tag LOCUS_08320 gene tyrS 443138 444418 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_08320 >Feature sequence03 1049 615 gene locus_tag LOCUS_08330 gene dtd 1049 615 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_08330 2885 1059 gene locus_tag LOCUS_08340 gene typA 2885 1059 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_08340 4456 2987 gene locus_tag LOCUS_08350 gene thiI 4456 2987 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_08350 4807 6213 gene locus_tag LOCUS_08360 gene glnA 4807 6213 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_08360 6525 7646 gene locus_tag LOCUS_08370 gene ntrB 6525 7646 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103111.1 protein_id gnl|my_center|LOCUS_08370 7668 9089 gene locus_tag LOCUS_08380 gene ntrC 7668 9089 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_08380 9208 9957 gene locus_tag LOCUS_08390 9208 9957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_08390 9960 10721 gene locus_tag LOCUS_08400 9960 10721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_08400 10732 12648 gene locus_tag LOCUS_08410 10732 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_08410 14011 12656 gene locus_tag LOCUS_08420 14011 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14709 14008 gene locus_tag LOCUS_08430 14709 14008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_08430 14808 16727 gene locus_tag LOCUS_08440 14808 16727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_08440 17811 16729 gene locus_tag LOCUS_08450 gene degP 17811 16729 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_08450 28382 17898 gene locus_tag LOCUS_08460 28382 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 28648 28941 gene locus_tag LOCUS_08470 28648 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 29395 28943 gene locus_tag LOCUS_08480 29395 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 30215 29385 gene locus_tag LOCUS_08490 30215 29385 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481003.1 protein_id gnl|my_center|LOCUS_08490 30795 30217 gene locus_tag LOCUS_08500 30795 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 31321 30788 gene locus_tag LOCUS_08510 31321 30788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 32103 31480 gene locus_tag LOCUS_08520 32103 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 33097 32462 gene locus_tag LOCUS_08530 33097 32462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 34564 33251 gene locus_tag LOCUS_08540 34564 33251 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_08540 36375 34573 gene locus_tag LOCUS_08550 36375 34573 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_08550 37612 36398 gene locus_tag LOCUS_08560 37612 36398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 38539 37619 gene locus_tag LOCUS_08570 gene mshM 38539 37619 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_08570 40435 38561 gene locus_tag LOCUS_08580 gene mshL 40435 38561 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_08580 40905 40504 gene locus_tag LOCUS_08590 40905 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 41587 40898 gene locus_tag LOCUS_08600 41587 40898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 42189 41584 gene locus_tag LOCUS_08610 42189 41584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 43131 42190 gene locus_tag LOCUS_08620 43131 42190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 43249 43770 gene locus_tag LOCUS_08630 gene trmL 43249 43770 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ6 protein_id gnl|my_center|LOCUS_08630 44279 43779 gene locus_tag LOCUS_08640 gene secB 44279 43779 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR3 protein_id gnl|my_center|LOCUS_08640 44884 44378 gene locus_tag LOCUS_08650 44884 44378 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_08650 44955 46529 gene locus_tag LOCUS_08660 gene gpmI 44955 46529 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_08660 46526 47689 gene locus_tag LOCUS_08670 46526 47689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_08670 47739 49070 gene locus_tag LOCUS_08680 47739 49070 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_08680 49070 50125 gene locus_tag LOCUS_08690 49070 50125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 50917 50144 gene locus_tag LOCUS_08700 gene hisF1 50917 50144 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_08700 51677 50934 gene locus_tag LOCUS_08710 gene hisA 51677 50934 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLQ1 protein_id gnl|my_center|LOCUS_08710 52410 51754 gene locus_tag LOCUS_08720 gene hisH 52410 51754 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLP9 protein_id gnl|my_center|LOCUS_08720 53072 52467 gene locus_tag LOCUS_08730 gene hisB 53072 52467 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_08730 53296 55311 gene locus_tag LOCUS_08740 53296 55311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 55314 56369 gene locus_tag LOCUS_08750 55314 56369 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 protein_id gnl|my_center|LOCUS_08750 56419 56694 gene locus_tag LOCUS_08760 56419 56694 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_08760 56793 56593 gene locus_tag LOCUS_08770 56793 56593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 56801 56876 gene locus_tag LOCUS_t00120 56801 56876 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57129 57476 gene locus_tag LOCUS_08780 gene arsC 57129 57476 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QP0 protein_id gnl|my_center|LOCUS_08780 58022 57468 gene locus_tag LOCUS_08790 58022 57468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 60732 58174 gene locus_tag LOCUS_08800 gene cirA 60732 58174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037527.1 protein_id gnl|my_center|LOCUS_08800 60911 61975 gene locus_tag LOCUS_08810 60911 61975 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_08810 62937 61984 gene locus_tag LOCUS_08820 62937 61984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 63539 62928 gene locus_tag LOCUS_08830 63539 62928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020541.1 protein_id gnl|my_center|LOCUS_08830 64614 63583 gene locus_tag LOCUS_08840 64614 63583 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085433.1 protein_id gnl|my_center|LOCUS_08840 65783 64620 gene locus_tag LOCUS_08850 65783 64620 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727756.1 protein_id gnl|my_center|LOCUS_08850 66567 65785 gene locus_tag LOCUS_08860 66567 65785 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921287.1 protein_id gnl|my_center|LOCUS_08860 67421 66600 gene locus_tag LOCUS_08870 67421 66600 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402934.1 protein_id gnl|my_center|LOCUS_08870 67584 68279 gene locus_tag LOCUS_08880 67584 68279 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_08880 68266 69714 gene locus_tag LOCUS_08890 68266 69714 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_08890 69711 70385 gene locus_tag LOCUS_08900 69711 70385 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_08900 70369 71166 gene locus_tag LOCUS_08910 70369 71166 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477831.1 protein_id gnl|my_center|LOCUS_08910 71166 71783 gene locus_tag LOCUS_08920 71166 71783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_08920 71803 72465 gene locus_tag LOCUS_08930 71803 72465 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_08930 72462 73883 gene locus_tag LOCUS_08940 72462 73883 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406386.1 protein_id gnl|my_center|LOCUS_08940 73885 74625 gene locus_tag LOCUS_08950 73885 74625 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_08950 74932 74642 gene locus_tag LOCUS_08960 74932 74642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 78024 74929 gene locus_tag LOCUS_08970 78024 74929 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_08970 79124 78024 gene locus_tag LOCUS_08980 79124 78024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 80383 79121 gene locus_tag LOCUS_08990 80383 79121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 80605 81303 gene locus_tag LOCUS_09000 80605 81303 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_09000 81300 82595 gene locus_tag LOCUS_09010 gene colS 81300 82595 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 protein_id gnl|my_center|LOCUS_09010 82693 83559 gene locus_tag LOCUS_09020 gene rssA 82693 83559 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_09020 83556 84995 gene locus_tag LOCUS_09030 83556 84995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 88214 85143 gene locus_tag LOCUS_09040 88214 85143 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_09040 88312 88461 gene locus_tag LOCUS_09050 88312 88461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 88458 88880 gene locus_tag LOCUS_09060 88458 88880 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_09060 92255 89019 gene locus_tag LOCUS_09070 92255 89019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 93121 92252 gene locus_tag LOCUS_09080 93121 92252 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_09080 93170 93856 gene locus_tag LOCUS_09090 93170 93856 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_09090 93853 94314 gene locus_tag LOCUS_09100 93853 94314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 94463 96034 gene locus_tag LOCUS_09110 gene pckA 94463 96034 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500D1 protein_id gnl|my_center|LOCUS_09110 96117 97691 gene locus_tag LOCUS_09120 gene gshA 96117 97691 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_09120 98237 97722 gene locus_tag LOCUS_09130 gene dsbB1 98237 97722 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_09130 99522 98230 gene locus_tag LOCUS_09140 99522 98230 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_09140 99661 100137 gene locus_tag LOCUS_09150 99661 100137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 102270 100153 gene locus_tag LOCUS_09160 102270 100153 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_09160 102458 103423 gene locus_tag LOCUS_09170 gene hemB 102458 103423 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_09170 103498 103824 gene locus_tag LOCUS_09180 gene trxA 103498 103824 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_09180 104144 105403 gene locus_tag LOCUS_09190 gene rho 104144 105403 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_09190 105668 107134 gene locus_tag LOCUS_09200 gene ubiD 105668 107134 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_09200 107422 107177 gene locus_tag LOCUS_09210 107422 107177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 108458 107427 gene locus_tag LOCUS_09220 108458 107427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 109416 108628 gene locus_tag LOCUS_09230 109416 108628 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266160.1 protein_id gnl|my_center|LOCUS_09230 110399 109467 gene locus_tag LOCUS_09240 gene hemC 110399 109467 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KI9 protein_id gnl|my_center|LOCUS_09240 110512 111939 gene locus_tag LOCUS_09250 gene argH 110512 111939 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_09250 113878 112058 gene locus_tag LOCUS_09260 113878 112058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 119565 113875 gene locus_tag LOCUS_09270 119565 113875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 120248 119562 gene locus_tag LOCUS_09280 120248 119562 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_09280 120642 121898 gene locus_tag LOCUS_09290 gene lysA 120642 121898 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_09290 121903 122883 gene locus_tag LOCUS_09300 gene dapF 121903 122883 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_09300 122901 123575 gene locus_tag LOCUS_09310 122901 123575 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 protein_id gnl|my_center|LOCUS_09310 123580 128121 gene locus_tag LOCUS_09320 123580 128121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 128128 128991 gene locus_tag LOCUS_09330 128128 128991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 129948 128983 gene locus_tag LOCUS_09340 gene cps2F 129948 128983 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068378.1 protein_id gnl|my_center|LOCUS_09340 130850 129945 gene locus_tag LOCUS_09350 gene rfbQ 130850 129945 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_09350 131343 130837 gene locus_tag LOCUS_09360 131343 130837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 133514 131409 gene locus_tag LOCUS_09370 133514 131409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 133927 133514 gene locus_tag LOCUS_09380 133927 133514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 134078 135031 gene locus_tag LOCUS_09390 gene gshB 134078 135031 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_09390 135100 135948 gene locus_tag LOCUS_09400 gene tonB3 135100 135948 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_09400 135966 136562 gene locus_tag LOCUS_09410 gene algH 135966 136562 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_09410 136569 137009 gene locus_tag LOCUS_09420 136569 137009 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_09420 137083 137337 gene locus_tag LOCUS_09430 137083 137337 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NP7 protein_id gnl|my_center|LOCUS_09430 137330 137593 gene locus_tag LOCUS_09440 137330 137593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105954.1 protein_id gnl|my_center|LOCUS_09440 138282 137599 gene locus_tag LOCUS_09450 138282 137599 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_09450 138659 138282 gene locus_tag LOCUS_09460 138659 138282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 139561 138692 gene locus_tag LOCUS_09470 139561 138692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 139712 140551 gene locus_tag LOCUS_09480 139712 140551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 140749 140555 gene locus_tag LOCUS_09490 140749 140555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 143217 140746 gene locus_tag LOCUS_09500 143217 140746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_09500 147816 143311 gene locus_tag LOCUS_09510 147816 143311 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_09510 147966 148487 gene locus_tag LOCUS_09520 147966 148487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 148632 149291 gene locus_tag LOCUS_09530 148632 149291 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_09530 149476 150606 gene locus_tag LOCUS_09540 gene gcvT 149476 150606 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_09540 150641 151024 gene locus_tag LOCUS_09550 gene gcvH 150641 151024 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_09550 151021 153942 gene locus_tag LOCUS_09560 gene gcvP2 151021 153942 CDS product glycine dehydrogenase (decarboxylating) 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX7 protein_id gnl|my_center|LOCUS_09560 153947 154759 gene locus_tag LOCUS_09570 153947 154759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 154843 155592 gene locus_tag LOCUS_09580 154843 155592 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074278.1 protein_id gnl|my_center|LOCUS_09580 155592 156260 gene locus_tag LOCUS_09590 155592 156260 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074279.1 protein_id gnl|my_center|LOCUS_09590 156293 158041 gene locus_tag LOCUS_09600 156293 158041 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 protein_id gnl|my_center|LOCUS_09600 159186 158149 gene locus_tag LOCUS_09610 gene pilT 159186 158149 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_09610 159244 159981 gene locus_tag LOCUS_09620 159244 159981 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_09620 160207 159890 gene locus_tag LOCUS_09630 160207 159890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 161887 160211 gene locus_tag LOCUS_09640 161887 160211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 162035 163396 gene locus_tag LOCUS_09650 162035 163396 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_09650 163789 163406 gene locus_tag LOCUS_09660 163789 163406 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_09660 164145 163825 gene locus_tag LOCUS_09670 164145 163825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 165189 164206 gene locus_tag LOCUS_09680 gene epmA 165189 164206 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFS7 protein_id gnl|my_center|LOCUS_09680 165763 165194 gene locus_tag LOCUS_09690 gene efp 165763 165194 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KX9 protein_id gnl|my_center|LOCUS_09690 165863 166858 gene locus_tag LOCUS_09700 165863 166858 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120173.1 protein_id gnl|my_center|LOCUS_09700 166863 168983 gene locus_tag LOCUS_09710 166863 168983 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_09710 171192 168916 gene locus_tag LOCUS_09720 gene parC 171192 168916 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_09720 171354 172124 gene locus_tag LOCUS_09730 gene exoA 171354 172124 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37454 protein_id gnl|my_center|LOCUS_09730 172669 172163 gene locus_tag LOCUS_09740 172669 172163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_09740 173169 172669 gene locus_tag LOCUS_09750 173169 172669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 173887 173174 gene locus_tag LOCUS_09760 173887 173174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 174005 174499 gene locus_tag LOCUS_09770 174005 174499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 174599 177415 gene locus_tag LOCUS_09780 174599 177415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 177817 179358 gene locus_tag LOCUS_09790 177817 179358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 180595 179363 gene locus_tag LOCUS_09800 180595 179363 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_09800 180664 181572 gene locus_tag LOCUS_09810 180664 181572 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927682.1 protein_id gnl|my_center|LOCUS_09810 181710 183131 gene locus_tag LOCUS_09820 181710 183131 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_09820 183128 185575 gene locus_tag LOCUS_09830 183128 185575 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRQ4 protein_id gnl|my_center|LOCUS_09830 185572 186258 gene locus_tag LOCUS_09840 185572 186258 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066993.1 protein_id gnl|my_center|LOCUS_09840 186299 186934 gene locus_tag LOCUS_09850 186299 186934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 186972 188621 gene locus_tag LOCUS_09860 186972 188621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_09860 188768 189949 gene locus_tag LOCUS_09870 188768 189949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_09870 190006 191673 gene locus_tag LOCUS_09880 190006 191673 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_09880 191782 193239 gene locus_tag LOCUS_09890 191782 193239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 193743 193243 gene locus_tag LOCUS_09900 193743 193243 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_09900 196086 193840 gene locus_tag LOCUS_09910 196086 193840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 197264 196095 gene locus_tag LOCUS_09920 197264 196095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 198146 197367 gene locus_tag LOCUS_09930 198146 197367 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_09930 198972 198247 gene locus_tag LOCUS_09940 198972 198247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 199604 198999 gene locus_tag LOCUS_09950 199604 198999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 200218 199709 gene locus_tag LOCUS_09960 200218 199709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 200543 202249 gene locus_tag LOCUS_09970 200543 202249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 202996 202289 gene locus_tag LOCUS_09980 202996 202289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 203595 203059 gene locus_tag LOCUS_09990 203595 203059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 204195 203614 gene locus_tag LOCUS_10000 204195 203614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 204784 204182 gene locus_tag LOCUS_10010 204784 204182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 205459 204791 gene locus_tag LOCUS_10020 205459 204791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 205797 205501 gene locus_tag LOCUS_10030 205797 205501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 206229 205810 gene locus_tag LOCUS_10040 206229 205810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 207196 206519 gene locus_tag LOCUS_10050 207196 206519 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186572.1 protein_id gnl|my_center|LOCUS_10050 208080 207295 gene locus_tag LOCUS_10060 208080 207295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 208533 208156 gene locus_tag LOCUS_10070 208533 208156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 208836 210227 gene locus_tag LOCUS_10080 208836 210227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 211436 210300 gene locus_tag LOCUS_10090 211436 210300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 213725 211539 gene locus_tag LOCUS_10100 213725 211539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 213991 213785 gene locus_tag LOCUS_10110 213991 213785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 213878 225841 gene locus_tag LOCUS_10120 213878 225841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 225838 227691 gene locus_tag LOCUS_10130 225838 227691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 229009 227720 gene locus_tag LOCUS_10140 229009 227720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 229815 229006 gene locus_tag LOCUS_10150 gene rstA 229815 229006 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_10150 229891 230589 gene locus_tag LOCUS_10160 229891 230589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 230605 231321 gene locus_tag LOCUS_10170 230605 231321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918522.1 protein_id gnl|my_center|LOCUS_10170 232687 231308 gene locus_tag LOCUS_10180 232687 231308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 234064 232844 gene locus_tag LOCUS_10190 234064 232844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_10190 234623 234156 gene locus_tag LOCUS_10200 234623 234156 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_10200 235039 234620 gene locus_tag LOCUS_10210 235039 234620 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706085.1 protein_id gnl|my_center|LOCUS_10210 235368 235084 gene locus_tag LOCUS_10220 235368 235084 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889208.1 protein_id gnl|my_center|LOCUS_10220 235609 235358 gene locus_tag LOCUS_10230 235609 235358 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMA1 protein_id gnl|my_center|LOCUS_10230 236016 235765 gene locus_tag LOCUS_10240 236016 235765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489304.1 protein_id gnl|my_center|LOCUS_10240 236392 236141 gene locus_tag LOCUS_10250 236392 236141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 236706 236314 gene locus_tag LOCUS_10260 236706 236314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 237317 236805 gene locus_tag LOCUS_10270 237317 236805 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619941.1 protein_id gnl|my_center|LOCUS_10270 237442 238533 gene locus_tag LOCUS_10280 237442 238533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640655.1 protein_id gnl|my_center|LOCUS_10280 238615 239499 gene locus_tag LOCUS_10290 238615 239499 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 protein_id gnl|my_center|LOCUS_10290 239691 240116 gene locus_tag LOCUS_10300 239691 240116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946562.1 protein_id gnl|my_center|LOCUS_10300 240228 241310 gene locus_tag LOCUS_10310 240228 241310 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089772.1 protein_id gnl|my_center|LOCUS_10310 241391 242641 gene locus_tag LOCUS_10320 241391 242641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 242788 243027 gene locus_tag LOCUS_10330 242788 243027 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_10330 243027 243320 gene locus_tag LOCUS_10340 243027 243320 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_10340 244064 243327 gene locus_tag LOCUS_10350 244064 243327 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_10350 244910 244065 gene locus_tag LOCUS_10360 244910 244065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 245368 246063 gene locus_tag LOCUS_10370 245368 246063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 247100 246207 gene locus_tag LOCUS_10380 247100 246207 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 protein_id gnl|my_center|LOCUS_10380 249012 247186 gene locus_tag LOCUS_10390 249012 247186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 249511 249110 gene locus_tag LOCUS_10400 249511 249110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_10400 250428 249916 gene locus_tag LOCUS_10410 250428 249916 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029452.1 protein_id gnl|my_center|LOCUS_10410 251015 250587 gene locus_tag LOCUS_10420 251015 250587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 251615 251118 gene locus_tag LOCUS_10430 251615 251118 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_10430 251830 252936 gene locus_tag LOCUS_10440 251830 252936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 252933 253937 gene locus_tag LOCUS_10450 252933 253937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 256287 254440 gene locus_tag LOCUS_10460 256287 254440 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_10460 256933 256277 gene locus_tag LOCUS_10470 gene agmR 256933 256277 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_10470 257862 257245 gene locus_tag LOCUS_10480 257862 257245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 258400 257933 gene locus_tag LOCUS_10490 258400 257933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 258500 258733 gene locus_tag LOCUS_10500 258500 258733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 258807 259769 gene locus_tag LOCUS_10510 258807 259769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_10510 259766 260527 gene locus_tag LOCUS_10520 259766 260527 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9K2 protein_id gnl|my_center|LOCUS_10520 261495 260536 gene locus_tag LOCUS_10530 261495 260536 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_10530 261630 262250 gene locus_tag LOCUS_10540 gene gst 261630 262250 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_10540 263080 262361 gene locus_tag LOCUS_10550 263080 262361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_10550 266987 263382 gene locus_tag LOCUS_10560 gene yobI 266987 263382 CDS product putative membrane protein YobI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34784 protein_id gnl|my_center|LOCUS_10560 269104 267185 gene locus_tag LOCUS_10570 gene parE 269104 267185 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH3 protein_id gnl|my_center|LOCUS_10570 270007 269138 gene locus_tag LOCUS_10580 gene cpdA 270007 269138 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_10580 270331 270011 gene locus_tag LOCUS_10590 270331 270011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 271079 270474 gene locus_tag LOCUS_10600 gene nudF 271079 270474 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_10600 271954 271247 gene locus_tag LOCUS_10610 271954 271247 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_10610 272591 271983 gene locus_tag LOCUS_10620 272591 271983 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_10620 272764 273222 gene locus_tag LOCUS_10630 272764 273222 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_10630 273219 273974 gene locus_tag LOCUS_10640 273219 273974 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_10640 273976 274755 gene locus_tag LOCUS_10650 273976 274755 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_10650 274752 276176 gene locus_tag LOCUS_10660 gene cfaS 274752 276176 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_10660 276186 276944 gene locus_tag LOCUS_10670 276186 276944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 277003 277665 gene locus_tag LOCUS_10680 277003 277665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_10680 279844 277643 gene locus_tag LOCUS_10690 279844 277643 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_10690 280580 279873 gene locus_tag LOCUS_10700 280580 279873 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_10700 280769 281431 gene locus_tag LOCUS_10710 280769 281431 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087925.1 protein_id gnl|my_center|LOCUS_10710 281488 282705 gene locus_tag LOCUS_10720 281488 282705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_10720 283770 282694 gene locus_tag LOCUS_10730 283770 282694 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_10730 285739 283832 gene locus_tag LOCUS_10740 gene thiC 285739 283832 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_10740 286009 287361 gene locus_tag LOCUS_10750 gene tolC 286009 287361 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_10750 288511 287414 gene locus_tag LOCUS_10760 gene hemH2 288511 287414 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_10760 288939 288508 gene locus_tag LOCUS_10770 288939 288508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 289589 288936 gene locus_tag LOCUS_10780 289589 288936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_10780 290893 289622 gene locus_tag LOCUS_10790 gene metY 290893 289622 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_10790 291446 290949 gene locus_tag LOCUS_10800 291446 290949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_10800 292865 291447 gene locus_tag LOCUS_10810 292865 291447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_10810 294304 292862 gene locus_tag LOCUS_10820 294304 292862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815874.1 protein_id gnl|my_center|LOCUS_10820 294358 294903 gene locus_tag LOCUS_10830 294358 294903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 294900 295166 gene locus_tag LOCUS_10840 294900 295166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 295159 295467 gene locus_tag LOCUS_10850 295159 295467 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_10850 295457 296386 gene locus_tag LOCUS_10860 295457 296386 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_10860 296383 296694 gene locus_tag LOCUS_10870 296383 296694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 296696 298129 gene locus_tag LOCUS_10880 296696 298129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 298129 299646 gene locus_tag LOCUS_10890 298129 299646 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_10890 299643 301199 gene locus_tag LOCUS_10900 299643 301199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 301243 302646 gene locus_tag LOCUS_10910 301243 302646 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_10910 303591 302674 gene locus_tag LOCUS_10920 303591 302674 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_10920 305111 303588 gene locus_tag LOCUS_10930 305111 303588 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_10930 307424 305133 gene locus_tag LOCUS_10940 307424 305133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_10940 308041 307538 gene locus_tag LOCUS_10950 308041 307538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 308196 309080 gene locus_tag LOCUS_10960 gene tesB 308196 309080 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_10960 310139 309120 gene locus_tag LOCUS_10970 gene dinB 310139 309120 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 protein_id gnl|my_center|LOCUS_10970 310259 311596 gene locus_tag LOCUS_10980 gene pepQ 310259 311596 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL3 protein_id gnl|my_center|LOCUS_10980 312900 311611 gene locus_tag LOCUS_10990 gene waaA 312900 311611 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_10990 313054 314142 gene locus_tag LOCUS_11000 gene corA 313054 314142 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_11000 314147 315436 gene locus_tag LOCUS_11010 314147 315436 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_11010 315436 316251 gene locus_tag LOCUS_11020 315436 316251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_11020 317664 316351 gene locus_tag LOCUS_11030 317664 316351 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_11030 318050 317679 gene locus_tag LOCUS_11040 318050 317679 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_11040 320281 318404 gene locus_tag LOCUS_11050 320281 318404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 322252 320384 gene locus_tag LOCUS_11060 gene sppA 322252 320384 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNJ6 protein_id gnl|my_center|LOCUS_11060 322374 322973 gene locus_tag LOCUS_11070 322374 322973 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32HQ6 protein_id gnl|my_center|LOCUS_11070 323904 322957 gene locus_tag LOCUS_11080 gene tal 323904 322957 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH2 protein_id gnl|my_center|LOCUS_11080 324541 323993 gene locus_tag LOCUS_11090 324541 323993 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525069.1 protein_id gnl|my_center|LOCUS_11090 324665 325885 gene locus_tag LOCUS_11100 324665 325885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 326851 325943 gene locus_tag LOCUS_11110 326851 325943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 326973 327734 gene locus_tag LOCUS_11120 gene kdkA 326973 327734 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T74 protein_id gnl|my_center|LOCUS_11120 329140 327680 gene locus_tag LOCUS_11130 329140 327680 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_11130 329305 331317 gene locus_tag LOCUS_11140 gene gcd-1 329305 331317 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_11140 331461 332342 gene locus_tag LOCUS_11150 331461 332342 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_11150 334843 333062 gene locus_tag LOCUS_11160 334843 333062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 335357 334866 gene locus_tag LOCUS_11170 335357 334866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 337047 335383 gene locus_tag LOCUS_11180 337047 335383 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_11180 337253 337687 gene locus_tag LOCUS_11190 337253 337687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 337691 337927 gene locus_tag LOCUS_11200 337691 337927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 338783 337905 gene locus_tag LOCUS_11210 338783 337905 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_11210 338911 339462 gene locus_tag