>Feature sequence001 1640 432 gene locus_tag LOCUS_00010 gene trpB2 1640 432 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ0 protein_id gnl|my_center|LOCUS_00010 2058 4124 gene locus_tag LOCUS_00020 2058 4124 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_00020 4218 5690 gene locus_tag LOCUS_00030 gene betB 4218 5690 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ1 protein_id gnl|my_center|LOCUS_00030 5705 7378 gene locus_tag LOCUS_00040 gene betA 5705 7378 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 protein_id gnl|my_center|LOCUS_00040 8822 7497 gene locus_tag LOCUS_00050 gene rimO 8822 7497 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_00050 9849 8998 gene locus_tag LOCUS_00060 9849 8998 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_00060 10168 11451 gene locus_tag LOCUS_00070 gene arsB 10168 11451 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1J6 protein_id gnl|my_center|LOCUS_00070 13038 11443 gene locus_tag LOCUS_00080 13038 11443 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_00080 14001 13135 gene locus_tag LOCUS_00090 14001 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14258 14458 gene locus_tag LOCUS_00100 14258 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14467 14961 gene locus_tag LOCUS_00110 14467 14961 CDS product pilus assembly-related outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_00110 14972 16396 gene locus_tag LOCUS_00120 14972 16396 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_00120 16303 17091 gene locus_tag LOCUS_00130 16303 17091 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_00130 17141 18646 gene locus_tag LOCUS_00140 17141 18646 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 protein_id gnl|my_center|LOCUS_00140 18660 18926 gene locus_tag LOCUS_00150 18660 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18937 20265 gene locus_tag LOCUS_00160 18937 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106056.1 protein_id gnl|my_center|LOCUS_00160 20275 20739 gene locus_tag LOCUS_00170 20275 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20739 21233 gene locus_tag LOCUS_00180 20739 21233 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 protein_id gnl|my_center|LOCUS_00180 21227 22444 gene locus_tag LOCUS_00190 21227 22444 CDS product Flp pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 protein_id gnl|my_center|LOCUS_00190 22448 23881 gene locus_tag LOCUS_00200 22448 23881 CDS product Flp pilus assembly protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_00200 23878 24864 gene locus_tag LOCUS_00210 23878 24864 CDS product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_00210 24884 25852 gene locus_tag LOCUS_00220 24884 25852 CDS product pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 protein_id gnl|my_center|LOCUS_00220 25854 26864 gene locus_tag LOCUS_00230 25854 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27931 26858 gene locus_tag LOCUS_00240 gene nodX 27931 26858 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_00240 28944 27946 gene locus_tag LOCUS_00250 28944 27946 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268291.1 protein_id gnl|my_center|LOCUS_00250 29198 29001 gene locus_tag LOCUS_00260 29198 29001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30718 29528 gene locus_tag LOCUS_00270 30718 29528 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104564.1 protein_id gnl|my_center|LOCUS_00270 31913 30810 gene locus_tag LOCUS_00280 31913 30810 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268293.1 protein_id gnl|my_center|LOCUS_00280 33274 31976 gene locus_tag LOCUS_00290 33274 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105556.1 protein_id gnl|my_center|LOCUS_00290 34572 33271 gene locus_tag LOCUS_00300 34572 33271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105555.1 protein_id gnl|my_center|LOCUS_00300 35770 34466 gene locus_tag LOCUS_00310 35770 34466 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104562.1 protein_id gnl|my_center|LOCUS_00310 36312 35821 gene locus_tag LOCUS_00320 gene rfaH 36312 35821 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRG4 protein_id gnl|my_center|LOCUS_00320 37107 36364 gene locus_tag LOCUS_00330 37107 36364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_00330 39322 37121 gene locus_tag LOCUS_00340 39322 37121 CDS product protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_00340 40302 39370 gene locus_tag LOCUS_00350 40302 39370 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216700.1 protein_id gnl|my_center|LOCUS_00350 41835 40306 gene locus_tag LOCUS_00360 41835 40306 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268286.1 protein_id gnl|my_center|LOCUS_00360 43020 41851 gene locus_tag LOCUS_00370 43020 41851 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_00370 43854 43078 gene locus_tag LOCUS_00380 43854 43078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44530 44454 gene locus_tag LOCUS_t00010 44530 44454 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44734 44658 gene locus_tag LOCUS_t00020 44734 44658 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45126 45452 gene locus_tag LOCUS_00390 45126 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45521 46501 gene locus_tag LOCUS_00400 gene dusC 45521 46501 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 protein_id gnl|my_center|LOCUS_00400 47257 46511 gene locus_tag LOCUS_00410 47257 46511 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_00410 47384 47827 gene locus_tag LOCUS_00420 gene ibpA 47384 47827 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_00420 50827 47882 gene locus_tag LOCUS_00430 50827 47882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51759 50860 gene locus_tag LOCUS_00440 51759 50860 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_00440 51913 53337 gene locus_tag LOCUS_00450 gene leuC 51913 53337 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58949 protein_id gnl|my_center|LOCUS_00450 >Feature sequence002 <1 1188 gene locus_tag LOCUS_00460 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770780.1:acyl-CoA dehydrogenase 1560 1189 gene locus_tag LOCUS_00470 1560 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 1768 3720 gene locus_tag LOCUS_00480 1768 3720 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU85 protein_id gnl|my_center|LOCUS_00480 5788 4682 gene locus_tag LOCUS_00490 gene AMACR 5788 4682 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083170.1 protein_id gnl|my_center|LOCUS_00490 7498 5858 gene locus_tag LOCUS_00500 7498 5858 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918081.1 protein_id gnl|my_center|LOCUS_00500 8763 7624 gene locus_tag LOCUS_00510 8763 7624 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_00510 9959 8775 gene locus_tag LOCUS_00520 9959 8775 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268168.1 protein_id gnl|my_center|LOCUS_00520 10738 9971 gene locus_tag LOCUS_00530 10738 9971 CDS product 3-hydroxy-2-methylbutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389261.1 protein_id gnl|my_center|LOCUS_00530 11927 10872 gene locus_tag LOCUS_00540 11927 10872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 protein_id gnl|my_center|LOCUS_00540 12431 11997 gene locus_tag LOCUS_00550 12431 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_00550 12561 14585 gene locus_tag LOCUS_00560 12561 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 15208 14552 gene locus_tag LOCUS_00570 15208 14552 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529766.1 protein_id gnl|my_center|LOCUS_00570 16069 15341 gene locus_tag LOCUS_00580 16069 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 16904 16224 gene locus_tag LOCUS_00590 16904 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 17492 17037 gene locus_tag LOCUS_00600 17492 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 17834 17613 gene locus_tag LOCUS_00610 17834 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 18390 17917 gene locus_tag LOCUS_00620 18390 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 19223 18387 gene locus_tag LOCUS_00630 19223 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 20420 19413 gene locus_tag LOCUS_00640 20420 19413 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268267.1 protein_id gnl|my_center|LOCUS_00640 21480 20506 gene locus_tag LOCUS_00650 21480 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 protein_id gnl|my_center|LOCUS_00650 21812 21477 gene locus_tag LOCUS_00660 21812 21477 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_00660 22111 21809 gene locus_tag LOCUS_00670 22111 21809 CDS product DsrH like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268264.1 protein_id gnl|my_center|LOCUS_00670 22470 22111 gene locus_tag LOCUS_00680 gene tusC 22470 22111 CDS product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N2 protein_id gnl|my_center|LOCUS_00680 22862 22470 gene locus_tag LOCUS_00690 gene tusD 22862 22470 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_00690 23620 22955 gene locus_tag LOCUS_00700 23620 22955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03268 protein_id gnl|my_center|LOCUS_00700 23742 23831 gene locus_tag LOCUS_t00030 23742 23831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25346 23886 gene locus_tag LOCUS_00710 gene cysG 25346 23886 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_00710 26719 25439 gene locus_tag LOCUS_00720 gene serS 26719 25439 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_00720 27157 26786 gene locus_tag LOCUS_00730 gene crcB 27157 26786 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS8 protein_id gnl|my_center|LOCUS_00730 28482 27157 gene locus_tag LOCUS_00740 28482 27157 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_00740 29152 28526 gene locus_tag LOCUS_00750 gene lolA 29152 28526 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_00750 31504 29171 gene locus_tag LOCUS_00760 gene ftsK 31504 29171 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 protein_id gnl|my_center|LOCUS_00760 31792 32739 gene locus_tag LOCUS_00770 gene trxB1 31792 32739 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_00770 32785 33465 gene locus_tag LOCUS_00780 gene aat 32785 33465 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_00780 33518 34225 gene locus_tag LOCUS_00790 gene ate 33518 34225 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK9 protein_id gnl|my_center|LOCUS_00790 34317 34535 gene locus_tag LOCUS_00800 gene infA 34317 34535 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_00800 36890 34620 gene locus_tag LOCUS_00810 gene clpA 36890 34620 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104508.1 protein_id gnl|my_center|LOCUS_00810 37288 36920 gene locus_tag LOCUS_00820 gene clpS 37288 36920 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK6 protein_id gnl|my_center|LOCUS_00820 37496 37762 gene locus_tag LOCUS_00830 gene cspD 37496 37762 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_00830 39130 37874 gene locus_tag LOCUS_00840 gene icd 39130 37874 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_00840 39483 41702 gene locus_tag LOCUS_00850 gene idh 39483 41702 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_00850 41816 42256 gene locus_tag LOCUS_00860 41816 42256 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_00860 42325 43455 gene locus_tag LOCUS_00870 gene mnmA 42325 43455 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_00870 43452 44072 gene locus_tag LOCUS_00880 gene hflD 43452 44072 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 protein_id gnl|my_center|LOCUS_00880 44166 45536 gene locus_tag LOCUS_00890 gene purB 44166 45536 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_00890 45640 46779 gene locus_tag LOCUS_00900 45640 46779 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246030.1 protein_id gnl|my_center|LOCUS_00900 46772 47206 gene locus_tag LOCUS_00910 46772 47206 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_00910 47236 47829 gene locus_tag LOCUS_00920 47236 47829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113372.1 protein_id gnl|my_center|LOCUS_00920 47826 48632 gene locus_tag LOCUS_00930 47826 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_00930 >Feature sequence003 3502 2075 gene locus_tag LOCUS_00940 3502 2075 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092370.1 protein_id gnl|my_center|LOCUS_00940 4228 3590 gene locus_tag LOCUS_00950 gene rnhB 4228 3590 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_00950 5337 4228 gene locus_tag LOCUS_00960 gene lpxB 5337 4228 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_00960 6139 5363 gene locus_tag LOCUS_00970 gene lpxA 6139 5363 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_00970 6615 6136 gene locus_tag LOCUS_00980 gene fabZ 6615 6136 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_00980 7728 6670 gene locus_tag LOCUS_00990 gene lpxD 7728 6670 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_00990 8233 7730 gene locus_tag LOCUS_01000 8233 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_01000 10635 8284 gene locus_tag LOCUS_01010 gene bamA 10635 8284 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_01010 12057 10705 gene locus_tag LOCUS_01020 12057 10705 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_01020 13258 12071 gene locus_tag LOCUS_01030 gene dxr 13258 12071 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS2 protein_id gnl|my_center|LOCUS_01030 14070 13255 gene locus_tag LOCUS_01040 gene cdsA-1 14070 13255 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_01040 14825 14064 gene locus_tag LOCUS_01050 gene uppS 14825 14064 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY2 protein_id gnl|my_center|LOCUS_01050 15505 14948 gene locus_tag LOCUS_01060 gene frr 15505 14948 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_01060 16245 15502 gene locus_tag LOCUS_01070 gene pyrH 16245 15502 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_01070 17313 16444 gene locus_tag LOCUS_01080 gene tsf 17313 16444 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82851 protein_id gnl|my_center|LOCUS_01080 18173 17433 gene locus_tag LOCUS_01090 gene rpsB 18173 17433 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_01090 18436 19218 gene locus_tag LOCUS_01100 gene map 18436 19218 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_01100 19261 21963 gene locus_tag LOCUS_01110 gene glnD 19261 21963 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_01110 22309 21980 gene locus_tag LOCUS_01120 22309 21980 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_01120 22589 22320 gene locus_tag LOCUS_01130 22589 22320 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_01130 23071 22574 gene locus_tag LOCUS_01140 23071 22574 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_01140 24567 23068 gene locus_tag LOCUS_01150 24567 23068 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_01150 24893 24564 gene locus_tag LOCUS_01160 24893 24564 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_01160 27685 24893 gene locus_tag LOCUS_01170 27685 24893 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_01170 28341 27880 gene locus_tag LOCUS_01180 28341 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_01180 28460 28717 gene locus_tag LOCUS_01190 28460 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719739.1 protein_id gnl|my_center|LOCUS_01190 29420 28773 gene locus_tag LOCUS_01200 gene pdxH 29420 28773 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_01200 30240 29596 gene locus_tag LOCUS_01210 30240 29596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 31513 30365 gene locus_tag LOCUS_01220 31513 30365 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 protein_id gnl|my_center|LOCUS_01220 33754 31610 gene locus_tag LOCUS_01230 33754 31610 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_01230 33838 34302 gene locus_tag LOCUS_01240 33838 34302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_01240 34992 34354 gene locus_tag LOCUS_01250 34992 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082015.1 protein_id gnl|my_center|LOCUS_01250 35446 35126 gene locus_tag LOCUS_01260 35446 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 35327 35614 gene locus_tag LOCUS_01270 35327 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 35617 36105 gene locus_tag LOCUS_01280 35617 36105 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XP9 protein_id gnl|my_center|LOCUS_01280 36931 36155 gene locus_tag LOCUS_01290 36931 36155 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_01290 37051 37977 gene locus_tag LOCUS_01300 37051 37977 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_01300 38568 37990 gene locus_tag LOCUS_01310 gene erdR 38568 37990 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_01310 38877 39785 gene locus_tag LOCUS_01320 38877 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_01320 40497 39787 gene locus_tag LOCUS_01330 40497 39787 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_01330 40617 41015 gene locus_tag LOCUS_01340 40617 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092248.1 protein_id gnl|my_center|LOCUS_01340 43440 41035 gene locus_tag LOCUS_01350 43440 41035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_01350 43571 44980 gene locus_tag LOCUS_01360 43571 44980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_01360 45041 46132 gene locus_tag LOCUS_01370 45041 46132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092255.1 protein_id gnl|my_center|LOCUS_01370 46692 46231 gene locus_tag LOCUS_01380 gene recX 46692 46231 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_01380 47750 46698 gene locus_tag LOCUS_01390 gene recA 47750 46698 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_01390 <48875 47836 gene locus_tag LOCUS_01400 <48875 47836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GV1:CinA-like protein >Feature sequence004 720 397 gene locus_tag LOCUS_01410 720 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 1518 3131 gene locus_tag LOCUS_01420 1518 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4492 3296 gene locus_tag LOCUS_01430 4492 3296 CDS product hipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232961.1 protein_id gnl|my_center|LOCUS_01430 4743 4492 gene locus_tag LOCUS_01440 4743 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5745 4858 gene locus_tag LOCUS_01450 5745 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6599 7798 gene locus_tag LOCUS_01460 gene intD 6599 7798 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_01460 8080 9417 gene locus_tag LOCUS_01470 8080 9417 CDS product phage-related integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_01470 9979 9446 gene locus_tag LOCUS_01480 9979 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 10538 9954 gene locus_tag LOCUS_01490 10538 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11300 12715 gene locus_tag LOCUS_01500 11300 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602905.1 protein_id gnl|my_center|LOCUS_01500 12827 13156 gene locus_tag LOCUS_01510 12827 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704074.1 protein_id gnl|my_center|LOCUS_01510 13254 14222 gene locus_tag LOCUS_01520 13254 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_01520 14297 15301 gene locus_tag LOCUS_01530 14297 15301 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_01530 15395 16345 gene locus_tag LOCUS_01540 15395 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705013.1 protein_id gnl|my_center|LOCUS_01540 16317 16814 gene locus_tag LOCUS_01550 16317 16814 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705007.1 protein_id gnl|my_center|LOCUS_01550 18094 17108 gene locus_tag LOCUS_01560 18094 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 20865 18091 gene locus_tag LOCUS_01570 20865 18091 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103377.1 protein_id gnl|my_center|LOCUS_01570 21461 20862 gene locus_tag LOCUS_01580 21461 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 22702 21458 gene locus_tag LOCUS_01590 22702 21458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103378.1 protein_id gnl|my_center|LOCUS_01590 24759 22711 gene locus_tag LOCUS_01600 24759 22711 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393721.1 protein_id gnl|my_center|LOCUS_01600 27078 24760 gene locus_tag LOCUS_01610 27078 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_01610 27776 27093 gene locus_tag LOCUS_01620 27776 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_01620 28876 27773 gene locus_tag LOCUS_01630 28876 27773 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_01630 30686 28893 gene locus_tag LOCUS_01640 30686 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_01640 31660 30683 gene locus_tag LOCUS_01650 31660 30683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 35154 31663 gene locus_tag LOCUS_01660 35154 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 38618 35154 gene locus_tag LOCUS_01670 38618 35154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_01670 39227 38682 gene locus_tag LOCUS_01680 39227 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_01680 39990 39220 gene locus_tag LOCUS_01690 39990 39220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_01690 40883 39987 gene locus_tag LOCUS_01700 40883 39987 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_01700 41442 41065 gene locus_tag LOCUS_01710 41442 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 42440 41457 gene locus_tag LOCUS_01720 42440 41457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 42692 43567 gene locus_tag LOCUS_01730 42692 43567 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_01730 43630 44130 gene locus_tag LOCUS_01740 43630 44130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 44413 44850 gene locus_tag LOCUS_01750 44413 44850 CDS product peptidase S24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318766.1 protein_id