LOCUS_11220 338911 339462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 339480 340097 gene locus_tag LOCUS_11230 339480 340097 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_11230 340091 340330 gene locus_tag LOCUS_11240 340091 340330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 340931 340380 gene locus_tag LOCUS_11250 340931 340380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975386.1 protein_id gnl|my_center|LOCUS_11250 341734 340967 gene locus_tag LOCUS_11260 341734 340967 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 protein_id gnl|my_center|LOCUS_11260 342587 341718 gene locus_tag LOCUS_11270 342587 341718 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEP9 protein_id gnl|my_center|LOCUS_11270 342974 342612 gene locus_tag LOCUS_11280 342974 342612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521493.1 protein_id gnl|my_center|LOCUS_11280 343746 343117 gene locus_tag LOCUS_11290 343746 343117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067481.1 protein_id gnl|my_center|LOCUS_11290 345425 343743 gene locus_tag LOCUS_11300 345425 343743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 protein_id gnl|my_center|LOCUS_11300 346690 345452 gene locus_tag LOCUS_11310 346690 345452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338058.1 protein_id gnl|my_center|LOCUS_11310 347790 346705 gene locus_tag LOCUS_11320 347790 346705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 348534 347821 gene locus_tag LOCUS_11330 348534 347821 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902690.1 protein_id gnl|my_center|LOCUS_11330 348938 348534 gene locus_tag LOCUS_11340 348938 348534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 350046 349063 gene locus_tag LOCUS_11350 350046 349063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390397.1 protein_id gnl|my_center|LOCUS_11350 350146 349979 gene locus_tag LOCUS_11360 350146 349979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 350309 353692 gene locus_tag LOCUS_11370 350309 353692 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_11370 353866 355512 gene locus_tag LOCUS_11380 353866 355512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 355660 356739 gene locus_tag LOCUS_11390 355660 356739 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 protein_id gnl|my_center|LOCUS_11390 357901 357515 gene locus_tag LOCUS_11400 357901 357515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 358180 358407 gene locus_tag LOCUS_11410 358180 358407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 358404 358880 gene locus_tag LOCUS_11420 358404 358880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 359011 359871 gene locus_tag LOCUS_11430 359011 359871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 359979 360548 gene locus_tag LOCUS_11440 359979 360548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 361495 360575 gene locus_tag LOCUS_11450 361495 360575 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_11450 362759 361470 gene locus_tag LOCUS_11460 362759 361470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_11460 362855 364027 gene locus_tag LOCUS_11470 362855 364027 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709443.1 protein_id gnl|my_center|LOCUS_11470 364033 365091 gene locus_tag LOCUS_11480 364033 365091 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383269.1 protein_id gnl|my_center|LOCUS_11480 365145 365852 gene locus_tag LOCUS_11490 365145 365852 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_11490 366722 365856 gene locus_tag LOCUS_11500 366722 365856 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_11500 367300 366752 gene locus_tag LOCUS_11510 367300 366752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_11510 368987 367302 gene locus_tag LOCUS_11520 368987 367302 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_11520 370568 369012 gene locus_tag LOCUS_11530 370568 369012 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_11530 370694 372064 gene locus_tag LOCUS_11540 370694 372064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 372554 372072 gene locus_tag LOCUS_11550 372554 372072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 374094 372670 gene locus_tag LOCUS_11560 gene hldE 374094 372670 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 protein_id gnl|my_center|LOCUS_11560 374214 375194 gene locus_tag LOCUS_11570 gene lpxL 374214 375194 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW10 protein_id gnl|my_center|LOCUS_11570 375191 376711 gene locus_tag LOCUS_11580 375191 376711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 378472 376721 gene locus_tag LOCUS_11590 378472 376721 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431977.1 protein_id gnl|my_center|LOCUS_11590 380063 378474 gene locus_tag LOCUS_11600 380063 378474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 381223 380063 gene locus_tag LOCUS_11610 gene waaG 381223 380063 CDS product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_11610 382308 381220 gene locus_tag LOCUS_11620 gene waaC 382308 381220 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_11620 383366 382296 gene locus_tag LOCUS_11630 gene waaF 383366 382296 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_11630 386335 383363 gene locus_tag LOCUS_11640 gene glnE 386335 383363 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_11640 386542 388482 gene locus_tag LOCUS_11650 386542 388482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_11650 388475 389863 gene locus_tag LOCUS_11660 gene dbpA 388475 389863 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_11660 390692 389844 gene locus_tag LOCUS_11670 390692 389844 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_11670 391057 390689 gene locus_tag LOCUS_11680 391057 390689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_11680 391518 391057 gene locus_tag LOCUS_11690 391518 391057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 392071 391508 gene locus_tag LOCUS_11700 392071 391508 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482287.1 protein_id gnl|my_center|LOCUS_11700 392212 393117 gene locus_tag LOCUS_11710 392212 393117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_11710 393187 393405 gene locus_tag LOCUS_11720 393187 393405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 395115 393436 gene locus_tag LOCUS_11730 395115 393436 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_11730 396250 395126 gene locus_tag LOCUS_11740 396250 395126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 398244 396361 gene locus_tag LOCUS_11750 398244 396361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_11750 399729 398311 gene locus_tag LOCUS_11760 399729 398311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945948.1 protein_id gnl|my_center|LOCUS_11760 401330 399888 gene locus_tag LOCUS_11770 gene aspA 401330 399888 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTD7 protein_id gnl|my_center|LOCUS_11770 402367 401411 gene locus_tag LOCUS_11780 402367 401411 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_11780 403434 402379 gene locus_tag LOCUS_11790 403434 402379 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK7 protein_id gnl|my_center|LOCUS_11790 403318 403536 gene locus_tag LOCUS_11800 403318 403536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 404252 403605 gene locus_tag LOCUS_11810 gene udk 404252 403605 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67409 protein_id gnl|my_center|LOCUS_11810 405148 404339 gene locus_tag LOCUS_11820 405148 404339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_11820 405354 405923 gene locus_tag LOCUS_11830 405354 405923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 405968 407512 gene locus_tag LOCUS_11840 405968 407512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 408303 407605 gene locus_tag LOCUS_11850 408303 407605 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_11850 408694 408308 gene locus_tag LOCUS_11860 408694 408308 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_11860 408817 410826 gene locus_tag LOCUS_11870 408817 410826 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_11870 412579 410870 gene locus_tag LOCUS_11880 412579 410870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_11880 414101 412701 gene locus_tag LOCUS_11890 414101 412701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 414532 414152 gene locus_tag LOCUS_11900 414532 414152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 protein_id gnl|my_center|LOCUS_11900 414725 415765 gene locus_tag LOCUS_11910 414725 415765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 416296 415790 gene locus_tag LOCUS_11920 416296 415790 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_11920 417961 416321 gene locus_tag LOCUS_11930 417961 416321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404757.1 protein_id gnl|my_center|LOCUS_11930 418969 418190 gene locus_tag LOCUS_11940 418969 418190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 420880 419120 gene locus_tag LOCUS_11950 420880 419120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence04 1691 225 gene locus_tag LOCUS_11960 1691 225 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_11960 2650 1841 gene locus_tag LOCUS_11970 2650 1841 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JC3 protein_id gnl|my_center|LOCUS_11970 4416 2647 gene locus_tag LOCUS_11980 4416 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_11980 5686 4505 gene locus_tag LOCUS_11990 5686 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5971 7962 gene locus_tag LOCUS_12000 5971 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 7959 10121 gene locus_tag LOCUS_12010 7959 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 12129 10084 gene locus_tag LOCUS_12020 gene dcp 12129 10084 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 protein_id gnl|my_center|LOCUS_12020 14028 12319 gene locus_tag LOCUS_12030 14028 12319 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_12030 14949 14065 gene locus_tag LOCUS_12040 14949 14065 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 protein_id gnl|my_center|LOCUS_12040 15149 15472 gene locus_tag LOCUS_12050 15149 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 15842 15459 gene locus_tag LOCUS_12060 15842 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 16092 16880 gene locus_tag LOCUS_12070 16092 16880 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_12070 17077 17991 gene locus_tag LOCUS_12080 17077 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 18857 17958 gene locus_tag LOCUS_12090 18857 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192105.1 protein_id gnl|my_center|LOCUS_12090 19086 18862 gene locus_tag LOCUS_12100 19086 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_12100 20192 19155 gene locus_tag LOCUS_12110 20192 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 21508 20297 gene locus_tag LOCUS_12120 21508 20297 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_12120 21700 22929 gene locus_tag LOCUS_12130 21700 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 24056 22917 gene locus_tag LOCUS_12140 24056 22917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_12140 24820 24128 gene locus_tag LOCUS_12150 gene ArsH 24820 24128 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337697.1 protein_id gnl|my_center|LOCUS_12150 25124 24810 gene locus_tag LOCUS_12160 25124 24810 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888244.1 protein_id gnl|my_center|LOCUS_12160 26281 25250 gene locus_tag LOCUS_12170 26281 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 27196 26432 gene locus_tag LOCUS_12180 27196 26432 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391422.1 protein_id gnl|my_center|LOCUS_12180 28001 27288 gene locus_tag LOCUS_12190 28001 27288 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073517.1 protein_id gnl|my_center|LOCUS_12190 28993 28067 gene locus_tag LOCUS_12200 28993 28067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 31207 29018 gene locus_tag LOCUS_12210 gene phuR 31207 29018 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_12210 31461 31294 gene locus_tag LOCUS_12220 31461 31294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 31861 31475 gene locus_tag LOCUS_12230 31861 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 33264 32431 gene locus_tag LOCUS_12240 33264 32431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 33448 33669 gene locus_tag LOCUS_12250 33448 33669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 34693 34397 gene locus_tag LOCUS_12260 34693 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 35498 34680 gene locus_tag LOCUS_12270 35498 34680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 35994 35608 gene locus_tag LOCUS_12280 35994 35608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 37569 36010 gene locus_tag LOCUS_12290 37569 36010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 37874 39406 gene locus_tag LOCUS_12300 gene estA1 37874 39406 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 protein_id gnl|my_center|LOCUS_12300 40052 39426 gene locus_tag LOCUS_12310 40052 39426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 41335 40082 gene locus_tag LOCUS_12320 41335 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 42705 41350 gene locus_tag LOCUS_12330 42705 41350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_12330 44307 42709 gene locus_tag LOCUS_12340 44307 42709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 44688 45200 gene locus_tag LOCUS_12350 44688 45200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 45187 46650 gene locus_tag LOCUS_12360 45187 46650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 47789 46668 gene locus_tag LOCUS_12370 47789 46668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267262.1 protein_id gnl|my_center|LOCUS_12370 48751 47786 gene locus_tag LOCUS_12380 48751 47786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_12380 50207 48753 gene locus_tag LOCUS_12390 50207 48753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_12390 50362 53694 gene locus_tag LOCUS_12400 50362 53694 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_12400 53769 56450 gene locus_tag LOCUS_12410 53769 56450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_12410 56447 57370 gene locus_tag LOCUS_12420 56447 57370 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_12420 61179 57388 gene locus_tag LOCUS_12430 61179 57388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 62831 61176 gene locus_tag LOCUS_12440 62831 61176 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104170.1 protein_id gnl|my_center|LOCUS_12440 63143 65797 gene locus_tag LOCUS_12450 gene acn 63143 65797 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37032 protein_id gnl|my_center|LOCUS_12450 65794 67185 gene locus_tag LOCUS_12460 gene fumC 65794 67185 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP7 protein_id gnl|my_center|LOCUS_12460 67217 68581 gene locus_tag LOCUS_12470 67217 68581 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_12470 68613 69950 gene locus_tag LOCUS_12480 68613 69950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705704.1 protein_id gnl|my_center|LOCUS_12480 69963 70844 gene locus_tag LOCUS_12490 gene htpX 69963 70844 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_12490 71655 70888 gene locus_tag LOCUS_12500 71655 70888 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_12500 71965 71690 gene locus_tag LOCUS_12510 71965 71690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 73908 72175 gene locus_tag LOCUS_12520 73908 72175 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_12520 75042 74053 gene locus_tag LOCUS_12530 75042 74053 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_12530 75168 76025 gene locus_tag LOCUS_12540 75168 76025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 76040 76534 gene locus_tag LOCUS_12550 gene rimI 76040 76534 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_12550 76567 77415 gene locus_tag LOCUS_12560 76567 77415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 77430 78518 gene locus_tag LOCUS_12570 gene hisC 77430 78518 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 protein_id gnl|my_center|LOCUS_12570 78578 79081 gene locus_tag LOCUS_12580 78578 79081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 79083 79325 gene locus_tag LOCUS_12590 79083 79325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 79785 79339 gene locus_tag LOCUS_12600 79785 79339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 80348 80923 gene locus_tag LOCUS_12610 80348 80923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 81079 82749 gene locus_tag LOCUS_12620 81079 82749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 82749 83696 gene locus_tag LOCUS_12630 82749 83696 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222019.1 protein_id gnl|my_center|LOCUS_12630 83686 84633 gene locus_tag LOCUS_12640 83686 84633 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 protein_id gnl|my_center|LOCUS_12640 84630 85703 gene locus_tag LOCUS_12650 84630 85703 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_12650 85700 86767 gene locus_tag LOCUS_12660 85700 86767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_12660 87365 86832 gene locus_tag LOCUS_12670 87365 86832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 87540 89072 gene locus_tag LOCUS_12680 87540 89072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 89072 90019 gene locus_tag LOCUS_12690 89072 90019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 90203 91303 gene locus_tag LOCUS_12700 90203 91303 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_12700 91367 92350 gene locus_tag LOCUS_12710 91367 92350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 92317 93255 gene locus_tag LOCUS_12720 92317 93255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 94153 93326 gene locus_tag LOCUS_12730 94153 93326 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_12730 94752 94195 gene locus_tag LOCUS_12740 94752 94195 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890258.1 protein_id gnl|my_center|LOCUS_12740 94928 95788 gene locus_tag LOCUS_12750 gene sseA 94928 95788 CDS product putative 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I452 protein_id gnl|my_center|LOCUS_12750 96614 95745 gene locus_tag LOCUS_12760 96614 95745 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68826 protein_id gnl|my_center|LOCUS_12760 96747 98333 gene locus_tag LOCUS_12770 gene prfC 96747 98333 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_12770 98768 99886 gene locus_tag LOCUS_12780 gene tgt 98768 99886 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_12780 99931 100260 gene locus_tag LOCUS_12790 99931 100260 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_12790 100357 102216 gene locus_tag LOCUS_12800 gene secD 100357 102216 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX41 protein_id gnl|my_center|LOCUS_12800 102253 103212 gene locus_tag LOCUS_12810 gene secF 102253 103212 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_12810 104863 103220 gene locus_tag LOCUS_12820 104863 103220 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_12820 105025 107184 gene locus_tag LOCUS_12830 105025 107184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 108261 107227 gene locus_tag LOCUS_12840 gene mltB 108261 107227 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_12840 109548 108388 gene locus_tag LOCUS_12850 109548 108388 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_12850 109614 111203 gene locus_tag LOCUS_12860 109614 111203 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190045.1 protein_id gnl|my_center|LOCUS_12860 111200 111817 gene locus_tag LOCUS_12870 111200 111817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 111844 112479 gene locus_tag LOCUS_12880 111844 112479 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_12880 112706 116260 gene locus_tag LOCUS_12890 112706 116260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 116264 118567 gene locus_tag LOCUS_12900 116264 118567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_12900 118564 119628 gene locus_tag LOCUS_12910 118564 119628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 119693 122377 gene locus_tag LOCUS_12920 119693 122377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_12920 122377 123345 gene locus_tag LOCUS_12930 122377 123345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 123376 124428 gene locus_tag LOCUS_12940 gene moxR 123376 124428 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_12940 124469 125362 gene locus_tag LOCUS_12950 124469 125362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_12950 125363 127402 gene locus_tag LOCUS_12960 125363 127402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 130752 127588 gene locus_tag LOCUS_12970 130752 127588 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_12970 131786 130749 gene locus_tag LOCUS_12980 131786 130749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 132687 132151 gene locus_tag LOCUS_12990 132687 132151 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203413.1 protein_id gnl|my_center|LOCUS_12990 134021 132687 gene locus_tag LOCUS_13000 gene roxS 134021 132687 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_13000 134186 135820 gene locus_tag LOCUS_13010 134186 135820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 135831 136694 gene locus_tag LOCUS_13020 135831 136694 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184944.1 protein_id gnl|my_center|LOCUS_13020 138790 136730 gene locus_tag LOCUS_13030 gene nicT 138790 136730 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_13030 139019 139447 gene locus_tag LOCUS_13040 139019 139447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 139440 140420 gene locus_tag LOCUS_13050 139440 140420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 140539 141642 gene locus_tag LOCUS_13060 140539 141642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 141642 142067 gene locus_tag LOCUS_13070 141642 142067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 142436 142098 gene locus_tag LOCUS_13080 gene glnK 142436 142098 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_13080 143238 142531 gene locus_tag LOCUS_13090 143238 142531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 143852 143397 gene locus_tag LOCUS_13100 143852 143397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 144047 144253 gene locus_tag LOCUS_13110 144047 144253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 144313 145293 gene locus_tag LOCUS_13120 144313 145293 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ5 protein_id gnl|my_center|LOCUS_13120 145300 148140 gene locus_tag LOCUS_13130 gene ileS 145300 148140 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_13130 148175 148648 gene locus_tag LOCUS_13140 148175 148648 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_13140 148653 149621 gene locus_tag LOCUS_13150 gene ispH 148653 149621 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_13150 150664 149642 gene locus_tag LOCUS_13160 150664 149642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 151528 150686 gene locus_tag LOCUS_13170 151528 150686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 151633 151998 gene locus_tag LOCUS_13180 151633 151998 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454676.1 protein_id gnl|my_center|LOCUS_13180 152127 153518 gene locus_tag LOCUS_13190 152127 153518 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_13190 154144 153545 gene locus_tag LOCUS_13200 154144 153545 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_13200 154240 155412 gene locus_tag LOCUS_13210 154240 155412 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305421.1 protein_id gnl|my_center|LOCUS_13210 157428 155398 gene locus_tag LOCUS_13220 gene recD 157428 155398 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889H1 protein_id gnl|my_center|LOCUS_13220 161186 157425 gene locus_tag LOCUS_13230 gene recB 161186 157425 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB6 protein_id gnl|my_center|LOCUS_13230 164785 161183 gene locus_tag LOCUS_13240 gene recC 164785 161183 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB5 protein_id gnl|my_center|LOCUS_13240 166409 164814 gene locus_tag LOCUS_13250 gene gatAX 166409 164814 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 protein_id gnl|my_center|LOCUS_13250 167501 166503 gene locus_tag LOCUS_13260 167501 166503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 167819 170143 gene locus_tag LOCUS_13270 167819 170143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 173246 170115 gene locus_tag LOCUS_13280 gene sbcC 173246 170115 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB15 protein_id gnl|my_center|LOCUS_13280 174597 173341 gene locus_tag LOCUS_13290 gene sbcD 174597 173341 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_13290 174695 175474 gene locus_tag LOCUS_13300 174695 175474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 176655 175450 gene locus_tag LOCUS_13310 176655 175450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 176790 177713 gene locus_tag LOCUS_13320 176790 177713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_13320 177722 178630 gene locus_tag LOCUS_13330 177722 178630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_13330 178621 180651 gene locus_tag LOCUS_13340 gene tgpA 178621 180651 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_13340 180749 183961 gene locus_tag LOCUS_13350 gene oar 180749 183961 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_13350 184087 184320 gene locus_tag LOCUS_13360 184087 184320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 184792 184286 gene locus_tag LOCUS_13370 184792 184286 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_13370 186046 184811 gene locus_tag LOCUS_13380 186046 184811 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_13380 186368 186913 gene locus_tag LOCUS_13390 186368 186913 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 protein_id gnl|my_center|LOCUS_13390 186987 188282 gene locus_tag LOCUS_13400 186987 188282 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_13400 188509 189384 gene locus_tag LOCUS_13410 gene mipA 188509 189384 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_13410 189604 189864 gene locus_tag LOCUS_13420 189604 189864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 189864 190625 gene locus_tag LOCUS_13430 gene parR 189864 190625 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 protein_id gnl|my_center|LOCUS_13430 190618 191952 gene locus_tag LOCUS_13440 190618 191952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 191998 192597 gene locus_tag LOCUS_13450 191998 192597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 192725 193687 gene locus_tag LOCUS_13460 192725 193687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_13460 193651 194676 gene locus_tag LOCUS_13470 193651 194676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_13470 194667 196463 gene locus_tag LOCUS_13480 194667 196463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 196484 196888 gene locus_tag LOCUS_13490 196484 196888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 196901 197443 gene locus_tag LOCUS_13500 196901 197443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_13500 197546 197986 gene locus_tag LOCUS_13510 197546 197986 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL38 protein_id gnl|my_center|LOCUS_13510 199246 198044 gene locus_tag LOCUS_13520 199246 198044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 199460 200173 gene locus_tag LOCUS_13530 199460 200173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 200288 202744 gene locus_tag LOCUS_13540 200288 202744 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_13540 202969 202805 gene locus_tag LOCUS_13550 202969 202805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 203278 203063 gene locus_tag LOCUS_13560 203278 203063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 205685 203424 gene locus_tag LOCUS_13570 205685 203424 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_13570 206804 205776 gene locus_tag LOCUS_13580 206804 205776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102998.1 protein_id gnl|my_center|LOCUS_13580 207312 208988 gene locus_tag LOCUS_13590 207312 208988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 209125 209751 gene locus_tag LOCUS_13600 209125 209751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 209756 210448 gene locus_tag LOCUS_13610 gene dsbA 209756 210448 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_13610 210578 211483 gene locus_tag LOCUS_13620 210578 211483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_13620 211483 212511 gene locus_tag LOCUS_13630 211483 212511 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_13630 212508 213227 gene locus_tag LOCUS_13640 gene algR 212508 213227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_13640 214001 213240 gene locus_tag LOCUS_13650 214001 213240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 214158 215156 gene locus_tag LOCUS_13660 214158 215156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 215153 215935 gene locus_tag LOCUS_13670 215153 215935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 217459 215954 gene locus_tag LOCUS_13680 217459 215954 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_13680 217607 218002 gene locus_tag LOCUS_13690 217607 218002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 218054 219496 gene locus_tag LOCUS_13700 218054 219496 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_13700 219545 221719 gene locus_tag LOCUS_13710 gene katG 219545 221719 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_13710 222172 221732 gene locus_tag LOCUS_13720 222172 221732 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464169.1 protein_id gnl|my_center|LOCUS_13720 222258 222677 gene locus_tag LOCUS_13730 222258 222677 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_13730 223898 222693 gene locus_tag LOCUS_13740 223898 222693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_13740 224941 223982 gene locus_tag LOCUS_13750 224941 223982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 225078 225614 gene locus_tag LOCUS_13760 225078 225614 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_13760 225728 226156 gene locus_tag LOCUS_13770 225728 226156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 226153 226824 gene locus_tag LOCUS_13780 gene senC 226153 226824 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_13780 227474 226830 gene locus_tag LOCUS_13790 227474 226830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 227962 227477 gene locus_tag LOCUS_13800 227962 227477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 229121 227940 gene locus_tag LOCUS_13810 229121 227940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022250.1 protein_id gnl|my_center|LOCUS_13810 230201 229374 gene locus_tag LOCUS_13820 230201 229374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 239672 230337 gene locus_tag LOCUS_13830 239672 230337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 240199 240546 gene locus_tag LOCUS_13840 240199 240546 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_13840 240543 241439 gene locus_tag LOCUS_13850 240543 241439 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_13850 241439 242110 gene locus_tag LOCUS_13860 241439 242110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 242121 244226 gene locus_tag LOCUS_13870 242121 244226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 244226 245035 gene locus_tag LOCUS_13880 244226 245035 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889268.1 protein_id gnl|my_center|LOCUS_13880 246066 245032 gene locus_tag LOCUS_13890 246066 245032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 246165 246392 gene locus_tag LOCUS_13900 246165 246392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 246747 247094 gene locus_tag LOCUS_13910 246747 247094 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_13910 247094 247426 gene locus_tag LOCUS_13920 247094 247426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 247431 248048 gene locus_tag LOCUS_13930 247431 248048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 248045 248431 gene locus_tag LOCUS_13940 248045 248431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 248507 249655 gene locus_tag LOCUS_13950 248507 249655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 252481 249671 gene locus_tag LOCUS_13960 gene valS 252481 249671 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887M3 protein_id gnl|my_center|LOCUS_13960 253437 252562 gene locus_tag LOCUS_13970 253437 252562 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479806.1 protein_id gnl|my_center|LOCUS_13970 255159 253633 gene locus_tag LOCUS_13980 255159 253633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 256873 255383 gene locus_tag LOCUS_13990 gene pepA 256873 255383 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_13990 257053 257487 gene locus_tag LOCUS_14000 257053 257487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 257496 258611 gene locus_tag LOCUS_14010 257496 258611 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_14010 258614 259687 gene locus_tag LOCUS_14020 258614 259687 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_14020 261277 259730 gene locus_tag LOCUS_14030 261277 259730 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108024.1 protein_id gnl|my_center|LOCUS_14030 261347 261823 gene locus_tag LOCUS_14040 261347 261823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 261828 262358 gene locus_tag LOCUS_14050 261828 262358 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_14050 263520 262411 gene locus_tag LOCUS_14060 gene leuB 263520 262411 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ26 protein_id gnl|my_center|LOCUS_14060 265357 264023 gene locus_tag LOCUS_14070 gene cry1 265357 264023 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR33 protein_id gnl|my_center|LOCUS_14070 265501 265935 gene locus_tag LOCUS_14080 265501 265935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 266001 268583 gene locus_tag LOCUS_14090 266001 268583 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_14090 269584 268607 gene locus_tag LOCUS_14100 269584 268607 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814121.1 protein_id gnl|my_center|LOCUS_14100 270899 269664 gene locus_tag LOCUS_14110 gene mntH 270899 269664 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_14110 271572 270919 gene locus_tag LOCUS_14120 271572 270919 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_14120 271958 271575 gene locus_tag LOCUS_14130 271958 271575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 272845 272024 gene locus_tag LOCUS_14140 272845 272024 