gnl|my_center|LOCUS_01750 44843 46117 gene locus_tag LOCUS_01760 44843 46117 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267005.1 protein_id gnl|my_center|LOCUS_01760 46698 46162 gene locus_tag LOCUS_01770 46698 46162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence005 2073 187 gene locus_tag LOCUS_01780 gene parE 2073 187 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_01780 2700 2083 gene locus_tag LOCUS_01790 2700 2083 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 protein_id gnl|my_center|LOCUS_01790 3629 2814 gene locus_tag LOCUS_01800 gene cpdA 3629 2814 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_01800 4213 3767 gene locus_tag LOCUS_01810 4213 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_01810 4827 4210 gene locus_tag LOCUS_01820 gene aspP 4827 4210 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_01820 5032 5757 gene locus_tag LOCUS_01830 5032 5757 CDS product DUF3298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102069.1 protein_id gnl|my_center|LOCUS_01830 7752 5764 gene locus_tag LOCUS_01840 gene wbpM 7752 5764 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_01840 8867 7836 gene locus_tag LOCUS_01850 8867 7836 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_01850 9811 8864 gene locus_tag LOCUS_01860 9811 8864 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_01860 10072 10386 gene locus_tag LOCUS_01870 10072 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11889 10471 gene locus_tag LOCUS_01880 11889 10471 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266727.1 protein_id gnl|my_center|LOCUS_01880 12050 13003 gene locus_tag LOCUS_01890 12050 13003 CDS product GDP-6-deoxy-D-lyxo-4-hexulose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_01890 13051 14229 gene locus_tag LOCUS_01900 gene wbpY 13051 14229 CDS product glycosyltransferase WbpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_01900 14461 15090 gene locus_tag LOCUS_01910 gene wzm 14461 15090 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_01910 15090 16310 gene locus_tag LOCUS_01920 gene wzt 15090 16310 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_01920 16307 17536 gene locus_tag LOCUS_01930 16307 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 17536 21318 gene locus_tag LOCUS_01940 17536 21318 CDS product mannosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_01940 21963 21553 gene locus_tag LOCUS_01950 21963 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 22901 21960 gene locus_tag LOCUS_01960 22901 21960 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_01960 24526 22907 gene locus_tag LOCUS_01970 24526 22907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 26683 24719 gene locus_tag LOCUS_01980 26683 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 27954 26944 gene locus_tag LOCUS_01990 27954 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 29219 28173 gene locus_tag LOCUS_02000 gene gmd 29219 28173 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888L3 protein_id gnl|my_center|LOCUS_02000 30607 29216 gene locus_tag LOCUS_02010 30607 29216 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266725.1 protein_id gnl|my_center|LOCUS_02010 31929 30607 gene locus_tag LOCUS_02020 31929 30607 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_02020 33677 31941 gene locus_tag LOCUS_02030 33677 31941 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_02030 33899 35014 gene locus_tag LOCUS_02040 33899 35014 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266713.1 protein_id gnl|my_center|LOCUS_02040 36441 35023 gene locus_tag LOCUS_02050 36441 35023 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268561.1 protein_id gnl|my_center|LOCUS_02050 36615 36541 gene locus_tag LOCUS_t00040 36615 36541 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38706 36823 gene locus_tag LOCUS_02060 gene thiC 38706 36823 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_02060 39103 40560 gene locus_tag LOCUS_02070 39103 40560 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_02070 41937 40666 gene locus_tag LOCUS_02080 gene waaA 41937 40666 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_02080 42049 42381 gene locus_tag LOCUS_02090 42049 42381 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 protein_id gnl|my_center|LOCUS_02090 42439 43611 gene locus_tag LOCUS_02100 42439 43611 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_02100 43608 44426 gene locus_tag LOCUS_02110 43608 44426 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence006 <1 1774 gene locus_tag LOCUS_02120 <1 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258002.1:molybdopterin oxidoreductase 1767 3122 gene locus_tag LOCUS_02130 1767 3122 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_02130 3115 3642 gene locus_tag LOCUS_02140 3115 3642 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633542.1 protein_id gnl|my_center|LOCUS_02140 3642 4166 gene locus_tag LOCUS_02150 3642 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 protein_id gnl|my_center|LOCUS_02150 4163 5155 gene locus_tag LOCUS_02160 4163 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5142 5543 gene locus_tag LOCUS_02170 5142 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5536 6333 gene locus_tag LOCUS_02180 5536 6333 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_02180 6330 7301 gene locus_tag LOCUS_02190 6330 7301 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_02190 7298 8920 gene locus_tag LOCUS_02200 7298 8920 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_02200 8907 9548 gene locus_tag LOCUS_02210 8907 9548 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_02210 9545 9805 gene locus_tag LOCUS_02220 9545 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9896 10504 gene locus_tag LOCUS_02230 9896 10504 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226114.1 protein_id gnl|my_center|LOCUS_02230 10525 11115 gene locus_tag LOCUS_02240 10525 11115 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537477.1 protein_id gnl|my_center|LOCUS_02240 11289 11200 gene locus_tag LOCUS_t00050 11289 11200 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12247 11378 gene locus_tag LOCUS_02250 gene purC 12247 11378 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_02250 13475 12375 gene locus_tag LOCUS_02260 13475 12375 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406091.1 protein_id gnl|my_center|LOCUS_02260 14372 13494 gene locus_tag LOCUS_02270 gene dapA 14372 13494 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_02270 14568 15128 gene locus_tag LOCUS_02280 14568 15128 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379024.1 protein_id gnl|my_center|LOCUS_02280 15139 15612 gene locus_tag LOCUS_02290 gene bcp 15139 15612 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_02290 15863 15621 gene locus_tag LOCUS_02300 15863 15621 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104802.1 protein_id gnl|my_center|LOCUS_02300 15971 17401 gene locus_tag LOCUS_02310 15971 17401 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_02310 18505 17447 gene locus_tag LOCUS_02320 gene nadA 18505 17447 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 protein_id gnl|my_center|LOCUS_02320 20247 18751 gene locus_tag LOCUS_02330 20247 18751 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096875.1 protein_id gnl|my_center|LOCUS_02330 20519 20444 gene locus_tag LOCUS_t00060 20519 20444 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21244 20570 gene locus_tag LOCUS_02340 gene queC 21244 20570 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_02340 21951 21271 gene locus_tag LOCUS_02350 gene queE 21951 21271 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_02350 22838 22035 gene locus_tag LOCUS_02360 22838 22035 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_02360 23351 22845 gene locus_tag LOCUS_02370 gene pal 23351 22845 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z4 protein_id gnl|my_center|LOCUS_02370 24702 23407 gene locus_tag LOCUS_02380 gene tolB 24702 23407 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_02380 25700 24699 gene locus_tag LOCUS_02390 gene tolA 25700 24699 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50600 protein_id gnl|my_center|LOCUS_02390 26152 25700 gene locus_tag LOCUS_02400 26152 25700 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 protein_id gnl|my_center|LOCUS_02400 26856 26164 gene locus_tag LOCUS_02410 gene tolQ 26856 26164 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_02410 27302 26859 gene locus_tag LOCUS_02420 27302 26859 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_02420 28406 27351 gene locus_tag LOCUS_02430 gene ruvB 28406 27351 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_02430 29016 28411 gene locus_tag LOCUS_02440 gene ruvA 29016 28411 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_02440 29576 29058 gene locus_tag LOCUS_02450 gene ruvC 29576 29058 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL3 protein_id gnl|my_center|LOCUS_02450 30489 29743 gene locus_tag LOCUS_02460 gene pmpR 30489 29743 CDS product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 protein_id gnl|my_center|LOCUS_02460 32322 30547 gene locus_tag LOCUS_02470 gene aspS 32322 30547 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_02470 32575 33045 gene locus_tag LOCUS_02480 32575 33045 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_02480 33247 33879 gene locus_tag LOCUS_02490 33247 33879 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_249652.2 protein_id gnl|my_center|LOCUS_02490 34109 33903 gene locus_tag LOCUS_02500 gene slyX 34109 33903 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z9 protein_id gnl|my_center|LOCUS_02500 34534 34112 gene locus_tag LOCUS_02510 34534 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 34916 35143 gene locus_tag LOCUS_02520 34916 35143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 >Feature sequence007 1686 70 gene locus_tag LOCUS_02530 gene treF 1686 70 CDS product cytoplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNM6 protein_id gnl|my_center|LOCUS_02530 2450 1683 gene locus_tag LOCUS_02540 gene gdh 2450 1683 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_02540 2643 3551 gene locus_tag LOCUS_02550 2643 3551 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I633 protein_id gnl|my_center|LOCUS_02550 4047 3529 gene locus_tag LOCUS_02560 4047 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_02560 4226 6406 gene locus_tag LOCUS_02570 gene glcB 4226 6406 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_02570 7409 6459 gene locus_tag LOCUS_02580 7409 6459 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190171.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 8120 9070 gene locus_tag LOCUS_02590 8120 9070 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039066.1 protein_id gnl|my_center|LOCUS_02590 9237 9088 gene locus_tag LOCUS_02600 9237 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 9885 11318 gene locus_tag LOCUS_02610 gene mgtE 9885 11318 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I544 protein_id gnl|my_center|LOCUS_02610 11722 11396 gene locus_tag LOCUS_02620 11722 11396 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554423.1 protein_id gnl|my_center|LOCUS_02620 12123 11944 gene locus_tag LOCUS_02630 12123 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 12370 12146 gene locus_tag LOCUS_02640 12370 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 12606 12682 gene locus_tag LOCUS_t00070 12606 12682 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13500 12754 gene locus_tag LOCUS_02650 13500 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_02650 14043 13573 gene locus_tag LOCUS_02660 14043 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113135.1 protein_id gnl|my_center|LOCUS_02660 14398 14072 gene locus_tag LOCUS_02670 gene flgM 14398 14072 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_02670 15186 14506 gene locus_tag LOCUS_02680 15186 14506 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYP6 protein_id gnl|my_center|LOCUS_02680 15330 16262 gene locus_tag LOCUS_02690 15330 16262 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_02690 16295 17122 gene locus_tag LOCUS_02700 gene cheR1 16295 17122 CDS product chemotaxis protein methyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87131 protein_id gnl|my_center|LOCUS_02700 17296 17700 gene locus_tag LOCUS_02710 gene flgB 17296 17700 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_02710 17715 18158 gene locus_tag LOCUS_02720 gene flgC 17715 18158 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_02720 18171 18851 gene locus_tag LOCUS_02730 gene flgD 18171 18851 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A1 protein_id gnl|my_center|LOCUS_02730 18874 20190 gene locus_tag LOCUS_02740 gene flgE 18874 20190 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P9 protein_id gnl|my_center|LOCUS_02740 20387 21127 gene locus_tag LOCUS_02750 gene flgF 20387 21127 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_02750 21170 21955 gene locus_tag LOCUS_02760 gene flgG 21170 21955 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_02760 22027 22722 gene locus_tag LOCUS_02770 gene flgH 22027 22722 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_02770 22737 23837 gene locus_tag LOCUS_02780 gene flgI 22737 23837 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_02780 23848 25008 gene locus_tag LOCUS_02790 gene flgJ 23848 25008 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P4 protein_id gnl|my_center|LOCUS_02790 25012 27021 gene locus_tag LOCUS_02800 gene flgK 25012 27021 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268454.1 protein_id gnl|my_center|LOCUS_02800 27033 28613 gene locus_tag LOCUS_02810 gene flgL 27033 28613 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268453.1 protein_id gnl|my_center|LOCUS_02810 29238 30659 gene locus_tag LOCUS_02820 gene fliC 29238 30659 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_02820 30727 31074 gene locus_tag LOCUS_02830 30727 31074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 31135 32538 gene locus_tag LOCUS_02840 gene fliD 31135 32538 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Y5 protein_id gnl|my_center|LOCUS_02840 32731 33048 gene locus_tag LOCUS_02850 32731 33048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 33417 33866 gene locus_tag LOCUS_02860 33417 33866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408555.1 protein_id gnl|my_center|LOCUS_02860 34002 34328 gene locus_tag LOCUS_02870 34002 34328 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770454.1 protein_id gnl|my_center|LOCUS_02870 34325 34705 gene locus_tag LOCUS_02880 34325 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245813.1 protein_id gnl|my_center|LOCUS_02880 34705 35172 gene locus_tag LOCUS_02890 34705 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence008 34 109 gene locus_tag LOCUS_t00080 34 109 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 194 1387 gene locus_tag LOCUS_02900 gene tuf 194 1387 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X3 protein_id gnl|my_center|LOCUS_02900 1538 1849 gene locus_tag LOCUS_02910 gene rpsJ 1538 1849 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD4 protein_id gnl|my_center|LOCUS_02910 1931 2566 gene locus_tag LOCUS_02920 gene rplC 1931 2566 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X1 protein_id gnl|my_center|LOCUS_02920 2579 3181 gene locus_tag LOCUS_02930 gene rplD 2579 3181 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X0 protein_id gnl|my_center|LOCUS_02930 3178 3477 gene locus_tag LOCUS_02940 gene rplW 3178 3477 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_02940 3492 4313 gene locus_tag LOCUS_02950 gene rplB 3492 4313 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD8 protein_id gnl|my_center|LOCUS_02950 4330 4605 gene locus_tag LOCUS_02960 gene rpsS 4330 4605 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W7 protein_id gnl|my_center|LOCUS_02960 4619 4951 gene locus_tag LOCUS_02970 gene rplV 4619 4951 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE0 protein_id gnl|my_center|LOCUS_02970 4965 5651 gene locus_tag LOCUS_02980 gene rpsC 4965 5651 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ0 protein_id gnl|my_center|LOCUS_02980 5664 6077 gene locus_tag LOCUS_02990 gene rplP 5664 6077 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_02990 6077 6268 gene locus_tag LOCUS_03000 gene rpmC 6077 6268 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ2 protein_id gnl|my_center|LOCUS_03000 6265 6537 gene locus_tag LOCUS_03010 gene rpsQ 6265 6537 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_03010 6561 6929 gene locus_tag LOCUS_03020 gene rplN 6561 6929 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W1 protein_id gnl|my_center|LOCUS_03020 6941 7255 gene locus_tag LOCUS_03030 gene rplX 6941 7255 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_03030 7275 7814 gene locus_tag LOCUS_03040 gene rplE 7275 7814 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V9 protein_id gnl|my_center|LOCUS_03040 7827 8132 gene locus_tag LOCUS_03050 gene rpsN 7827 8132 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_03050 8307 8699 gene locus_tag LOCUS_03060 gene rpsH 8307 8699 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_03060 8712 9245 gene locus_tag LOCUS_03070 gene rplF 8712 9245 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_03070 9256 9606 gene locus_tag LOCUS_03080 gene rplR 9256 9606 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_03080 9610 10110 gene locus_tag LOCUS_03090 gene rpsE 9610 10110 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_03090 10113 10292 gene locus_tag LOCUS_03100 gene rpmD 10113 10292 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF3 protein_id gnl|my_center|LOCUS_03100 10295 10729 gene locus_tag LOCUS_03110 gene rplO 10295 10729 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF4 protein_id gnl|my_center|LOCUS_03110 10730 12058 gene locus_tag LOCUS_03120 gene secY 10730 12058 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_03120 12333 12689 gene locus_tag LOCUS_03130 gene rpsM 12333 12689 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR5 protein_id gnl|my_center|LOCUS_03130 12720 13109 gene locus_tag LOCUS_03140 gene rpsK 12720 13109 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_03140 13128 13748 gene locus_tag LOCUS_03150 gene rpsD 13128 13748 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR7 protein_id gnl|my_center|LOCUS_03150 13771 14772 gene locus_tag LOCUS_03160 gene rpoA 13771 14772 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_03160 14818 15204 gene locus_tag LOCUS_03170 gene rplQ 14818 15204 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR9 protein_id gnl|my_center|LOCUS_03170 15389 16849 gene locus_tag LOCUS_03180 gene katA 15389 16849 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WJ8 protein_id gnl|my_center|LOCUS_03180 19754 16911 gene locus_tag LOCUS_03190 gene uvrA 19754 16911 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_03190 19887 21254 gene locus_tag LOCUS_03200 19887 21254 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_03200 21423 21911 gene locus_tag LOCUS_03210 gene ssb 21423 21911 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40947 protein_id gnl|my_center|LOCUS_03210 21927 22805 gene locus_tag LOCUS_03220 21927 22805 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103231.1 protein_id gnl|my_center|LOCUS_03220 22798 23727 gene locus_tag LOCUS_03230 22798 23727 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_03230 24473 23796 gene locus_tag LOCUS_03240 24473 23796 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_03240 24657 25439 gene locus_tag LOCUS_03250 24657 25439 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_03250 25436 26782 gene locus_tag LOCUS_03260 25436 26782 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_03260 26775 27320 gene locus_tag LOCUS_03270 gene exbB 26775 27320 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_03270 27331 27744 gene locus_tag LOCUS_03280 27331 27744 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_03280 27744 28460 gene locus_tag LOCUS_03290 27744 28460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 28462 29553 gene locus_tag LOCUS_03300 28462 29553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 30079 29567 gene locus_tag LOCUS_03310 30079 29567 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769001.1 protein_id gnl|my_center|LOCUS_03310 31352 30087 gene locus_tag LOCUS_03320 31352 30087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_03320 31549 31355 gene locus_tag LOCUS_03330 31549 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence009 1216 71 gene locus_tag LOCUS_03340 1216 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1352 1927 gene locus_tag LOCUS_03350 1352 1927 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_03350 1908 3155 gene locus_tag LOCUS_03360 1908 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 3043 3372 gene locus_tag LOCUS_03370 3043 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 3635 3925 gene locus_tag LOCUS_03380 3635 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 3892 4416 gene locus_tag LOCUS_03390 3892 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4602 5180 gene locus_tag LOCUS_03400 4602 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5900 5565 gene locus_tag LOCUS_03410 5900 5565 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_03410 6294 7001 gene locus_tag LOCUS_03420 6294 7001 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919380.1 protein_id gnl|my_center|LOCUS_03420 7718 8185 gene locus_tag LOCUS_03430 7718 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8213 8491 gene locus_tag LOCUS_03440 8213 8491 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037837.1 protein_id gnl|my_center|LOCUS_03440 8509 8784 gene locus_tag LOCUS_03450 8509 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 9602 8739 gene locus_tag LOCUS_03460 9602 8739 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 protein_id gnl|my_center|LOCUS_03460 9922 9599 gene locus_tag LOCUS_03470 9922 9599 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015462.1 protein_id gnl|my_center|LOCUS_03470 9957 10640 gene locus_tag LOCUS_03480 9957 10640 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887797.1 protein_id gnl|my_center|LOCUS_03480 11900 12166 gene locus_tag LOCUS_03490 11900 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03490 12230 14758 gene locus_tag LOCUS_03500 12230 14758 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_03500 16711 16466 gene locus_tag LOCUS_03510 16711 16466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 18146 17730 gene locus_tag LOCUS_03520 18146 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 19341 18937 gene locus_tag LOCUS_03530 19341 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03530 20102 19632 gene locus_tag LOCUS_03540 20102 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 21314 20574 gene locus_tag LOCUS_03550 21314 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03550 22108 22749 gene locus_tag LOCUS_03560 22108 22749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_03560 22746 23351 gene locus_tag LOCUS_03570 22746 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 23348 23989 gene locus_tag LOCUS_03580 23348 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 24039 24356 gene locus_tag LOCUS_03590 24039 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_03590 24459 24758 gene locus_tag LOCUS_03600 24459 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_03600 24862 27141 gene locus_tag LOCUS_03610 24862 27141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038886.1 protein_id gnl|my_center|LOCUS_03610 27253 28110 gene locus_tag LOCUS_03620 27253 28110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 29026 28172 gene locus_tag LOCUS_03630 29026 28172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 29835 29023 gene locus_tag LOCUS_03640 29835 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 30098 30676 gene locus_tag LOCUS_03650 30098 30676 CDS product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038885.