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_14140 273021 274313 gene locus_tag LOCUS_14150 gene amaA 273021 274313 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_14150 274512 276488 gene locus_tag LOCUS_14160 274512 276488 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074381.1 protein_id gnl|my_center|LOCUS_14160 278314 276566 gene locus_tag LOCUS_14170 278314 276566 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_14170 278468 278920 gene locus_tag LOCUS_14180 278468 278920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_14180 279807 278929 gene locus_tag LOCUS_14190 279807 278929 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_14190 281658 279838 gene locus_tag LOCUS_14200 281658 279838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_14200 281750 281983 gene locus_tag LOCUS_14210 281750 281983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 282008 284932 gene locus_tag LOCUS_14220 282008 284932 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_14220 284937 286250 gene locus_tag LOCUS_14230 284937 286250 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_14230 286894 286262 gene locus_tag LOCUS_14240 286894 286262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 286989 287666 gene locus_tag LOCUS_14250 286989 287666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 289447 287729 gene locus_tag LOCUS_14260 289447 287729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 290075 289479 gene locus_tag LOCUS_14270 290075 289479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 290248 291156 gene locus_tag LOCUS_14280 gene lpqP 290248 291156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_14280 292284 291145 gene locus_tag LOCUS_14290 292284 291145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 292525 294753 gene locus_tag LOCUS_14300 gene katG2 292525 294753 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ17 protein_id gnl|my_center|LOCUS_14300 294897 295376 gene locus_tag LOCUS_14310 294897 295376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 protein_id gnl|my_center|LOCUS_14310 296807 295386 gene locus_tag LOCUS_14320 296807 295386 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037744.1 protein_id gnl|my_center|LOCUS_14320 297145 297059 gene locus_tag LOCUS_t00130 297145 297059 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 297265 298314 gene locus_tag LOCUS_14330 gene queA 297265 298314 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_14330 298381 299361 gene locus_tag LOCUS_14340 gene mdh 298381 299361 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC25 protein_id gnl|my_center|LOCUS_14340 299391 300440 gene locus_tag LOCUS_14350 299391 300440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 300454 301248 gene locus_tag LOCUS_14360 300454 301248 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_14360 301740 301267 gene locus_tag LOCUS_14370 301740 301267 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_14370 302035 303723 gene locus_tag LOCUS_14380 gene leuA-2 302035 303723 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_14380 303788 304357 gene locus_tag LOCUS_14390 303788 304357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 304354 305031 gene locus_tag LOCUS_14400 304354 305031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 305147 306154 gene locus_tag LOCUS_14410 305147 306154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 306275 306706 gene locus_tag LOCUS_14420 306275 306706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 307597 306728 gene locus_tag LOCUS_14430 307597 306728 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217214.1 protein_id gnl|my_center|LOCUS_14430 307742 308215 gene locus_tag LOCUS_14440 gene iscR 307742 308215 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_14440 308249 309415 gene locus_tag LOCUS_14450 gene iscS 308249 309415 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_14450 309467 309895 gene locus_tag LOCUS_14460 gene ndk 309467 309895 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_14460 309926 311083 gene locus_tag LOCUS_14470 gene rlmN 309926 311083 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX26 protein_id gnl|my_center|LOCUS_14470 311095 311970 gene locus_tag LOCUS_14480 gene rodZ 311095 311970 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P3 protein_id gnl|my_center|LOCUS_14480 312055 313137 gene locus_tag LOCUS_14490 gene ispG 312055 313137 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_14490 313150 314436 gene locus_tag LOCUS_14500 gene hisS 313150 314436 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ45 protein_id gnl|my_center|LOCUS_14500 314549 315217 gene locus_tag LOCUS_14510 314549 315217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_14510 315245 316393 gene locus_tag LOCUS_14520 gene bamB 315245 316393 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_14520 316444 317886 gene locus_tag LOCUS_14530 gene der 316444 317886 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_14530 317890 318888 gene locus_tag LOCUS_14540 317890 318888 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_14540 319294 318854 gene locus_tag LOCUS_14550 319294 318854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 319397 320542 gene locus_tag LOCUS_14560 gene mrdB 319397 320542 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707028.1 protein_id gnl|my_center|LOCUS_14560 320626 322293 gene locus_tag LOCUS_14570 320626 322293 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_14570 323017 322322 gene locus_tag LOCUS_14580 323017 322322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 324230 322983 gene locus_tag LOCUS_14590 gene xseA 324230 322983 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_14590 324295 325764 gene locus_tag LOCUS_14600 gene guaB 324295 325764 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_14600 325872 327452 gene locus_tag LOCUS_14610 gene guaA 325872 327452 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 protein_id gnl|my_center|LOCUS_14610 328201 327506 gene locus_tag LOCUS_14620 328201 327506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 329037 328198 gene locus_tag LOCUS_14630 329037 328198 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_14630 330010 329045 gene locus_tag LOCUS_14640 330010 329045 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_14640 330288 330007 gene locus_tag LOCUS_14650 330288 330007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence05 1499 729 gene locus_tag LOCUS_14660 gene tatC 1499 729 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_14660 2224 1496 gene locus_tag LOCUS_14670 2224 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2519 2268 gene locus_tag LOCUS_14680 gene tatA 2519 2268 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57051 protein_id gnl|my_center|LOCUS_14680 2909 2571 gene locus_tag LOCUS_14690 gene hisE 2909 2571 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_14690 3369 2929 gene locus_tag LOCUS_14700 gene hisI 3369 2929 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_14700 4955 3387 gene locus_tag LOCUS_14710 gene ubiB 4955 3387 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_14710 5619 4966 gene locus_tag LOCUS_14720 gene coq7 5619 4966 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_14720 6954 5638 gene locus_tag LOCUS_14730 gene purD 6954 5638 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_14730 8540 6969 gene locus_tag LOCUS_14740 gene purH 8540 6969 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VR9 protein_id gnl|my_center|LOCUS_14740 8880 8593 gene locus_tag LOCUS_14750 gene fis 8880 8593 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64128 protein_id gnl|my_center|LOCUS_14750 9908 8877 gene locus_tag LOCUS_14760 gene dusB 9908 8877 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY3 protein_id gnl|my_center|LOCUS_14760 10501 9905 gene locus_tag LOCUS_14770 10501 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11389 10511 gene locus_tag LOCUS_14780 gene prmA 11389 10511 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_14780 12775 11414 gene locus_tag LOCUS_14790 gene accC 12775 11414 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_14790 13249 12788 gene locus_tag LOCUS_14800 gene accB 13249 12788 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_14800 13736 13290 gene locus_tag LOCUS_14810 gene aroQ1 13736 13290 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_14810 14279 13851 gene locus_tag LOCUS_14820 14279 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15540 14320 gene locus_tag LOCUS_14830 gene fabB 15540 14320 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_14830 16091 15564 gene locus_tag LOCUS_14840 gene fabA 16091 15564 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK2 protein_id gnl|my_center|LOCUS_14840 16233 17690 gene locus_tag LOCUS_14850 16233 17690 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932001.1 protein_id gnl|my_center|LOCUS_14850 17733 18557 gene locus_tag LOCUS_14860 gene galU 17733 18557 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_14860 18579 19919 gene locus_tag LOCUS_14870 18579 19919 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_14870 20389 19937 gene locus_tag LOCUS_14880 20389 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 21812 20400 gene locus_tag LOCUS_14890 gene rimK 21812 20400 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_14890 23476 21809 gene locus_tag LOCUS_14900 gene pgi 23476 21809 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_14900 23631 23708 gene locus_tag LOCUS_t00140 23631 23708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24057 26951 gene locus_tag LOCUS_14910 24057 26951 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_14910 27102 27761 gene locus_tag LOCUS_14920 27102 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 28773 27745 gene locus_tag LOCUS_14930 28773 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 28841 29224 gene locus_tag LOCUS_14940 28841 29224 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_14940 29952 29221 gene locus_tag LOCUS_14950 gene cobB 29952 29221 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJL6 protein_id gnl|my_center|LOCUS_14950 30034 30507 gene locus_tag LOCUS_14960 30034 30507 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_14960 30517 31299 gene locus_tag LOCUS_14970 30517 31299 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_14970 31296 32039 gene locus_tag LOCUS_14980 gene pdxJ 31296 32039 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_14980 32029 33303 gene locus_tag LOCUS_14990 32029 33303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 protein_id gnl|my_center|LOCUS_14990 33906 33304 gene locus_tag LOCUS_15000 33906 33304 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_15000 34178 34861 gene locus_tag LOCUS_15010 34178 34861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_15010 34854 37463 gene locus_tag LOCUS_15020 34854 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_15020 37480 38082 gene locus_tag LOCUS_15030 37480 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 38119 38757 gene locus_tag LOCUS_15040 gene pdxH 38119 38757 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKM4 protein_id gnl|my_center|LOCUS_15040 40023 38761 gene locus_tag LOCUS_15050 gene pfp 40023 38761 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_15050 40224 40754 gene locus_tag LOCUS_15060 gene ubiX 40224 40754 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WDB8 protein_id gnl|my_center|LOCUS_15060 41244 40729 gene locus_tag LOCUS_15070 41244 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 41291 42721 gene locus_tag LOCUS_15080 gene mpl 41291 42721 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M0 protein_id gnl|my_center|LOCUS_15080 42725 43342 gene locus_tag LOCUS_15090 42725 43342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_15090 43870 43385 gene locus_tag LOCUS_15100 gene cheW-2 43870 43385 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_15100 44028 44210 gene locus_tag LOCUS_15110 44028 44210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 44427 44269 gene locus_tag LOCUS_15120 44427 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 44507 45286 gene locus_tag LOCUS_15130 44507 45286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 45346 45825 gene locus_tag LOCUS_15140 45346 45825 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_15140 45902 46648 gene locus_tag LOCUS_15150 45902 46648 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_15150 46649 47329 gene locus_tag LOCUS_15160 46649 47329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 47952 47326 gene locus_tag LOCUS_15170 gene nudL 47952 47326 CDS product putative Nudix hydrolase NudL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CHW2 protein_id gnl|my_center|LOCUS_15170 50007 47980 gene locus_tag LOCUS_15180 50007 47980 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_15180 50245 51045 gene locus_tag LOCUS_15190 50245 51045 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_15190 51127 51612 gene locus_tag LOCUS_15200 gene slyD 51127 51612 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_15200 52095 51691 gene locus_tag LOCUS_15210 52095 51691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 53519 52092 gene locus_tag LOCUS_15220 53519 52092 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_15220 53813 54928 gene locus_tag LOCUS_15230 53813 54928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 54995 55546 gene locus_tag LOCUS_15240 54995 55546 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_15240 55654 56508 gene locus_tag LOCUS_15250 55654 56508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 56512 58332 gene locus_tag LOCUS_15260 gene recQ 56512 58332 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_15260 58398 59390 gene locus_tag LOCUS_15270 58398 59390 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FT1 protein_id gnl|my_center|LOCUS_15270 59602 59387 gene locus_tag LOCUS_15280 59602 59387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 59728 60087 gene locus_tag LOCUS_15290 59728 60087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 61543 60197 gene locus_tag LOCUS_15300 61543 60197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 62576 61728 gene locus_tag LOCUS_15310 62576 61728 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687000.1 protein_id gnl|my_center|LOCUS_15310 62742 64463 gene locus_tag LOCUS_15320 62742 64463 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730166.1 protein_id gnl|my_center|LOCUS_15320 64467 65399 gene locus_tag LOCUS_15330 gene oppB 64467 65399 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048147.1 protein_id gnl|my_center|LOCUS_15330 65442 66851 gene locus_tag LOCUS_15340 65442 66851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 66848 67912 gene locus_tag LOCUS_15350 gene oppD 66848 67912 CDS product oligopeptide transport ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24136 protein_id gnl|my_center|LOCUS_15350 67909 68868 gene locus_tag LOCUS_15360 gene ykfD 67909 68868 CDS product putative oligopeptide transport ATP-binding protein YkfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP98 protein_id gnl|my_center|LOCUS_15360 68892 69911 gene locus_tag LOCUS_15370 gene yejB 68892 69911 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_15370 69920 70987 gene locus_tag LOCUS_15380 69920 70987 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459031.1 protein_id gnl|my_center|LOCUS_15380 71011 72966 gene locus_tag LOCUS_15390 71011 72966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_15390 72976 73977 gene locus_tag LOCUS_15400 72976 73977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_15400 73974 74963 gene locus_tag LOCUS_15410 73974 74963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_15410 75025 75741 gene locus_tag LOCUS_15420 75025 75741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 75748 78438 gene locus_tag LOCUS_15430 75748 78438 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_15430 79317 78403 gene locus_tag LOCUS_15440 gene rimK 79317 78403 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_15440 79529 81190 gene locus_tag LOCUS_15450 79529 81190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 81196 82155 gene locus_tag LOCUS_15460 81196 82155 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_15460 82152 82514 gene locus_tag LOCUS_15470 82152 82514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 82545 84062 gene locus_tag LOCUS_15480 82545 84062 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403996.1 protein_id gnl|my_center|LOCUS_15480 84069 85520 gene locus_tag LOCUS_15490 84069 85520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 85567 86331 gene locus_tag LOCUS_15500 85567 86331 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_15500 86331 87797 gene locus_tag LOCUS_15510 86331 87797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_15510 88949 87822 gene locus_tag LOCUS_15520 88949 87822 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_15520 89615 88965 gene locus_tag LOCUS_15530 gene ompA 89615 88965 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310900.1 protein_id gnl|my_center|LOCUS_15530 89718 89554 gene locus_tag LOCUS_15540 89718 89554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 90773 89745 gene locus_tag LOCUS_15550 90773 89745 CDS product NAD/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036475.1 protein_id gnl|my_center|LOCUS_15550 91319 90777 gene locus_tag LOCUS_15560 91319 90777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175561.1 protein_id gnl|my_center|LOCUS_15560 92073 91339 gene locus_tag LOCUS_15570 92073 91339 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707541.1 protein_id gnl|my_center|LOCUS_15570 93598 92063 gene locus_tag LOCUS_15580 93598 92063 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_15580 93984 93595 gene locus_tag LOCUS_15590 93984 93595 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071074.1 protein_id gnl|my_center|LOCUS_15590 95489 93981 gene locus_tag LOCUS_15600 95489 93981 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266221.1 protein_id gnl|my_center|LOCUS_15600 96695 95640 gene locus_tag LOCUS_15610 96695 95640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 97077 96883 gene locus_tag LOCUS_15620 97077 96883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 97270 97734 gene locus_tag LOCUS_15630 97270 97734 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_15630 100300 97745 gene locus_tag LOCUS_15640 100300 97745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 101141 100509 gene locus_tag LOCUS_15650 101141 100509 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_15650 102846 101119 gene locus_tag LOCUS_15660 102846 101119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 102830 103186 gene locus_tag LOCUS_15670 102830 103186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 103347 105428 gene locus_tag LOCUS_15680 103347 105428 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105562.1 protein_id gnl|my_center|LOCUS_15680 106507 105425 gene locus_tag LOCUS_15690 gene ephA 106507 105425 CDS product epoxide hydrolase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YGS0 protein_id gnl|my_center|LOCUS_15690 106630 106950 gene locus_tag LOCUS_15700 106630 106950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 108955 106976 gene locus_tag LOCUS_15710 108955 106976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975516.1 protein_id gnl|my_center|LOCUS_15710 109128 110171 gene locus_tag LOCUS_15720 109128 110171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 110297 111514 gene locus_tag LOCUS_15730 110297 111514 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_15730 112095 111556 gene locus_tag LOCUS_15740 112095 111556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038147.1 protein_id gnl|my_center|LOCUS_15740 112427 114751 gene locus_tag LOCUS_15750 112427 114751 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_15750 114761 115318 gene locus_tag LOCUS_15760 114761 115318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 115901 115383 gene locus_tag LOCUS_15770 115901 115383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 116465 115998 gene locus_tag LOCUS_15780 116465 115998 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918799.1 protein_id gnl|my_center|LOCUS_15780 118486 116462 gene locus_tag LOCUS_15790 gene nosR 118486 116462 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 protein_id gnl|my_center|LOCUS_15790 118634 119095 gene locus_tag LOCUS_15800 118634 119095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880978.1 protein_id gnl|my_center|LOCUS_15800 120006 119110 gene locus_tag LOCUS_15810 120006 119110 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_15810 120132 120827 gene locus_tag LOCUS_15820 120132 120827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 121936 120836 gene locus_tag LOCUS_15830 121936 120836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 122210 125236 gene locus_tag LOCUS_15840 122210 125236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_15840 126544 125303 gene locus_tag LOCUS_15850 126544 125303 CDS product cytochrome C nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_15850 127872 126553 gene locus_tag LOCUS_15860 127872 126553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 128137 131142 gene locus_tag LOCUS_15870 128137 131142 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918879.1 protein_id gnl|my_center|LOCUS_15870 131238 132671 gene locus_tag LOCUS_15880 131238 132671 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_15880 132838 134247 gene locus_tag LOCUS_15890 132838 134247 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_15890 134386 135525 gene locus_tag LOCUS_15900 gene fic 134386 135525 CDS product adenosine monophosphate-protein transferase SoFic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K5 protein_id gnl|my_center|LOCUS_15900 135618 136403 gene locus_tag LOCUS_15910 135618 136403 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727156.1 protein_id gnl|my_center|LOCUS_15910 136442 137800 gene locus_tag LOCUS_15920 136442 137800 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_15920 137800 139065 gene locus_tag LOCUS_15930 137800 139065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_15930 139213 140565 gene locus_tag LOCUS_15940 139213 140565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 141817 140732 gene locus_tag LOCUS_15950 141817 140732 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_15950 141701 141976 gene locus_tag LOCUS_15960 141701 141976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 142250 142774 gene locus_tag LOCUS_15970 142250 142774 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_15970 143136 142732 gene locus_tag LOCUS_15980 143136 142732 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0M0 protein_id gnl|my_center|LOCUS_15980 143247 144644 gene locus_tag LOCUS_15990 143247 144644 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140247.1 protein_id gnl|my_center|LOCUS_15990 144985 145182 gene locus_tag LOCUS_16000 144985 145182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 145760 145185 gene locus_tag LOCUS_16010 145760 145185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 145995 146654 gene locus_tag LOCUS_16020 145995 146654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 147462 146716 gene locus_tag LOCUS_16030 147462 146716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 147941 147462 gene locus_tag LOCUS_16040 147941 147462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 148304 148561 gene locus_tag LOCUS_16050 148304 148561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 148551 148826 gene locus_tag LOCUS_16060 148551 148826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 150196 148868 gene locus_tag LOCUS_16070 150196 148868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_16070 150620 150408 gene locus_tag LOCUS_16080 150620 150408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 151280 150621 gene locus_tag LOCUS_16090 151280 150621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 151638 151351 gene locus_tag LOCUS_16100 151638 151351 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_16100 153512 151797 gene locus_tag LOCUS_16110 153512 151797 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460549.1 protein_id gnl|my_center|LOCUS_16110 153653 154513 gene locus_tag LOCUS_16120 153653 154513 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_16120 154582 154860 gene locus_tag LOCUS_16130 154582 154860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 155710 157962 gene locus_tag LOCUS_16140 155710 157962 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_16140 158166 158810 gene locus_tag LOCUS_16150 158166 158810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 158807 159517 gene locus_tag LOCUS_16160 158807 159517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_16160 159517 160254 gene locus_tag LOCUS_16170 159517 160254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 162517 160325 gene locus_tag LOCUS_16180 162517 160325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 162834 162514 gene locus_tag LOCUS_16190 162834 162514 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321975.1 protein_id gnl|my_center|LOCUS_16190 163483 163190 gene locus_tag LOCUS_16200 163483 163190 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_16200 163781 163473 gene locus_tag LOCUS_16210 163781 163473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205522.1 protein_id gnl|my_center|LOCUS_16210 164360 163818 gene locus_tag LOCUS_16220 164360 163818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_16220 165249 164497 gene locus_tag LOCUS_16230 165249 164497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 165752 165351 gene locus_tag LOCUS_16240 165752 165351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 166115 165771 gene locus_tag LOCUS_16250 166115 165771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 168155 166149 gene locus_tag LOCUS_16260 168155 166149 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_16260 168503 169459 gene locus_tag LOCUS_16270 168503 169459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 169968 171578 gene locus_tag LOCUS_16280 169968 171578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 172590 172817 gene locus_tag LOCUS_16290 172590 172817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 172814 173734 gene locus_tag LOCUS_16300 172814 173734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_16300 173731 177210 gene locus_tag LOCUS_16310 173731 177210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_16310 177200 178069 gene locus_tag LOCUS_16320 177200 178069 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_16320 178287 180464 gene locus_tag LOCUS_16330 178287 180464 CDS product DNA-repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_603345.2 protein_id gnl|my_center|LOCUS_16330 180468 180689 gene locus_tag LOCUS_16340 180468 180689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 180664 182715 gene locus_tag LOCUS_16350 180664 182715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 182722 183234 gene locus_tag LOCUS_16360 182722 183234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 183545 183459 gene locus_tag LOCUS_t00150 183545 183459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 183713 186583 gene locus_tag LOCUS_16370 gene rnr 183713 186583 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_16370 186583 187395 gene locus_tag LOCUS_16380 gene rlmB 186583 187395 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_16380 187569 188066 gene locus_tag LOCUS_16390 187569 188066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 188095 188325 gene locus_tag LOCUS_16400 gene rpsR 188095 188325 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_16400 188365 189213 gene locus_tag LOCUS_16410 188365 189213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_16410 189260 189706 gene locus_tag LOCUS_16420 gene rplI 189260 189706 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN2 protein_id gnl|my_center|LOCUS_16420 189883 191283 gene locus_tag LOCUS_16430 189883 191283 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 protein_id gnl|my_center|LOCUS_16430 191276 192481 gene locus_tag LOCUS_16440 gene alr 191276 192481 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW2 protein_id gnl|my_center|LOCUS_16440 192488 193867 gene locus_tag LOCUS_16450 gene radA 192488 193867 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45266 protein_id gnl|my_center|LOCUS_16450 193917 194840 gene locus_tag LOCUS_16460 193917 194840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_16460 194840 195601 gene locus_tag LOCUS_16470 194840 195601 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG7 protein_id gnl|my_center|LOCUS_16470 197025 195628 gene locus_tag LOCUS_16480 197025 195628 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_16480 197153 197980 gene locus_tag LOCUS_16490 197153 197980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_16490 198014 198457 gene locus_tag LOCUS_16500 198014 198457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 198492 201032 gene locus_tag LOCUS_16510 198492 201032 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525316.1 protein_id gnl|my_center|LOCUS_16510 202167 200995 gene locus_tag LOCUS_16520 202167 200995 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_16520 202378 204123 gene locus_tag LOCUS_16530 202378 204123 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367939.1 protein_id gnl|my_center|LOCUS_16530 204107 205876 gene locus_tag LOCUS_16540 204107 205876 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459842.1 protein_id gnl|my_center|LOCUS_16540 208879 206138 gene locus_tag LOCUS_16550 gene ppd 208879 206138 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_16550 209866 209087 gene locus_tag LOCUS_16560 209866 209087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477264.1 protein_id gnl|my_center|LOCUS_16560 211268 209883 gene locus_tag LOCUS_16570 211268 209883 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_16570 211543 212508 gene locus_tag LOCUS_16580 211543 212508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 212789 213652 gene locus_tag LOCUS_16590 212789 213652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 213847 214800 gene locus_tag LOCUS_16600 213847 214800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 215001 215951 gene locus_tag LOCUS_16610 215001 215951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 216179 215994 gene locus_tag LOCUS_16620 216179 215994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 216124 217083 gene locus_tag LOCUS_16630 216124 217083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 217256 218365 gene locus_tag LOCUS_16640 217256 218365 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 protein_id gnl|my_center|LOCUS_16640 218388 219917 gene locus_tag LOCUS_16650 218388 219917 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804020.1 protein_id gnl|my_center|LOCUS_16650 222067 219890 gene locus_tag LOCUS_16660 gene rlmL 222067 219890 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_16660 222110 222991 gene locus_tag LOCUS_16670 gene rlmJ 222110 222991 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP43 protein_id gnl|my_center|LOCUS_16670 222988 223497 gene locus_tag LOCUS_16680 222988 223497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 225097 223535 gene locus_tag LOCUS_16690 225097 223535 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_16690 225414 227468 gene locus_tag LOCUS_16700 225414 227468 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_16700 227600 229066 gene locus_tag LOCUS_16710 227600 229066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 229224 229433 gene locus_tag LOCUS_16720 229224 229433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 protein_id gnl|my_center|LOCUS_16720 229523 230590 gene locus_tag LOCUS_16730 229523 230590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_16730 230664 231446 gene locus_tag LOCUS_16740 230664 231446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 231523 232806 gene locus_tag LOCUS_16750 gene aroA 231523 232806 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z0 protein_id gnl|my_center|LOCUS_16750 233739 232807 gene locus_tag LOCUS_16760 233739 232807 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_16760 235244 233760 gene locus_tag LOCUS_16770 235244 233760 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_16770 237265 235526 gene locus_tag LOCUS_16780 237265 235526 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702957.1 protein_id gnl|my_center|LOCUS_16780 238068 237403 gene locus_tag LOCUS_16790 238068 237403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 238984 238319 gene locus_tag LOCUS_16800 238984 238319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 240219 239134 gene locus_tag LOCUS_16810 240219 239134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 240832 240206 gene locus_tag LOCUS_16820 240832 240206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 241596 240829 gene locus_tag LOCUS_16830 241596 240829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 242587 241610 gene locus_tag LOCUS_16840 242587 241610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 243243 242587 gene locus_tag LOCUS_16850 243243 242587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 243893 243243 gene locus_tag LOCUS_16860 243893 243243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 245467 243890 gene locus_tag LOCUS_16870 245467 243890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 246693 245488 gene locus_tag LOCUS_16880 246693 245488 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_16880 248408 246699 gene locus_tag LOCUS_16890 248408 246699 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_16890 250504 248405 gene locus_tag LOCUS_16900 250504 248405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 252214 250535 gene locus_tag LOCUS_16910 252214 250535 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_16910 253834 252230 gene locus_tag LOCUS_16920 253834 252230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 258153 253993 gene locus_tag LOCUS_16930 258153 253993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 258315 258242 gene locus_tag LOCUS_t00160 258315 258242 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 259536 258403 gene locus_tag LOCUS_16940 259536 258403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 260293 259814 gene locus_tag LOCUS_16950 260293 259814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 260949 260290 gene locus_tag LOCUS_16960 260949 260290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 262448 261141 gene locus_tag LOCUS_16970 262448 261141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 262832 262452 gene locus_tag LOCUS_16980 262832 262452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 263871 262951 gene locus_tag LOCUS_16990 263871 262951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_16990 264605 263868 gene locus_tag LOCUS_17000 264605 263868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038853.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence06 1279 485 gene locus_tag LOCUS_17010 1279 485 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709386.1 protein_id gnl|my_center|LOCUS_17010 1865 1407 gene locus_tag LOCUS_17020 1865 1407 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_17020 2859 1915 gene locus_tag LOCUS_17030 gene dhaA 2859 1915 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_17030 3281 2940 gene locus_tag LOCUS_17040 3281 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3572 3372 gene locus_tag LOCUS_17050 3572 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3532 4779 gene locus_tag LOCUS_17060 3532 4779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878640.1 protein_id gnl|my_center|LOCUS_17060 4844 5539 gene locus_tag LOCUS_17070 4844 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122952.1 protein_id gnl|my_center|LOCUS_17070 5551 6534 gene locus_tag LOCUS_17080 gene thrB 5551 6534 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29364 protein_id gnl|my_center|LOCUS_17080 6565 8235 gene locus_tag LOCUS_17090 6565 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9742 8246 gene locus_tag LOCUS_17100 9742 8246 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_17100 10037 10783 gene locus_tag LOCUS_17110 10037 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 11633 10833 gene locus_tag LOCUS_17120 11633 10833 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_17120 11732 12139 gene locus_tag LOCUS_17130 11732 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 13454 12150 gene locus_tag LOCUS_17140 13454 12150 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205023.1 protein_id gnl|my_center|LOCUS_17140 13706 14344 gene locus_tag LOCUS_17150 13706 14344 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67024 protein_id gnl|my_center|LOCUS_17150 14487 15857 gene locus_tag LOCUS_17160 14487 15857 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_17160 15862 16863 gene locus_tag LOCUS_17170 15862 16863 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086510.1 protein_id gnl|my_center|LOCUS_17170 16882 17769 gene locus_tag LOCUS_17180 16882 17769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 protein_id gnl|my_center|LOCUS_17180 17804 19525 gene locus_tag LOCUS_17190 17804 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_17190 20661 19534 gene locus_tag LOCUS_17200 20661 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 22140 20662 gene locus_tag LOCUS_17210 22140 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_17210 22852 22163 gene locus_tag LOCUS_17220 22852 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 23499 22879 gene locus_tag LOCUS_17230 23499 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24534 23530 gene locus_tag LOCUS_17240 24534 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 25631 24531 gene locus_tag LOCUS_17250 25631 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 26835 25618 gene locus_tag LOCUS_17260 26835 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 27680 26832 gene locus_tag LOCUS_17270 27680 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 28071 27700 gene locus_tag LOCUS_17280 28071 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 30164 28068 gene locus_tag LOCUS_17290 30164 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 31656 30169 gene locus_tag LOCUS_17300 31656 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 32837 31656 gene locus_tag LOCUS_17310 32837 31656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 33403 32894 gene locus_tag LOCUS_17320 33403 32894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 33522 33740 gene locus_tag LOCUS_17330 33522 33740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 33903 34223 gene locus_tag LOCUS_17340 33903 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 35537 34260 gene locus_tag LOCUS_17350 35537 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 35779 36594 gene locus_tag LOCUS_17360 gene mutM 35779 36594 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_17360 37092 36598 gene locus_tag LOCUS_17370 gene coaD 37092 36598 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_17370 38187 37168 gene locus_tag LOCUS_17380 38187 37168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_17380 38834 38184 gene locus_tag LOCUS_17390 38834 38184 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_17390 39132 40085 gene locus_tag LOCUS_17400 39132 40085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 40082 40777 gene locus_tag LOCUS_17410 gene ftsE 40082 40777 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_17410 40770 41729 gene locus_tag LOCUS_17420 gene ftsX 40770 41729 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E200 protein_id gnl|my_center|LOCUS_17420 43843 41738 gene locus_tag LOCUS_17430 gene pepO 43843 41738 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_17430 43952 44845 gene locus_tag LOCUS_17440 gene rpoH 43952 44845 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_17440 44909 45289 gene locus_tag LOCUS_17450 44909 45289 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_17450 45303 45503 gene locus_tag LOCUS_17460 45303 45503 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_17460 45529 46317 gene locus_tag LOCUS_17470 gene thiG 45529 46317 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_17470 46319 47026 gene locus_tag LOCUS_17480 gene trmB 46319 47026 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_17480 47150 48361 gene locus_tag LOCUS_17490 47150 48361 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_17490 48403 50406 gene locus_tag LOCUS_17500 48403 50406 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_17500 51220 50438 gene locus_tag LOCUS_17510 51220 50438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889115.1 protein_id gnl|my_center|LOCUS_17510 51325 51750 gene locus_tag LOCUS_17520 51325 51750 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WML3 protein_id gnl|my_center|LOCUS_17520 51743 52489 gene locus_tag LOCUS_17530 gene cmoA 51743 52489 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRM2 protein_id gnl|my_center|LOCUS_17530 52489 53463 gene locus_tag LOCUS_17540 gene cmoB 52489 53463 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE5 protein_id gnl|my_center|LOCUS_17540 53609 54577 gene locus_tag LOCUS_17550 53609 54577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 54869 54714 gene locus_tag LOCUS_17560 gene rpmG 54869 54714 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZX4 protein_id gnl|my_center|LOCUS_17560 55140 54904 gene locus_tag LOCUS_17570 gene rpmB 55140 54904 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEM3 protein_id gnl|my_center|LOCUS_17570 55911 55237 gene locus_tag LOCUS_17580 55911 55237 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_17580 56065 57282 gene locus_tag LOCUS_17590 gene coaC 56065 57282 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_17590 57275 58702 gene locus_tag LOCUS_17600 gene algC 57275 58702 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_17600 58829 59746 gene locus_tag LOCUS_17610 gene argB 58829 59746 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_17610 59746 60393 gene locus_tag LOCUS_17620 gene slmA 59746 60393 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_17620 61059 60397 gene locus_tag LOCUS_17630 gene pyrE 61059 60397 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVV4 protein_id gnl|my_center|LOCUS_17630 61834 61085 gene locus_tag LOCUS_17640 gene rph 61834 61085 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_17640 62004 62870 gene locus_tag LOCUS_17650 62004 62870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_17650 63689 63078 gene locus_tag LOCUS_17660 63689 63078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 64268 64921 gene locus_tag LOCUS_17670 64268 64921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 65162 65407 gene locus_tag LOCUS_17680 65162 65407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 66011 67324 gene locus_tag LOCUS_17690 66011 67324 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_17690 67767 67330 gene locus_tag LOCUS_17700 67767 67330 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_17700 67888 68373 gene locus_tag LOCUS_17710 67888 68373 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974003.1 protein_id gnl|my_center|LOCUS_17710 69024 68383 gene locus_tag LOCUS_17720 69024 68383 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_17720 69227 69024 gene locus_tag LOCUS_17730 69227 69024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 69346 69540 gene locus_tag LOCUS_17740 69346 69540 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061934.1 protein_id gnl|my_center|LOCUS_17740 69578 72031 gene locus_tag LOCUS_17750 69578 72031 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_17750 72659 72006 gene locus_tag LOCUS_17760 72659 72006 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884942.1 protein_id gnl|my_center|LOCUS_17760 72738 73829 gene locus_tag LOCUS_17770 gene gapA 72738 73829 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_17770 73832 75058 gene locus_tag LOCUS_17780 73832 75058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_17780 76980 74953 gene locus_tag LOCUS_17790 76980 74953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 78232 77006 gene locus_tag LOCUS_17800 78232 77006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 78417 80057 gene locus_tag LOCUS_17810 78417 80057 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_17810 81081 80032 gene locus_tag LOCUS_17820 gene rsmC 81081 80032 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44453 protein_id gnl|my_center|LOCUS_17820 81770 81078 gene locus_tag LOCUS_17830 81770 81078 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPE7 protein_id gnl|my_center|LOCUS_17830 81898 83067 gene locus_tag LOCUS_17840 81898 83067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 83174 83986 gene locus_tag LOCUS_17850 83174 83986 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_17850 83983 86088 gene locus_tag LOCUS_17860 83983 86088 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_17860 86120 86695 gene locus_tag LOCUS_17870 86120 86695 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_17870 86698 89184 gene locus_tag LOCUS_17880 86698 89184 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268962.1 protein_id gnl|my_center|LOCUS_17880 90002 89247 gene locus_tag LOCUS_17890 90002 89247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 90176 91051 gene locus_tag LOCUS_17900 90176 91051 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 protein_id gnl|my_center|LOCUS_17900 91511 91077 gene locus_tag LOCUS_17910 gene trxC 91511 91077 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_17910 91752 92897 gene locus_tag LOCUS_17920 91752 92897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 93484 92960 gene locus_tag LOCUS_17930 93484 92960 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_17930 93667 94590 gene locus_tag LOCUS_17940 93667 94590 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537577.1 protein_id gnl|my_center|LOCUS_17940 95877 94657 gene locus_tag LOCUS_17950 95877 94657 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_17950 96976 95864 gene locus_tag LOCUS_17960 gene selU 96976 95864 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_17960 98012 96960 gene locus_tag LOCUS_17970 gene selD 98012 96960 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEK1 protein_id gnl|my_center|LOCUS_17970 98165 98782 gene locus_tag LOCUS_17980 gene gmk 98165 98782 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_17980 98889 99209 gene locus_tag LOCUS_17990 98889 99209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 99217 101424 gene locus_tag LOCUS_18000 gene spoT 99217 101424 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_18000 101455 101841 gene locus_tag LOCUS_18010 gene yjgF 101455 101841 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_18010 101865 103991 gene locus_tag LOCUS_18020 gene recG 101865 103991 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZZ8 protein_id gnl|my_center|LOCUS_18020 103984 105267 gene locus_tag LOCUS_18030 103984 105267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_18030 105274 106203 gene locus_tag LOCUS_18040 gene ubiA 105274 106203 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_18040 106415 106200 gene locus_tag LOCUS_18050 106415 106200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 106622 108514 gene locus_tag LOCUS_18060 106622 108514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_18060 108840 108682 gene locus_tag LOCUS_18070 108840 108682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 109203 110126 gene locus_tag LOCUS_18080 109203 110126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 111476 110289 gene locus_tag LOCUS_18090 gene gcdH 111476 110289 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_18090 111666 113882 gene locus_tag LOCUS_18100 gene uvrD 111666 113882 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_18100 113984 115327 gene locus_tag LOCUS_18110 113984 115327 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480760.1 protein_id gnl|my_center|LOCUS_18110 115750 115337 gene locus_tag LOCUS_18120 gene yciA 115750 115337 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_18120 116192 115827 gene locus_tag LOCUS_18130 116192 115827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 116244 116735 gene locus_tag LOCUS_18140 116244 116735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 116757 117530 gene locus_tag LOCUS_18150 116757 117530 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 protein_id gnl|my_center|LOCUS_18150 117532 118371 gene locus_tag LOCUS_18160 117532 118371 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 protein_id gnl|my_center|LOCUS_18160 119514 118342 gene locus_tag LOCUS_18170 119514 118342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_18170 119640 120509 gene locus_tag LOCUS_18180 119640 120509 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_18180 122631 120514 gene locus_tag LOCUS_18190 gene nicT 122631 120514 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_18190 123444 122743 gene locus_tag LOCUS_18200 123444 122743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 123671 125335 gene locus_tag LOCUS_18210 123671 125335 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_18210 125350 126411 gene locus_tag LOCUS_18220 125350 126411 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_18220 127399 126425 gene locus_tag LOCUS_18230 127399 126425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_18230 127953 127396 gene locus_tag LOCUS_18240 127953 127396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 128485 127943 gene locus_tag LOCUS_18250 128485 127943 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_18250 128715 128987 gene locus_tag LOCUS_18260 128715 128987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 130831 128996 gene locus_tag LOCUS_18270 gene glmS 130831 128996 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT8 protein_id gnl|my_center|LOCUS_18270 132229 130847 gene locus_tag LOCUS_18280 gene glmU 132229 130847 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH7 protein_id gnl|my_center|LOCUS_18280 132731 132318 gene locus_tag LOCUS_18290 gene atpC 132731 132318 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_18290 134166 132763 gene locus_tag LOCUS_18300 gene atpD 134166 132763 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_18300 135091 134231 gene locus_tag LOCUS_18310 gene atpG 135091 134231 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_18310 136671 135127 gene locus_tag LOCUS_18320 gene atpA 136671 135127 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_18320 137233 136697 gene locus_tag LOCUS_18330 gene atpH 137233 136697 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_18330 137715 137245 gene locus_tag LOCUS_18340 gene atpF 137715 137245 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_18340 138017 137772 gene locus_tag LOCUS_18350 gene atpE 138017 137772 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH0 protein_id gnl|my_center|LOCUS_18350 138947 138087 gene locus_tag LOCUS_18360 gene atpB 138947 138087 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_18360 139310 138978 gene locus_tag LOCUS_18370 139310 138978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 140383 139478 gene locus_tag LOCUS_18380 gene spoOJ 140383 139478 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_18380 141216 140437 gene locus_tag LOCUS_18390 141216 140437 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 protein_id gnl|my_center|LOCUS_18390 141902 141237 gene locus_tag LOCUS_18400 gene rsmG 141902 141237 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_18400 143831 141927 gene locus_tag LOCUS_18410 gene mnmG 143831 141927 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_18410 145658 144261 gene locus_tag LOCUS_18420 gene mnmE 145658 144261 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NR09 protein_id gnl|my_center|LOCUS_18420 147379 145664 gene locus_tag LOCUS_18430 gene yidC 147379 145664 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS1 protein_id gnl|my_center|LOCUS_18430 147646 147389 gene locus_tag LOCUS_18440 147646 147389 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I270 protein_id gnl|my_center|LOCUS_18440 148031 147660 gene locus_tag LOCUS_18450 gene rnpA 148031 147660 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_18450 148616 150244 gene locus_tag LOCUS_18460 gene dnaA 148616 150244 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U7 protein_id gnl|my_center|LOCUS_18460 150295 151401 gene locus_tag LOCUS_18470 gene dnaN 150295 151401 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_18470 151419 152519 gene locus_tag LOCUS_18480 gene recF 151419 152519 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_18480 152542 154962 gene locus_tag LOCUS_18490 gene gyrB 152542 154962 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_18490 155708 154992 gene locus_tag LOCUS_18500 gene lptA 155708 154992 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_18500 156354 155752 gene locus_tag LOCUS_18510 156354 155752 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T8 protein_id gnl|my_center|LOCUS_18510 158463 156382 gene locus_tag LOCUS_18520 gene glyS 158463 156382 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_18520 159435 158494 gene locus_tag LOCUS_18530 gene glyQ 159435 158494 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B36 protein_id gnl|my_center|LOCUS_18530 159532 160443 gene locus_tag LOCUS_18540 gene htrB 159532 160443 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_18540 161944 160493 gene locus_tag LOCUS_18550 gene trkH 161944 160493 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_18550 163338 161965 gene locus_tag LOCUS_18560 gene trkA 163338 161965 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_18560 164818 163475 gene locus_tag LOCUS_18570 gene rsmB 164818 163475 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_18570 165798 164815 gene locus_tag LOCUS_18580 gene fmt 165798 164815 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_18580 166335 165823 gene locus_tag LOCUS_18590 gene def 166335 165823 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_18590 166543 167685 gene locus_tag LOCUS_18600 166543 167685 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_18600 167690 168280 gene locus_tag LOCUS_18610 gene tsaC 167690 168280 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_18610 168311 169246 gene locus_tag LOCUS_18620 gene hemF 168311 169246 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_18620 169247 170095 gene locus_tag LOCUS_18630 gene aroE 169247 170095 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S3 protein_id gnl|my_center|LOCUS_18630 170610 170074 gene locus_tag LOCUS_18640 170610 170074 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_18640 170740 172815 gene locus_tag LOCUS_18650 gene prlC 170740 172815 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103009.1 protein_id gnl|my_center|LOCUS_18650 173172 174320 gene locus_tag LOCUS_18660 gene coxB 173172 174320 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_18660 174326 175930 gene locus_tag LOCUS_18670 gene coxA 174326 175930 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_18670 176014 176583 gene locus_tag LOCUS_18680 176014 176583 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_18680 176619 177545 gene locus_tag LOCUS_18690 gene coIII 176619 177545 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_18690 177852 177643 gene locus_tag LOCUS_18700 177852 177643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 177901 178629 gene locus_tag LOCUS_18710 177901 178629 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_18710 178631 179281 gene locus_tag LOCUS_18720 178631 179281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 179732 179382 gene locus_tag LOCUS_18730 179732 179382 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709070.1 protein_id gnl|my_center|LOCUS_18730 180454 179768 gene locus_tag LOCUS_18740 gene coxP 180454 179768 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_18740 181127 180495 gene locus_tag LOCUS_18750 gene coxO 181127 180495 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 protein_id gnl|my_center|LOCUS_18750 182887 181130 gene locus_tag LOCUS_18760 182887 181130 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UC78 protein_id gnl|my_center|LOCUS_18760 184346 182982 gene locus_tag LOCUS_18770 184346 182982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 185216 184677 gene locus_tag LOCUS_18780 185216 184677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 protein_id gnl|my_center|LOCUS_18780 185425 186312 gene locus_tag LOCUS_18790 gene cyoE1 185425 186312 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_18790 186338 187012 gene locus_tag LOCUS_18800 186338 187012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 187810 187025 gene locus_tag LOCUS_18810 gene znuB 187810 187025 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_18810 188600 187803 gene locus_tag LOCUS_18820 gene znuC 188600 187803 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZS2 protein_id gnl|my_center|LOCUS_18820 188679 189617 gene locus_tag LOCUS_18830 188679 189617 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_18830 189651 192419 gene locus_tag LOCUS_18840 gene polA 189651 192419 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_18840 193081 192416 gene locus_tag LOCUS_18850 gene engB 193081 192416 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLZ6 protein_id gnl|my_center|LOCUS_18850 193163 193774 gene locus_tag LOCUS_18860 gene cc4 193163 193774 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_18860 193877 194521 gene locus_tag LOCUS_18870 193877 194521 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT1 protein_id gnl|my_center|LOCUS_18870 194587 196545 gene locus_tag LOCUS_18880 194587 196545 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266287.1 protein_id gnl|my_center|LOCUS_18880 196651 197979 gene locus_tag LOCUS_18890 196651 197979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 197982 198554 gene locus_tag LOCUS_18900 197982 198554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 198551 200029 gene locus_tag LOCUS_18910 gene gspE 198551 200029 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_18910 200026 201237 gene locus_tag LOCUS_18920 200026 201237 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_18920 201282 203438 gene locus_tag LOCUS_18930 gene xcpQ 201282 203438 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_18930 203461 203868 gene locus_tag LOCUS_18940 203461 203868 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_18940 203846 204337 gene locus_tag LOCUS_18950 203846 204337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 204330 204722 gene locus_tag LOCUS_18960 204330 204722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 204719 205360 gene locus_tag LOCUS_18970 204719 205360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 205357 206442 gene locus_tag LOCUS_18980 205357 206442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 207705 206491 gene locus_tag LOCUS_18990 gene tagH 207705 206491 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_18990 208508 207705 gene locus_tag LOCUS_19000 gene wzm 208508 207705 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_19000 208511 209305 gene locus_tag LOCUS_19010 208511 209305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_19010 209427 210164 gene locus_tag LOCUS_19020 209427 210164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 210154 211020 gene locus_tag LOCUS_19030 gene wbiF 210154 211020 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938487.1 protein_id gnl|my_center|LOCUS_19030 211017 211985 gene locus_tag LOCUS_19040 211017 211985 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_19040 211987 212886 gene locus_tag LOCUS_19050 gene rmlA 211987 212886 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_19050 212950 213516 gene locus_tag LOCUS_19060 212950 213516 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344923.1 protein_id gnl|my_center|LOCUS_19060 213547 214446 gene locus_tag LOCUS_19070 gene rfbD 213547 214446 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_19070 214466 215098 gene locus_tag LOCUS_19080 214466 215098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 215095 216570 gene locus_tag LOCUS_19090 215095 216570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 217953 216556 gene locus_tag LOCUS_19100 gene aprF 217953 216556 CDS product alkaline protease secretion protein AprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03027 protein_id gnl|my_center|LOCUS_19100 219368 217959 gene locus_tag LOCUS_19110 219368 217959 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_19110 221068 219365 gene locus_tag LOCUS_19120 221068 219365 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_19120 221971 221270 gene locus_tag LOCUS_19130 221971 221270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 222147 223673 gene locus_tag LOCUS_19140 222147 223673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 223676 225721 gene locus_tag LOCUS_19150 gene gidA 223676 225721 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_19150 225964 227208 gene locus_tag LOCUS_19160 225964 227208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 227545 232152 gene locus_tag LOCUS_19170 227545 232152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 232297 233079 gene locus_tag LOCUS_19180 232297 233079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 233134 234705 gene locus_tag LOCUS_19190 233134 234705 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 protein_id gnl|my_center|LOCUS_19190 234763 234921 gene locus_tag LOCUS_19200 234763 234921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 234951 235592 gene locus_tag LOCUS_19210 234951 235592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 235771 236100 gene locus_tag LOCUS_19220 235771 236100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 236042 236560 gene locus_tag LOCUS_19230 236042 236560 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_19230 236690 237145 gene locus_tag LOCUS_19240 236690 237145 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_19240 237235 237606 gene locus_tag LOCUS_19250 237235 237606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 239704 237644 gene locus_tag LOCUS_19260 gene rep 239704 237644 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 protein_id gnl|my_center|LOCUS_19260 239797 241512 gene locus_tag LOCUS_19270 239797 241512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 241637 243172 gene locus_tag LOCUS_19280 241637 243172 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_19280 243383 243141 gene locus_tag LOCUS_19290 243383 243141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_19290 243697 244035 gene locus_tag LOCUS_19300 gene glnK 243697 244035 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_19300 244069 245331 gene locus_tag LOCUS_19310 gene amtB 244069 245331 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_19310 246172 245450 gene locus_tag LOCUS_19320 246172 245450 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_19320 247031 246183 gene locus_tag LOCUS_19330 gene metF 247031 246183 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 protein_id gnl|my_center|LOCUS_19330 248437 247058 gene locus_tag LOCUS_19340 gene ahcY 248437 247058 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 protein_id gnl|my_center|LOCUS_19340 249633 248476 gene locus_tag LOCUS_19350 gene metK 249633 248476 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7J5 protein_id gnl|my_center|LOCUS_19350 250675 249659 gene locus_tag LOCUS_19360 250675 249659 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_19360 250860 252857 gene locus_tag LOCUS_19370 gene tktA 250860 252857 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83Q94 protein_id gnl|my_center|LOCUS_19370 252871 253902 gene locus_tag LOCUS_19380 gene epd 252871 253902 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_19380 253912 255096 gene locus_tag LOCUS_19390 gene pgk 253912 255096 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD3 protein_id gnl|my_center|LOCUS_19390 255127 256170 gene locus_tag LOCUS_19400 gene fba 255127 256170 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence07 387 698 gene locus_tag LOCUS_19410 gene rpsJ 387 698 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 protein_id gnl|my_center|LOCUS_19410 890 1543 gene locus_tag LOCUS_19420 gene rplC 890 1543 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD5 protein_id gnl|my_center|LOCUS_19420 1547 2170 gene locus_tag LOCUS_19430 gene rplD 1547 2170 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY5 protein_id gnl|my_center|LOCUS_19430 2167 2466 gene locus_tag LOCUS_19440 gene rplW 2167 2466 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_19440 2482 3312 gene locus_tag LOCUS_19450 gene rplB 2482 3312 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W8 protein_id gnl|my_center|LOCUS_19450 3337 3612 gene locus_tag LOCUS_19460 gene rpsS 3337 3612 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W7 protein_id gnl|my_center|LOCUS_19460 3630 3962 gene locus_tag LOCUS_19470 gene rplV 3630 3962 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP9 protein_id gnl|my_center|LOCUS_19470 3972 4640 gene locus_tag LOCUS_19480 gene rpsC 3972 4640 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_19480 4654 5067 gene locus_tag LOCUS_19490 gene rplP 4654 5067 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_19490 5067 5264 gene locus_tag LOCUS_19500 gene rpmC 5067 5264 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE3 protein_id gnl|my_center|LOCUS_19500 5267 5545 gene locus_tag LOCUS_19510 gene rpsQ 5267 5545 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W2 protein_id gnl|my_center|LOCUS_19510 5623 5991 gene locus_tag LOCUS_19520 gene rplN 5623 5991 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE5 protein_id gnl|my_center|LOCUS_19520 6013 6324 gene locus_tag LOCUS_19530 gene rplX 6013 6324 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_19530 6345 6914 gene locus_tag LOCUS_19540 gene rplE 6345 6914 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_19540 6916 7221 gene locus_tag LOCUS_19550 gene rpsN 6916 7221 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V8 protein_id gnl|my_center|LOCUS_19550 7236 7631 gene locus_tag LOCUS_19560 gene rpsH 7236 7631 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ8 protein_id gnl|my_center|LOCUS_19560 7672 8205 gene locus_tag LOCUS_19570 gene rplF 7672 8205 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V6 protein_id gnl|my_center|LOCUS_19570 8217 8567 gene locus_tag LOCUS_19580 gene rplR 8217 8567 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_19580 8580 9089 gene locus_tag LOCUS_19590 gene rpsE 8580 9089 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_19590 9095 9277 gene locus_tag LOCUS_19600 gene rpmD 9095 9277 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM3 protein_id gnl|my_center|LOCUS_19600 9282 9767 gene locus_tag LOCUS_19610 gene rplO 9282 9767 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 protein_id gnl|my_center|LOCUS_19610 9819 11123 gene locus_tag LOCUS_19620 gene secY 9819 11123 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_19620 11411 11767 gene locus_tag LOCUS_19630 gene rpsM 11411 11767 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN45 protein_id gnl|my_center|LOCUS_19630 11837 12235 gene locus_tag LOCUS_19640 gene rpsK 11837 12235 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_19640 12348 12968 gene locus_tag LOCUS_19650 gene rpsD 12348 12968 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_19650 13042 14037 gene locus_tag LOCUS_19660 gene rpoA 13042 14037 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR8 protein_id gnl|my_center|LOCUS_19660 14098 14490 gene locus_tag LOCUS_19670 gene rplQ 14098 14490 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK46 protein_id gnl|my_center|LOCUS_19670 14587 15777 gene locus_tag LOCUS_19680 gene agxT 14587 15777 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_19680 16279 15743 gene locus_tag LOCUS_19690 gene lspA 16279 15743 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DQ64 protein_id gnl|my_center|LOCUS_19690 17133 16339 gene locus_tag LOCUS_19700 17133 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 17840 17205 gene locus_tag LOCUS_19710 17840 17205 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_19710 19342 17837 gene locus_tag LOCUS_19720 gene glpK1 19342 17837 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_19720 19424 20968 gene locus_tag LOCUS_19730 gene glpD 19424 20968 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 protein_id gnl|my_center|LOCUS_19730 20961 22367 gene locus_tag LOCUS_19740 20961 22367 CDS product glycerol-3-phosphate 1-O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8D8 protein_id gnl|my_center|LOCUS_19740 22429 23802 gene locus_tag LOCUS_19750 22429 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_19750 24207 23782 gene locus_tag LOCUS_19760 24207 23782 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073609.1 protein_id gnl|my_center|LOCUS_19760 25011 24226 gene locus_tag LOCUS_19770 25011 24226 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_19770 25095 25766 gene locus_tag LOCUS_19780 25095 25766 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_19780 26223 25783 gene locus_tag LOCUS_19790 26223 