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence010 <1 1148 gene locus_tag LOCUS_03660 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0J6:NADH-quinone oxidoreductase subunit G 1145 2137 gene locus_tag LOCUS_03670 gene nuoH 1145 2137 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J5 protein_id gnl|my_center|LOCUS_03670 2150 2698 gene locus_tag LOCUS_03680 gene nuoI 2150 2698 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_03680 2785 3285 gene locus_tag LOCUS_03690 gene nuoJ 2785 3285 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380113.1 protein_id gnl|my_center|LOCUS_03690 3289 3597 gene locus_tag LOCUS_03700 gene nuoK 3289 3597 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI4 protein_id gnl|my_center|LOCUS_03700 3594 5438 gene locus_tag LOCUS_03710 gene nuoL 3594 5438 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 protein_id gnl|my_center|LOCUS_03710 5460 6992 gene locus_tag LOCUS_03720 gene nuoM 5460 6992 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619067.1 protein_id gnl|my_center|LOCUS_03720 7000 8469 gene locus_tag LOCUS_03730 gene nuoN 7000 8469 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_03730 11188 8813 gene locus_tag LOCUS_03740 11188 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_03740 12214 11207 gene locus_tag LOCUS_03750 12214 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_03750 15186 12526 gene locus_tag LOCUS_03760 gene pepN 15186 12526 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_03760 15112 15612 gene locus_tag LOCUS_03770 15112 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 16546 15713 gene locus_tag LOCUS_03780 16546 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_03780 16824 16546 gene locus_tag LOCUS_03790 16824 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_03790 17758 16892 gene locus_tag LOCUS_03800 17758 16892 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_03800 18727 17768 gene locus_tag LOCUS_03810 18727 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_03810 19633 18746 gene locus_tag LOCUS_03820 gene nadK 19633 18746 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_03820 19823 20740 gene locus_tag LOCUS_03830 19823 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_03830 20811 22016 gene locus_tag LOCUS_03840 20811 22016 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_03840 23021 22059 gene locus_tag LOCUS_03850 23021 22059 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267167.1 protein_id gnl|my_center|LOCUS_03850 24379 23021 gene locus_tag LOCUS_03860 24379 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_03860 26760 24730 gene locus_tag LOCUS_03870 gene fadH1 26760 24730 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence011 1981 830 gene locus_tag LOCUS_03880 1981 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 2442 2032 gene locus_tag LOCUS_03890 2442 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03890 3056 2592 gene locus_tag LOCUS_03900 3056 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087466.1 protein_id gnl|my_center|LOCUS_03900 4137 3106 gene locus_tag LOCUS_03910 4137 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_03910 4435 4869 gene locus_tag LOCUS_03920 4435 4869 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582738.1 protein_id gnl|my_center|LOCUS_03920 6831 4927 gene locus_tag LOCUS_03930 gene htpG 6831 4927 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_03930 8189 6954 gene locus_tag LOCUS_03940 8189 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114261.1 protein_id gnl|my_center|LOCUS_03940 8692 8246 gene locus_tag LOCUS_03950 8692 8246 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_03950 9147 8689 gene locus_tag LOCUS_03960 9147 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_03960 9930 9205 gene locus_tag LOCUS_03970 9930 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_03970 11300 9993 gene locus_tag LOCUS_03980 gene braB 11300 9993 CDS product branched-chain amino acid transport system 2 carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19072 protein_id gnl|my_center|LOCUS_03980 12473 11586 gene locus_tag LOCUS_03990 gene sucD 12473 11586 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_03990 13639 12470 gene locus_tag LOCUS_04000 gene sucC 13639 12470 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_04000 15255 13819 gene locus_tag LOCUS_04010 gene lpdG 15255 13819 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_04010 16580 15354 gene locus_tag LOCUS_04020 gene sucB 16580 15354 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_04020 19478 16650 gene locus_tag LOCUS_04030 gene sucA 19478 16650 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_04030 20456 19752 gene locus_tag LOCUS_04040 gene sdhB 20456 19752 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_04040 22239 20467 gene locus_tag LOCUS_04050 gene sdhA 22239 20467 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_04050 22611 22243 gene locus_tag LOCUS_04060 gene sdhD 22611 22243 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D6 protein_id gnl|my_center|LOCUS_04060 22979 22605 gene locus_tag LOCUS_04070 22979 22605 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_04070 23340 24614 gene locus_tag LOCUS_04080 gene gltA 23340 24614 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_04080 25283 24678 gene locus_tag LOCUS_04090 25283 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769634.1 protein_id gnl|my_center|LOCUS_04090 25751 26032 gene locus_tag LOCUS_04100 25751 26032 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_04100 26462 26079 gene locus_tag LOCUS_04110 gene fliS 26462 26079 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_04110 26913 26692 gene locus_tag LOCUS_04120 26913 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 >Feature sequence012 1072 209 gene locus_tag LOCUS_04130 gene rsmI 1072 209 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ3 protein_id gnl|my_center|LOCUS_04130 1251 3071 gene locus_tag LOCUS_04140 1251 3071 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_04140 3391 3107 gene locus_tag LOCUS_04150 3391 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3494 4087 gene locus_tag LOCUS_04160 gene gmhA 3494 4087 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_04160 4084 4662 gene locus_tag LOCUS_04170 4084 4662 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 protein_id gnl|my_center|LOCUS_04170 5106 4696 gene locus_tag LOCUS_04180 5106 4696 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_04180 5736 5119 gene locus_tag LOCUS_04190 gene sspA 5736 5119 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_04190 6631 5822 gene locus_tag LOCUS_04200 6631 5822 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_04200 7842 6631 gene locus_tag LOCUS_04210 7842 6631 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_04210 8435 7842 gene locus_tag LOCUS_04220 8435 7842 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_04220 9081 8689 gene locus_tag LOCUS_04230 gene rpsI 9081 8689 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_04230 9524 9096 gene locus_tag LOCUS_04240 gene rplM 9524 9096 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_04240 9891 10601 gene locus_tag LOCUS_04250 9891 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_04250 10792 10595 gene locus_tag LOCUS_04260 gene yacG 10792 10595 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_04260 11397 10789 gene locus_tag LOCUS_04270 gene coaE 11397 10789 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_04270 12360 11491 gene locus_tag LOCUS_04280 gene pilD 12360 11491 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22610 protein_id gnl|my_center|LOCUS_04280 13577 12360 gene locus_tag LOCUS_04290 gene pilC 13577 12360 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_04290 15286 13580 gene locus_tag LOCUS_04300 gene pilB 15286 13580 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_04300 15607 16071 gene locus_tag LOCUS_04310 gene pilE 15607 16071 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_04310 16459 16632 gene locus_tag LOCUS_04320 16459 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 16945 17382 gene locus_tag LOCUS_04330 gene ytoQ 16945 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_04330 19401 17503 gene locus_tag LOCUS_04340 gene C 19401 17503 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW1 protein_id gnl|my_center|LOCUS_04340 20331 19414 gene locus_tag LOCUS_04350 gene cysD 20331 19414 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50273 protein_id gnl|my_center|LOCUS_04350 21225 20467 gene locus_tag LOCUS_04360 21225 20467 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_04360 21365 22513 gene locus_tag LOCUS_04370 21365 22513 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_04370 23609 22551 gene locus_tag LOCUS_04380 gene hisC1 23609 22551 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_04380 25021 23714 gene locus_tag LOCUS_04390 gene hisD 25021 23714 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_04390 25856 25224 gene locus_tag LOCUS_04400 gene hisG 25856 25224 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_04400 <26854 25928 gene locus_tag LOCUS_04410 <26854 25928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVW7:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence013 1781 633 gene locus_tag LOCUS_04420 gene bamB 1781 633 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX20 protein_id gnl|my_center|LOCUS_04420 2422 1781 gene locus_tag LOCUS_04430 2422 1781 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_04430 3738 2449 gene locus_tag LOCUS_04440 gene hisS 3738 2449 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ5 protein_id gnl|my_center|LOCUS_04440 4866 3754 gene locus_tag LOCUS_04450 gene ispG 4866 3754 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_04450 5915 4869 gene locus_tag LOCUS_04460 5915 4869 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 protein_id gnl|my_center|LOCUS_04460 6670 5912 gene locus_tag LOCUS_04470 gene pilF 6670 5912 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_04470 7829 6681 gene locus_tag LOCUS_04480 gene rlmN 7829 6681 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_04480 8280 7849 gene locus_tag LOCUS_04490 gene ndk 8280 7849 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_04490 8604 8404 gene locus_tag LOCUS_04500 8604 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_04500 8962 8618 gene locus_tag LOCUS_04510 gene fdx 8962 8618 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_04510 10821 8959 gene locus_tag LOCUS_04520 gene hscA 10821 8959 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51382 protein_id gnl|my_center|LOCUS_04520 11398 10862 gene locus_tag LOCUS_04530 gene hscB 11398 10862 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX31 protein_id gnl|my_center|LOCUS_04530 11714 11391 gene locus_tag LOCUS_04540 gene iscA 11714 11391 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z9 protein_id gnl|my_center|LOCUS_04540 12111 11725 gene locus_tag LOCUS_04550 12111 11725 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX33 protein_id gnl|my_center|LOCUS_04550 13361 12147 gene locus_tag LOCUS_04560 gene iscS 13361 12147 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_04560 13883 13392 gene locus_tag LOCUS_04570 13883 13392 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_04570 14828 14049 gene locus_tag LOCUS_04580 gene cysE 14828 14049 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771032.1 protein_id gnl|my_center|LOCUS_04580 15601 14825 gene locus_tag LOCUS_04590 gene trmJ 15601 14825 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_04590 15756 16571 gene locus_tag LOCUS_04600 gene suhB 15756 16571 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 protein_id gnl|my_center|LOCUS_04600 17202 16669 gene locus_tag LOCUS_04610 17202 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_04610 18178 17270 gene locus_tag LOCUS_04620 gene secF 18178 17270 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI2 protein_id gnl|my_center|LOCUS_04620 20059 18191 gene locus_tag LOCUS_04630 gene secD 20059 18191 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_04630 20454 20125 gene locus_tag LOCUS_04640 20454 20125 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_04640 21631 20498 gene locus_tag LOCUS_04650 gene tgt 21631 20498 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_04650 22512 21631 gene locus_tag LOCUS_04660 gene queA 22512 21631 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L6W9 protein_id gnl|my_center|LOCUS_04660 22396 22806 gene locus_tag LOCUS_04670 22396 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 22785 22871 gene locus_tag LOCUS_t00090 22785 22871 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23330 23542 gene locus_tag LOCUS_04680 23330 23542 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 protein_id gnl|my_center|LOCUS_04680 23638 24135 gene locus_tag LOCUS_04690 23638 24135 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_04690 25229 24168 gene locus_tag LOCUS_04700 25229 24168 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_04700 26340 25222 gene locus_tag LOCUS_04710 26340 25222 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence014 1603 302 gene locus_tag LOCUS_04720 gene hflX 1603 302 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_04720 1869 1615 gene locus_tag LOCUS_04730 gene hfq 1869 1615 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_04730 2931 1960 gene locus_tag LOCUS_04740 gene miaA 2931 1960 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_04740 4878 3001 gene locus_tag LOCUS_04750 gene mutL 4878 3001 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_04750 6290 4875 gene locus_tag LOCUS_04760 6290 4875 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266494.1 protein_id gnl|my_center|LOCUS_04760 6775 6305 gene locus_tag LOCUS_04770 6775 6305 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_04770 8253 6763 gene locus_tag LOCUS_04780 8253 6763 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_04780 8326 9396 gene locus_tag LOCUS_04790 gene queG 8326 9396 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_04790 11231 9393 gene locus_tag LOCUS_04800 gene ftsH 11231 9393 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_04800 11628 11332 gene locus_tag LOCUS_04810 11628 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114084.1 protein_id gnl|my_center|LOCUS_04810 12303 11674 gene locus_tag LOCUS_04820 gene ubiX 12303 11674 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_04820 13964 12615 gene locus_tag LOCUS_04830 gene mpl 13964 12615 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_04830 14177 15697 gene locus_tag LOCUS_04840 14177 15697 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 protein_id gnl|my_center|LOCUS_04840 15896 17344 gene locus_tag LOCUS_04850 15896 17344 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_04850 17356 18747 gene locus_tag LOCUS_04860 gene eutB 17356 18747 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_04860 18921 19715 gene locus_tag LOCUS_04870 gene eutC 18921 19715 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX02 protein_id gnl|my_center|LOCUS_04870 20147 20959 gene locus_tag LOCUS_04880 20147 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093244.1 protein_id gnl|my_center|LOCUS_04880 21068 21595 gene locus_tag LOCUS_04890 gene ppa 21068 21595 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_04890 21864 22925 gene locus_tag LOCUS_04900 21864 22925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 22922 23878 gene locus_tag LOCUS_04910 gene prsA 22922 23878 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 protein_id gnl|my_center|LOCUS_04910 23875 24504 gene locus_tag LOCUS_04920 23875 24504 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706796.1 protein_id gnl|my_center|LOCUS_04920 <25037 24526 gene locus_tag LOCUS_04930 <25037 24526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63X23:nicotinate phosphoribosyltransferase >Feature sequence015 3389 1980 gene locus_tag LOCUS_04940 gene cbrB 3389 1980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_04940 6402 3448 gene locus_tag LOCUS_04950 6402 3448 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266662.1 protein_id gnl|my_center|LOCUS_04950 6562 6386 gene locus_tag LOCUS_04960 6562 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_04960 7559 6648 gene locus_tag LOCUS_04970 gene gluQ 7559 6648 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_04970 8058 7612 gene locus_tag LOCUS_04980 gene dksA 8058 7612 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_04980 8246 9418 gene locus_tag LOCUS_04990 8246 9418 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV76 protein_id gnl|my_center|LOCUS_04990 9418 10125 gene locus_tag LOCUS_05000 gene sfsA 9418 10125 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV77 protein_id gnl|my_center|LOCUS_05000 10363 11277 gene locus_tag LOCUS_05010 10363 11277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_05010 11366 12265 gene locus_tag LOCUS_05020 11366 12265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_05020 13158 12439 gene locus_tag LOCUS_05030 13158 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_05030 14178 13234 gene locus_tag LOCUS_05040 14178 13234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388243.1 protein_id gnl|my_center|LOCUS_05040 14932 14366 gene locus_tag LOCUS_05050 14932 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 15240 15632 gene locus_tag LOCUS_05060 15240 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 18425 15642 gene locus_tag LOCUS_05070 gene retS 18425 15642 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_05070 19833 18541 gene locus_tag LOCUS_05080 gene purD 19833 18541 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV8 protein_id gnl|my_center|LOCUS_05080 21658 20054 gene locus_tag LOCUS_05090 gene purH 21658 20054 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_05090 22062 21742 gene locus_tag LOCUS_05100 22062 21742 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN37 protein_id gnl|my_center|LOCUS_05100 23072 22059 gene locus_tag LOCUS_05110 gene dusB 23072 22059 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_05110 24470 23238 gene locus_tag LOCUS_05120 24470 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence016 <1 3190 gene locus_tag LOCUS_05130 <1 3190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2Q2:methionine synthase 3187 3516 gene locus_tag LOCUS_05140 3187 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092770.1 protein_id gnl|my_center|LOCUS_05140 4629 3520 gene locus_tag LOCUS_05150 4629 3520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_05150 4321 4234 gene locus_tag LOCUS_t00100 4321 4234 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5662 4745 gene locus_tag LOCUS_05160 5662 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6007 5759 gene locus_tag LOCUS_05170 6007 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6141 7280 gene locus_tag LOCUS_05180 6141 7280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619360.1 protein_id gnl|my_center|LOCUS_05180 7334 8392 gene locus_tag LOCUS_05190 7334 8392 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q6 protein_id gnl|my_center|LOCUS_05190 8439 9761 gene locus_tag LOCUS_05200 8439 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_05200 9761 10213 gene locus_tag LOCUS_05210 9761 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261145.1 protein_id gnl|my_center|LOCUS_05210 10341 10871 gene locus_tag LOCUS_05220 gene hspC2 10341 10871 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 protein_id gnl|my_center|LOCUS_05220 11079 10858 gene locus_tag LOCUS_05230 