25783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056732.1 protein_id gnl|my_center|LOCUS_19790 26648 26298 gene locus_tag LOCUS_19800 26648 26298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 26734 27393 gene locus_tag LOCUS_19810 26734 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 27703 29493 gene locus_tag LOCUS_19820 27703 29493 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_19820 29609 30856 gene locus_tag LOCUS_19830 29609 30856 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_19830 30867 31298 gene locus_tag LOCUS_19840 30867 31298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 31313 32302 gene locus_tag LOCUS_19850 31313 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 32304 33824 gene locus_tag LOCUS_19860 32304 33824 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_19860 34663 33839 gene locus_tag LOCUS_19870 34663 33839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 35777 34737 gene locus_tag LOCUS_19880 35777 34737 CDS product hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_19880 36032 37678 gene locus_tag LOCUS_19890 36032 37678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 protein_id gnl|my_center|LOCUS_19890 37857 40457 gene locus_tag LOCUS_19900 gene fecA 37857 40457 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_19900 40690 41349 gene locus_tag LOCUS_19910 40690 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 41363 43390 gene locus_tag LOCUS_19920 gene xcpQ 41363 43390 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_19920 43387 44868 gene locus_tag LOCUS_19930 gene gspE 43387 44868 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704541.1 protein_id gnl|my_center|LOCUS_19930 44873 46096 gene locus_tag LOCUS_19940 gene xcpS 44873 46096 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_19940 46156 46623 gene locus_tag LOCUS_19950 gene gspG 46156 46623 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262830.1 protein_id gnl|my_center|LOCUS_19950 46627 47145 gene locus_tag LOCUS_19960 46627 47145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 47156 47602 gene locus_tag LOCUS_19970 47156 47602 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947090.1 protein_id gnl|my_center|LOCUS_19970 47599 48318 gene locus_tag LOCUS_19980 gene xcpW 47599 48318 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_19980 48311 49468 gene locus_tag LOCUS_19990 gene xcpX 48311 49468 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_19990 49465 50727 gene locus_tag LOCUS_20000 49465 50727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 50789 51274 gene locus_tag LOCUS_20010 50789 51274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 51277 52071 gene locus_tag LOCUS_20020 51277 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 52878 52099 gene locus_tag LOCUS_20030 52878 52099 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY19 protein_id gnl|my_center|LOCUS_20030 53891 52875 gene locus_tag LOCUS_20040 53891 52875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523048.1 protein_id gnl|my_center|LOCUS_20040 54619 53888 gene locus_tag LOCUS_20050 54619 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 54703 55458 gene locus_tag LOCUS_20060 54703 55458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 55588 57750 gene locus_tag LOCUS_20070 55588 57750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 58342 59454 gene locus_tag LOCUS_20080 58342 59454 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970792.1 protein_id gnl|my_center|LOCUS_20080 62715 59884 gene locus_tag LOCUS_20090 gene uvrA 62715 59884 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_20090 62863 63378 gene locus_tag LOCUS_20100 gene ssb 62863 63378 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40947 protein_id gnl|my_center|LOCUS_20100 63517 64422 gene locus_tag LOCUS_20110 63517 64422 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103231.1 protein_id gnl|my_center|LOCUS_20110 64415 65650 gene locus_tag LOCUS_20120 gene moeA2 64415 65650 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113969.1 protein_id gnl|my_center|LOCUS_20120 65685 66443 gene locus_tag LOCUS_20130 65685 66443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 66735 68324 gene locus_tag LOCUS_20140 66735 68324 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_20140 68755 68342 gene locus_tag LOCUS_20150 68755 68342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 68904 69707 gene locus_tag LOCUS_20160 68904 69707 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810328.1 protein_id gnl|my_center|LOCUS_20160 69704 70474 gene locus_tag LOCUS_20170 69704 70474 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_20170 70488 71174 gene locus_tag LOCUS_20180 gene modC 70488 71174 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_20180 71185 72249 gene locus_tag LOCUS_20190 gene modC 71185 72249 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSS5 protein_id gnl|my_center|LOCUS_20190 72605 72294 gene locus_tag LOCUS_20200 gene dskA 72605 72294 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971243.1 protein_id gnl|my_center|LOCUS_20200 74389 72638 gene locus_tag LOCUS_20210 gene aceK 74389 72638 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRX0 protein_id gnl|my_center|LOCUS_20210 75757 74429 gene locus_tag LOCUS_20220 gene aceA 75757 74429 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104513.1 protein_id gnl|my_center|LOCUS_20220 75967 78171 gene locus_tag LOCUS_20230 gene glcB1 75967 78171 CDS product malate synthase G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AB2 protein_id gnl|my_center|LOCUS_20230 78370 79179 gene locus_tag LOCUS_20240 78370 79179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 79217 80977 gene locus_tag LOCUS_20250 79217 80977 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_20250 80992 81978 gene locus_tag LOCUS_20260 gene nahR 80992 81978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_20260 82058 83293 gene locus_tag LOCUS_20270 82058 83293 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_20270 83320 83742 gene locus_tag LOCUS_20280 83320 83742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 83766 85490 gene locus_tag LOCUS_20290 83766 85490 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_20290 86702 85524 gene locus_tag LOCUS_20300 gene phbA-1 86702 85524 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103367.1 protein_id gnl|my_center|LOCUS_20300 88646 86709 gene locus_tag LOCUS_20310 gene acsA2 88646 86709 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_20310 89539 88667 gene locus_tag LOCUS_20320 gene panC 89539 88667 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_20320 90369 89557 gene locus_tag LOCUS_20330 gene panB 90369 89557 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJN8 protein_id gnl|my_center|LOCUS_20330 91057 90410 gene locus_tag LOCUS_20340 91057 90410 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_20340 92541 91057 gene locus_tag LOCUS_20350 gene pcnB 92541 91057 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_20350 94544 93159 gene locus_tag LOCUS_20360 gene cbrB 94544 93159 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_20360 97480 94541 gene locus_tag LOCUS_20370 gene cbrA 97480 94541 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_20370 97646 97470 gene locus_tag LOCUS_20380 97646 97470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 98582 97662 gene locus_tag LOCUS_20390 gene gluQ 98582 97662 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_20390 99012 98560 gene locus_tag LOCUS_20400 gene dksA 99012 98560 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIZ1 protein_id gnl|my_center|LOCUS_20400 99338 100546 gene locus_tag LOCUS_20410 99338 100546 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_20410 100894 100550 gene locus_tag LOCUS_20420 100894 100550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 102152 100914 gene locus_tag LOCUS_20430 102152 100914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_20430 103557 102208 gene locus_tag LOCUS_20440 103557 102208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 103717 104337 gene locus_tag LOCUS_20450 103717 104337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 104951 104373 gene locus_tag LOCUS_20460 104951 104373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 105310 106131 gene locus_tag LOCUS_20470 105310 106131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 107821 106112 gene locus_tag LOCUS_20480 107821 106112 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_20480 108099 107818 gene locus_tag LOCUS_20490 108099 107818 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_20490 109162 108143 gene locus_tag LOCUS_20500 109162 108143 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_20500 109900 109205 gene locus_tag LOCUS_20510 109900 109205 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_20510 110033 110887 gene locus_tag LOCUS_20520 110033 110887 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_20520 111491 110937 gene locus_tag LOCUS_20530 111491 110937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938274.1 protein_id gnl|my_center|LOCUS_20530 111773 111507 gene locus_tag LOCUS_20540 gene ptsH 111773 111507 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_20540 112660 111770 gene locus_tag LOCUS_20550 112660 111770 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_20550 113200 112733 gene locus_tag LOCUS_20560 gene ptsN 113200 112733 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_20560 114814 113267 gene locus_tag LOCUS_20570 gene rpoN 114814 113267 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_20570 115654 114929 gene locus_tag LOCUS_20580 115654 114929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_20580 116302 115655 gene locus_tag LOCUS_20590 116302 115655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 116891 116268 gene locus_tag LOCUS_20600 116891 116268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 117445 116888 gene locus_tag LOCUS_20610 117445 116888 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_20610 118416 117442 gene locus_tag LOCUS_20620 gene kdsD 118416 117442 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_20620 119392 118436 gene locus_tag LOCUS_20630 gene yrbG 119392 118436 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_20630 119612 120220 gene locus_tag LOCUS_20640 119612 120220 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766521.1 protein_id gnl|my_center|LOCUS_20640 120273 120515 gene locus_tag LOCUS_20650 gene ligA 120273 120515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_20650 120546 121805 gene locus_tag LOCUS_20660 gene murA 120546 121805 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_20660 121815 122471 gene locus_tag LOCUS_20670 gene hisG 121815 122471 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_20670 122468 123814 gene locus_tag LOCUS_20680 gene hisD 122468 123814 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_20680 124999 123815 gene locus_tag LOCUS_20690 124999 123815 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_20690 125050 125823 gene locus_tag LOCUS_20700 125050 125823 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_20700 127741 125828 gene locus_tag LOCUS_20710 gene cysN 127741 125828 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW6 protein_id gnl|my_center|LOCUS_20710 128651 127743 gene locus_tag LOCUS_20720 gene cysD 128651 127743 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 protein_id gnl|my_center|LOCUS_20720 129204 128767 gene locus_tag LOCUS_20730 129204 128767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_20730 129445 130602 gene locus_tag LOCUS_20740 gene zapE 129445 130602 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_20740 130701 131129 gene locus_tag LOCUS_20750 gene rplM 130701 131129 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M9 protein_id gnl|my_center|LOCUS_20750 131157 131549 gene locus_tag LOCUS_20760 gene rpsI 131157 131549 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX3 protein_id gnl|my_center|LOCUS_20760 131951 132550 gene locus_tag LOCUS_20770 131951 132550 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_20770 132550 134568 gene locus_tag LOCUS_20780 132550 134568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 134618 135250 gene locus_tag LOCUS_20790 gene sspA 134618 135250 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_20790 135259 135693 gene locus_tag LOCUS_20800 gene sspB 135259 135693 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_20800 136304 135732 gene locus_tag LOCUS_20810 136304 135732 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_20810 136837 136301 gene locus_tag LOCUS_20820 gene gmhA 136837 136301 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_20820 137305 136889 gene locus_tag LOCUS_20830 137305 136889 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 protein_id gnl|my_center|LOCUS_20830 139100 137346 gene locus_tag LOCUS_20840 139100 137346 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_20840 139069 139248 gene locus_tag LOCUS_20850 139069 139248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 139326 140237 gene locus_tag LOCUS_20860 gene yraL 139326 140237 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2P1 protein_id gnl|my_center|LOCUS_20860 140603 140253 gene locus_tag LOCUS_20870 140603 140253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_20870 140882 140661 gene locus_tag LOCUS_20880 140882 140661 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_20880 142844 140979 gene locus_tag LOCUS_20890 142844 140979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 143785 144240 gene locus_tag LOCUS_20900 gene mraZ 143785 144240 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY1 protein_id gnl|my_center|LOCUS_20900 144277 145212 gene locus_tag LOCUS_20910 gene rsmH 144277 145212 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_20910 145278 145631 gene locus_tag LOCUS_20920 145278 145631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 145624 147351 gene locus_tag LOCUS_20930 gene ftsI 145624 147351 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_20930 147356 148906 gene locus_tag LOCUS_20940 gene murE 147356 148906 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 protein_id gnl|my_center|LOCUS_20940 148903 150288 gene locus_tag LOCUS_20950 gene murF 148903 150288 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ED92 protein_id gnl|my_center|LOCUS_20950 150288 151370 gene locus_tag LOCUS_20960 gene mraY 150288 151370 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_20960 151395 152759 gene locus_tag LOCUS_20970 gene murD 151395 152759 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_20970 152756 153946 gene locus_tag LOCUS_20980 gene ftsW 152756 153946 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_20980 153943 155037 gene locus_tag LOCUS_20990 gene murG 153943 155037 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_20990 155027 156454 gene locus_tag LOCUS_21000 gene murC 155027 156454 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ1 protein_id gnl|my_center|LOCUS_21000 156451 157431 gene locus_tag LOCUS_21010 gene ddlB 156451 157431 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_21010 157428 158411 gene locus_tag LOCUS_21020 157428 158411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 158426 159670 gene locus_tag LOCUS_21030 gene ftsA 158426 159670 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_21030 159708 160901 gene locus_tag LOCUS_21040 gene ftsZ 159708 160901 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ5 protein_id gnl|my_center|LOCUS_21040 161089 162000 gene locus_tag LOCUS_21050 gene lpxC 161089 162000 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_21050 162042 162974 gene locus_tag LOCUS_21060 162042 162974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_21060 163089 165854 gene locus_tag LOCUS_21070 gene secA 163089 165854 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_21070 165876 167099 gene locus_tag LOCUS_21080 gene argJ 165876 167099 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_21080 168165 167173 gene locus_tag LOCUS_21090 168165 167173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_21090 168373 168158 gene locus_tag LOCUS_21100 gene yacG 168373 168158 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_21100 168981 168370 gene locus_tag LOCUS_21110 gene coaE 168981 168370 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U3 protein_id gnl|my_center|LOCUS_21110 169938 169036 gene locus_tag LOCUS_21120 169938 169036 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_21120 171164 169935 gene locus_tag LOCUS_21130 gene pilC 171164 169935 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_21130 172819 171158 gene locus_tag LOCUS_21140 gene pilB 172819 171158 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_21140 172943 173389 gene locus_tag LOCUS_21150 172943 173389 CDS product pilin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_21150 173566 173970 gene locus_tag LOCUS_21160 173566 173970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 174873 173989 gene locus_tag LOCUS_21170 gene nadC 174873 173989 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_21170 175023 175490 gene locus_tag LOCUS_21180 175023 175490 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_21180 175487 176380 gene locus_tag LOCUS_21190 175487 176380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 176526 179216 gene locus_tag LOCUS_21200 176526 179216 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ34 protein_id gnl|my_center|LOCUS_21200 179260 180918 gene locus_tag LOCUS_21210 gene aceF 179260 180918 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59638 protein_id gnl|my_center|LOCUS_21210 181977 181033 gene locus_tag LOCUS_21220 181977 181033 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189570.1 protein_id gnl|my_center|LOCUS_21220 182884 182108 gene locus_tag LOCUS_21230 182884 182108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_21230 183900 182881 gene locus_tag LOCUS_21240 183900 182881 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_21240 184928 183942 gene locus_tag LOCUS_21250 184928 183942 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP04 protein_id gnl|my_center|LOCUS_21250 184979 185461 gene locus_tag LOCUS_21260 184979 185461 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRX5 protein_id gnl|my_center|LOCUS_21260 185454 187163 gene locus_tag LOCUS_21270 185454 187163 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918026.1 protein_id gnl|my_center|LOCUS_21270 187226 187747 gene locus_tag LOCUS_21280 187226 187747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 187916 188206 gene locus_tag LOCUS_21290 gene groS 187916 188206 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP19 protein_id gnl|my_center|LOCUS_21290 188269 189912 gene locus_tag LOCUS_21300 gene groL 188269 189912 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_21300 190130 190633 gene locus_tag LOCUS_21310 gene purE 190130 190633 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72157 protein_id gnl|my_center|LOCUS_21310 190642 191718 gene locus_tag LOCUS_21320 gene purK 190642 191718 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72158 protein_id gnl|my_center|LOCUS_21320 191754 192668 gene locus_tag LOCUS_21330 191754 192668 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_21330 193478 192672 gene locus_tag LOCUS_21340 193478 192672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_21340 194283 193471 gene locus_tag LOCUS_21350 gene motA-1 194283 193471 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_21350 194576 195820 gene locus_tag LOCUS_21360 194576 195820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 196041 197105 gene locus_tag LOCUS_21370 196041 197105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 197764 197177 gene locus_tag LOCUS_21380 197764 197177 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 protein_id gnl|my_center|LOCUS_21380 197918 198706 gene locus_tag LOCUS_21390 197918 198706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 198770 198854 gene locus_tag LOCUS_t00170 198770 198854 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 198999 199370 gene locus_tag LOCUS_21400 198999 199370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 199720 199944 gene locus_tag LOCUS_21410 199720 199944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 200166 200624 gene locus_tag LOCUS_21420 200166 200624 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_21420 200624 201220 gene locus_tag LOCUS_21430 200624 201220 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_21430 201229 202083 gene locus_tag LOCUS_21440 201229 202083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 202126 204573 gene locus_tag LOCUS_21450 202126 204573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 204838 204593 gene locus_tag LOCUS_21460 204838 204593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 205876 204884 gene locus_tag LOCUS_21470 205876 204884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 206205 205873 gene locus_tag LOCUS_21480 206205 205873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence08 1627 398 gene locus_tag LOCUS_21490 gene serA 1627 398 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_21490 1720 3117 gene locus_tag LOCUS_21500 1720 3117 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_21500 3263 3529 gene locus_tag LOCUS_21510 3263 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4271 3600 gene locus_tag LOCUS_21520 gene rpiA 4271 3600 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLU8 protein_id gnl|my_center|LOCUS_21520 4403 5917 gene locus_tag LOCUS_21530 gene ilvA1 4403 5917 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_21530 6248 5934 gene locus_tag LOCUS_21540 6248 5934 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_21540 7120 6251 gene locus_tag LOCUS_21550 7120 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7287 8138 gene locus_tag LOCUS_21560 gene motA 7287 8138 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_21560 8170 9117 gene locus_tag LOCUS_21570 gene motB 8170 9117 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402902.1 protein_id gnl|my_center|LOCUS_21570 10194 9142 gene locus_tag LOCUS_21580 gene rsgA 10194 9142 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY9 protein_id gnl|my_center|LOCUS_21580 10273 10830 gene locus_tag LOCUS_21590 gene orn 10273 10830 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQA6 protein_id gnl|my_center|LOCUS_21590 11885 10833 gene locus_tag LOCUS_21600 gene queG 11885 10833 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_21600 13002 11917 gene locus_tag LOCUS_21610 13002 11917 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_21610 13173 15491 gene locus_tag LOCUS_21620 13173 15491 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_21620 16455 15457 gene locus_tag LOCUS_21630 16455 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 protein_id gnl|my_center|LOCUS_21630 16740 17765 gene locus_tag LOCUS_21640 16740 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 17787 18653 gene locus_tag LOCUS_21650 17787 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 18724 21897 gene locus_tag LOCUS_21660 gene dnaE2 18724 21897 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJQ8 protein_id gnl|my_center|LOCUS_21660 22026 23024 gene locus_tag LOCUS_21670 22026 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 23950 23036 gene locus_tag LOCUS_21680 23950 23036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_21680 24044 25246 gene locus_tag LOCUS_21690 24044 25246 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_21690 26615 25272 gene locus_tag LOCUS_21700 26615 25272 CDS product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104196.1 protein_id gnl|my_center|LOCUS_21700 27394 26609 gene locus_tag LOCUS_21710 27394 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 28401 27793 gene locus_tag LOCUS_21720 28401 27793 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP94 protein_id gnl|my_center|LOCUS_21720 29067 28735 gene locus_tag LOCUS_21730 gene zapA 29067 28735 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_21730 29275 29060 gene locus_tag LOCUS_21740 29275 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 29405 30739 gene locus_tag LOCUS_21750 gene pepP 29405 30739 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_21750 30739 32025 gene locus_tag LOCUS_21760 gene ubiH 30739 32025 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_21760 32443 32042 gene locus_tag LOCUS_21770 32443 32042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_21770 32968 32501 gene locus_tag LOCUS_21780 32968 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_21780 33038 34297 gene locus_tag LOCUS_21790 33038 34297 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_21790 34373 34561 gene locus_tag LOCUS_21800 34373 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 34699 35400 gene locus_tag LOCUS_21810 34699 35400 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918910.1 protein_id gnl|my_center|LOCUS_21810 35533 37374 gene locus_tag LOCUS_21820 35533 37374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_21820 37409 39064 gene locus_tag LOCUS_21830 37409 39064 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_21830 39266 42409 gene locus_tag LOCUS_21840 gene czcA 39266 42409 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_21840 42484 43725 gene locus_tag LOCUS_21850 42484 43725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 43800 44543 gene locus_tag LOCUS_21860 43800 44543 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_21860 44569 45459 gene locus_tag LOCUS_21870 44569 45459 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_21870 47042 45489 gene locus_tag LOCUS_21880 gene ahpF 47042 45489 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z2 protein_id gnl|my_center|LOCUS_21880 47701 47138 gene locus_tag LOCUS_21890 47701 47138 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_21890 48204 47845 gene locus_tag LOCUS_21900 48204 47845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_21900 48342 49238 gene locus_tag LOCUS_21910 48342 49238 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_21910 49263 49412 gene locus_tag LOCUS_21920 49263 49412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 50126 49542 gene locus_tag LOCUS_21930 50126 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_21930 51491 50148 gene locus_tag LOCUS_21940 51491 50148 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_21940 51913 51494 gene locus_tag LOCUS_21950 51913 51494 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_21950 52875 52069 gene locus_tag LOCUS_21960 52875 52069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 52847 53380 gene locus_tag LOCUS_21970 gene slyD 52847 53380 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 protein_id gnl|my_center|LOCUS_21970 53429 54580 gene locus_tag LOCUS_21980 53429 54580 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_21980 54656 55177 gene locus_tag LOCUS_21990 54656 55177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_21990 55877 55158 gene locus_tag LOCUS_22000 55877 55158 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_22000 55980 56492 gene locus_tag LOCUS_22010 gene rppH 55980 56492 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_22010 56498 58774 gene locus_tag LOCUS_22020 56498 58774 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_22020 58802 59593 gene locus_tag LOCUS_22030 gene lgt 58802 59593 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_22030 59590 60384 gene locus_tag LOCUS_22040 gene thyA 59590 60384 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_22040 60384 60914 gene locus_tag LOCUS_22050 60384 60914 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S46 protein_id gnl|my_center|LOCUS_22050 62238 60916 gene locus_tag LOCUS_22060 gene argA 62238 60916 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU5 protein_id gnl|my_center|LOCUS_22060 63478 62297 gene locus_tag LOCUS_22070 63478 62297 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_22070 63911 63549 gene locus_tag LOCUS_22080 63911 63549 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_22080 65105 63921 gene locus_tag LOCUS_22090 65105 63921 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_22090 65749 65105 gene locus_tag LOCUS_22100 65749 65105 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHF4 protein_id gnl|my_center|LOCUS_22100 66363 65749 gene locus_tag LOCUS_22110 gene metW 66363 65749 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_22110 67552 66353 gene locus_tag LOCUS_22120 gene metX 67552 66353 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_22120 68157 67579 gene locus_tag LOCUS_22130 68157 67579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_22130 68991 68182 gene locus_tag LOCUS_22140 gene proC 68991 68182 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_22140 70111 69071 gene locus_tag LOCUS_22150 70111 69071 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268279.1 protein_id gnl|my_center|LOCUS_22150 71737 70145 gene locus_tag LOCUS_22160 71737 70145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 72684 71734 gene locus_tag LOCUS_22170 72684 71734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_22170 74217 72781 gene locus_tag LOCUS_22180 gene gltD 74217 72781 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_22180 78825 74251 gene locus_tag LOCUS_22190 gene gltB 78825 74251 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_22190 79360 80115 gene locus_tag LOCUS_22200 79360 80115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 80112 80498 gene locus_tag LOCUS_22210 80112 80498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 80731 80579 gene locus_tag LOCUS_22220 80731 80579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 80994 83405 gene locus_tag LOCUS_22230 80994 83405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 83555 84568 gene locus_tag LOCUS_22240 gene glpQ 83555 84568 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705544.1 protein_id gnl|my_center|LOCUS_22240 84694 86886 gene locus_tag LOCUS_22250 gene deaD 84694 86886 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_22250 86921 87559 gene locus_tag LOCUS_22260 86921 87559 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_22260 87564 87854 gene locus_tag LOCUS_22270 87564 87854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 87802 88206 gene locus_tag LOCUS_22280 87802 88206 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464875.1 protein_id gnl|my_center|LOCUS_22280 88298 88861 gene locus_tag LOCUS_22290 88298 88861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 88942 89229 gene locus_tag LOCUS_22300 gene yqjZ 88942 89229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_22300 89320 89811 gene locus_tag LOCUS_22310 89320 89811 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_22310 89929 90513 gene locus_tag LOCUS_22320 89929 90513 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_22320 90550 91014 gene locus_tag LOCUS_22330 gene ysnE 90550 91014 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_22330 91094 92488 gene locus_tag LOCUS_22340 91094 92488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 92600 93022 gene locus_tag LOCUS_22350 92600 93022 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_22350 93047 93358 gene locus_tag LOCUS_22360 93047 93358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 93368 94285 gene locus_tag LOCUS_22370 93368 94285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 94436 94741 gene locus_tag LOCUS_22380 94436 94741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 94738 96012 gene locus_tag LOCUS_22390 94738 96012 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_22390 96439 96050 gene locus_tag LOCUS_22400 96439 96050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 97646 96459 gene locus_tag LOCUS_22410 97646 96459 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_22410 97860 98624 gene locus_tag LOCUS_22420 97860 98624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109588.1 protein_id gnl|my_center|LOCUS_22420 98883 98680 gene locus_tag LOCUS_22430 98883 98680 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_22430 99302 98880 gene locus_tag LOCUS_22440 99302 98880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 99418 99819 gene locus_tag LOCUS_22450 99418 99819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 100471 99776 gene locus_tag LOCUS_22460 100471 99776 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902207.1 protein_id gnl|my_center|LOCUS_22460 100829 101377 gene locus_tag LOCUS_22470 100829 101377 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_22470 101379 101798 gene locus_tag LOCUS_22480 101379 101798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 101913 102263 gene locus_tag LOCUS_22490 101913 102263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 102298 103065 gene locus_tag LOCUS_22500 102298 103065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_22500 103093 103413 gene locus_tag LOCUS_22510 103093 103413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 103397 103906 gene locus_tag LOCUS_22520 103397 103906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 104606 103908 gene locus_tag LOCUS_22530 104606 103908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 104737 105699 gene locus_tag LOCUS_22540 104737 105699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 105786 106100 gene locus_tag LOCUS_22550 105786 106100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_22550 106132 107352 gene locus_tag LOCUS_22560 106132 107352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_22560 107391 108020 gene locus_tag LOCUS_22570 107391 108020 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 protein_id gnl|my_center|LOCUS_22570 108338 109600 gene locus_tag LOCUS_22580 108338 109600 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_22580 109653 110132 gene locus_tag LOCUS_22590 109653 110132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 110357 111706 gene locus_tag LOCUS_22600 110357 111706 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_22600 113014 111719 gene locus_tag LOCUS_22610 113014 111719 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_22610 113769 113107 gene locus_tag LOCUS_22620 113769 113107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 115383 113812 gene locus_tag LOCUS_22630 115383 113812 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103017.1 protein_id gnl|my_center|LOCUS_22630 116168 115380 gene locus_tag LOCUS_22640 116168 115380 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930443.1 protein_id gnl|my_center|LOCUS_22640 116370 117500 gene locus_tag LOCUS_22650 116370 117500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 117547 118527 gene locus_tag LOCUS_22660 117547 118527 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_22660 118533 119672 