11079 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10969 11184 gene locus_tag LOCUS_05240 10969 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_05240 11377 11192 gene locus_tag LOCUS_05250 11377 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11536 13194 gene locus_tag LOCUS_05260 gene cysI 11536 13194 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_05260 13178 13678 gene locus_tag LOCUS_05270 13178 13678 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_05270 13992 15059 gene locus_tag LOCUS_05280 13992 15059 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_05280 15116 15883 gene locus_tag LOCUS_05290 15116 15883 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_05290 16635 15979 gene locus_tag LOCUS_05300 16635 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_05300 16856 17641 gene locus_tag LOCUS_05310 16856 17641 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S1 protein_id gnl|my_center|LOCUS_05310 18445 17609 gene locus_tag LOCUS_05320 gene nudC 18445 17609 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86062 protein_id gnl|my_center|LOCUS_05320 20109 18445 gene locus_tag LOCUS_05330 gene fimL 20109 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_05330 20959 20147 gene locus_tag LOCUS_05340 20959 20147 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_05340 23402 21153 gene locus_tag LOCUS_05350 gene ldcA 23402 21153 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_05350 <24571 23493 gene locus_tag LOCUS_05360 <24571 23493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106469.1:hybrid sensor histidine kinase/response regulator >Feature sequence017 1168 374 gene locus_tag LOCUS_05370 1168 374 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_05370 1578 1192 gene locus_tag LOCUS_05380 gene cheY 1578 1192 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51455 protein_id gnl|my_center|LOCUS_05380 2364 1639 gene locus_tag LOCUS_05390 gene fliA 2364 1639 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV3 protein_id gnl|my_center|LOCUS_05390 3206 2382 gene locus_tag LOCUS_05400 3206 2382 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 protein_id gnl|my_center|LOCUS_05400 4581 3298 gene locus_tag LOCUS_05410 gene flhF 4581 3298 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_05410 6717 4597 gene locus_tag LOCUS_05420 gene flhA 6717 4597 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_05420 6881 7402 gene locus_tag LOCUS_05430 6881 7402 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXB4 protein_id gnl|my_center|LOCUS_05430 8582 7446 gene locus_tag LOCUS_05440 gene flhB 8582 7446 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_05440 9392 8616 gene locus_tag LOCUS_05450 gene fliR 9392 8616 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_05450 9661 9392 gene locus_tag LOCUS_05460 gene fliQ 9661 9392 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_05460 10448 9672 gene locus_tag LOCUS_05470 gene fliP 10448 9672 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W4 protein_id gnl|my_center|LOCUS_05470 10867 10448 gene locus_tag LOCUS_05480 gene fliO 10867 10448 CDS product flagellar protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51467 protein_id gnl|my_center|LOCUS_05480 11349 10870 gene locus_tag LOCUS_05490 gene fliN 11349 10870 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51466 protein_id gnl|my_center|LOCUS_05490 12354 11383 gene locus_tag LOCUS_05500 gene fliM 12354 11383 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_05500 12900 12367 gene locus_tag LOCUS_05510 12900 12367 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_05510 14477 13218 gene locus_tag LOCUS_05520 14477 13218 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_05520 14891 14541 gene locus_tag LOCUS_05530 14891 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_05530 16604 14919 gene locus_tag LOCUS_05540 16604 14919 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_05540 16912 16607 gene locus_tag LOCUS_05550 16912 16607 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_05550 17580 17131 gene locus_tag LOCUS_05560 gene fliJ 17580 17131 CDS product flagellar protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_05560 19002 17644 gene locus_tag LOCUS_05570 gene fliI 19002 17644 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_05570 19765 18992 gene locus_tag LOCUS_05580 19765 18992 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_05580 20789 19773 gene locus_tag LOCUS_05590 gene fliG 20789 19773 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_05590 22566 20782 gene locus_tag LOCUS_05600 gene fliF 22566 20782 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884X8 protein_id gnl|my_center|LOCUS_05600 22909 22580 gene locus_tag LOCUS_05610 gene fliE 22909 22580 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51462 protein_id gnl|my_center|LOCUS_05610 23134 24321 gene locus_tag LOCUS_05620 23134 24321 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence018 1091 1372 gene locus_tag LOCUS_05630 1091 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_05630 1400 2353 gene locus_tag LOCUS_05640 gene thrB 1400 2353 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP1 protein_id gnl|my_center|LOCUS_05640 2530 3903 gene locus_tag LOCUS_05650 2530 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_05650 4725 4027 gene locus_tag LOCUS_05660 gene nrdJb 4725 4027 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_05660 6944 4794 gene locus_tag LOCUS_05670 gene nrdJa 6944 4794 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_05670 7979 7041 gene locus_tag LOCUS_05680 7979 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_05680 8086 8655 gene locus_tag LOCUS_05690 8086 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_05690 9595 8693 gene locus_tag LOCUS_05700 gene spuH 9595 8693 CDS product polyamine transporter PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112939.1 protein_id gnl|my_center|LOCUS_05700 10476 9592 gene locus_tag LOCUS_05710 gene spuG 10476 9592 CDS product polyamine transporter PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121722.1 protein_id gnl|my_center|LOCUS_05710 11639 10488 gene locus_tag LOCUS_05720 gene spuF 11639 10488 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6I9 protein_id gnl|my_center|LOCUS_05720 12836 11751 gene locus_tag LOCUS_05730 12836 11751 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_05730 14129 13032 gene locus_tag LOCUS_05740 gene spuD 14129 13032 CDS product putrescine-binding periplasmic protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J1 protein_id gnl|my_center|LOCUS_05740 15705 14347 gene locus_tag LOCUS_05750 gene spuC 15705 14347 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 protein_id gnl|my_center|LOCUS_05750 17128 15770 gene locus_tag LOCUS_05760 gene spuB 17128 15770 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 protein_id gnl|my_center|LOCUS_05760 17905 17159 gene locus_tag LOCUS_05770 gene spuA 17905 17159 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_05770 18159 19535 gene locus_tag LOCUS_05780 18159 19535 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 protein_id gnl|my_center|LOCUS_05780 19632 20261 gene locus_tag LOCUS_05790 gene aguR 19632 20261 CDS product transcriptional regulator AguR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_05790 20389 21270 gene locus_tag LOCUS_05800 gene aguB 20389 21270 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_05800 21366 22466 gene locus_tag LOCUS_05810 gene aguA 21366 22466 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_05810 22748 22882 gene locus_tag LOCUS_05820 22748 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence019 <1 639 gene locus_tag LOCUS_05830 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYB8:electron transport complex subunit C 794 1822 gene locus_tag LOCUS_05840 794 1822 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_05840 1819 2580 gene locus_tag LOCUS_05850 1819 2580 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_05850 2582 3295 gene locus_tag LOCUS_05860 2582 3295 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_05860 3360 3998 gene locus_tag LOCUS_05870 gene nth 3360 3998 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_05870 4106 4285 gene locus_tag LOCUS_05880 4106 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4713 4321 gene locus_tag LOCUS_05890 gene gloA 4713 4321 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_05890 6016 4799 gene locus_tag LOCUS_05900 gene argG 6016 4799 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_05900 6965 6087 gene locus_tag LOCUS_05910 6965 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_05910 7143 8186 gene locus_tag LOCUS_05920 gene pyrC 7143 8186 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72170 protein_id gnl|my_center|LOCUS_05920 8183 8857 gene locus_tag LOCUS_05930 gene rnt 8183 8857 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_05930 10370 8946 gene locus_tag LOCUS_05940 gene thrC 10370 8946 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_05940 11732 10428 gene locus_tag LOCUS_05950 gene hom 11732 10428 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_05950 12587 11862 gene locus_tag LOCUS_05960 gene dsbC 12587 11862 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_05960 13563 12667 gene locus_tag LOCUS_05970 gene xerD 13563 12667 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_05970 14075 13725 gene locus_tag LOCUS_05980 gene rplS 14075 13725 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_05980 14877 14125 gene locus_tag LOCUS_05990 gene trmD 14877 14125 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ1 protein_id gnl|my_center|LOCUS_05990 15418 14882 gene locus_tag LOCUS_06000 gene rimM 15418 14882 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_06000 15675 15424 gene locus_tag LOCUS_06010 gene rpsP 15675 15424 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_06010 17196 15820 gene locus_tag LOCUS_06020 gene ffh 17196 15820 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP8 protein_id gnl|my_center|LOCUS_06020 17361 18161 gene locus_tag LOCUS_06030 17361 18161 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_06030 18177 19460 gene locus_tag LOCUS_06040 18177 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111904.1 protein_id gnl|my_center|LOCUS_06040 20672 19491 gene locus_tag LOCUS_06050 gene purT 20672 19491 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_06050 20901 20710 gene locus_tag LOCUS_06060 20901 20710 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_06060 21422 20898 gene locus_tag LOCUS_06070 21422 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_06070 22074 21457 gene locus_tag LOCUS_06080 22074 21457 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_06080 22198 22752 gene locus_tag LOCUS_06090 22198 22752 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_06090 22780 23283 gene locus_tag LOCUS_06100 22780 23283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092667.1 protein_id gnl|my_center|LOCUS_06100 23609 23292 gene locus_tag LOCUS_06110 23609 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence020 1243 92 gene locus_tag LOCUS_06120 1243 92 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_06120 2411 1320 gene locus_tag LOCUS_06130 gene aroC 2411 1320 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC2 protein_id gnl|my_center|LOCUS_06130 2552 3517 gene locus_tag LOCUS_06140 2552 3517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 protein_id gnl|my_center|LOCUS_06140 3568 4341 gene locus_tag LOCUS_06150 3568 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087649.1 protein_id gnl|my_center|LOCUS_06150 5267 4338 gene locus_tag LOCUS_06160 gene prmB 5267 4338 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_06160 5499 6095 gene locus_tag LOCUS_06170 5499 6095 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103179.1 protein_id gnl|my_center|LOCUS_06170 6171 6479 gene locus_tag LOCUS_06180 6171 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6539 7105 gene locus_tag LOCUS_06190 6539 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087642.1 protein_id gnl|my_center|LOCUS_06190 7213 7758 gene locus_tag LOCUS_06200 gene folE2 7213 7758 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_06200 8419 7817 gene locus_tag LOCUS_06210 8419 7817 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_06210 9618 8452 gene locus_tag LOCUS_06220 9618 8452 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114606.1 protein_id gnl|my_center|LOCUS_06220 9739 10146 gene locus_tag LOCUS_06230 9739 10146 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097819.1 protein_id gnl|my_center|LOCUS_06230 11908 10226 gene locus_tag LOCUS_06240 gene rpsA 11908 10226 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_06240 12769 12083 gene locus_tag LOCUS_06250 gene cmk 12769 12083 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T2 protein_id gnl|my_center|LOCUS_06250 15006 12766 gene locus_tag LOCUS_06260 gene aroA 15006 12766 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_06260 16112 15003 gene locus_tag LOCUS_06270 gene hisC2 16112 15003 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_06270 17294 16197 gene locus_tag LOCUS_06280 gene pheA 17294 16197 CDS product P-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ67 protein_id gnl|my_center|LOCUS_06280 18457 17294 gene locus_tag LOCUS_06290 gene serC 18457 17294 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_06290 21258 18469 gene locus_tag LOCUS_06300 gene gyrA 21258 18469 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48372 protein_id gnl|my_center|LOCUS_06300 21827 21375 gene locus_tag LOCUS_06310 21827 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 21891 22106 gene locus_tag LOCUS_06320 21891 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 23246 22713 gene locus_tag LOCUS_06330 23246 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence021 2584 2015 gene locus_tag LOCUS_06340 2584 2015 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_06340 3171 2587 gene locus_tag LOCUS_06350 3171 2587 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC0 protein_id gnl|my_center|LOCUS_06350 3373 3795 gene locus_tag LOCUS_06360 3373 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4625 3807 gene locus_tag LOCUS_06370 4625 3807 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_06370 5988 4744 gene locus_tag LOCUS_06380 5988 4744 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 protein_id gnl|my_center|LOCUS_06380 6250 6945 gene locus_tag LOCUS_06390 gene ung 6250 6945 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H9 protein_id gnl|my_center|LOCUS_06390 7476 6961 gene locus_tag LOCUS_06400 7476 6961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 protein_id gnl|my_center|LOCUS_06400 8464 7628 gene locus_tag LOCUS_06410 8464 7628 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_06410 9474 8530 gene locus_tag LOCUS_06420 9474 8530 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_06420 9612 9866 gene locus_tag LOCUS_06430 9612 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_06430 9850 10305 gene locus_tag LOCUS_06440 9850 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268756.1 protein_id gnl|my_center|LOCUS_06440 11890 10274 gene locus_tag LOCUS_06450 gene nadB 11890 10274 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_06450 12217 12798 gene locus_tag LOCUS_06460 gene algU 12217 12798 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_06460 12830 13429 gene locus_tag LOCUS_06470 12830 13429 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405339.1 protein_id gnl|my_center|LOCUS_06470 13487 14383 gene locus_tag LOCUS_06480 gene mucB 13487 14383 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_06480 14380 14862 gene locus_tag LOCUS_06490 gene mucC 14380 14862 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_06490 15424 17223 gene locus_tag LOCUS_06500 gene lepA 15424 17223 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_06500 17225 18079 gene locus_tag LOCUS_06510 gene lepB 17225 18079 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_06510 18170 18547 gene locus_tag LOCUS_06520 18170 18547 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 protein_id gnl|my_center|LOCUS_06520 18544 19233 gene locus_tag LOCUS_06530 gene rnc 18544 19233 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE1 protein_id gnl|my_center|LOCUS_06530 19226 20143 gene locus_tag LOCUS_06540 gene era 19226 20143 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_06540 20191 20880 gene locus_tag LOCUS_06550 gene recO 20191 20880 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_06550 20873 21619 gene locus_tag LOCUS_06560 gene pdxJ 20873 21619 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_06560 21949 21743 gene locus_tag LOCUS_06570 21949 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 protein_id gnl|my_center|LOCUS_06570 22884 21934 gene locus_tag LOCUS_06580 22884 21934 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence022 1710 142 gene locus_tag LOCUS_06590 gene aer-2 1710 142 CDS product aerotaxis receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103804.1 protein_id gnl|my_center|LOCUS_06590 4740 2065 gene locus_tag LOCUS_06600 gene acnA 4740 2065 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F5 protein_id gnl|my_center|LOCUS_06600 4913 5962 gene locus_tag LOCUS_06610 gene rlmM 4913 5962 CDS product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQY7 protein_id gnl|my_center|LOCUS_06610 6025 6273 gene locus_tag LOCUS_06620 gene tusA 6025 6273 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_06620 7114 6287 gene locus_tag LOCUS_06630 7114 6287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_06630 7464 7105 gene locus_tag LOCUS_06640 7464 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9992 7464 gene locus_tag LOCUS_06650 gene qoxA 9992 7464 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_06650 11005 9989 gene locus_tag LOCUS_06660 11005 9989 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975791.1 protein_id gnl|my_center|LOCUS_06660 11081 11545 gene locus_tag LOCUS_06670 11081 11545 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529160.1 protein_id gnl|my_center|LOCUS_06670 12013 11600 gene locus_tag LOCUS_06680 12013 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12993 12106 gene locus_tag LOCUS_06690 12993 12106 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_06690 13151 14146 gene locus_tag LOCUS_06700 gene moaA2 13151 14146 CDS product GTP 3',8-cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3K7 protein_id gnl|my_center|LOCUS_06700 14396 17881 gene locus_tag LOCUS_06710 gene smc 14396 17881 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_06710 18062 18904 gene locus_tag LOCUS_06720 gene zipA 18062 18904 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_06720 19242 21608 gene locus_tag LOCUS_06730 gene ligA 19242 21608 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I4 protein_id gnl|my_center|LOCUS_06730 22039 22335 gene locus_tag LOCUS_06740 22039 22335 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945908.1 protein_id gnl|my_center|LOCUS_06740 22461 23192 gene locus_tag LOCUS_06750 gene tnp 22461 23192 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974621.