gene locus_tag LOCUS_22670 118533 119672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 protein_id gnl|my_center|LOCUS_22670 119669 120466 gene locus_tag LOCUS_22680 119669 120466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_22680 120468 121382 gene locus_tag LOCUS_22690 120468 121382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_22690 121379 121999 gene locus_tag LOCUS_22700 121379 121999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_22700 122076 122657 gene locus_tag LOCUS_22710 122076 122657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 122741 123433 gene locus_tag LOCUS_22720 122741 123433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_22720 123436 124011 gene locus_tag LOCUS_22730 123436 124011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_22730 124016 124288 gene locus_tag LOCUS_22740 124016 124288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 124285 124962 gene locus_tag LOCUS_22750 124285 124962 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819924.1 protein_id gnl|my_center|LOCUS_22750 124970 125809 gene locus_tag LOCUS_22760 124970 125809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 125809 126840 gene locus_tag LOCUS_22770 125809 126840 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_22770 126837 127526 gene locus_tag LOCUS_22780 126837 127526 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_22780 127551 128432 gene locus_tag LOCUS_22790 127551 128432 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215545.1 protein_id gnl|my_center|LOCUS_22790 128434 128952 gene locus_tag LOCUS_22800 128434 128952 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_22800 128965 129720 gene locus_tag LOCUS_22810 128965 129720 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709510.1 protein_id gnl|my_center|LOCUS_22810 129725 130024 gene locus_tag LOCUS_22820 129725 130024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 130037 131323 gene locus_tag LOCUS_22830 130037 131323 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086530.1 protein_id gnl|my_center|LOCUS_22830 131360 132931 gene locus_tag LOCUS_22840 gene ydiF 131360 132931 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207054.1 protein_id gnl|my_center|LOCUS_22840 132991 133482 gene locus_tag LOCUS_22850 132991 133482 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 protein_id gnl|my_center|LOCUS_22850 133492 134706 gene locus_tag LOCUS_22860 gene fabV 133492 134706 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE66 protein_id gnl|my_center|LOCUS_22860 134791 135942 gene locus_tag LOCUS_22870 134791 135942 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_22870 135985 136194 gene locus_tag LOCUS_22880 135985 136194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 136191 137123 gene locus_tag LOCUS_22890 136191 137123 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259425.1 protein_id gnl|my_center|LOCUS_22890 138390 137104 gene locus_tag LOCUS_22900 138390 137104 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917952.1 protein_id gnl|my_center|LOCUS_22900 138731 138411 gene locus_tag LOCUS_22910 gene fdxB 138731 138411 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_22910 138848 140032 gene locus_tag LOCUS_22920 138848 140032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 140901 140068 gene locus_tag LOCUS_22930 gene cobB2 140901 140068 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EA6 protein_id gnl|my_center|LOCUS_22930 140945 142126 gene locus_tag LOCUS_22940 140945 142126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_22940 142261 143424 gene locus_tag LOCUS_22950 142261 143424 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_22950 143460 146666 gene locus_tag LOCUS_22960 143460 146666 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_22960 146641 148023 gene locus_tag LOCUS_22970 146641 148023 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_22970 148521 149384 gene locus_tag LOCUS_22980 148521 149384 CDS product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339326.1 protein_id gnl|my_center|LOCUS_22980 149429 151132 gene locus_tag LOCUS_22990 149429 151132 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_22990 151759 151139 gene locus_tag LOCUS_23000 gene rlmE 151759 151139 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_23000 151855 153507 gene locus_tag LOCUS_23010 151855 153507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_23010 153518 154258 gene locus_tag LOCUS_23020 153518 154258 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_23020 156031 154265 gene locus_tag LOCUS_23030 156031 154265 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_23030 156150 156725 gene locus_tag LOCUS_23040 156150 156725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 156813 159272 gene locus_tag LOCUS_23050 156813 159272 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_23050 159265 159795 gene locus_tag LOCUS_23060 159265 159795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 159860 160891 gene locus_tag LOCUS_23070 159860 160891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_23070 161913 163694 gene locus_tag LOCUS_23080 161913 163694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 163691 165226 gene locus_tag LOCUS_23090 gene cse1 163691 165226 CDS product CRISPR-associated protein CasA/Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53VY1 protein_id gnl|my_center|LOCUS_23090 165223 165771 gene locus_tag LOCUS_23100 gene cse2 165223 165771 CDS product CRISPR-associated protein Cse2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53VY0 protein_id gnl|my_center|LOCUS_23100 165768 166892 gene locus_tag LOCUS_23110 165768 166892 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_23110 166896 167576 gene locus_tag LOCUS_23120 166896 167576 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_23120 167563 168234 gene locus_tag LOCUS_23130 gene cse3 167563 168234 CDS product CRISPR-associated endoribonuclease Cse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WG9 protein_id gnl|my_center|LOCUS_23130 168239 169093 gene locus_tag LOCUS_23140 168239 169093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_23140 169098 170018 gene locus_tag LOCUS_23150 gene ygbT 169098 170018 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46896 protein_id gnl|my_center|LOCUS_23150 170022 170312 gene locus_tag LOCUS_23160 gene ygbF 170022 170312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_404470.2 protein_id gnl|my_center|LOCUS_23160 170439 >172296 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacggacgtggggatgaaccg >Feature sequence09 1008 430 gene locus_tag LOCUS_23170 1008 430 CDS product NnrU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 protein_id gnl|my_center|LOCUS_23170 1239 1784 gene locus_tag LOCUS_23180 1239 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1869 2141 gene locus_tag LOCUS_23190 1869 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2247 4043 gene locus_tag LOCUS_23200 2247 4043 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883377.1 protein_id gnl|my_center|LOCUS_23200 4049 5179 gene locus_tag LOCUS_23210 4049 5179 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_23210 5291 6667 gene locus_tag LOCUS_23220 5291 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_23220 7459 6680 gene locus_tag LOCUS_23230 7459 6680 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_23230 8320 7514 gene locus_tag LOCUS_23240 gene mshM 8320 7514 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_23240 8482 10218 gene locus_tag LOCUS_23250 8482 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 12142 10226 gene locus_tag LOCUS_23260 12142 10226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036212.1 protein_id gnl|my_center|LOCUS_23260 12301 13251 gene locus_tag LOCUS_23270 12301 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 15394 13208 gene locus_tag LOCUS_23280 gene ppk 15394 13208 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_23280 15573 16298 gene locus_tag LOCUS_23290 15573 16298 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA8 protein_id gnl|my_center|LOCUS_23290 17595 16282 gene locus_tag LOCUS_23300 gene phoR 17595 16282 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245011.1 protein_id gnl|my_center|LOCUS_23300 18398 17685 gene locus_tag LOCUS_23310 gene phoB 18398 17685 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_23310 18745 19794 gene locus_tag LOCUS_23320 18745 19794 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406743.1 protein_id gnl|my_center|LOCUS_23320 19873 20421 gene locus_tag LOCUS_23330 gene ubiC 19873 20421 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_23330 20438 21631 gene locus_tag LOCUS_23340 20438 21631 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_23340 23036 21639 gene locus_tag LOCUS_23350 23036 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 23536 24756 gene locus_tag LOCUS_23360 gene argD 23536 24756 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_23360 24814 25830 gene locus_tag LOCUS_23370 24814 25830 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_23370 25833 26666 gene locus_tag LOCUS_23380 25833 26666 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_23380 26818 27582 gene locus_tag LOCUS_23390 26818 27582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_23390 27637 28851 gene locus_tag LOCUS_23400 27637 28851 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_23400 28873 30129 gene locus_tag LOCUS_23410 28873 30129 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_23410 31346 30147 gene locus_tag LOCUS_23420 31346 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 31612 33003 gene locus_tag LOCUS_23430 31612 33003 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894687.1 protein_id gnl|my_center|LOCUS_23430 33257 34531 gene locus_tag LOCUS_23440 gene bla 33257 34531 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 protein_id gnl|my_center|LOCUS_23440 34528 35265 gene locus_tag LOCUS_23450 34528 35265 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_23450 36472 35288 gene locus_tag LOCUS_23460 36472 35288 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_23460 36667 37362 gene locus_tag LOCUS_23470 36667 37362 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_23470 39555 37411 gene locus_tag LOCUS_23480 39555 37411 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_23480 39744 40655 gene locus_tag LOCUS_23490 39744 40655 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706167.1 protein_id gnl|my_center|LOCUS_23490 40723 42387 gene locus_tag LOCUS_23500 40723 42387 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_23500 42495 43670 gene locus_tag LOCUS_23510 42495 43670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 45557 43698 gene locus_tag LOCUS_23520 45557 43698 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_23520 46636 45671 gene locus_tag LOCUS_23530 46636 45671 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_23530 46877 47188 gene locus_tag LOCUS_23540 gene rplU 46877 47188 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBD7 protein_id gnl|my_center|LOCUS_23540 47208 47465 gene locus_tag LOCUS_23550 gene rpmA 47208 47465 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 protein_id gnl|my_center|LOCUS_23550 47630 48814 gene locus_tag LOCUS_23560 gene obg 47630 48814 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK1 protein_id gnl|my_center|LOCUS_23560 48818 49945 gene locus_tag LOCUS_23570 gene proB 48818 49945 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_23570 50351 50085 gene locus_tag LOCUS_23580 gene rpsT 50351 50085 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_23580 50525 50995 gene locus_tag LOCUS_23590 50525 50995 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457571.1 protein_id gnl|my_center|LOCUS_23590 52271 51042 gene locus_tag LOCUS_23600 52271 51042 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_23600 52380 53981 gene locus_tag LOCUS_23610 gene mviN 52380 53981 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_23610 54555 53992 gene locus_tag LOCUS_23620 54555 53992 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_23620 54739 55812 gene locus_tag LOCUS_23630 54739 55812 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_23630 56069 55866 gene locus_tag LOCUS_23640 56069 55866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 56174 56611 gene locus_tag LOCUS_23650 56174 56611 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_23650 57899 56703 gene locus_tag LOCUS_23660 gene aspC 57899 56703 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_23660 58791 57910 gene locus_tag LOCUS_23670 gene folD 58791 57910 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_23670 59291 58872 gene locus_tag LOCUS_23680 59291 58872 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_23680 59750 59310 gene locus_tag LOCUS_23690 59750 59310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 60959 59832 gene locus_tag LOCUS_23700 60959 59832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 61145 62017 gene locus_tag LOCUS_23710 gene purU 61145 62017 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWY5 protein_id gnl|my_center|LOCUS_23710 62067 63752 gene locus_tag LOCUS_23720 62067 63752 CDS product phosphate:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_23720 63855 64832 gene locus_tag LOCUS_23730 gene pstS 63855 64832 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_23730 64962 67259 gene locus_tag LOCUS_23740 64962 67259 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_23740 67298 68965 gene locus_tag LOCUS_23750 gene pstA 67298 68965 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_23750 68980 69885 gene locus_tag LOCUS_23760 gene pstB 68980 69885 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_23760 70670 69876 gene locus_tag LOCUS_23770 70670 69876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 72205 70739 gene locus_tag LOCUS_23780 72205 70739 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 protein_id gnl|my_center|LOCUS_23780 77780 72252 gene locus_tag LOCUS_23790 77780 72252 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I5 protein_id gnl|my_center|LOCUS_23790 78385 77801 gene locus_tag LOCUS_23800 78385 77801 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_23800 79318 78539 gene locus_tag LOCUS_23810 79318 78539 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_23810 79502 80212 gene locus_tag LOCUS_23820 79502 80212 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKQ0 protein_id gnl|my_center|LOCUS_23820 80288 80662 gene locus_tag LOCUS_23830 80288 80662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 80791 81573 gene locus_tag LOCUS_23840 80791 81573 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_23840 82159 81551 gene locus_tag LOCUS_23850 82159 81551 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_23850 82732 82160 gene locus_tag LOCUS_23860 82732 82160 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_23860 84348 82717 gene locus_tag LOCUS_23870 gene estA1 84348 82717 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 protein_id gnl|my_center|LOCUS_23870 84548 86194 gene locus_tag LOCUS_23880 84548 86194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 87558 86191 gene locus_tag LOCUS_23890 87558 86191 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_23890 88380 87586 gene locus_tag LOCUS_23900 88380 87586 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_23900 88503 89321 gene locus_tag LOCUS_23910 gene trmJ 88503 89321 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY4 protein_id gnl|my_center|LOCUS_23910 89369 91696 gene locus_tag LOCUS_23920 89369 91696 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_23920 93909 91744 gene locus_tag LOCUS_23930 93909 91744 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_23930 94775 94005 gene locus_tag LOCUS_23940 94775 94005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 95084 98587 gene locus_tag LOCUS_23950 95084 98587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 98907 102353 gene locus_tag LOCUS_23960 98907 102353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 102680 106114 gene locus_tag LOCUS_23970 102680 106114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 106485 109940 gene locus_tag LOCUS_23980 106485 109940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 110822 110049 gene locus_tag LOCUS_23990 110822 110049 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_23990 110980 112779 gene locus_tag LOCUS_24000 110980 112779 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_24000 113955 112744 gene locus_tag LOCUS_24010 113955 112744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_24010 114233 114072 gene locus_tag LOCUS_24020 114233 114072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 115687 114347 gene locus_tag LOCUS_24030 115687 114347 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_24030 115813 116730 gene locus_tag LOCUS_24040 gene rdgC 115813 116730 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX7 protein_id gnl|my_center|LOCUS_24040 116861 118045 gene locus_tag LOCUS_24050 116861 118045 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_24050 118042 121182 gene locus_tag LOCUS_24060 118042 121182 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_24060 121383 121601 gene locus_tag LOCUS_24070 121383 121601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_24070 122120 121638 gene locus_tag LOCUS_24080 122120 121638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 123204 122176 gene locus_tag LOCUS_24090 123204 122176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 125438 123204 gene locus_tag LOCUS_24100 125438 123204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 127707 125491 gene locus_tag LOCUS_24110 127707 125491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 127779 128531 gene locus_tag LOCUS_24120 127779 128531 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZN6 protein_id gnl|my_center|LOCUS_24120 129877 128573 gene locus_tag LOCUS_24130 129877 128573 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_24130 130254 129877 gene locus_tag LOCUS_24140 130254 129877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence10 766 392 gene locus_tag LOCUS_24150 766 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 855 1337 gene locus_tag LOCUS_24160 855 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1805 4267 gene locus_tag LOCUS_24170 1805 4267 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 protein_id gnl|my_center|LOCUS_24170 4264 5436 gene locus_tag LOCUS_24180 4264 5436 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870274.1 protein_id gnl|my_center|LOCUS_24180 5446 7176 gene locus_tag LOCUS_24190 5446 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 7398 10526 gene locus_tag LOCUS_24200 gene hsdR-1 7398 10526 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_24200 10523 11242 gene locus_tag LOCUS_24210 10523 11242 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_24210 11243 12679 gene locus_tag LOCUS_24220 11243 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 12993 14105 gene locus_tag LOCUS_24230 12993 14105 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_24230 14448 16442 gene locus_tag LOCUS_24240 14448 16442 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24240 16449 17036 gene locus_tag LOCUS_24250 16449 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24250 17048 19039 gene locus_tag LOCUS_24260 gene spdH 17048 19039 CDS product spermidine dehydrogenase SpdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_24260 19150 20610 gene locus_tag LOCUS_24270 19150 20610 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266225.1 protein_id gnl|my_center|LOCUS_24270 20611 21711 gene locus_tag LOCUS_24280 20611 21711 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339268.1 protein_id gnl|my_center|LOCUS_24280 21976 23247 gene locus_tag LOCUS_24290 21976 23247 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886749.1 protein_id gnl|my_center|LOCUS_24290 23269 23769 gene locus_tag LOCUS_24300 gene lrp 23269 23769 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004445447.1 protein_id gnl|my_center|LOCUS_24300 23978 25468 gene locus_tag LOCUS_24310 gene opuE 23978 25468 CDS product osmoregulated proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06493 protein_id gnl|my_center|LOCUS_24310 26033 25509 gene locus_tag LOCUS_24320 26033 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 26245 26400 gene locus_tag LOCUS_24330 26245 26400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 26387 27118 gene locus_tag LOCUS_24340 26387 27118 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967980.1 protein_id gnl|my_center|LOCUS_24340 27176 27514 gene locus_tag LOCUS_24350 gene csaA 27176 27514 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114937.1 protein_id gnl|my_center|LOCUS_24350 28199 28591 gene locus_tag LOCUS_24360 28199 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121288.1 protein_id gnl|my_center|LOCUS_24360 28604 30040 gene locus_tag LOCUS_24370 28604 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 30249 30070 gene locus_tag LOCUS_24380 30249 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 30306 30938 gene locus_tag LOCUS_24390 30306 30938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_24390 30962 31702 gene locus_tag LOCUS_24400 30962 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 32491 31727 gene locus_tag LOCUS_24410 gene echH 32491 31727 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_24410 33500 32517 gene locus_tag LOCUS_24420 33500 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_24420 33690 35315 gene locus_tag LOCUS_24430 33690 35315 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_24430 35341 35616 gene locus_tag LOCUS_24440 35341 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 35603 36841 gene locus_tag LOCUS_24450 35603 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 36831 38078 gene locus_tag LOCUS_24460 36831 38078 CDS product toxin secretion, membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074383.1 protein_id gnl|my_center|LOCUS_24460 38075 40168 gene locus_tag LOCUS_24470 38075 40168 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_24470 41181 40192 gene locus_tag LOCUS_24480 41181 40192 CDS product hydroxylase molybdopterin-containing subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_24480 43630 41192 gene locus_tag LOCUS_24490 gene xdhA 43630 41192 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861444.1 protein_id gnl|my_center|LOCUS_24490 44214 43627 gene locus_tag LOCUS_24500 44214 43627 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_24500 45590 44394 gene locus_tag LOCUS_24510 45590 44394 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816T7 protein_id gnl|my_center|LOCUS_24510 47258 45639 gene locus_tag LOCUS_24520 47258 45639 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_24520 48628 47324 gene locus_tag LOCUS_24530 48628 47324 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_24530 48774 51086 gene locus_tag LOCUS_24540 48774 51086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_24540 51198 51899 gene locus_tag LOCUS_24550 51198 51899 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_24550 55329 51952 gene locus_tag LOCUS_24560 55329 51952 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_24560 55487 57013 gene locus_tag LOCUS_24570 55487 57013 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_24570 58554 57025 gene locus_tag LOCUS_24580 58554 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 59021 58554 gene locus_tag LOCUS_24590 59021 58554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 60234 59023 gene locus_tag LOCUS_24600 60234 59023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 protein_id gnl|my_center|LOCUS_24600 60560 61177 gene locus_tag LOCUS_24610 60560 61177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 61363 61932 gene locus_tag LOCUS_24620 61363 61932 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_24620 61929 62378 gene locus_tag LOCUS_24630 61929 62378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 62378 62854 gene locus_tag LOCUS_24640 62378 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 64784 62868 gene locus_tag LOCUS_24650 gene fabY 64784 62868 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_24650 64881 65420 gene locus_tag LOCUS_24660 64881 65420 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036332.1 protein_id gnl|my_center|LOCUS_24660 65497 66528 gene locus_tag LOCUS_24670 gene mltB 65497 66528 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_24670 66630 67046 gene locus_tag LOCUS_24680 66630 67046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 67178 67447 gene locus_tag LOCUS_24690 67178 67447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_24690 68461 67466 gene locus_tag LOCUS_24700 68461 67466 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_24700 68964 68458 gene locus_tag LOCUS_24710 gene greB 68964 68458 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSG9 protein_id gnl|my_center|LOCUS_24710 70049 68961 gene locus_tag LOCUS_24720 gene serC 70049 68961 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BC0 protein_id gnl|my_center|LOCUS_24720 71263 70085 gene locus_tag LOCUS_24730 71263 70085 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_24730 71420 72304 gene locus_tag LOCUS_24740 71420 72304 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_24740 72304 72600 gene locus_tag LOCUS_24750 72304 72600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 72597 73553 gene locus_tag LOCUS_24760 72597 73553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_24760 73589 74863 gene locus_tag LOCUS_24770 gene proA 73589 74863 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_24770 74860 75516 gene locus_tag LOCUS_24780 gene nadD 74860 75516 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV7 protein_id gnl|my_center|LOCUS_24780 75559 75957 gene locus_tag LOCUS_24790 gene rsfS 75559 75957 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP7 protein_id gnl|my_center|LOCUS_24790 75947 76417 gene locus_tag LOCUS_24800 gene rlmH 75947 76417 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_24800 76534 78501 gene locus_tag LOCUS_24810 76534 78501 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_24810 78629 79489 gene locus_tag LOCUS_24820 gene rlpA 78629 79489 CDS product septal ring lipoprotein RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_24820 79500 80735 gene locus_tag LOCUS_24830 gene dacC 79500 80735 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_24830 80742 81044 gene locus_tag LOCUS_24840 80742 81044 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF7 protein_id gnl|my_center|LOCUS_24840 81041 81781 gene locus_tag LOCUS_24850 gene lipB 81041 81781 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P589 protein_id gnl|my_center|LOCUS_24850 81832 82806 gene locus_tag LOCUS_24860 81832 82806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 82803 84155 gene locus_tag LOCUS_24870 82803 84155 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_24870 85384 84161 gene locus_tag LOCUS_24880 85384 84161 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404020.1 protein_id gnl|my_center|LOCUS_24880 86793 85387 gene locus_tag LOCUS_24890 86793 85387 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894508.1 protein_id gnl|my_center|LOCUS_24890 88343 86961 gene locus_tag LOCUS_24900 88343 86961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 88490 89041 gene locus_tag LOCUS_24910 88490 89041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 89029 89652 gene locus_tag LOCUS_24920 89029 89652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 89859 90116 gene locus_tag LOCUS_24930 89859 90116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 91125 90085 gene locus_tag LOCUS_24940 gene holA 91125 90085 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_24940 91610 91122 gene locus_tag LOCUS_24950 gene lptE 91610 91122 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQ26 protein_id gnl|my_center|LOCUS_24950 94138 91610 gene locus_tag LOCUS_24960 gene leuS 94138 91610 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_24960 95050 94175 gene locus_tag LOCUS_24970 95050 94175 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_24970 95553 95047 gene locus_tag LOCUS_24980 gene ybeY 95553 95047 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX37 protein_id gnl|my_center|LOCUS_24980 96577 95537 gene locus_tag LOCUS_24990 96577 95537 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_24990 97914 96634 gene locus_tag LOCUS_25000 gene miaB 97914 96634 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN97 protein_id gnl|my_center|LOCUS_25000 98105 98437 gene locus_tag LOCUS_25010 98105 98437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_25010 98545 99153 gene locus_tag LOCUS_25020 98545 99153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 100465 99194 gene locus_tag LOCUS_25030 100465 99194 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_25030 100611 101624 gene locus_tag LOCUS_25040 gene srkA 100611 101624 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_25040 102153 101632 gene locus_tag LOCUS_25050 102153 101632 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_25050 103356 102172 gene locus_tag LOCUS_25060 gene oel1 103356 102172 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_25060 103527 103748 gene locus_tag LOCUS_25070 103527 103748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 104189 103764 gene locus_tag LOCUS_25080 104189 103764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 104399 104950 gene locus_tag LOCUS_25090 104399 104950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 105135 105440 gene locus_tag LOCUS_25100 105135 105440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 105444 106118 gene locus_tag LOCUS_25110 gene phoP 105444 106118 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_25110 106126 107517 gene locus_tag LOCUS_25120 106126 107517 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_25120 108321 107563 gene locus_tag LOCUS_25130 108321 107563 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_25130 108480 108902 gene locus_tag LOCUS_25140 108480 108902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 108920 109606 gene locus_tag LOCUS_25150 108920 109606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 109669 110058 gene locus_tag LOCUS_25160 109669 110058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 110631 110065 gene locus_tag LOCUS_25170 110631 110065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 110735 111859 gene locus_tag LOCUS_25180 110735 111859 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_25180 111917 113581 gene locus_tag LOCUS_25190 gene nadE 111917 113581 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_25190 113612 114226 gene locus_tag LOCUS_25200 gene gmhA 113612 114226 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63222 protein_id gnl|my_center|LOCUS_25200 115246 114230 gene locus_tag LOCUS_25210 gene bamD 115246 114230 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_25210 115357 116319 gene locus_tag LOCUS_25220 gene rluD 115357 116319 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_25220 116357 117151 gene locus_tag LOCUS_25230 116357 117151 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 protein_id gnl|my_center|LOCUS_25230 117238 119844 gene locus_tag LOCUS_25240 gene clpB 117238 119844 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_25240 120106 121878 gene locus_tag LOCUS_25250 gene ilvB 120106 121878 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N6 protein_id gnl|my_center|LOCUS_25250 121880 122371 gene locus_tag LOCUS_25260 gene ilvH 121880 122371 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_25260 124053 122584 gene locus_tag LOCUS_25270 gene ilvC 124053 122584 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_25270 124218 125186 gene locus_tag LOCUS_25280 124218 125186 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 protein_id gnl|my_center|LOCUS_25280 125187 126026 gene locus_tag LOCUS_25290 gene pssA 125187 126026 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_25290 126085 127128 gene locus_tag LOCUS_25300 gene msrP 126085 127128 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_25300 127135 127767 gene locus_tag LOCUS_25310 127135 127767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence11 <1 4641 gene locus_tag LOCUS_25320 <1 4641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263951.1:RTX toxin 4746 6224 gene locus_tag LOCUS_25330 4746 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 6362 7003 gene locus_tag LOCUS_25340 6362 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 7003 8364 gene locus_tag LOCUS_25350 7003 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 8366 10522 gene locus_tag LOCUS_25360 8366 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 10711 11637 gene locus_tag LOCUS_25370 10711 11637 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_25370 11772 12938 gene locus_tag LOCUS_25380 11772 12938 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_25380 13255 12956 gene locus_tag LOCUS_25390 13255 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 13538 14791 gene locus_tag LOCUS_25400 13538 14791 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_25400 15016 14801 gene locus_tag LOCUS_25410 15016 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 15458 15030 gene locus_tag LOCUS_25420 15458 15030 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_25420 15751 15479 gene locus_tag LOCUS_25430 15751 15479 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY0 protein_id gnl|my_center|LOCUS_25430 16253 15843 gene locus_tag LOCUS_25440 gene vapC 16253 15843 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EUB2 protein_id gnl|my_center|LOCUS_25440 16882 16250 gene locus_tag LOCUS_25450 16882 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 17880 16960 gene locus_tag LOCUS_25460 17880 16960 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_25460 18406 17867 gene locus_tag LOCUS_25470 18406 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480550.1 protein_id gnl|my_center|LOCUS_25470 18575 18847 gene locus_tag LOCUS_25480 18575 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 19186 18782 gene locus_tag LOCUS_25490 gene vapC 19186 18782 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IUZ4 protein_id gnl|my_center|LOCUS_25490 19406 19161 gene locus_tag LOCUS_25500 19406 19161 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331446.1 protein_id gnl|my_center|LOCUS_25500 19587 21068 gene locus_tag LOCUS_25510 gene xanB 19587 21068 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_25510 21868 21104 gene locus_tag LOCUS_25520 21868 21104 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_25520 23634 21889 gene locus_tag LOCUS_25530 gene yfbS 23634 21889 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_25530 25555 23654 gene locus_tag LOCUS_25540 25555 23654 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_25540 26250 25555 gene locus_tag LOCUS_25550 26250 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 27536 26664 gene locus_tag LOCUS_25560 27536 26664 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_25560 28735 27569 gene locus_tag LOCUS_25570 28735 27569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 29345 28728 gene locus_tag LOCUS_25580 29345 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 30396 29293 gene locus_tag LOCUS_25590 30396 29293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 31178 30393 gene locus_tag LOCUS_25600 31178 30393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 32471 31224 gene locus_tag LOCUS_25610 32471 31224 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_25610 34504 33494 gene locus_tag LOCUS_25620 gene galE-1 34504 33494 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_25620 36376 35795 gene locus_tag LOCUS_25630 36376 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 37864 36887 gene locus_tag LOCUS_25640 gene fcl 37864 36887 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMT4 protein_id gnl|my_center|LOCUS_25640 38988 37870 gene locus_tag LOCUS_25650 gene gmd 38988 37870 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV56 protein_id gnl|my_center|LOCUS_25650 41140 39980 gene locus_tag LOCUS_25660 41140 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107284.1 protein_id gnl|my_center|LOCUS_25660 41729 41151 gene locus_tag LOCUS_25670 41729 41151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 43618 41873 gene locus_tag LOCUS_25680 43618 41873 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_25680 44560 43691 gene locus_tag LOCUS_25690 gene fabG 44560 43691 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068375.1 protein_id gnl|my_center|LOCUS_25690 44900 45328 gene locus_tag LOCUS_25700 44900 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 46435 46647 gene locus_tag LOCUS_25710 46435 46647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25710 47388 46900 gene locus_tag LOCUS_25720 gene rfaH 47388 46900 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZI5 protein_id gnl|my_center|LOCUS_25720 47723 47385 gene locus_tag LOCUS_25730 47723 47385 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968012.1 protein_id gnl|my_center|LOCUS_25730 50136 47800 gene locus_tag LOCUS_25740 50136 47800 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 protein_id gnl|my_center|LOCUS_25740 50610 50158 gene locus_tag LOCUS_25750 50610 50158 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_25750 52027 50771 gene locus_tag LOCUS_25760 gene gfcE 52027 50771 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_25760 52259 52498 gene locus_tag LOCUS_25770 52259 52498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 52485 52895 gene locus_tag LOCUS_25780 52485 52895 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_25780 53277 53495 gene locus_tag LOCUS_25790 53277 53495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 53763 54023 gene locus_tag LOCUS_25800 53763 54023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 54023 55366 gene locus_tag LOCUS_25810 54023 55366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_25810 55686 55901 gene locus_tag LOCUS_25820 55686 55901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 56763 55921 gene locus_tag LOCUS_25830 56763 55921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919495.1 protein_id gnl|my_center|LOCUS_25830 57037 56822 gene locus_tag LOCUS_25840 57037 56822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 57068 59806 gene locus_tag LOCUS_25850 57068 59806 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_25850 60041 61456 gene locus_tag LOCUS_25860 60041 61456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932725.1 protein_id gnl|my_center|LOCUS_25860 61470 63512 gene locus_tag LOCUS_25870 61470 63512 CDS product antibiotic hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_25870 63509 64729 gene locus_tag LOCUS_25880 63509 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919499.1 protein_id gnl|my_center|LOCUS_25880 65642 64782 gene locus_tag LOCUS_25890 65642 64782 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919060.1 protein_id gnl|my_center|LOCUS_25890 65550 65891 gene locus_tag LOCUS_25900 65550 65891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 67573 66011 gene locus_tag LOCUS_25910 gene calB 67573 66011 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_25910 68367 67570 gene locus_tag LOCUS_25920 68367 67570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 68635 69045 gene locus_tag LOCUS_25930 68635 69045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 70822 69011 gene locus_tag LOCUS_25940 gene atsA 70822 69011 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_25940 71747 70815 gene locus_tag LOCUS_25950 71747 70815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_25950 71924 73306 gene locus_tag LOCUS_25960 71924 73306 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_25960 73633 74907 gene locus_tag LOCUS_25970 gene ybjY 73633 74907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 protein_id gnl|my_center|LOCUS_25970 74935 75627 gene locus_tag LOCUS_25980 gene ycfV 74935 75627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_25980 75643 76950 gene locus_tag LOCUS_25990 gene ybjZ 75643 76950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_25990 76960 78171 gene locus_tag LOCUS_26000 gene ybjZ 76960 78171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_26000 78344 78949 gene locus_tag LOCUS_26010 78344 78949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_26010 78988 81087 gene locus_tag LOCUS_26020 78988 81087 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_26020 81410 82324 gene locus_tag LOCUS_26030 gene pqqB 81410 82324 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A81 protein_id gnl|my_center|LOCUS_26030 82321 82626 gene locus_tag LOCUS_26040 82321 82626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 82623 83744 gene locus_tag LOCUS_26050 gene pqqE 82623 83744 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMC1 protein_id gnl|my_center|LOCUS_26050 83750 84496 gene locus_tag LOCUS_26060 gene pqqC 83750 84496 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_26060 84703 85398 gene locus_tag LOCUS_26070 84703 85398 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719729.1 protein_id gnl|my_center|LOCUS_26070 85508 85705 gene locus_tag LOCUS_26080 85508 85705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 85796 86167 gene locus_tag LOCUS_26090 85796 86167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 88243 86186 gene locus_tag LOCUS_26100 gene ligA 88243 86186 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ42 protein_id gnl|my_center|LOCUS_26100 90641 88230 gene locus_tag LOCUS_26110 90641 88230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 94181 90669 gene locus_tag LOCUS_26120 gene smc 94181 90669 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_26120 94277 95554 gene locus_tag LOCUS_26130 94277 95554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 96041 101731 gene locus_tag LOCUS_26140 96041 101731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 101879 102937 gene locus_tag LOCUS_26150 gene wecA 101879 102937 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z386 protein_id gnl|my_center|LOCUS_26150 104361 102934 gene locus_tag LOCUS_26160 104361 102934 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_26160 104741 104403 gene locus_tag LOCUS_26170 104741 104403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 105954 104884 gene locus_tag LOCUS_26180 105954 104884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 106790 106164 gene locus_tag LOCUS_26190 gene msrA 106790 106164 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_26190 106920 108077 gene locus_tag LOCUS_26200 gene argD 106920 108077 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 protein_id gnl|my_center|LOCUS_26200 108227 111241 gene locus_tag LOCUS_26210 108227 111241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 111306 112850 gene locus_tag LOCUS_26220 111306 112850 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_26220 112932 114095 gene locus_tag LOCUS_26230 gene liuA 112932 114095 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_26230 114762 116363 gene locus_tag LOCUS_26240 gene mccC2 114762 116363 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 protein_id gnl|my_center|LOCUS_26240 116394 117293 gene locus_tag LOCUS_26250 116394 117293 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483374.1 protein_id gnl|my_center|LOCUS_26250 117290 119095 gene locus_tag LOCUS_26260 117290 119095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence12 1096 59 gene locus_tag LOCUS_26270 1096 59 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_26270 3236 1131 gene locus_tag LOCUS_26280 3236 1131 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_26280 4495 3281 gene locus_tag LOCUS_26290 gene dcaF 4495 3281 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_26290 4634 5782 gene locus_tag LOCUS_26300 gene dcaA 4634 5782 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_26300 6752 7240 gene locus_tag LOCUS_26310 6752 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 7255 8121 gene locus_tag LOCUS_26320 gene speE 7255 8121 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB1 protein_id gnl|my_center|LOCUS_26320 8189 9121 gene locus_tag LOCUS_26330 gene uspE 8189 9121 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_26330 9111 9857 gene locus_tag LOCUS_26340 9111 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946218.1 protein_id gnl|my_center|LOCUS_26340 9862 11289 gene locus_tag LOCUS_26350 gene cls 9862 11289 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_26350 12169 11249 gene locus_tag LOCUS_26360 12169 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_26360 12337 12771 gene locus_tag LOCUS_26370 12337 12771 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_26370 13041 13661 gene locus_tag LOCUS_26380 gene anr 13041 13661 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_26380 14605 13724 gene locus_tag LOCUS_26390 14605 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_26390 14734 15039 gene locus_tag LOCUS_26400 14734 15039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_26400 15063 15497 gene locus_tag LOCUS_26410 15063 15497 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_26410 15519 15956 gene locus_tag LOCUS_26420 15519 15956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_26420 16833 15949 gene locus_tag LOCUS_26430 16833 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 17480 16836 gene locus_tag LOCUS_26440 17480 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 17638 18978 gene locus_tag LOCUS_26450 17638 18978 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_26450 20348 19173 gene locus_tag LOCUS_26460 20348 19173 CDS product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_26460 21907 20348 gene locus_tag LOCUS_26470 21907 20348 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_26470 22064 23008 gene locus_tag LOCUS_26480 22064 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 23036 23737 gene locus_tag LOCUS_26490 23036 23737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 23734 24096 gene locus_tag LOCUS_26500 23734 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 24117 25145 gene locus_tag LOCUS_26510 24117 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 25352 25549 gene locus_tag LOCUS_26520 25352 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 26479 25952 gene locus_tag LOCUS_26530 26479 25952 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923342.1 protein_id gnl|my_center|LOCUS_26530 26855 26484 gene locus_tag LOCUS_26540 26855 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_26540 28462 27383 gene locus_tag LOCUS_26550 28462 27383 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_26550 29188 28484 gene locus_tag LOCUS_26560 29188 28484 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_26560 30438 29305 gene locus_tag LOCUS_26570 30438 29305 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_26570 31679 30480 gene locus_tag LOCUS_26580 31679 30480 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_26580 31988 32818 gene locus_tag LOCUS_26590 31988 32818 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_26590 32869 33666 gene locus_tag LOCUS_26600 gene uppP1 32869 33666 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_26600 35148 33676 gene locus_tag LOCUS_26610 35148 33676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 35251 36804 gene locus_tag LOCUS_26620 gene ilvB 35251 36804 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_26620 37026 37301 gene locus_tag LOCUS_26630 37026 37301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 37321 38364 gene locus_tag LOCUS_26640 37321 38364 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_26640 38797 38366 gene locus_tag LOCUS_26650 38797 38366 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_26650 39016 38798 gene locus_tag LOCUS_26660 39016 38798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 40109 39009 gene locus_tag LOCUS_26670 40109 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_26670 40268 41008 gene locus_tag LOCUS_26680 40268 41008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 41927 40998 gene locus_tag LOCUS_26690 41927 40998 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 protein_id gnl|my_center|LOCUS_26690 42753 42037 gene locus_tag LOCUS_26700 42753 42037 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_26700 42925 43272 gene locus_tag LOCUS_26710 gene hit 42925 43272 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_26710 44421 43291 gene locus_tag LOCUS_26720 gene mtnA 44421 43291 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_26720 44944 44531 gene locus_tag LOCUS_26730 44944 44531 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_26730 45742 45158 gene locus_tag LOCUS_26740 45742 45158 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071743.1 protein_id gnl|my_center|LOCUS_26740 46694 45960 gene locus_tag LOCUS_26750 46694 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882802.1 protein_id gnl|my_center|LOCUS_26750 47519 46698 gene locus_tag LOCUS_26760 47519 46698 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 protein_id gnl|my_center|LOCUS_26760 51726 47662 gene locus_tag LOCUS_26770 51726 47662 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_26770 53244 51766 gene locus_tag LOCUS_26780 gene cafA 53244 51766 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_26780 53890 53237 gene locus_tag LOCUS_26790 53890 53237 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_26790 54368 53880 gene locus_tag LOCUS_26800 gene mreD 54368 53880 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_26800 55330 54365 gene locus_tag LOCUS_26810 gene mreC 55330 54365 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_26810 56468 55428 gene locus_tag LOCUS_26820 56468 55428 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_26820 56794 57081 gene locus_tag LOCUS_26830 gene gatC 56794 57081 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_26830 57108 58562 gene locus_tag LOCUS_26840 gene gatA 57108 58562 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_26840 58559 59992 gene locus_tag LOCUS_26850 gene gatB 58559 59992 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_26850 60013 60333 gene locus_tag LOCUS_26860 60013 60333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_26860 62030 60330 gene locus_tag LOCUS_26870 62030 60330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 62849 62097 gene locus_tag LOCUS_26880 gene moeB 62849 62097 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_26880 63708 62842 gene locus_tag LOCUS_26890 gene prmC 63708 62842 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ26 protein_id gnl|my_center|LOCUS_26890 64792 63710 gene locus_tag LOCUS_26900 gene prfA 64792 63710 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_26900 66111 64789 gene locus_tag LOCUS_26910 gene hemA 66111 64789 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_26910 66343 68124 gene locus_tag LOCUS_26920 66343 68124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_26920 68124 68738 gene locus_tag LOCUS_26930 gene lolB 68124 68738 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 protein_id gnl|my_center|LOCUS_26930 68745 69647 gene locus_tag LOCUS_26940 gene ispE 68745 69647 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN01 protein_id gnl|my_center|LOCUS_26940 69787 69862 gene locus_tag LOCUS_t00180 69787 69862 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70046 71002 gene locus_tag LOCUS_26950 gene prs 70046 71002 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_26950 71110 71748 gene locus_tag LOCUS_26960 gene rplY 71110 71748 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX3 protein_id gnl|my_center|LOCUS_26960 71761 72372 gene locus_tag LOCUS_26970 gene pth 71761 72372 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AP0 protein_id gnl|my_center|LOCUS_26970 72387 73478 gene locus_tag LOCUS_26980 gene ychF 72387 73478 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_26980 73562 73638 gene locus_tag LOCUS_t00190 73562 73638 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 73676 74392 gene locus_tag LOCUS_26990 73676 74392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_26990 74486 74887 gene locus_tag LOCUS_27000 74486 74887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 75967 74900 gene locus_tag LOCUS_27010 75967 74900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_27010 77621 75951 gene locus_tag LOCUS_27020 77621 75951 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_27020 78705 77641 gene locus_tag LOCUS_27030 gene idiA 78705 77641 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_27030 79884 78832 gene locus_tag LOCUS_27040 79884 78832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 80069 80605 gene locus_tag LOCUS_27050 80069 80605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 80605 81294 gene locus_tag LOCUS_27060 80605 81294 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_27060 81308 81874 gene locus_tag LOCUS_27070 81308 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_27070 82302 81880 gene locus_tag LOCUS_27080 82302 81880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 82917 82462 gene locus_tag LOCUS_27090 82917 82462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 84093 83161 gene locus_tag LOCUS_27100 84093 83161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 84216 85094 gene locus_tag LOCUS_27110 84216 85094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 85581 85240 gene locus_tag LOCUS_27120 85581 85240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 86460 85708 gene locus_tag LOCUS_27130 86460 85708 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_27130 86601 88583 gene locus_tag LOCUS_27140 86601 88583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 88641 88922 gene locus_tag LOCUS_27150 gene xseB 88641 88922 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_27150 88925 89863 gene locus_tag LOCUS_27160 88925 89863 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_27160 89951 91852 gene locus_tag LOCUS_27170 gene dxs 89951 91852 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_27170 91874 92482 gene locus_tag LOCUS_27180 gene cobO 91874 92482 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_27180 92445 93383 gene locus_tag LOCUS_27190 gene btuF 92445 93383 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_27190 93949 93365 gene locus_tag LOCUS_27200 gene ribA 93949 93365 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY6 protein_id gnl|my_center|LOCUS_27200 94443 93967 gene locus_tag LOCUS_27210 gene pgpA 94443 93967 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_27210 95468 94458 gene locus_tag LOCUS_27220 gene thiL 95468 94458 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_27220 95973 95455 gene locus_tag LOCUS_27230 gene nusB 95973 95455 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_27230 96453 95977 gene locus_tag LOCUS_27240 gene ribH 96453 95977 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_27240 97599 96478 gene locus_tag LOCUS_27250 gene ribB 97599 96478 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_27250 98306 97638 gene locus_tag LOCUS_27260 98306 97638 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_27260 99455 98340 gene locus_tag LOCUS_27270 gene ribD 99455 98340 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX83 protein_id gnl|my_center|LOCUS_27270 99943 99491 gene locus_tag LOCUS_27280 gene nrdR 99943 99491 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_27280 101240 99969 gene locus_tag LOCUS_27290 gene glyA 101240 99969 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_27290 101408 102604 gene locus_tag LOCUS_27300 101408 102604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 102627 103502 gene locus_tag LOCUS_27310 102627 103502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 103593 105260 gene locus_tag LOCUS_27320 103593 105260 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_27320 105347 105703 gene locus_tag LOCUS_27330 105347 105703 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI1 protein_id gnl|my_center|LOCUS_27330 106436 105741 gene locus_tag LOCUS_27340 106436 105741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 107493 106348 gene locus_tag LOCUS_27350 107493 106348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 107636 108559 gene locus_tag LOCUS_27360 107636 108559 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_27360 108543 109427 gene locus_tag LOCUS_27370 108543 109427 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 protein_id gnl|my_center|LOCUS_27370 109424 110674 gene locus_tag LOCUS_27380 109424 110674 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_27380 110677 112494 gene locus_tag LOCUS_27390 110677 112494 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_27390 113627 112410 gene locus_tag LOCUS_27400 gene erg3 113627 112410 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_27400 113695 114129 gene locus_tag LOCUS_27410 113695 114129 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_27410 114280 114356 gene locus_tag LOCUS_t00200 114280 114356 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 186 1193 gene locus_tag LOCUS_27420 186 1193 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930147.1 protein_id gnl|my_center|LOCUS_27420 2616 1411 gene locus_tag LOCUS_27430 2616 1411 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 protein_id gnl|my_center|LOCUS_27430 2560 2766 gene locus_tag LOCUS_27440 2560 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 4231 3125 gene locus_tag LOCUS_27450 4231 3125 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_27450 5082 4228 gene locus_tag LOCUS_27460 5082 4228 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K28 protein_id gnl|my_center|LOCUS_27460 5175 5726 gene locus_tag LOCUS_27470 5175 5726 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_27470 5723 7072 gene locus_tag LOCUS_27480 5723 7072 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_27480 7091 9367 gene locus_tag LOCUS_27490 7091 9367 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_27490 11094 9397 gene locus_tag LOCUS_27500 11094 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 12254 11106 gene locus_tag LOCUS_27510 12254 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 13564 12281 gene locus_tag LOCUS_27520 13564 12281 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_27520 13650 16073 gene locus_tag LOCUS_27530 13650 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 17009 16068 gene locus_tag LOCUS_27540 17009 16068 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_27540 17066 18250 gene locus_tag LOCUS_27550 17066 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 19797 18226 gene locus_tag LOCUS_27560 19797 18226 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810816.1 protein_id gnl|my_center|LOCUS_27560 20033 20530 gene locus_tag LOCUS_27570 20033 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 20533 21189 gene locus_tag LOCUS_27580 20533 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 22729 21179 gene locus_tag LOCUS_27590 22729 21179 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_27590 24043 22772 gene locus_tag LOCUS_27600 24043 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 25713 24040 gene locus_tag LOCUS_27610 25713 24040 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_27610 25730 26758 gene locus_tag LOCUS_27620 25730 26758 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090615.1 protein_id gnl|my_center|LOCUS_27620 26768 27244 gene locus_tag LOCUS_27630 26768 27244 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPI9 protein_id gnl|my_center|LOCUS_27630 28513 27233 gene locus_tag LOCUS_27640 28513 27233 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640274.1 protein_id gnl|my_center|LOCUS_27640 28998 32090 gene locus_tag LOCUS_27650 28998 32090 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_27650 32852 32208 gene locus_tag LOCUS_27660 32852 32208 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921221.1 protein_id gnl|my_center|LOCUS_27660 33449 32886 gene locus_tag LOCUS_27670 33449 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 35415 33490 gene locus_tag LOCUS_27680 35415 33490 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_27680 36774 35665 gene locus_tag LOCUS_27690 gene rsgA 36774 35665 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 protein_id gnl|my_center|LOCUS_27690 37144 36800 gene locus_tag LOCUS_27700 37144 36800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 protein_id gnl|my_center|LOCUS_27700 38358 37327 gene locus_tag LOCUS_27710 38358 37327 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_27710 38558 40417 gene locus_tag LOCUS_27720 38558 40417 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_27720 41508 40471 gene locus_tag LOCUS_27730 41508 40471 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_27730 43079 42204 gene locus_tag LOCUS_27740 43079 42204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 44050 43076 gene locus_tag LOCUS_27750 44050 43076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_27750 44922 44047 gene locus_tag LOCUS_27760 44922 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 45875 44928 gene locus_tag LOCUS_27770 45875 44928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_27770 48549 45877 gene locus_tag LOCUS_27780 48549 45877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 49106 48546 gene locus_tag LOCUS_27790 49106 48546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 49675 49232 gene locus_tag LOCUS_27800 49675 49232 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122325.1 protein_id gnl|my_center|LOCUS_27800 50592 49756 gene locus_tag LOCUS_27810 50592 49756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 50991 50623 gene locus_tag LOCUS_27820 50991 50623 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_27820 51178 51011 gene locus_tag LOCUS_27830 51178 51011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 52032 51325 gene locus_tag LOCUS_27840 52032 51325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 52362 52165 gene locus_tag LOCUS_27850 52362 52165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 52864 52517 gene locus_tag LOCUS_27860 52864 52517 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_27860 53226 53047 gene locus_tag LOCUS_27870 53226 53047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 53413 53658 gene locus_tag LOCUS_27880 53413 53658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710070.1 protein_id gnl|my_center|LOCUS_27880 53658 53975 gene locus_tag LOCUS_27890 53658 53975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 54844 54062 gene locus_tag LOCUS_27900 54844 54062 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_27900 55596 54994 gene locus_tag LOCUS_27910 55596 54994 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_27910 55904 55686 gene locus_tag LOCUS_27920 55904 55686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 56298 55909 gene locus_tag LOCUS_27930 56298 55909 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_27930 57022 56468 gene locus_tag LOCUS_27940 57022 56468 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106834.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence14 3233 609 gene locus_tag LOCUS_27950 gene topA 3233 609 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_27950 4388 3321 gene locus_tag LOCUS_27960 gene ilvE 4388 3321 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54689 protein_id gnl|my_center|LOCUS_27960 4473 5288 gene locus_tag LOCUS_27970 gene mttC 4473 5288 CDS product secretion protein MttC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114747.1 protein_id gnl|my_center|LOCUS_27970 5508 5263 gene locus_tag LOCUS_27980 5508 5263 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 protein_id gnl|my_center|LOCUS_27980 6570 5512 gene locus_tag LOCUS_27990 gene pyrD 6570 5512 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_27990 6809 7768 gene locus_tag LOCUS_28000 6809 7768 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342804.1 protein_id gnl|my_center|LOCUS_28000 7797 8771 gene locus_tag LOCUS_28010 7797 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_28010 8750 9292 gene locus_tag LOCUS_28020 8750 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_28020 9285 10298 gene locus_tag LOCUS_28030 gene batA 9285 10298 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_28030 10295 12166 gene locus_tag LOCUS_28040 10295 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_28040 12177 13982 gene locus_tag LOCUS_28050 12177 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104709.1 protein_id gnl|my_center|LOCUS_28050 14056 14415 gene locus_tag LOCUS_28060 14056 14415 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_28060 15952 14453 gene locus_tag LOCUS_28070 gene purF 15952 14453 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_28070 16462 15983 gene locus_tag LOCUS_28080 16462 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_28080 17140 16463 gene locus_tag LOCUS_28090 17140 16463 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_28090 18501 17173 gene locus_tag LOCUS_28100 18501 17173 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267159.1 protein_id gnl|my_center|LOCUS_28100 19389 18508 gene locus_tag LOCUS_28110 gene accD 19389 18508 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_28110 20253 19432 gene locus_tag LOCUS_28120 gene trpA 20253 19432 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Y6 protein_id gnl|my_center|LOCUS_28120 21510 20266 gene locus_tag LOCUS_28130 gene trpB 21510 20266 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVY4 protein_id gnl|my_center|LOCUS_28130 22147 21497 gene locus_tag LOCUS_28140 gene trpF 22147 21497 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9X5 protein_id gnl|my_center|LOCUS_28140 23061 22270 gene locus_tag LOCUS_28150 gene truA 23061 22270 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN7 protein_id gnl|my_center|LOCUS_28150 25542 23083 gene locus_tag LOCUS_28160 25542 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 26632 25613 gene locus_tag LOCUS_28170 gene asd 26632 25613 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_28170 27316 26672 gene locus_tag LOCUS_28180 gene leuD 27316 26672 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_28180 28806 27367 gene locus_tag LOCUS_28190 gene leuC 28806 27367 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_28190 29966 28881 gene locus_tag LOCUS_28200 gene aroC 29966 28881 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3U6 protein_id gnl|my_center|LOCUS_28200 30899 30018 gene locus_tag LOCUS_28210 gene prmB 30899 30018 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A294 protein_id gnl|my_center|LOCUS_28210 31057 31599 gene locus_tag LOCUS_28220 gene folE1 31057 31599 CDS product GTP cyclohydrolase 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887V1 protein_id gnl|my_center|LOCUS_28220 32591 31611 gene locus_tag LOCUS_28230 32591 31611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 33261 32584 gene locus_tag LOCUS_28240 33261 32584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 34301 33264 gene locus_tag LOCUS_28250 gene gpsA 34301 33264 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_28250 35726 34341 gene locus_tag LOCUS_28260 gene sthA 35726 34341 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_28260 35908 35723 gene locus_tag LOCUS_28270 35908 35723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 36990 35905 gene locus_tag LOCUS_28280 gene apbE 36990 35905 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ0 protein_id gnl|my_center|LOCUS_28280 38358 37132 gene locus_tag LOCUS_28290 gene nqrF 38358 37132 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_28290 39024 38416 gene locus_tag LOCUS_28300 gene nqrE 39024 38416 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_28300 39686 39024 gene locus_tag LOCUS_28310 gene nqrD 39686 39024 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ5 protein_id gnl|my_center|LOCUS_28310 40491 39700 gene locus_tag LOCUS_28320 gene nqrC 40491 39700 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_28320 41698 40481 gene locus_tag LOCUS_28330 gene nqrB 41698 40481 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_28330 43071 41713 gene locus_tag LOCUS_28340 gene nqrA 43071 41713 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_28340 44872 43412 gene locus_tag LOCUS_28350 gene gap-2 44872 43412 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884J0 protein_id gnl|my_center|LOCUS_28350 45037 48501 gene locus_tag LOCUS_28360 gene mfd 45037 48501 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_28360 49923 48538 gene locus_tag LOCUS_28370 49923 48538 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44917 protein_id gnl|my_center|LOCUS_28370 50123 50974 gene locus_tag LOCUS_28380 50123 50974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 51708 50938 gene locus_tag LOCUS_28390 51708 50938 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_28390 51849 53057 gene locus_tag LOCUS_28400 51849 53057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_28400 53139 53666 gene locus_tag LOCUS_28410 gene efp 53139 53666 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ2 protein_id gnl|my_center|LOCUS_28410 53835 53656 gene locus_tag LOCUS_28420 53835 53656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence15 79 2 gene locus_tag LOCUS_t00210 79 2 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 661 155 gene locus_tag LOCUS_28430 661 155 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_28430 