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence023 1411 686 gene locus_tag LOCUS_06760 gene dnaQ 1411 686 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_06760 1879 1424 gene locus_tag LOCUS_06770 gene rnhA 1879 1424 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YT0 protein_id gnl|my_center|LOCUS_06770 2680 1925 gene locus_tag LOCUS_06780 2680 1925 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_06780 2797 3576 gene locus_tag LOCUS_06790 gene gloB 2797 3576 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_06790 3718 5214 gene locus_tag LOCUS_06800 gene mltD 3718 5214 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_06800 6670 5225 gene locus_tag LOCUS_06810 6670 5225 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_06810 6792 8639 gene locus_tag LOCUS_06820 6792 8639 CDS product solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113590.1 protein_id gnl|my_center|LOCUS_06820 8636 10480 gene locus_tag LOCUS_06830 8636 10480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_06830 10480 11553 gene locus_tag LOCUS_06840 10480 11553 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_06840 11555 12574 gene locus_tag LOCUS_06850 11555 12574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315267.1 protein_id gnl|my_center|LOCUS_06850 12576 14222 gene locus_tag LOCUS_06860 12576 14222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770761.1 protein_id gnl|my_center|LOCUS_06860 14203 14997 gene locus_tag LOCUS_06870 14203 14997 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_06870 16009 15458 gene locus_tag LOCUS_06880 gene saxB 16009 15458 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103735.1 protein_id gnl|my_center|LOCUS_06880 16076 17089 gene locus_tag LOCUS_06890 16076 17089 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 protein_id gnl|my_center|LOCUS_06890 17207 18277 gene locus_tag LOCUS_06900 17207 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_06900 18398 19825 gene locus_tag LOCUS_06910 gene arcD 18398 19825 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 protein_id gnl|my_center|LOCUS_06910 19879 21135 gene locus_tag LOCUS_06920 gene arcA 19879 21135 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13981 protein_id gnl|my_center|LOCUS_06920 21148 22158 gene locus_tag LOCUS_06930 gene arcB 21148 22158 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08308 protein_id gnl|my_center|LOCUS_06930 >Feature sequence024 2303 972 gene locus_tag LOCUS_06940 gene dgt2 2303 972 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG5 protein_id gnl|my_center|LOCUS_06940 2751 2422 gene locus_tag LOCUS_06950 2751 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103249.1 protein_id gnl|my_center|LOCUS_06950 3128 2748 gene locus_tag LOCUS_06960 3128 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091263.1 protein_id gnl|my_center|LOCUS_06960 3541 3140 gene locus_tag LOCUS_06970 3541 3140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373339.1 protein_id gnl|my_center|LOCUS_06970 5109 3856 gene locus_tag LOCUS_06980 5109 3856 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_06980 5491 5727 gene locus_tag LOCUS_06990 5491 5727 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_06990 5908 5832 gene locus_tag LOCUS_t00110 5908 5832 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6238 6020 gene locus_tag LOCUS_07000 6238 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_07000 6893 6294 gene locus_tag LOCUS_07010 gene mobA 6893 6294 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68799 protein_id gnl|my_center|LOCUS_07010 7065 8096 gene locus_tag LOCUS_07020 gene cps1E 7065 8096 CDS product acyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_07020 8315 8142 gene locus_tag LOCUS_07030 8315 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8744 9136 gene locus_tag LOCUS_07040 8744 9136 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839179.1 protein_id gnl|my_center|LOCUS_07040 9133 9477 gene locus_tag LOCUS_07050 9133 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_07050 9513 11021 gene locus_tag LOCUS_07060 9513 11021 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998051.1 protein_id gnl|my_center|LOCUS_07060 11025 11603 gene locus_tag LOCUS_07070 11025 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388104.1 protein_id gnl|my_center|LOCUS_07070 11686 11928 gene locus_tag LOCUS_07080 11686 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 12036 12854 gene locus_tag LOCUS_07090 12036 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_07090 14146 12863 gene locus_tag LOCUS_07100 14146 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_07100 14317 14393 gene locus_tag LOCUS_t00120 14317 14393 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14612 16534 gene locus_tag LOCUS_07110 gene thrS 14612 16534 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I099 protein_id gnl|my_center|LOCUS_07110 16552 17085 gene locus_tag LOCUS_07120 gene infC 16552 17085 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_07120 17145 17339 gene locus_tag LOCUS_07130 gene rpmI 17145 17339 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG5 protein_id gnl|my_center|LOCUS_07130 17367 17723 gene locus_tag LOCUS_07140 gene rplT 17367 17723 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG4 protein_id gnl|my_center|LOCUS_07140 17886 18902 gene locus_tag LOCUS_07150 gene pheS 17886 18902 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_07150 18937 21315 gene locus_tag LOCUS_07160 gene pheT 18937 21315 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H7 protein_id gnl|my_center|LOCUS_07160 21319 21621 gene locus_tag LOCUS_07170 gene ihfA 21319 21621 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_07170 21602 21958 gene locus_tag LOCUS_07180 21602 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_07180 22033 22109 gene locus_tag LOCUS_t00130 22033 22109 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 936 1154 gene locus_tag LOCUS_07190 936 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1287 2105 gene locus_tag LOCUS_07200 1287 2105 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_07200 3363 2176 gene locus_tag LOCUS_07210 3363 2176 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_07210 6071 3465 gene locus_tag LOCUS_07220 6071 3465 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_07220 7277 6150 gene locus_tag LOCUS_07230 gene prpC 7277 6150 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E3 protein_id gnl|my_center|LOCUS_07230 8230 7343 gene locus_tag LOCUS_07240 gene prpB 8230 7343 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_07240 8955 8227 gene locus_tag LOCUS_07250 8955 8227 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_07250 9231 9767 gene locus_tag LOCUS_07260 9231 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267424.1 protein_id gnl|my_center|LOCUS_07260 9773 11296 gene locus_tag LOCUS_07270 9773 11296 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267423.1 protein_id gnl|my_center|LOCUS_07270 11300 12283 gene locus_tag LOCUS_07280 11300 12283 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_07280 12327 13679 gene locus_tag LOCUS_07290 12327 13679 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_07290 14349 13732 gene locus_tag LOCUS_07300 gene thrH 14349 13732 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_07300 14537 15274 gene locus_tag LOCUS_07310 gene cysH 14537 15274 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05927 protein_id gnl|my_center|LOCUS_07310 16253 15279 gene locus_tag LOCUS_07320 gene cysB 16253 15279 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_07320 17348 16392 gene locus_tag LOCUS_07330 17348 16392 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y5 protein_id gnl|my_center|LOCUS_07330 17600 18682 gene locus_tag LOCUS_07340 17600 18682 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_07340 19006 18716 gene locus_tag LOCUS_07350 19006 18716 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382493.1 protein_id gnl|my_center|LOCUS_07350 19352 19633 gene locus_tag LOCUS_07360 gene oprI 19352 19633 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11221 protein_id gnl|my_center|LOCUS_07360 20690 19725 gene locus_tag LOCUS_07370 20690 19725 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_07370 21036 20755 gene locus_tag LOCUS_07380 21036 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090947.1 protein_id gnl|my_center|LOCUS_07380 21722 21117 gene locus_tag LOCUS_07390 21722 21117 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence026 1038 601 gene locus_tag LOCUS_07400 gene trxC 1038 601 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_07400 2392 1115 gene locus_tag LOCUS_07410 gene metY 2392 1115 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_07410 2946 4193 gene locus_tag LOCUS_07420 2946 4193 CDS product putative adenine-specific methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50290 protein_id gnl|my_center|LOCUS_07420 4190 5026 gene locus_tag LOCUS_07430 4190 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 6255 5023 gene locus_tag LOCUS_07440 6255 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 6954 6361 gene locus_tag LOCUS_07450 6954 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07450 7282 6866 gene locus_tag LOCUS_07460 7282 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07460 8118 7321 gene locus_tag LOCUS_07470 8118 7321 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_07470 9611 9168 gene locus_tag LOCUS_07480 9611 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10073 9618 gene locus_tag LOCUS_07490 10073 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_07490 11117 10164 gene locus_tag LOCUS_07500 11117 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11800 11090 gene locus_tag LOCUS_07510 11800 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 12348 11797 gene locus_tag LOCUS_07520 12348 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767203.1 protein_id gnl|my_center|LOCUS_07520 13268 12345 gene locus_tag LOCUS_07530 13268 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767206.1 protein_id gnl|my_center|LOCUS_07530 13783 13265 gene locus_tag LOCUS_07540 13783 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 16141 13796 gene locus_tag LOCUS_07550 16141 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16752 16153 gene locus_tag LOCUS_07560 16752 16153 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767209.1 protein_id gnl|my_center|LOCUS_07560 16871 16749 gene locus_tag LOCUS_07570 16871 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 18036 16864 gene locus_tag LOCUS_07580 18036 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 protein_id gnl|my_center|LOCUS_07580 18350 18033 gene locus_tag LOCUS_07590 18350 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 protein_id gnl|my_center|LOCUS_07590 20356 18347 gene locus_tag LOCUS_07600 20356 18347 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811082.1 protein_id gnl|my_center|LOCUS_07600 20504 20364 gene locus_tag LOCUS_07610 20504 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 20815 20528 gene locus_tag LOCUS_07620 20815 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 21045 20812 gene locus_tag LOCUS_07630 21045 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 21409 21047 gene locus_tag LOCUS_07640 21409 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 21626 21399 gene locus_tag LOCUS_07650 21626 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence027 234 944 gene locus_tag LOCUS_07660 234 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 868 1245 gene locus_tag LOCUS_07670 868 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 1654 3243 gene locus_tag LOCUS_07680 1654 3243 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_07680 5209 3356 gene locus_tag LOCUS_07690 gene ppiD 5209 3356 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_07690 5679 5407 gene locus_tag LOCUS_07700 gene hupB 5679 5407 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_07700 8208 5812 gene locus_tag LOCUS_07710 gene lon 8208 5812 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_07710 9617 8337 gene locus_tag LOCUS_07720 gene clpX 9617 8337 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_07720 10355 9717 gene locus_tag LOCUS_07730 gene clpP1 10355 9717 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U1 protein_id gnl|my_center|LOCUS_07730 11755 10445 gene locus_tag LOCUS_07740 gene tig 11755 10445 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_07740 12866 12036 gene locus_tag LOCUS_07750 gene uppP 12866 12036 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS30 protein_id gnl|my_center|LOCUS_07750 13137 14771 gene locus_tag LOCUS_07760 13137 14771 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267230.1 protein_id gnl|my_center|LOCUS_07760 15112 15381 gene locus_tag LOCUS_07770 15112 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098204.1 protein_id gnl|my_center|LOCUS_07770 15511 15792 gene locus_tag LOCUS_07780 15511 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 15856 16548 gene locus_tag LOCUS_07790 15856 16548 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171029.1 protein_id gnl|my_center|LOCUS_07790 16643 16807 gene locus_tag LOCUS_07800 16643 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 16840 17931 gene locus_tag LOCUS_07810 16840 17931 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_07810 18572 17988 gene locus_tag LOCUS_07820 gene nfuA 18572 17988 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTL7 protein_id gnl|my_center|LOCUS_07820 20941 18668 gene locus_tag LOCUS_07830 gene cti 20941 18668 CDS product cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence028 2058 3509 gene locus_tag LOCUS_07840 2058 3509 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK4 protein_id gnl|my_center|LOCUS_07840 3925 5136 gene locus_tag LOCUS_07850 gene nqrA 3925 5136 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_07850 5140 6351 gene locus_tag LOCUS_07860 gene nqrB 5140 6351 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_07860 6344 7138 gene locus_tag LOCUS_07870 gene nqrC 6344 7138 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_07870 7141 7809 gene locus_tag LOCUS_07880 gene nqrD 7141 7809 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_07880 7809 8417 gene locus_tag LOCUS_07890 gene nqrE 7809 8417 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_07890 8433 9656 gene locus_tag LOCUS_07900 gene nqrF 8433 9656 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_07900 9658 10683 gene locus_tag LOCUS_07910 9658 10683 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL2 protein_id gnl|my_center|LOCUS_07910 10680 10907 gene locus_tag LOCUS_07920 10680 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_07920 11003 12397 gene locus_tag LOCUS_07930 gene sthA 11003 12397 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_07930 13282 12560 gene locus_tag LOCUS_07940 13282 12560 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_07940 13584 13279 gene locus_tag LOCUS_07950 13584 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14161 13589 gene locus_tag LOCUS_07960 14161 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251679.2 protein_id gnl|my_center|LOCUS_07960 14256 15503 gene locus_tag LOCUS_07970 14256 15503 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_07970 15496 16206 gene locus_tag LOCUS_07980 gene lolD 15496 16206 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_07980 16203 17450 gene locus_tag LOCUS_07990 16203 17450 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405690.1 protein_id gnl|my_center|LOCUS_07990 17969 17454 gene locus_tag LOCUS_08000 17969 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_08000 18114 20387 gene locus_tag LOCUS_08010 18114 20387 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_08010 20416 21048 gene locus_tag LOCUS_08020 20416 21048 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_08020 21045 21473 gene locus_tag LOCUS_08030 21045 21473 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence029 <1 691 gene locus_tag LOCUS_08040 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113313.1:1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase 744 2084 gene locus_tag LOCUS_08050 gene benK 744 2084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_08050 2111 3232 gene locus_tag LOCUS_08060 gene catB 2111 3232 CDS product muconate cycloisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_08060 3252 3542 gene locus_tag LOCUS_08070 gene catC 3252 3542 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0X4 protein_id gnl|my_center|LOCUS_08070 3587 4525 gene locus_tag LOCUS_08080 gene catA 3587 4525 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_08080 4665 5894 gene locus_tag LOCUS_08090 gene benE 4665 5894 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_08090 5988 7256 gene locus_tag LOCUS_08100 5988 7256 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115516.1 protein_id gnl|my_center|LOCUS_08100 8426 7326 gene locus_tag LOCUS_08110 8426 7326 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771202.1 protein_id gnl|my_center|LOCUS_08110 9561 8794 gene locus_tag LOCUS_08120 9561 8794 CDS product WecB/TagA/CpsF family glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 protein_id gnl|my_center|LOCUS_08120 10429 9551 gene locus_tag LOCUS_08130 10429 9551 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889298.1 protein_id gnl|my_center|LOCUS_08130 11642 10389 gene locus_tag LOCUS_08140 11642 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12936 11686 gene locus_tag LOCUS_08150 12936 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 14227 12995 gene locus_tag LOCUS_08160 14227 12995 CDS product O-antigen transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228096.1 protein_id gnl|my_center|LOCUS_08160 15417 14230 gene locus_tag LOCUS_08170 15417 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_08170 16506 15436 gene locus_tag LOCUS_08180 gene egl 16506 15436 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 protein_id gnl|my_center|LOCUS_08180 18843 16633 gene locus_tag LOCUS_08190 18843 16633 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104560.1 protein_id gnl|my_center|LOCUS_08190 19297 18860 gene locus_tag LOCUS_08200 19297 18860 CDS product low molecular weight phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268288.1 protein_id gnl|my_center|LOCUS_08200 20882 19449 gene locus_tag LOCUS_08210 20882 19449 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765093.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence030 <1 912 gene locus_tag LOCUS_08220 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948968.1:helicase 963 1727 gene locus_tag LOCUS_08230 963 1727 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_08230 1882 2805 gene locus_tag LOCUS_08240 gene glpF 1882 2805 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51389 protein_id gnl|my_center|LOCUS_08240 2817 4325 gene locus_tag LOCUS_08250 gene glpK2 2817 4325 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51390 protein_id gnl|my_center|LOCUS_08250 4458 5216 gene locus_tag LOCUS_08260 4458 5216 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 protein_id gnl|my_center|LOCUS_08260 5364 6899 gene locus_tag LOCUS_08270 gene glpD 5364 6899 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 protein_id gnl|my_center|LOCUS_08270 7194 6904 gene locus_tag LOCUS_08280 7194 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7418 7191 gene locus_tag LOCUS_08290 7418 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7576 7857 gene locus_tag LOCUS_08300 gene ppiC2 7576 7857 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 protein_id gnl|my_center|LOCUS_08300 8159 7899 gene locus_tag LOCUS_08310 8159 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_08310 9144 8239 gene locus_tag LOCUS_08320 9144 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 9289 9753 gene locus_tag LOCUS_08330 9289 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 10216 9806 gene locus_tag LOCUS_08340 10216 9806 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764200.1 protein_id gnl|my_center|LOCUS_08340 10742 10482 gene locus_tag LOCUS_08350 10742 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119823.1 protein_id gnl|my_center|LOCUS_08350 11689 10874 gene locus_tag LOCUS_08360 11689 10874 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816321.1 protein_id gnl|my_center|LOCUS_08360 13132 11924 gene locus_tag LOCUS_08370 13132 11924 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_08370 14970 13483 gene locus_tag LOCUS_08380 gene dgt 14970 13483 CDS product putative deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4L1 protein_id gnl|my_center|LOCUS_08380 15081 15275 gene locus_tag LOCUS_08390 15081 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 15368 16066 gene locus_tag LOCUS_08400 15368 16066 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS10 protein_id gnl|my_center|LOCUS_08400 16088 16429 gene locus_tag LOCUS_08410 16088 16429 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_08410 16894 16463 gene locus_tag LOCUS_08420 16894 16463 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 protein_id gnl|my_center|LOCUS_08420 17018 17458 gene locus_tag LOCUS_08430 17018 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 19381 17459 gene locus_tag LOCUS_08440 19381 17459 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_08440 19771 19409 gene locus_tag LOCUS_08450 19771 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 19673 20350 gene locus_tag LOCUS_08460 19673 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 20498 20358 gene locus_tag LOCUS_08470 20498 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence031 1758 505 gene locus_tag LOCUS_08480 1758 505 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_08480 2204 1854 gene locus_tag LOCUS_08490 2204 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2495 3343 gene locus_tag LOCUS_08500 gene rsbR 2495 3343 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_08500 3343 3705 gene locus_tag LOCUS_08510 gene rsbS 3343 3705 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_08510 3702 4106 gene locus_tag LOCUS_08520 gene rsbT 3702 4106 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_08520 4097 5110 gene locus_tag LOCUS_08530 4097 5110 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 protein_id gnl|my_center|LOCUS_08530 5103 5957 gene locus_tag LOCUS_08540 5103 5957 CDS product two-component system sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636549.2 protein_id gnl|my_center|LOCUS_08540 5947 7890 gene locus_tag LOCUS_08550 gene cvgSY 5947 7890 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036373.1 protein_id gnl|my_center|LOCUS_08550 9146 8154 gene locus_tag LOCUS_08560 9146 8154 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_08560 10180 9158 gene locus_tag LOCUS_08570 10180 9158 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_08570 10362 11072 gene locus_tag LOCUS_08580 10362 11072 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_08580 11121 11435 gene locus_tag LOCUS_08590 11121 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_08590 11689 11937 gene locus_tag LOCUS_08600 11689 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12121 14244 gene locus_tag LOCUS_08610 gene bfrI 12121 14244 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_08610 14274 14570 gene locus_tag LOCUS_08620 14274 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 14567 16096 gene locus_tag LOCUS_08630 14567 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114194.1 protein_id gnl|my_center|LOCUS_08630 16099 16422 gene locus_tag LOCUS_08640 16099 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 16813 16508 gene locus_tag LOCUS_08650 16813 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08650 17222 17668 gene locus_tag LOCUS_08660 17222 17668 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_08660 17896 20127 gene locus_tag LOCUS_08670 gene katG 17896 20127 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCD1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence032 2262 796 gene locus_tag LOCUS_08680 gene fleQ 2262 796 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_08680 2935 2639 gene locus_tag LOCUS_08690 2935 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082194.1 protein_id gnl|my_center|LOCUS_08690 3298 3047 gene locus_tag LOCUS_08700 3298 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4713 3508 gene locus_tag LOCUS_08710 gene cycH 4713 3508 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_08710 5183 4710 gene locus_tag LOCUS_08720 5183 4710 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_08720 5713 5180 gene locus_tag LOCUS_08730 gene dsbE 5713 5180 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_08730 7688 5715 gene locus_tag LOCUS_08740 gene ccmF 7688 5715 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_08740 8152 7685 gene locus_tag LOCUS_08750 gene ccmE 8152 7685 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_08750 8325 8149 gene locus_tag LOCUS_08760 8325 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9077 8322 gene locus_tag LOCUS_08770 gene ccmC 9077 8322 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_08770 9802 9131 gene locus_tag LOCUS_08780 gene ccmB 9802 9131 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 protein_id gnl|my_center|LOCUS_08780 10434 9799 gene locus_tag LOCUS_08790 gene ccmA 10434 9799 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_08790 10570 12099 gene locus_tag LOCUS_08800 10570 12099 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_08800 12096 12428 gene locus_tag LOCUS_08810 12096 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_08810 12846 12409 gene locus_tag LOCUS_08820 12846 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 13362 12949 gene locus_tag LOCUS_08830 13362 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13845 13366 gene locus_tag LOCUS_08840 gene cheW-2 13845 13366 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_08840 14729 13920 gene locus_tag LOCUS_08850 14729 13920 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_08850 15605 14817 gene locus_tag LOCUS_08860 15605 14817 CDS product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_08860 16506 15691 gene locus_tag LOCUS_08870 gene motD 16506 15691 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_08870 17257 16517 gene locus_tag LOCUS_08880 gene motC 17257 16517 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_08880 18379 17276 gene locus_tag LOCUS_08890 gene cheB1 18379 17276 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_08890 <20241 18424 gene locus_tag LOCUS_08900 <20241 18424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114282.1:chemotaxis protein CheA >Feature sequence033 3308 1377 gene locus_tag LOCUS_08910 gene dnaG 3308 1377 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF2 protein_id gnl|my_center|LOCUS_08910 3663 3448 gene locus_tag LOCUS_08920 gene rpsU 3663 3448 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_08920 3863 4888 gene locus_tag LOCUS_08930 gene tsaD 3863 4888 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_08930 5476 4898 gene locus_tag LOCUS_08940 gene plsY 5476 4898 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A56 protein_id gnl|my_center|LOCUS_08940 5542 5895 gene locus_tag LOCUS_08950 5542 5895 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF6 protein_id gnl|my_center|LOCUS_08950 5886 6440 gene locus_tag LOCUS_08960 5886 6440 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269139.1 protein_id gnl|my_center|LOCUS_08960 7599 6448 gene locus_tag LOCUS_08970 gene cca 7599 6448 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 protein_id gnl|my_center|LOCUS_08970 9255 7711 gene locus_tag LOCUS_08980 9255 7711 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_08980 10538 9252 gene locus_tag LOCUS_08990 10538 9252 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V0 protein_id gnl|my_center|LOCUS_08990 12569 10647 gene locus_tag LOCUS_09000 12569 10647 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_09000 13167 12841 gene locus_tag LOCUS_09010 gene glpE 13167 12841 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG2 protein_id gnl|my_center|LOCUS_09010 13994 13167 gene locus_tag LOCUS_09020 gene apaH 13994 13167 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_09020 14248 13991 gene locus_tag LOCUS_09030 14248 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09030 14374 14249 gene locus_tag LOCUS_09040 14374 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09040 15194 14400 gene locus_tag LOCUS_09050 gene rsmA 15194 14400 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_09050 16298 15309 gene locus_tag LOCUS_09060 gene pdxA1 16298 15309 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_09060 17692 16379 gene locus_tag LOCUS_09070 gene surA 17692 16379 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_09070 <20222 17667 gene locus_tag LOCUS_09080 <20222 17667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZMG8:LPS-assembly protein LptD >Feature sequence034 4533 3667 gene locus_tag LOCUS_09090 gene pilK 4533 3667 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_09090 6637 4589 gene locus_tag LOCUS_09100 gene pilJ 6637 4589 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_09100 7168 6725 gene locus_tag LOCUS_09110 gene pilI 7168 6725 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_09110 7659 7294 gene locus_tag LOCUS_09120 gene pilH 7659 7294 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_09120 8112 7705 gene locus_tag LOCUS_09130 gene pilG 8112 7705 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_09130 8341 9291 gene locus_tag LOCUS_09140 gene gshB 8341 9291 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_09140 9378 10271 gene locus_tag LOCUS_09150 gene tonB3 9378 10271 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_09150 10332 10901 gene locus_tag LOCUS_09160 gene algH 10332 10901 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_09160 10898 11329 gene locus_tag LOCUS_09170 10898 11329 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_09170 11345 11857 gene locus_tag LOCUS_09180 gene pyrR 11345 11857 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_09180 11867 12889 gene locus_tag LOCUS_09190 gene pyrB 11867 12889 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ70 protein_id gnl|my_center|LOCUS_09190 12883 14154 gene locus_tag LOCUS_09200 gene pyrC 12883 14154 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ71 protein_id gnl|my_center|LOCUS_09200 14593 14192 gene locus_tag LOCUS_09210 14593 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_09210 14690 15901 gene locus_tag LOCUS_09220 14690 15901 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 protein_id gnl|my_center|LOCUS_09220 15901 16785 gene locus_tag LOCUS_09230 15901 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104114.1 protein_id gnl|my_center|LOCUS_09230 17896 16751 gene locus_tag LOCUS_09240 gene pilU 17896 16751 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_09240 19007 17973 gene locus_tag LOCUS_09250 gene pilT 19007 17973 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_09250 19172 19762 gene locus_tag LOCUS_09260 19172 19762 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_09260 >Feature sequence035 1003 26 gene locus_tag LOCUS_09270 1003 26 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_09270 1175 1579 gene locus_tag LOCUS_09280 1175 1579 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096328.1 protein_id gnl|my_center|LOCUS_09280 2036 1569 gene locus_tag LOCUS_09290 2036 1569 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266315.1 protein_id gnl|my_center|LOCUS_09290 2198 2368 gene locus_tag LOCUS_09300 2198 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317333.1 protein_id gnl|my_center|LOCUS_09300 2997 2365 gene locus_tag LOCUS_09310 2997 2365 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_09310 3679 3365 gene locus_tag LOCUS_09320 gene zapA 3679 3365 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_09320 3885 3676 gene locus_tag LOCUS_09330 3885 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4004 4558 gene locus_tag LOCUS_09340 4004 4558 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US2 protein_id gnl|my_center|LOCUS_09340 4568 5902 gene locus_tag LOCUS_09350 gene pepP 4568 5902 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_09350 5904 7082 gene locus_tag LOCUS_09360 gene ubiH 5904 7082 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_09360 7144 8364 gene locus_tag LOCUS_09370 7144 8364 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_09370 8462 9463 gene locus_tag LOCUS_09380 8462 9463 CDS product putative binding protein component of ABC iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX3 protein_id gnl|my_center|LOCUS_09380 9575 11185 gene locus_tag LOCUS_09390 9575 11185 CDS product binding-protein-dependent transport system inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_09390 11324 12406 gene locus_tag LOCUS_09400 gene gcvT 11324 12406 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_09400 12470 12856 gene locus_tag LOCUS_09410 gene gcvH2 12470 12856 CDS product glycine cleavage system H protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX6 protein_id gnl|my_center|LOCUS_09410 12910 15786 gene locus_tag LOCUS_09420 gene gcvP2 12910 15786 CDS product glycine dehydrogenase (decarboxylating) 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX7 protein_id gnl|my_center|LOCUS_09420 16611 15961 gene locus_tag LOCUS_09430 gene engB 16611 15961 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT81 protein_id gnl|my_center|LOCUS_09430 16867 17499 gene locus_tag LOCUS_09440 gene cc4 16867 17499 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_09440 17670 18299 gene locus_tag LOCUS_09450 gene dsbA 17670 18299 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_09450 18306 19175 gene locus_tag LOCUS_09460 18306 19175 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence036 364 2451 gene locus_tag LOCUS_09470 364 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_09470 3529 2603 gene locus_tag LOCUS_09480 3529 2603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316999.1 protein_id gnl|my_center|LOCUS_09480 4665 3529 gene locus_tag LOCUS_09490 4665 3529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266763.1 protein_id gnl|my_center|LOCUS_09490 6235 4658 gene locus_tag LOCUS_09500 6235 4658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103450.1 protein_id gnl|my_center|LOCUS_09500 7335 6232 gene locus_tag LOCUS_09510 7335 6232 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103449.1 protein_id gnl|my_center|LOCUS_09510 7747 7361 gene locus_tag LOCUS_09520 7747 7361 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104311.1 protein_id gnl|my_center|LOCUS_09520 8754 7744 gene locus_tag LOCUS_09530 8754 7744 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104312.1 protein_id gnl|my_center|LOCUS_09530 9739 9083 gene locus_tag LOCUS_09540 9739 9083 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268041.1 protein_id gnl|my_center|LOCUS_09540 10504 9773 gene locus_tag LOCUS_09550 10504 9773 CDS product pyrimidine utilization regulatory protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266761.1 protein_id gnl|my_center|LOCUS_09550 10778 11866 gene locus_tag LOCUS_09560 gene rutA 10778 11866 CDS product pyrimidine monooxygenase RutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXR7 protein_id gnl|my_center|LOCUS_09560 11866 12612 gene locus_tag LOCUS_09570 gene rutB 11866 12612 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXR8 protein_id gnl|my_center|LOCUS_09570 12674 13060 gene locus_tag LOCUS_09580 gene rutC 12674 13060 CDS product putative aminoacrylate peracid reductase RutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887X5 protein_id gnl|my_center|LOCUS_09580 13166 13963 gene locus_tag LOCUS_09590 gene rutD 13166 13963 CDS product putative aminoacrylate hydrolase RutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXS0 protein_id gnl|my_center|LOCUS_09590 13976 14566 gene locus_tag LOCUS_09600 13976 14566 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58792 protein_id gnl|my_center|LOCUS_09600 14580 15107 gene locus_tag LOCUS_09610 gene rutF 14580 15107 CDS product FMN reductase (NADH) RutF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D5CE37 protein_id gnl|my_center|LOCUS_09610 16105 15377 gene locus_tag LOCUS_09620 16105 15377 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432251.1 protein_id gnl|my_center|LOCUS_09620 16739 16092 gene locus_tag LOCUS_09630 16739 16092 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105389.1 protein_id gnl|my_center|LOCUS_09630 17404 16739 gene locus_tag LOCUS_09640 17404 16739 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 protein_id gnl|my_center|LOCUS_09640 18217 17432 gene locus_tag LOCUS_09650 18217 17432 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266305.1 protein_id gnl|my_center|LOCUS_09650 18435 19142 gene locus_tag LOCUS_09660 18435 19142 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247319.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence037 1543 326 gene locus_tag LOCUS_09670 1543 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2048 1599 gene locus_tag LOCUS_09680 2048 1599 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I445 protein_id gnl|my_center|LOCUS_09680 2544 2149 gene locus_tag LOCUS_09690 2544 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2925 2632 gene locus_tag LOCUS_09700 2925 2632 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 protein_id gnl|my_center|LOCUS_09700 4046 2922 gene locus_tag LOCUS_09710 gene rnd 4046 2922 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 protein_id gnl|my_center|LOCUS_09710 4279 4004 gene locus_tag LOCUS_09720 4279 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4181 5023 gene locus_tag LOCUS_09730 gene sseA 4181 5023 CDS product putative 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I452 protein_id gnl|my_center|LOCUS_09730 5234 6520 gene locus_tag LOCUS_09740 5234 6520 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103685.1 protein_id gnl|my_center|LOCUS_09740 7110 6565 gene locus_tag LOCUS_09750 7110 6565 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I457 protein_id gnl|my_center|LOCUS_09750 7259 8071 gene locus_tag LOCUS_09760 7259 8071 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 protein_id gnl|my_center|LOCUS_09760 8084 8827 gene locus_tag LOCUS_09770 gene modA 8084 8827 CDS product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_09770 8829 9512 gene locus_tag LOCUS_09780 gene modB 8829 9512 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_09780 9509 10603 gene locus_tag LOCUS_09790 gene modC 9509 10603 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_09790 10763 11569 gene locus_tag LOCUS_09800 10763 11569 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_09800 12099 11578 gene locus_tag LOCUS_09810 12099 11578 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_09810 12817 12179 gene locus_tag LOCUS_09820 12817 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082470.1 protein_id gnl|my_center|LOCUS_09820 13205 12933 gene locus_tag LOCUS_09830 13205 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13341 13216 gene locus_tag LOCUS_09840 gene ybgT 13341 13216 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_09840 14635 13493 gene locus_tag LOCUS_09850 gene cydB 14635 13493 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_09850 16283 14646 gene locus_tag LOCUS_09860 gene cydA 16283 14646 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_09860 16459 16280 gene locus_tag LOCUS_09870 16459 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 17419 16868 gene locus_tag LOCUS_09880 17419 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249561.1 protein_id gnl|my_center|LOCUS_09880 17879 17508 gene locus_tag LOCUS_09890 17879 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 18625 17954 gene locus_tag LOCUS_09900 18625 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence038 53 940 gene locus_tag LOCUS_09910 53 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1100 2815 gene locus_tag LOCUS_09920 gene proS 1100 2815 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_09920 2826 3779 gene locus_tag LOCUS_09930 2826 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102379.1 protein_id gnl|my_center|LOCUS_09930 3791 4363 gene locus_tag LOCUS_09940 3791 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4825 4367 gene locus_tag LOCUS_09950 4825 4367 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_09950 5030 5422 gene locus_tag LOCUS_09960 5030 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109947.1 protein_id gnl|my_center|LOCUS_09960 5611 5423 gene locus_tag LOCUS_09970 5611 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6965 5739 gene locus_tag LOCUS_09980 6965 5739 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_09980 7095 7448 gene locus_tag LOCUS_09990 7095 7448 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_09990 7445 8050 gene locus_tag LOCUS_10000 7445 8050 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_10000 8043 8453 gene locus_tag LOCUS_10010 8043 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_10010 8934 8503 gene locus_tag LOCUS_10020 8934 8503 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_10020 9693 8989 gene locus_tag LOCUS_10030 9693 8989 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_10030 10781 9690 gene locus_tag LOCUS_10040 10781 9690 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_10040 11906 10833 gene locus_tag LOCUS_10050 11906 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112582.1 protein_id gnl|my_center|LOCUS_10050 12184 13242 gene locus_tag LOCUS_10060 gene purM 12184 13242 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y1 protein_id gnl|my_center|LOCUS_10060 13242 13883 gene locus_tag LOCUS_10070 gene purN 13242 13883 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_10070 13892 14602 gene locus_tag LOCUS_10080 13892 14602 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369623.1 protein_id gnl|my_center|LOCUS_10080 14645 15295 gene locus_tag LOCUS_10090 14645 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082099.1 protein_id gnl|my_center|LOCUS_10090 15340 16536 gene locus_tag LOCUS_10100 15340 16536 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_10100 16725 16567 gene locus_tag LOCUS_10110 16725 16567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 16989 16744 gene locus_tag LOCUS_10120 16989 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 17116 17442 gene locus_tag LOCUS_10130 17116 17442 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_10130 17527 17889 gene locus_tag LOCUS_10140 17527 17889 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098619.1 protein_id gnl|my_center|LOCUS_10140 17930 18964 gene locus_tag LOCUS_10150 gene dapD 17930 18964 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_10150 >Feature sequence039 2711 291 gene locus_tag LOCUS_10160 gene gyrB 2711 291 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_10160 3823 2708 gene locus_tag LOCUS_10170 gene recF 3823 2708 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C3 protein_id gnl|my_center|LOCUS_10170 4939 3836 gene locus_tag LOCUS_10180 gene dnaN 4939 3836 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_10180 6417 4966 gene locus_tag LOCUS_10190 gene dnaA 6417 4966 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 protein_id gnl|my_center|LOCUS_10190 7071 7469 gene locus_tag LOCUS_10200 gene rnpA 7071 7469 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TR9 protein_id gnl|my_center|LOCUS_10200 7710 9374 gene locus_tag LOCUS_10210 gene yidC 7710 9374 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_10210 9447 10814 gene locus_tag LOCUS_10220 gene mnmE 9447 10814 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT07 protein_id gnl|my_center|LOCUS_10220 11233 13131 gene locus_tag LOCUS_10230 gene mnmG 11233 13131 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_10230 13128 13778 gene locus_tag LOCUS_10240 gene rsmG 13128 13778 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_10240 13797 14585 gene locus_tag LOCUS_10250 gene soj 13797 14585 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_10250 14595 15467 gene locus_tag LOCUS_10260 gene spoOJ 14595 15467 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_10260 15679 16002 gene locus_tag LOCUS_10270 gene atpI 15679 16002 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT13 protein_id gnl|my_center|LOCUS_10270 16019 16891 gene locus_tag LOCUS_10280 gene atpB 16019 16891 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_10280 16962 17189 gene locus_tag LOCUS_10290 gene atpE 16962 17189 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_10290 17283 17753 gene locus_tag LOCUS_10300 gene atpF 17283 17753 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_10300 17766 18302 gene locus_tag LOCUS_10310 gene atpH 17766 18302 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_10310 >Feature sequence040 623 138 gene locus_tag LOCUS_10320 623 138 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088308.1 protein_id gnl|my_center|LOCUS_10320 831 1715 gene locus_tag LOCUS_10330 831 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_10330 1881 2744 gene locus_tag LOCUS_10340 1881 2744 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU1 protein_id gnl|my_center|LOCUS_10340 3460 2753 gene locus_tag LOCUS_10350 3460 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268648.1 protein_id gnl|my_center|LOCUS_10350 3665 3931 gene locus_tag LOCUS_10360 3665 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_10360 5899 4199 gene locus_tag LOCUS_10370 gene ureC2 5899 4199 CDS product urease subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN06 protein_id gnl|my_center|LOCUS_10370 6306 6001 gene locus_tag LOCUS_10380 gene ureB 6306 6001 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN07 protein_id gnl|my_center|LOCUS_10380 6857 6303 gene locus_tag LOCUS_10390 6857 6303 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269031.1 protein_id gnl|my_center|LOCUS_10390 7171 6869 gene locus_tag LOCUS_10400 gene ureA 7171 6869 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP4 protein_id gnl|my_center|LOCUS_10400 8175 7342 gene locus_tag LOCUS_10410 gene ureD2 8175 7342 CDS product urease accessory protein UreD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN11 