928 692 gene locus_tag LOCUS_28440 928 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1185 2495 gene locus_tag LOCUS_28450 1185 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3210 2503 gene locus_tag LOCUS_28460 3210 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3702 3226 gene locus_tag LOCUS_28470 3702 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 4104 3775 gene locus_tag LOCUS_28480 4104 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4997 4218 gene locus_tag LOCUS_28490 gene flgA 4997 4218 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268462.1 protein_id gnl|my_center|LOCUS_28490 5197 6129 gene locus_tag LOCUS_28500 5197 6129 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_28500 6132 6980 gene locus_tag LOCUS_28510 gene cheR-2 6132 6980 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244386.1 protein_id gnl|my_center|LOCUS_28510 7145 7543 gene locus_tag LOCUS_28520 gene flgB 7145 7543 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_28520 7546 7986 gene locus_tag LOCUS_28530 gene flgC 7546 7986 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_28530 7997 8671 gene locus_tag LOCUS_28540 gene flgD 7997 8671 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_28540 8699 10744 gene locus_tag LOCUS_28550 8699 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 10778 11518 gene locus_tag LOCUS_28560 gene flgF 10778 11518 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_28560 11552 12337 gene locus_tag LOCUS_28570 11552 12337 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR5 protein_id gnl|my_center|LOCUS_28570 12358 13029 gene locus_tag LOCUS_28580 gene flgH 12358 13029 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_28580 13074 14225 gene locus_tag LOCUS_28590 gene flgI 13074 14225 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Z4 protein_id gnl|my_center|LOCUS_28590 14236 15216 gene locus_tag LOCUS_28600 gene flgJ 14236 15216 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_28600 15213 17885 gene locus_tag LOCUS_28610 15213 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 17888 19132 gene locus_tag LOCUS_28620 gene flgL 17888 19132 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_28620 19553 19182 gene locus_tag LOCUS_28630 19553 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 19764 21863 gene locus_tag LOCUS_28640 19764 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 21982 22449 gene locus_tag LOCUS_28650 21982 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 23554 22505 gene locus_tag LOCUS_28660 23554 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 23540 23743 gene locus_tag LOCUS_28670 23540 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 23843 26662 gene locus_tag LOCUS_28680 23843 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 26698 27096 gene locus_tag LOCUS_28690 gene fliS 26698 27096 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV3 protein_id gnl|my_center|LOCUS_28690 27235 28695 gene locus_tag LOCUS_28700 gene fleQ 27235 28695 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_28700 29592 28732 gene locus_tag LOCUS_28710 29592 28732 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369623.1 protein_id gnl|my_center|LOCUS_28710 30271 29612 gene locus_tag LOCUS_28720 gene purN 30271 29612 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ50 protein_id gnl|my_center|LOCUS_28720 31341 30268 gene locus_tag LOCUS_28730 gene purM 31341 30268 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM24 protein_id gnl|my_center|LOCUS_28730 31463 32599 gene locus_tag LOCUS_28740 31463 32599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 32604 33368 gene locus_tag LOCUS_28750 gene hda 32604 33368 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM41 protein_id gnl|my_center|LOCUS_28750 33734 33387 gene locus_tag LOCUS_28760 33734 33387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 34449 33814 gene locus_tag LOCUS_28770 gene wrbA 34449 33814 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_28770 35788 34436 gene locus_tag LOCUS_28780 35788 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_28780 37547 35799 gene locus_tag LOCUS_28790 gene proS 37547 35799 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP53 protein_id gnl|my_center|LOCUS_28790 38053 37637 gene locus_tag LOCUS_28800 38053 37637 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_28800 38297 38575 gene locus_tag LOCUS_28810 38297 38575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550867.1 protein_id gnl|my_center|LOCUS_28810 38639 40429 gene locus_tag LOCUS_28820 gene aspS 38639 40429 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 protein_id gnl|my_center|LOCUS_28820 40488 41009 gene locus_tag LOCUS_28830 gene ruvC 40488 41009 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR00 protein_id gnl|my_center|LOCUS_28830 41064 41684 gene locus_tag LOCUS_28840 gene ruvA 41064 41684 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_28840 41681 42715 gene locus_tag LOCUS_28850 gene ruvB 41681 42715 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_28850 42838 43530 gene locus_tag LOCUS_28860 gene tolQ 42838 43530 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_28860 43551 43985 gene locus_tag LOCUS_28870 gene tolR 43551 43985 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_28870 43990 44817 gene locus_tag LOCUS_28880 43990 44817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 44814 46124 gene locus_tag LOCUS_28890 gene tolB 44814 46124 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK6 protein_id gnl|my_center|LOCUS_28890 46240 46791 gene locus_tag LOCUS_28900 46240 46791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 46798 47595 gene locus_tag LOCUS_28910 46798 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 protein_id gnl|my_center|LOCUS_28910 47601 48242 gene locus_tag LOCUS_28920 gene queE 47601 48242 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTW7 protein_id gnl|my_center|LOCUS_28920 48284 48964 gene locus_tag LOCUS_28930 gene queC 48284 48964 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A28 protein_id gnl|my_center|LOCUS_28930 49077 49151 gene locus_tag LOCUS_t00220 49077 49151 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 1113 544 gene locus_tag LOCUS_28940 gene dcd 1113 544 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC9 protein_id gnl|my_center|LOCUS_28940 2761 1208 gene locus_tag LOCUS_28950 2761 1208 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_28950 4991 2868 gene locus_tag LOCUS_28960 gene metG 4991 2868 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_28960 5196 5032 gene locus_tag LOCUS_28970 5196 5032 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 protein_id gnl|my_center|LOCUS_28970 6001 5270 gene locus_tag LOCUS_28980 6001 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 6129 6848 gene locus_tag LOCUS_28990 6129 6848 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246633.1 protein_id gnl|my_center|LOCUS_28990 6881 7528 gene locus_tag LOCUS_29000 gene nth 6881 7528 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_29000 7515 8417 gene locus_tag LOCUS_29010 7515 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 9373 8420 gene locus_tag LOCUS_29020 9373 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 10597 9383 gene locus_tag LOCUS_29030 gene argG 10597 9383 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_29030 11724 10870 gene locus_tag LOCUS_29040 11724 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_29040 11915 13018 gene locus_tag LOCUS_29050 gene pyrC 11915 13018 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72170 protein_id gnl|my_center|LOCUS_29050 13018 13662 gene locus_tag LOCUS_29060 gene rnt 13018 13662 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_29060 14532 13828 gene locus_tag LOCUS_29070 gene ompW 14532 13828 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17266 protein_id gnl|my_center|LOCUS_29070 14841 14671 gene locus_tag LOCUS_29080 14841 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 15867 14986 gene locus_tag LOCUS_29090 15867 14986 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_29090 17507 15867 gene locus_tag LOCUS_29100 17507 15867 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_29100 20414 17601 gene locus_tag LOCUS_29110 20414 17601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_29110 21481 20555 gene locus_tag LOCUS_29120 21481 20555 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807652.1 protein_id gnl|my_center|LOCUS_29120 21608 22933 gene locus_tag LOCUS_29130 21608 22933 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_29130 23040 23744 gene locus_tag LOCUS_29140 23040 23744 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 protein_id gnl|my_center|LOCUS_29140 23807 25705 gene locus_tag LOCUS_29150 23807 25705 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_29150 25683 26864 gene locus_tag LOCUS_29160 25683 26864 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_29160 27922 26912 gene locus_tag LOCUS_29170 27922 26912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 29403 27919 gene locus_tag LOCUS_29180 29403 27919 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_29180 31025 29445 gene locus_tag LOCUS_29190 31025 29445 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_29190 31543 34596 gene locus_tag LOCUS_29200 gene btuB 31543 34596 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_29200 34602 36254 gene locus_tag LOCUS_29210 34602 36254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_29210 36413 37558 gene locus_tag LOCUS_29220 36413 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 37558 38082 gene locus_tag LOCUS_29230 37558 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 38087 38707 gene locus_tag LOCUS_29240 38087 38707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 38707 39300 gene locus_tag LOCUS_29250 38707 39300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 39335 40957 gene locus_tag LOCUS_29260 39335 40957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence17 2210 2533 gene locus_tag LOCUS_29270 2210 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3407 3700 gene locus_tag LOCUS_29280 3407 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 4134 3793 gene locus_tag LOCUS_29290 4134 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 protein_id gnl|my_center|LOCUS_29290 4616 4155 gene locus_tag LOCUS_29300 4616 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199588.1 protein_id gnl|my_center|LOCUS_29300 4983 7049 gene locus_tag LOCUS_29310 4983 7049 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_29310 7405 8046 gene locus_tag LOCUS_29320 7405 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 8110 9312 gene locus_tag LOCUS_29330 8110 9312 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_29330 9309 12938 gene locus_tag LOCUS_29340 9309 12938 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706045.1 protein_id gnl|my_center|LOCUS_29340 15548 12942 gene locus_tag LOCUS_29350 15548 12942 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_29350 16408 15641 gene locus_tag LOCUS_29360 gene djlA 16408 15641 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUR8 protein_id gnl|my_center|LOCUS_29360 17760 16402 gene locus_tag LOCUS_29370 17760 16402 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_29370 17811 18755 gene locus_tag LOCUS_29380 17811 18755 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_29380 19336 18812 gene locus_tag LOCUS_29390 19336 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 19649 19398 gene locus_tag LOCUS_29400 19649 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 20494 19646 gene locus_tag LOCUS_29410 20494 19646 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119048.1 protein_id gnl|my_center|LOCUS_29410 22089 20503 gene locus_tag LOCUS_29420 gene abgT 22089 20503 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_29420 24554 22089 gene locus_tag LOCUS_29430 24554 22089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 25252 24671 gene locus_tag LOCUS_29440 25252 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 25386 27002 gene locus_tag LOCUS_29450 25386 27002 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_29450 27015 27638 gene locus_tag LOCUS_29460 27015 27638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 27635 28084 gene locus_tag LOCUS_29470 27635 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 28101 29384 gene locus_tag LOCUS_29480 28101 29384 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_29480 29404 30438 gene locus_tag LOCUS_29490 29404 30438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 31656 30520 gene locus_tag LOCUS_29500 31656 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071615.1 protein_id gnl|my_center|LOCUS_29500 32136 31657 gene locus_tag LOCUS_29510 32136 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 33323 32139 gene locus_tag LOCUS_29520 33323 32139 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 protein_id gnl|my_center|LOCUS_29520 33465 34718 gene locus_tag LOCUS_29530 33465 34718 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088454.1 protein_id gnl|my_center|LOCUS_29530 34718 35155 gene locus_tag LOCUS_29540 34718 35155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019821.1 protein_id gnl|my_center|LOCUS_29540 35248 36657 gene locus_tag LOCUS_29550 35248 36657 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729025.1 protein_id gnl|my_center|LOCUS_29550 36782 >42723 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgtccgtggggaacac >Feature sequence18 715 1677 gene locus_tag LOCUS_29560 gene intI 715 1677 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_29560 1956 3125 gene locus_tag LOCUS_29570 1956 3125 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976026.1 protein_id gnl|my_center|LOCUS_29570 3270 3181 gene locus_tag LOCUS_t00230 3270 3181 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3545 3330 gene locus_tag LOCUS_29580 gene csrA 3545 3330 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_29580 5001 3760 gene locus_tag LOCUS_29590 5001 3760 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_29590 7686 5077 gene locus_tag LOCUS_29600 gene alaS 7686 5077 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVQ5 protein_id gnl|my_center|LOCUS_29600 8847 7780 gene locus_tag LOCUS_29610 8847 7780 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_29610 11081 8928 gene locus_tag LOCUS_29620 11081 8928 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_29620 12959 11208 gene locus_tag LOCUS_29630 gene recJ 12959 11208 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_29630 14344 12953 gene locus_tag LOCUS_29640 gene thrC 14344 12953 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_29640 15695 14352 gene locus_tag LOCUS_29650 gene hom 15695 14352 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_29650 16590 15814 gene locus_tag LOCUS_29660 16590 15814 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 protein_id gnl|my_center|LOCUS_29660 17120 16755 gene locus_tag LOCUS_29670 gene rplS 17120 16755 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_29670 17908 17117 gene locus_tag LOCUS_29680 gene trmD 17908 17117 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZ16 protein_id gnl|my_center|LOCUS_29680 18509 17973 gene locus_tag LOCUS_29690 gene rimM 18509 17973 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_29690 18785 18525 gene locus_tag LOCUS_29700 gene rpsP 18785 18525 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_29700 20313 18931 gene locus_tag LOCUS_29710 gene ffh 20313 18931 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 protein_id gnl|my_center|LOCUS_29710 20516 21325 gene locus_tag LOCUS_29720 20516 21325 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_29720 21333 22622 gene locus_tag LOCUS_29730 gene corB 21333 22622 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261309.1 protein_id gnl|my_center|LOCUS_29730 23464 22685 gene locus_tag LOCUS_29740 23464 22685 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085024.1 protein_id gnl|my_center|LOCUS_29740 24593 23451 gene locus_tag LOCUS_29750 24593 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 25667 24606 gene locus_tag LOCUS_29760 gene pspF 25667 24606 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_29760 25909 26568 gene locus_tag LOCUS_29770 gene pspA 25909 26568 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_29770 26581 26817 gene locus_tag LOCUS_29780 26581 26817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 26801 27520 gene locus_tag LOCUS_29790 26801 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 27527 27901 gene locus_tag LOCUS_29800 27527 27901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 28154 28519 gene locus_tag LOCUS_29810 28154 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 29094 28783 gene locus_tag LOCUS_29820 29094 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_29820 33013 29099 gene locus_tag LOCUS_29830 gene purL 33013 29099 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W6 protein_id gnl|my_center|LOCUS_29830 33661 33122 gene locus_tag LOCUS_29840 gene tadA 33661 33122 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 protein_id gnl|my_center|LOCUS_29840 34473 33652 gene locus_tag LOCUS_29850 gene phoC 34473 33652 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P342 protein_id gnl|my_center|LOCUS_29850 34659 35822 gene locus_tag LOCUS_29860 34659 35822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 36537 35908 gene locus_tag LOCUS_29870 36537 35908 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226962.1 protein_id gnl|my_center|LOCUS_29870 36735 37721 gene locus_tag LOCUS_29880 36735 37721 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 protein_id gnl|my_center|LOCUS_29880 38732 37797 gene locus_tag LOCUS_29890 38732 37797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_29890 38800 39483 gene locus_tag LOCUS_29900 38800 39483 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801072.1 protein_id gnl|my_center|LOCUS_29900 39514 40311 gene locus_tag LOCUS_29910 39514 40311 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence19 1435 815 gene locus_tag LOCUS_29920 gene lexA 1435 815 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q8 protein_id gnl|my_center|LOCUS_29920 1580 2689 gene locus_tag LOCUS_29930 gene nagZ 1580 2689 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_29930 2711 3259 gene locus_tag LOCUS_29940 2711 3259 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_29940 3277 3870 gene locus_tag LOCUS_29950 3277 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_29950 4002 4751 gene locus_tag LOCUS_29960 4002 4751 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267476.1 protein_id gnl|my_center|LOCUS_29960 4766 5695 gene locus_tag LOCUS_29970 gene etfA 4766 5695 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_29970 5950 7857 gene locus_tag LOCUS_29980 5950 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 11135 7899 gene locus_tag LOCUS_29990 gene rne 11135 7899 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_29990 11926 12717 gene locus_tag LOCUS_30000 11926 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 12720 13961 gene locus_tag LOCUS_30010 12720 13961 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405690.1 protein_id gnl|my_center|LOCUS_30010 13981 14721 gene locus_tag LOCUS_30020 gene lolD 13981 14721 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_30020 14714 16006 gene locus_tag LOCUS_30030 14714 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_30030 16267 16058 gene locus_tag LOCUS_30040 16267 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 16152 18584 gene locus_tag LOCUS_30050 gene comA 16152 18584 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_30050 18589 19275 gene locus_tag LOCUS_30060 18589 19275 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_30060 19272 19706 gene locus_tag LOCUS_30070 19272 19706 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_30070 19699 21519 gene locus_tag LOCUS_30080 gene msbA 19699 21519 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_30080 21519 22673 gene locus_tag LOCUS_30090 gene lpxK 21519 22673 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 protein_id gnl|my_center|LOCUS_30090 22666 22854 gene locus_tag LOCUS_30100 22666 22854 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_30100 22851 23588 gene locus_tag LOCUS_30110 gene kdsB 22851 23588 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_30110 23595 24767 gene locus_tag LOCUS_30120 gene murB 23595 24767 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB5 protein_id gnl|my_center|LOCUS_30120 24776 26818 gene locus_tag LOCUS_30130 gene uvrC 24776 26818 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_30130 26853 27425 gene locus_tag LOCUS_30140 gene pgsA 26853 27425 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947999.1 protein_id gnl|my_center|LOCUS_30140 27564 27639 gene locus_tag LOCUS_t00240 27564 27639 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27703 27776 gene locus_tag LOCUS_t00250 27703 27776 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28046 28132 gene locus_tag LOCUS_t00260 28046 28132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28347 28661 gene locus_tag LOCUS_30150 28347 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 28549 28797 gene locus_tag LOCUS_30160 28549 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 28901 29269 gene locus_tag LOCUS_30170 28901 29269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 29972 29706 gene locus_tag LOCUS_30180 29972 29706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 30565 30224 gene locus_tag LOCUS_30190 30565 30224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038641.1 protein_id gnl|my_center|LOCUS_30190 31266 30571 gene locus_tag LOCUS_30200 31266 30571 CDS product DNA ligase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_30200 31858 31259 gene locus_tag LOCUS_30210 31858 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 32850 31864 gene locus_tag LOCUS_30220 32850 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 32999 33853 gene locus_tag LOCUS_30230 32999 33853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_30230 33850 35046 gene locus_tag LOCUS_30240 gene rlmI 33850 35046 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKF0 protein_id gnl|my_center|LOCUS_30240 35097 35738 gene locus_tag LOCUS_30250 gene mtnB 35097 35738 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_30250 35735 36292 gene locus_tag LOCUS_30260 gene mtnD 35735 36292 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN79 protein_id gnl|my_center|LOCUS_30260 36292 36987 gene locus_tag LOCUS_30270 gene mtnC 36292 36987 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_30270 <39122 37129 gene locus_tag LOCUS_30280 <39122 37129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113499.1:acetoacetyl-CoA synthetase >Feature sequence20 692 339 gene locus_tag LOCUS_30290 692 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1026 2273 gene locus_tag LOCUS_30300 1026 2273 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_30300 5020 2303 gene locus_tag LOCUS_30310 gene pepN 5020 2303 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_30310 5859 5032 gene locus_tag LOCUS_30320 5859 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_30320 6261 5950 gene locus_tag LOCUS_30330 6261 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 7099 6254 gene locus_tag LOCUS_30340 7099 6254 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_30340 7982 7092 gene locus_tag LOCUS_30350 gene nadK 7982 7092 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 protein_id gnl|my_center|LOCUS_30350 10290 8071 gene locus_tag LOCUS_30360 10290 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 11384 10458 gene locus_tag LOCUS_30370 gene dcyD 11384 10458 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_30370 11566 11490 gene locus_tag LOCUS_t00270 11566 11490 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11689 11614 gene locus_tag LOCUS_t00280 11689 11614 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11870 12229 gene locus_tag LOCUS_30380 gene ptps 11870 12229 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW2 protein_id gnl|my_center|LOCUS_30380 13431 12250 gene locus_tag LOCUS_30390 13431 12250 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_30390 14151 13459 gene locus_tag LOCUS_30400 gene ung 14151 13459 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XE2 protein_id gnl|my_center|LOCUS_30400 15691 14162 gene locus_tag LOCUS_30410 gene lysS 15691 14162 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_30410 16577 15696 gene locus_tag LOCUS_30420 gene prfB 16577 15696 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_30420 16539 16733 gene locus_tag LOCUS_30430 16539 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 17326 19374 gene locus_tag LOCUS_30440 gene mnmC 17326 19374 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA8 protein_id gnl|my_center|LOCUS_30440 21580 20249 gene locus_tag LOCUS_30450 gene apeB 21580 20249 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW15 protein_id gnl|my_center|LOCUS_30450 22279 21587 gene locus_tag LOCUS_30460 22279 21587 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW30 protein_id gnl|my_center|LOCUS_30460 22512 23003 gene locus_tag LOCUS_30470 22512 23003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 23604 22975 gene locus_tag LOCUS_30480 23604 22975 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 protein_id gnl|my_center|LOCUS_30480 24865 23591 gene locus_tag LOCUS_30490 gene rmuC 24865 23591 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U3 protein_id gnl|my_center|LOCUS_30490 25967 24885 gene locus_tag LOCUS_30500 25967 24885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 26863 25988 gene locus_tag LOCUS_30510 gene dapA 26863 25988 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_30510 28041 26944 gene locus_tag LOCUS_30520 28041 26944 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_30520 28317 28048 gene locus_tag LOCUS_30530 28317 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_30530 28404 29864 gene locus_tag LOCUS_30540 28404 29864 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_30540 30974 29874 gene locus_tag LOCUS_30550 gene nadA 30974 29874 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 protein_id gnl|my_center|LOCUS_30550 31174 31569 gene locus_tag LOCUS_30560 31174 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 31632 32159 gene locus_tag LOCUS_30570 31632 32159 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C794 protein_id gnl|my_center|LOCUS_30570 32156 32545 gene locus_tag LOCUS_30580 32156 32545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence21 1227 106 gene locus_tag LOCUS_30590 1227 106 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312131.1 protein_id gnl|my_center|LOCUS_30590 1697 1266 gene locus_tag LOCUS_30600 1697 1266 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_30600 2144 1743 gene locus_tag LOCUS_30610 gene yaeJ 2144 1743 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_30610 2528 3547 gene locus_tag LOCUS_30620 2528 3547 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069704.1 protein_id gnl|my_center|LOCUS_30620 3725 4507 gene locus_tag LOCUS_30630 3725 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4507 5658 gene locus_tag LOCUS_30640 gene yhaZ 4507 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07541 protein_id gnl|my_center|LOCUS_30640 6628 5630 gene locus_tag LOCUS_30650 gene yjlD 6628 5630 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122519.1 protein_id gnl|my_center|LOCUS_30650 6851 7906 gene locus_tag LOCUS_30660 6851 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_30660 7943 8734 gene locus_tag LOCUS_30670 7943 8734 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_30670 9341 8853 gene locus_tag LOCUS_30680 9341 8853 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_30680 9810 9496 gene locus_tag LOCUS_30690 9810 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 11529 9811 gene locus_tag LOCUS_30700 11529 9811 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_30700 11805 12830 gene locus_tag LOCUS_30710 gene ldh 11805 12830 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_30710 12848 13978 gene locus_tag LOCUS_30720 12848 13978 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706668.1 protein_id gnl|my_center|LOCUS_30720 13968 14966 gene locus_tag LOCUS_30730 13968 14966 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_30730 14963 15967 gene locus_tag LOCUS_30740 14963 15967 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV80 protein_id gnl|my_center|LOCUS_30740 16844 15975 gene locus_tag LOCUS_30750 gene hslO 16844 15975 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AZ5 protein_id gnl|my_center|LOCUS_30750 19156 16874 gene locus_tag LOCUS_30760 gene trpE(G) 19156 16874 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15395 protein_id gnl|my_center|LOCUS_30760 20557 19418 gene locus_tag LOCUS_30770 gene hisC 20557 19418 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJC5 protein_id gnl|my_center|LOCUS_30770 21265 20573 gene locus_tag LOCUS_30780 21265 20573 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_30780 21437 22732 gene locus_tag LOCUS_30790 21437 22732 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_30790 23803 23117 gene locus_tag LOCUS_30800 gene yugP 23803 23117 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971756.1 protein_id gnl|my_center|LOCUS_30800 23866 24108 gene locus_tag LOCUS_30810 23866 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 25273 24128 gene locus_tag LOCUS_30820 25273 24128 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_30820 26539 25277 gene locus_tag LOCUS_30830 26539 25277 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_30830 26790 27140 gene locus_tag LOCUS_30840 26790 27140 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_30840 28146 27256 gene locus_tag LOCUS_30850 28146 27256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_30850 28400 28251 gene locus_tag LOCUS_30860 28400 28251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 28644 28465 gene locus_tag LOCUS_30870 28644 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 29975 28794 gene locus_tag LOCUS_30880 29975 28794 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence22 522 2546 gene locus_tag LOCUS_30890 522 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2574 3533 gene locus_tag LOCUS_30900 2574 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4101 3724 gene locus_tag LOCUS_30910 4101 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 4441 6759 gene locus_tag LOCUS_30920 4441 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_30920 7116 6778 gene locus_tag LOCUS_30930 7116 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 8120 7113 gene locus_tag LOCUS_30940 8120 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 8257 9129 gene locus_tag LOCUS_30950 8257 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 9531 9148 gene locus_tag LOCUS_30960 9531 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262087.1 protein_id gnl|my_center|LOCUS_30960 9448 9651 gene locus_tag LOCUS_30970 9448 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 9675 11108 gene locus_tag LOCUS_30980 9675 11108 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268469.1 protein_id gnl|my_center|LOCUS_30980 11192 12628 gene locus_tag LOCUS_30990 11192 12628 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021047.1 protein_id gnl|my_center|LOCUS_30990 12683 13432 gene locus_tag LOCUS_31000 12683 13432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_31000 13435 14769 gene locus_tag LOCUS_31010 gene sufD 13435 14769 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_31010 14762 16012 gene locus_tag LOCUS_31020 14762 16012 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_31020 16023 16388 gene locus_tag LOCUS_31030 gene ydiC 16023 16388 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947470.1 protein_id gnl|my_center|LOCUS_31030 16391 16924 gene locus_tag LOCUS_31040 16391 16924 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_31040 16926 17357 gene locus_tag LOCUS_31050 16926 17357 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_31050 18065 17400 gene locus_tag LOCUS_31060 18065 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 18745 18062 gene locus_tag LOCUS_31070 18745 18062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 19157 18732 gene locus_tag LOCUS_31080 19157 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 19289 19365 gene locus_tag LOCUS_t00290 19289 19365 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19827 20117 gene locus_tag LOCUS_31090 19827 20117 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_31090 20168 20449 gene locus_tag LOCUS_31100 20168 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 20843 20478 gene locus_tag LOCUS_31110 20843 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 21357 20905 gene locus_tag LOCUS_31120 21357 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence23 5321 6307 gene locus_tag LOCUS_31130 5321 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_31130 6391 6693 gene locus_tag LOCUS_31140 6391 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142129.1 protein_id gnl|my_center|LOCUS_31140 6700 7179 gene locus_tag LOCUS_31150 6700 7179 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_31150 7231 7833 gene locus_tag LOCUS_31160 7231 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 9258 7867 gene locus_tag LOCUS_31170 9258 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence24 597 310 gene locus_tag LOCUS_31180 597 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3263 669 gene locus_tag LOCUS_31190 gene acnB 3263 669 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP3 protein_id gnl|my_center|LOCUS_31190 3434 3856 gene locus_tag LOCUS_31200 3434 3856 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_31200 4596 3811 gene locus_tag LOCUS_31210 gene lpxH 4596 3811 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N978 protein_id gnl|my_center|LOCUS_31210 5115 4612 gene locus_tag LOCUS_31220 5115 4612 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQZ8 protein_id gnl|my_center|LOCUS_31220 5202 7010 gene locus_tag LOCUS_31230 gene glnS 5202 7010 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_31230 7007 8404 gene locus_tag LOCUS_31240 gene cysS 7007 8404 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_31240 8510 8586 gene locus_tag LOCUS_t00300 8510 8586 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8618 8693 gene locus_tag LOCUS_t00310 8618 8693 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8775 8851 gene locus_tag LOCUS_t00320 8775 8851 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9203 9000 gene locus_tag LOCUS_31250 9203 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250