protein_id gnl|my_center|LOCUS_10410 11912 8355 gene locus_tag LOCUS_10420 11912 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 12822 12007 gene locus_tag LOCUS_10430 12822 12007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763108.1 protein_id gnl|my_center|LOCUS_10430 13686 12835 gene locus_tag LOCUS_10440 13686 12835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_10440 14762 13683 gene locus_tag LOCUS_10450 14762 13683 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269027.1 protein_id gnl|my_center|LOCUS_10450 16431 14884 gene locus_tag LOCUS_10460 16431 14884 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763115.1 protein_id gnl|my_center|LOCUS_10460 17930 16662 gene locus_tag LOCUS_10470 17930 16662 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_10470 18295 18861 gene locus_tag LOCUS_10480 18295 18861 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_10480 >Feature sequence041 795 349 gene locus_tag LOCUS_10490 795 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114329.1 protein_id gnl|my_center|LOCUS_10490 1038 3644 gene locus_tag LOCUS_10500 gene leuS 1038 3644 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN90 protein_id gnl|my_center|LOCUS_10500 3690 4295 gene locus_tag LOCUS_10510 gene lptE 3690 4295 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX2 protein_id gnl|my_center|LOCUS_10510 4338 5369 gene locus_tag LOCUS_10520 gene holA 4338 5369 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_10520 5459 6754 gene locus_tag LOCUS_10530 5459 6754 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 protein_id gnl|my_center|LOCUS_10530 7160 6816 gene locus_tag LOCUS_10540 7160 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8336 7359 gene locus_tag LOCUS_10550 gene lipA 8336 7359 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_10550 8991 8323 gene locus_tag LOCUS_10560 gene lipB 8991 8323 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VW6 protein_id gnl|my_center|LOCUS_10560 9275 8991 gene locus_tag LOCUS_10570 9275 8991 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_10570 10495 9338 gene locus_tag LOCUS_10580 10495 9338 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268985.1 protein_id gnl|my_center|LOCUS_10580 11524 10544 gene locus_tag LOCUS_10590 gene rlpA 11524 10544 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V6 protein_id gnl|my_center|LOCUS_10590 12534 11521 gene locus_tag LOCUS_10600 gene mltB 12534 11521 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_10600 13694 12549 gene locus_tag LOCUS_10610 gene rodA 13694 12549 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763236.1 protein_id gnl|my_center|LOCUS_10610 15580 13691 gene locus_tag LOCUS_10620 gene pbpA 15580 13691 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10620 16066 15599 gene locus_tag LOCUS_10630 gene rlmH 16066 15599 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_10630 16428 16069 gene locus_tag LOCUS_10640 gene rsfS 16428 16069 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_10640 17087 16443 gene locus_tag LOCUS_10650 gene nadD 17087 16443 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV7 protein_id gnl|my_center|LOCUS_10650 18352 17087 gene locus_tag LOCUS_10660 gene proA 18352 17087 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_10660 >Feature sequence042 1687 143 gene locus_tag LOCUS_10670 gene pckA 1687 143 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_10670 2731 1844 gene locus_tag LOCUS_10680 gene hslO 2731 1844 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_10680 3250 2849 gene locus_tag LOCUS_10690 3250 2849 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_10690 3345 3812 gene locus_tag LOCUS_10700 3345 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768489.1 protein_id gnl|my_center|LOCUS_10700 3809 4714 gene locus_tag LOCUS_10710 gene rimK 3809 4714 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_10710 6044 4725 gene locus_tag LOCUS_10720 gene envZ 6044 4725 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246751.1 protein_id gnl|my_center|LOCUS_10720 6813 6079 gene locus_tag LOCUS_10730 gene amgR 6813 6079 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 protein_id gnl|my_center|LOCUS_10730 7283 6927 gene locus_tag LOCUS_10740 gene dgkA 7283 6927 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_10740 7556 9037 gene locus_tag LOCUS_10750 7556 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 9034 9222 gene locus_tag LOCUS_10760 9034 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 9219 10844 gene locus_tag LOCUS_10770 gene bcsG 9219 10844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 protein_id gnl|my_center|LOCUS_10770 10850 11074 gene locus_tag LOCUS_10780 10850 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 11071 11814 gene locus_tag LOCUS_10790 gene bcsF 11071 11814 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_10790 11807 14395 gene locus_tag LOCUS_10800 gene bcsA 11807 14395 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817395.1 protein_id gnl|my_center|LOCUS_10800 14392 16623 gene locus_tag LOCUS_10810 gene bcsB 14392 16623 CDS product cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z290 protein_id gnl|my_center|LOCUS_10810 >Feature sequence043 1710 880 gene locus_tag LOCUS_10820 1710 880 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114196.1 protein_id gnl|my_center|LOCUS_10820 2437 1802 gene locus_tag LOCUS_10830 2437 1802 CDS product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_10830 2681 3334 gene locus_tag LOCUS_10840 2681 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3331 3714 gene locus_tag LOCUS_10850 gene csgE 3331 3714 CDS product curli production assembly/transport component CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A201 protein_id gnl|my_center|LOCUS_10850 3711 4130 gene locus_tag LOCUS_10860 gene csgF 3711 4130 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262786.1 protein_id gnl|my_center|LOCUS_10860 4153 4989 gene locus_tag LOCUS_10870 gene csgG 4153 4989 CDS product curli production assembly protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 protein_id gnl|my_center|LOCUS_10870 5247 5729 gene locus_tag LOCUS_10880 5247 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5771 7126 gene locus_tag LOCUS_10890 5771 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7484 8272 gene locus_tag LOCUS_10900 7484 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 protein_id gnl|my_center|LOCUS_10900 8452 9123 gene locus_tag LOCUS_10910 8452 9123 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_10910 9217 9663 gene locus_tag LOCUS_10920 9217 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_10920 9698 10231 gene locus_tag LOCUS_10930 9698 10231 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_10930 11173 10232 gene locus_tag LOCUS_10940 11173 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_10940 11338 12546 gene locus_tag LOCUS_10950 11338 12546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705840.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10950 12610 14571 gene locus_tag LOCUS_10960 12610 14571 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_10960 14648 15664 gene locus_tag LOCUS_10970 14648 15664 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705838.1 protein_id gnl|my_center|LOCUS_10970 15669 16715 gene locus_tag LOCUS_10980 15669 16715 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705837.1 protein_id gnl|my_center|LOCUS_10980 16715 17554 gene locus_tag LOCUS_10990 16715 17554 CDS product iron-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705836.1 protein_id gnl|my_center|LOCUS_10990 17551 18501 gene locus_tag LOCUS_11000 17551 18501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence044 <1 623 gene locus_tag LOCUS_11010 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114921.1:hydroxylase large subunit 1925 654 gene locus_tag LOCUS_11020 1925 654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_11020 2349 1945 gene locus_tag LOCUS_11030 2349 1945 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070496.1 protein_id gnl|my_center|LOCUS_11030 2785 2408 gene locus_tag LOCUS_11040 2785 2408 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070495.1 protein_id gnl|my_center|LOCUS_11040 3909 2782 gene locus_tag LOCUS_11050 gene rlmG 3909 2782 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH4 protein_id gnl|my_center|LOCUS_11050 3996 4772 gene locus_tag LOCUS_11060 3996 4772 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110878.1 protein_id gnl|my_center|LOCUS_11060 6350 5013 gene locus_tag LOCUS_11070 gene gdhA 6350 5013 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_11070 7491 6706 gene locus_tag LOCUS_11080 7491 6706 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_11080 7879 7502 gene locus_tag LOCUS_11090 7879 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_11090 8441 7899 gene locus_tag LOCUS_11100 8441 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_11100 10452 8464 gene locus_tag LOCUS_11110 10452 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_11110 12277 10610 gene locus_tag LOCUS_11120 12277 10610 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_11120 12521 13774 gene locus_tag LOCUS_11130 gene glyA2 12521 13774 CDS product serine hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI7 protein_id gnl|my_center|LOCUS_11130 13871 14332 gene locus_tag LOCUS_11140 13871 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_11140 14357 14719 gene locus_tag LOCUS_11150 14357 14719 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI1 protein_id gnl|my_center|LOCUS_11150 16085 14724 gene locus_tag LOCUS_11160 gene radA 16085 14724 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 protein_id gnl|my_center|LOCUS_11160 16201 16635 gene locus_tag LOCUS_11170 16201 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_11170 16965 16696 gene locus_tag LOCUS_11180 16965 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 17186 17602 gene locus_tag LOCUS_11190 gene mscL 17186 17602 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB2 protein_id gnl|my_center|LOCUS_11190 <18512 17660 gene locus_tag LOCUS_11200 <18512 17660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P14532:cytochrome c551 peroxidase >Feature sequence045 2264 24 gene locus_tag LOCUS_11210 gene xcpQ 2264 24 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_11210 2891 2268 gene locus_tag LOCUS_11220 2891 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3112 3187 gene locus_tag LOCUS_t00140 3112 3187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3225 3301 gene locus_tag LOCUS_t00150 3225 3301 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3362 3733 gene locus_tag LOCUS_11230 3362 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4283 3807 gene locus_tag LOCUS_11240 4283 3807 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_11240 4966 4370 gene locus_tag LOCUS_11250 gene ambA 4966 4370 CDS product protein AmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_11250 5222 5034 gene locus_tag LOCUS_11260 5222 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5643 5185 gene locus_tag LOCUS_11270 5643 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6279 8282 gene locus_tag LOCUS_11280 6279 8282 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_11280 8431 8970 gene locus_tag LOCUS_11290 8431 8970 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 protein_id gnl|my_center|LOCUS_11290 9262 10317 gene locus_tag LOCUS_11300 9262 10317 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402184.1 protein_id gnl|my_center|LOCUS_11300 11949 10525 gene locus_tag LOCUS_11310 11949 10525 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_11310 12235 14370 gene locus_tag LOCUS_11320 12235 14370 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11320 14632 15834 gene locus_tag LOCUS_11330 14632 15834 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105544.1 protein_id gnl|my_center|LOCUS_11330 15834 16442 gene locus_tag LOCUS_11340 15834 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence046 1 612 gene locus_tag LOCUS_11350 1 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1313 639 gene locus_tag LOCUS_11360 1313 639 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_11360 1449 2657 gene locus_tag LOCUS_11370 gene coaC 1449 2657 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_11370 2659 3114 gene locus_tag LOCUS_11380 gene dut 2659 3114 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN3 protein_id gnl|my_center|LOCUS_11380 3165 5741 gene locus_tag LOCUS_11390 3165 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5757 6659 gene locus_tag LOCUS_11400 gene argB 5757 6659 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_11400 8195 6720 gene locus_tag LOCUS_11410 8195 6720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 protein_id gnl|my_center|LOCUS_11410 8877 8335 gene locus_tag LOCUS_11420 8877 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_11420 9588 8947 gene locus_tag LOCUS_11430 gene pyrE 9588 8947 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_11430 9673 10452 gene locus_tag LOCUS_11440 gene crc 9673 10452 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_11440 10869 10501 gene locus_tag LOCUS_11450 10869 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_11450 11602 10880 gene locus_tag LOCUS_11460 gene rph 11602 10880 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY6 protein_id gnl|my_center|LOCUS_11460 11750 12613 gene locus_tag LOCUS_11470 11750 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_11470 12662 13282 gene locus_tag LOCUS_11480 gene gmk 12662 13282 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_11480 13403 13666 gene locus_tag LOCUS_11490 gene rpoZ 13403 13666 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_11490 13726 15834 gene locus_tag LOCUS_11500 gene spoT 13726 15834 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_11500 16088 18007 gene locus_tag LOCUS_11510 16088 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence047 <1 996 gene locus_tag LOCUS_11520 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1W4:alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase 1116 4442 gene locus_tag LOCUS_11530 1116 4442 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267720.1 protein_id gnl|my_center|LOCUS_11530 4435 6651 gene locus_tag LOCUS_11540 gene glgB 4435 6651 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881X0 protein_id gnl|my_center|LOCUS_11540 7502 6648 gene locus_tag LOCUS_11550 gene pyrD 7502 6648 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKQ4 protein_id gnl|my_center|LOCUS_11550 8595 7495 gene locus_tag LOCUS_11560 gene serC 8595 7495 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ94 protein_id gnl|my_center|LOCUS_11560 9079 8576 gene locus_tag LOCUS_11570 9079 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 9008 9211 gene locus_tag LOCUS_11580 9008 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 10429 9284 gene locus_tag LOCUS_11590 gene pqqE 10429 9284 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP48 protein_id gnl|my_center|LOCUS_11590 10691 10398 gene locus_tag LOCUS_11600 gene pqqD 10691 10398 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_11600 11226 12746 gene locus_tag LOCUS_11610 gene exaC 11226 12746 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 protein_id gnl|my_center|LOCUS_11610 12973 14091 gene locus_tag LOCUS_11620 12973 14091 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728729.1 protein_id gnl|my_center|LOCUS_11620 14369 15280 gene locus_tag LOCUS_11630 gene pqqB 14369 15280 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C3 protein_id gnl|my_center|LOCUS_11630 15311 16063 gene locus_tag LOCUS_11640 gene pqqC 15311 16063 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_11640 16131 16409 gene locus_tag LOCUS_11650 gene pqqD 16131 16409 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_11650 16381 17535 gene locus_tag LOCUS_11660 gene pqqE 16381 17535 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C0 protein_id gnl|my_center|LOCUS_11660 >Feature sequence048 <1 553 gene locus_tag LOCUS_11670 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HW09:putative 2-dehydropantoate 2-reductase 599 2614 gene locus_tag LOCUS_11680 599 2614 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_11680 2627 3214 gene locus_tag LOCUS_11690 2627 3214 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_11690 3234 4235 gene locus_tag LOCUS_11700 3234 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_11700 5026 4238 gene locus_tag LOCUS_11710 5026 4238 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113660.1 protein_id gnl|my_center|LOCUS_11710 6134 5013 gene locus_tag LOCUS_11720 6134 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063834.1 protein_id gnl|my_center|LOCUS_11720 7912 6347 gene locus_tag LOCUS_11730 gene ahpF 7912 6347 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z2 protein_id gnl|my_center|LOCUS_11730 8585 8022 gene locus_tag LOCUS_11740 gene ahpC 8585 8022 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_11740 9685 8744 gene locus_tag LOCUS_11750 9685 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_11750 10968 9751 gene locus_tag LOCUS_11760 gene argJ 10968 9751 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_11760 13840 11081 gene locus_tag LOCUS_11770 gene secA 13840 11081 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_11770 14016 14471 gene locus_tag LOCUS_11780 14016 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268843.1 protein_id gnl|my_center|LOCUS_11780 14534 14998 gene locus_tag LOCUS_11790 14534 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092973.1 protein_id gnl|my_center|LOCUS_11790 15095 15352 gene locus_tag LOCUS_11800 15095 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_11800 15451 15711 gene locus_tag LOCUS_11810 15451 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 <18095 15793 gene locus_tag LOCUS_11820 <18095 15793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103006.1:transcriptional regulator >Feature sequence049 1351 284 gene locus_tag LOCUS_11830 1351 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_11830 2172 1348 gene locus_tag LOCUS_11840 2172 1348 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_11840 3413 2169 gene locus_tag LOCUS_11850 gene fabF1 3413 2169 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_11850 3815 3579 gene locus_tag LOCUS_11860 gene acpP1 3815 3579 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_11860 4748 4005 gene locus_tag LOCUS_11870 gene fabG 4748 4005 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_11870 5702 4764 gene locus_tag LOCUS_11880 gene fabD 5702 4764 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCZ6 protein_id gnl|my_center|LOCUS_11880 6824 5757 gene locus_tag LOCUS_11890 gene plsX 6824 5757 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN5 protein_id gnl|my_center|LOCUS_11890 7008 6826 gene locus_tag LOCUS_11900 gene rpmF 7008 6826 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN4 protein_id gnl|my_center|LOCUS_11900 7219 7022 gene locus_tag LOCUS_11910 7219 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7142 7645 gene locus_tag LOCUS_11920 7142 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7923 7696 gene locus_tag LOCUS_11930 7923 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7828 8247 gene locus_tag LOCUS_11940 7828 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 9243 8257 gene locus_tag LOCUS_11950 9243 8257 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_11950 9918 9253 gene locus_tag LOCUS_11960 9918 9253 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_11960 10864 9911 gene locus_tag LOCUS_11970 gene rluC 10864 9911 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_11970 11419 14469 gene locus_tag LOCUS_11980 gene rne 11419 14469 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_11980 15587 14568 gene locus_tag LOCUS_11990 gene murB 15587 14568 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 protein_id gnl|my_center|LOCUS_11990 15883 15584 gene locus_tag LOCUS_12000 15883 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16815 16045 gene locus_tag LOCUS_12010 gene kdsB 16815 16045 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_12010 16997 16812 gene locus_tag LOCUS_12020 16997 16812 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_12020 <17685 17044 gene locus_tag LOCUS_12030 <17685 17044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVY9:tetraacyldisaccharide 4'-kinase >Feature sequence050 1252 317 gene locus_tag LOCUS_12040 1252 317 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_12040 2559 1357 gene locus_tag LOCUS_12050 2559 1357 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_12050 3069 3350 gene locus_tag LOCUS_12060 gene ihfB 3069 3350 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T0 protein_id gnl|my_center|LOCUS_12060 3868 3461 gene locus_tag LOCUS_12070 3868 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_12070 6447 4000 gene locus_tag LOCUS_12080 6447 4000 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_12080 6639 7571 gene locus_tag LOCUS_12090 6639 7571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_12090 7568 8347 gene locus_tag LOCUS_12100 7568 8347 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I032 protein_id gnl|my_center|LOCUS_12100 8476 9306 gene locus_tag LOCUS_12110 gene queF 8476 9306 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I037 protein_id gnl|my_center|LOCUS_12110 9630 9364 gene locus_tag LOCUS_12120 9630 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090878.1 protein_id gnl|my_center|LOCUS_12120 9833 10537 gene locus_tag LOCUS_12130 9833 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_12130 10861 10562 gene locus_tag LOCUS_12140 10861 10562 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407020.1 protein_id gnl|my_center|LOCUS_12140 11067 12251 gene locus_tag LOCUS_12150 11067 12251 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_12150 12248 12730 gene locus_tag LOCUS_12160 12248 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_12160 13657 12731 gene locus_tag LOCUS_12170 gene tal 13657 12731 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I047 protein_id gnl|my_center|LOCUS_12170 14719 13781 gene locus_tag LOCUS_12180 gene dusA 14719 13781 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I048 protein_id gnl|my_center|LOCUS_12180 16559 14904 gene locus_tag LOCUS_12190 16559 14904 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_12190 >Feature sequence051 1807 359 gene locus_tag LOCUS_12200 1807 359 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_12200 2881 1964 gene locus_tag LOCUS_12210 2881 1964 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_12210 3341 2937 gene locus_tag LOCUS_12220 gene ectC 3341 2937 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 protein_id gnl|my_center|LOCUS_12220 4629 3352 gene locus_tag LOCUS_12230 gene ectB 4629 3352 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_12230 5159 4626 gene locus_tag LOCUS_12240 gene ectA 5159 4626 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RW2 protein_id gnl|my_center|LOCUS_12240 7143 5701 gene locus_tag LOCUS_12250 gene zwf 7143 5701 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTC7 protein_id gnl|my_center|LOCUS_12250 7302 8165 gene locus_tag LOCUS_12260 7302 8165 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 protein_id gnl|my_center|LOCUS_12260 8318 8533 gene locus_tag LOCUS_12270 8318 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 9437 8478 gene locus_tag LOCUS_12280 9437 8478 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_12280 9664 11079 gene locus_tag LOCUS_12290 9664 11079 CDS product acetyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_12290 11091 12896 gene locus_tag LOCUS_12300 11091 12896 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_12300 13000 13941 gene locus_tag LOCUS_12310 13000 13941 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_12310 13943 14245 gene locus_tag LOCUS_12320 13943 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_12320 14313 15221 gene locus_tag LOCUS_12330 gene glsA 14313 15221 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I387 protein_id gnl|my_center|LOCUS_12330 15299 15997 gene locus_tag LOCUS_12340 15299 15997 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_12340 16997 16008 gene locus_tag LOCUS_12350 gene ansA 16997 16008 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113732.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence052 148 62 gene locus_tag LOCUS_t00160 148 62 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 355 2892 gene locus_tag LOCUS_12360 gene rnr 355 2892 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_12360 2889 3641 gene locus_tag LOCUS_12370 gene rlmB 2889 3641 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_12370 3810 5957 gene locus_tag LOCUS_12380 3810 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6133 6546 gene locus_tag LOCUS_12390 gene rpsF 6133 6546 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK3 protein_id gnl|my_center|LOCUS_12390 6575 6805 gene locus_tag LOCUS_12400 gene rpsR 6575 6805 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_12400 6839 7732 gene locus_tag LOCUS_12410 6839 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_12410 7754 8200 gene locus_tag LOCUS_12420 gene rplI 7754 8200 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_12420 8306 9700 gene locus_tag LOCUS_12430 gene dnaB 8306 9700 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_12430 9930 9703 gene locus_tag LOCUS_12440 9930 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9811 10887 gene locus_tag LOCUS_12450 gene alr 9811 10887 CDS product alanine racemase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN4 protein_id gnl|my_center|LOCUS_12450 12740 10875 gene locus_tag LOCUS_12460 12740 10875 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_12460 12908 15190 gene locus_tag LOCUS_12470 12908 15190 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_12470 <16850 15200 gene locus_tag LOCUS_12480 <16850 15200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUW6:methyl-accepting chemotaxis protein CtpL >Feature sequence053 145 1047 gene locus_tag LOCUS_12490 145 1047 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_12490 3960 1111 gene locus_tag LOCUS_12500 gene rapA 3960 1111 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XS2 protein_id gnl|my_center|LOCUS_12500 4102 4413 gene locus_tag LOCUS_12510 4102 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091664.1 protein_id gnl|my_center|LOCUS_12510 4413 5009 gene locus_tag LOCUS_12520 4413 5009 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_12520 5006 5167 gene locus_tag LOCUS_12530 5006 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268687.1 protein_id gnl|my_center|LOCUS_12530 6081 5611 gene locus_tag LOCUS_12540 6081 5611 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402365.1 protein_id gnl|my_center|LOCUS_12540 6326 8014 gene locus_tag LOCUS_12550 gene fadD2 6326 8014 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_12550 8223 9914 gene locus_tag LOCUS_12560 gene fadD1 8223 9914 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_12560 10112 11797 gene locus_tag LOCUS_12570 10112 11797 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I6 protein_id gnl|my_center|LOCUS_12570 12021 13622 gene locus_tag LOCUS_12580 gene lap 12021 13622 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ8 protein_id gnl|my_center|LOCUS_12580 >Feature sequence054 1899 1521 gene locus_tag LOCUS_tm00010 1899 1521 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2342 2037 gene locus_tag LOCUS_12590 2342 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5368 2519 gene locus_tag LOCUS_12600 5368 2519 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_12600 5949 5365 gene locus_tag LOCUS_12610 5949 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_12610 7493 6033 gene locus_tag LOCUS_12620 7493 6033 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_12620 8398 7490 gene locus_tag LOCUS_12630 8398 7490 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702609.1 protein_id gnl|my_center|LOCUS_12630 10100 8406 gene locus_tag LOCUS_12640 10100 8406 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_12640 10390 11172 gene locus_tag LOCUS_12650 10390 11172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_12650 11679 11197 gene locus_tag LOCUS_12660 gene smpB 11679 11197 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_12660 11859 12293 gene locus_tag LOCUS_12670 gene ratA 11859 12293 CDS product ribosome association toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68560 protein_id gnl|my_center|LOCUS_12670 12286 12615 gene locus_tag LOCUS_12680 12286 12615 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_12680 13382 12678 gene locus_tag LOCUS_12690 13382 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094423.1 protein_id gnl|my_center|LOCUS_12690 13531 14784 gene locus_tag LOCUS_12700 gene roxS 13531 14784 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_12700 14813 15373 gene locus_tag LOCUS_12710 gene roxR 14813 15373 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_12710 15462 16400 gene locus_tag LOCUS_12720 15462 16400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence055 356 1030 gene locus_tag LOCUS_12730 gene rpe 356 1030 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_12730 1027 1728 gene locus_tag LOCUS_12740 gene gph1 1027 1728 CDS product phosphoglycolate phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S586 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 1909 3402 gene locus_tag LOCUS_12750 1909 3402 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_12750 3597 4877 gene locus_tag LOCUS_12760 3597 4877 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706186.1 protein_id gnl|my_center|LOCUS_12760 5498 4905 gene locus_tag LOCUS_12770 5498 4905 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028285.1 protein_id gnl|my_center|LOCUS_12770 5646 6635 gene locus_tag LOCUS_12780 5646 6635 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028284.1 protein_id gnl|my_center|LOCUS_12780 7016 6660 gene locus_tag LOCUS_12790 7016 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 12084 7648 gene locus_tag LOCUS_12800 12084 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 12467 12784 gene locus_tag LOCUS_12810 12467 12784 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888282.1 protein_id gnl|my_center|LOCUS_12810 12784 13242 gene locus_tag LOCUS_12820 12784 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888283.1 protein_id gnl|my_center|LOCUS_12820 13269 13646 gene locus_tag LOCUS_12830 13269 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15179 13662 gene locus_tag LOCUS_12840 15179 13662 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 protein_id gnl|my_center|LOCUS_12840 15545 15195 gene locus_tag LOCUS_12850 15545 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <16425 15542 gene locus_tag LOCUS_12860 <16425 15542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038229.1:integrating conjugative element protein >Feature sequence056 1114 641 gene locus_tag LOCUS_12870 1114 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036063.1 protein_id gnl|my_center|LOCUS_12870 1672 1202 gene locus_tag LOCUS_12880 1672 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2548 1961 gene locus_tag LOCUS_12890 2548 1961 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_12890 3139 4047 gene locus_tag LOCUS_12900 3139 4047 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_12900 5757 4051 gene locus_tag LOCUS_12910 5757 4051 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 protein_id gnl|my_center|LOCUS_12910 5959 6246 gene locus_tag LOCUS_12920 5959 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_12920 6577 8067 gene locus_tag LOCUS_12930 gene mqo2 6577 8067 CDS product putative malate:quinone oxidoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVF1 protein_id gnl|my_center|LOCUS_12930 8334 8149 gene locus_tag LOCUS_12940 8334 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8485 9069 gene locus_tag LOCUS_12950 8485 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094953.1 protein_id gnl|my_center|LOCUS_12950 10485 9124 gene locus_tag LOCUS_12960 10485 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_12960 10797 10627 gene locus_tag LOCUS_12970 10797 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 10836 11096 gene locus_tag LOCUS_12980 10836 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114705.1 protein_id gnl|my_center|LOCUS_12980 12275 11112 gene locus_tag LOCUS_12990 12275 11112 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 protein_id gnl|my_center|LOCUS_12990 12454 12636 gene locus_tag LOCUS_13000 12454 12636 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318204.1 protein_id gnl|my_center|LOCUS_13000 12636 12896 gene locus_tag LOCUS_13010 12636 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719779.1 protein_id gnl|my_center|LOCUS_13010 12904 13524 gene locus_tag LOCUS_13020 12904 13524 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266751.1 protein_id gnl|my_center|LOCUS_13020 13611 14423 gene locus_tag LOCUS_13030 13611 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_13030 14882 14439 gene locus_tag LOCUS_13040 14882 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_13040 15552 14965 gene locus_tag LOCUS_13050 15552 14965 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768799.1 protein_id gnl|my_center|LOCUS_13050 <16343 15816 gene locus_tag LOCUS_13060 <16343 15816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVG4:ribosomal RNA small subunit methyltransferase C >Feature sequence057 642 959 gene locus_tag LOCUS_13070 642 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_13070 1168 2556 gene locus_tag LOCUS_13080 gene cyaB 1168 2556 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_13080 2604 3359 gene locus_tag LOCUS_13090 2604 3359 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_13090 3433 3768 gene locus_tag LOCUS_13100 gene csaA 3433 3768 CDS product molecular chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109191.1 protein_id gnl|my_center|LOCUS_13100 3765 4640 gene locus_tag LOCUS_13110 3765 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_13110 4930 4646 gene locus_tag LOCUS_13120 4930 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_13120 5003 7186 gene locus_tag LOCUS_13130 gene plpD 5003 7186 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_13130 7619 7188 gene locus_tag LOCUS_13140 7619 7188 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 protein_id gnl|my_center|LOCUS_13140 8569 7790 gene locus_tag LOCUS_13150 8569 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 9916 8684 gene locus_tag LOCUS_13160 9916 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 10090 10677 gene locus_tag LOCUS_13170 10090 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_13170 10693 11103 gene locus_tag LOCUS_13180 10693 11103 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 protein_id gnl|my_center|LOCUS_13180 11692 11108 gene locus_tag LOCUS_13190 11692 11108 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_13190 11781 12452 gene locus_tag LOCUS_13200 11781 12452 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_13200 12665 12477 gene locus_tag LOCUS_13210 12665 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 14523 12802 gene locus_tag LOCUS_13220 gene aceK 14523 12802 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_13220 15607 14633 gene locus_tag LOCUS_13230 gene cysK 15607 14633 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0D3 protein_id gnl|my_center|LOCUS_13230 >Feature sequence058 <1 682 gene locus_tag LOCUS_13240 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113324.1:sodium:alanine symporter 752 1252 gene locus_tag LOCUS_13250 gene tpx 752 1252 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 protein_id gnl|my_center|LOCUS_13250 1514 2749 gene locus_tag LOCUS_13260 1514 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4099 2861 gene locus_tag LOCUS_13270 4099 2861 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_13270 4378 6156 gene locus_tag LOCUS_13280 4378 6156 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_13280 7231 6203 gene locus_tag LOCUS_13290 7231 6203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268326.1 protein_id gnl|my_center|LOCUS_13290 8469 7228 gene locus_tag LOCUS_13300 gene clsB 8469 7228 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W0 protein_id gnl|my_center|LOCUS_13300 9266 8466 gene locus_tag LOCUS_13310 9266 8466 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245356.1 protein_id gnl|my_center|LOCUS_13310 10183 9263 gene locus_tag LOCUS_13320 10183 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113650.1 protein_id gnl|my_center|LOCUS_13320 11452 10202 gene locus_tag LOCUS_13330 11452 10202 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088939.1 protein_id gnl|my_center|LOCUS_13330 12701 11784 gene locus_tag LOCUS_13340 12701 11784 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089293.1 protein_id gnl|my_center|LOCUS_13340 12830 13621 gene locus_tag LOCUS_13350 12830 13621 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_13350 13651 13956 gene locus_tag LOCUS_13360 13651 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093387.1 protein_id gnl|my_center|LOCUS_13360 13953 14474 gene locus_tag LOCUS_13370 13953 14474 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 protein_id gnl|my_center|LOCUS_13370 15352 14483 gene locus_tag LOCUS_13380 15352 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_13380 <16181 15530 gene locus_tag LOCUS_13390 <16181 15530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZS41:glycogen operon protein GlgX homolog >Feature sequence059 <1 552 gene locus_tag LOCUS_13400 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZ63:ubiquinone biosynthesis O-methyltransferase 552 1223 gene locus_tag LOCUS_13410 gene gph2 552 1223 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_13410 1257 2000 gene locus_tag LOCUS_13420 1257 2000 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_13420 2199 3134 gene locus_tag LOCUS_13430 2199 3134 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_13430 4266 3163 gene locus_tag LOCUS_13440 gene rluB 4266 3163 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ55 protein_id gnl|my_center|LOCUS_13440 4992 4348 gene locus_tag LOCUS_13450 gene eda-1 4992 4348 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764046.1 protein_id gnl|my_center|LOCUS_13450 5723 5010 gene locus_tag LOCUS_13460 5723 5010 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 protein_id gnl|my_center|LOCUS_13460 7179 5710 gene locus_tag LOCUS_13470 gene zwf 7179 5710 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXE8 protein_id gnl|my_center|LOCUS_13470 8651 7431 gene locus_tag LOCUS_13480 gene lamB 8651 7431 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_13480 9923 8760 gene locus_tag LOCUS_13490 gene gltK 9923 8760 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764049.1 protein_id gnl|my_center|LOCUS_13490 10780 9935 gene locus_tag LOCUS_13500 10780 9935 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615493.1 protein_id gnl|my_center|LOCUS_13500 11681 10773 gene locus_tag LOCUS_13510 11681 10773 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314048.1 protein_id gnl|my_center|LOCUS_13510 13058 11805 gene locus_tag LOCUS_13520 13058 11805 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_13520 14612 13194 gene locus_tag LOCUS_13530 14612 13194 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266832.1 protein_id gnl|my_center|LOCUS_13530 15409 14663 gene locus_tag LOCUS_13540 15409 14663 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764051.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence060 1168 1668 gene locus_tag LOCUS_13550 gene fimT 1168 1668 CDS product type 4 fimbrial biogenesis protein FimT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112829.1 protein_id gnl|my_center|LOCUS_13550 1637 1792 gene locus_tag LOCUS_13560 1637 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1850 2344 gene locus_tag LOCUS_13570 gene fimU 1850 2344 CDS product type 4 fimbrial biogenesis protein FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102598.1 protein_id gnl|my_center|LOCUS_13570 2341 2865 gene locus_tag LOCUS_13580 gene pilV 2341 2865 CDS product type 4 fimbrial biogenesis protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119423.1 protein_id gnl|my_center|LOCUS_13580 2875 3702 gene locus_tag LOCUS_13590 gene pilW 2875 3702 CDS product type 4 fimbrial biogenesis protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119422.1 protein_id gnl|my_center|LOCUS_13590 3699 4217 gene locus_tag LOCUS_13600 gene pilX 3699 4217 CDS product type 4 fimbrial biogenesis protein PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112826.1 protein_id gnl|my_center|LOCUS_13600 4234 9132 gene locus_tag LOCUS_13610 4234 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9129 9566 gene locus_tag LOCUS_13620 gene pilE 9129 9566 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_13620 10579 9635 gene locus_tag LOCUS_13630 gene ispH 10579 9635 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_13630 11067 10630 gene locus_tag LOCUS_13640 11067 10630 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_13640 11563 11060 gene locus_tag LOCUS_13650 gene lspA 11563 11060 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ3 protein_id gnl|my_center|LOCUS_13650 14434 11603 gene locus_tag LOCUS_13660 gene ileS 14434 11603 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM4 protein_id gnl|my_center|LOCUS_13660 15386 14436 gene locus_tag LOCUS_13670 gene ribF 15386 14436 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_13670 >Feature sequence061 1128 337 gene locus_tag LOCUS_13680 1128 337 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H04 protein_id gnl|my_center|LOCUS_13680 1937 1125 gene locus_tag LOCUS_13690 1937 1125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_13690 2965 1934 gene locus_tag LOCUS_13700 2965 1934 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_13700 3449 2940 gene locus_tag LOCUS_13710 3449 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4642 3446 gene locus_tag LOCUS_13720 4642 3446 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706377.1 protein_id gnl|my_center|LOCUS_13720 6952 4781 gene locus_tag LOCUS_13730 6952 4781 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267883.1 protein_id gnl|my_center|LOCUS_13730 7353 7790 gene locus_tag LOCUS_13740 7353 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532046.1 protein_id gnl|my_center|LOCUS_13740 7801 9063 gene locus_tag LOCUS_13750 7801 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9090 9719 gene locus_tag LOCUS_13760 gene eraR 9090 9719 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_13760 10117 12417 gene locus_tag LOCUS_13770 gene fepA 10117 12417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_13770 13794 12469 gene locus_tag LOCUS_13780 13794 12469 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103384.1 protein_id gnl|my_center|LOCUS_13780 14566 13919 gene locus_tag LOCUS_13790 gene wrn 14566 13919 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_13790 15034 14570 gene locus_tag LOCUS_13800 15034 14570 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence062 1605 901 gene locus_tag LOCUS_13810 1605 901 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_13810 1699 2754 gene locus_tag LOCUS_13820 gene bioB 1699 2754 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 protein_id gnl|my_center|LOCUS_13820 2840 4018 gene locus_tag LOCUS_13830 gene bioF 2840 4018 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I617 protein_id gnl|my_center|LOCUS_13830 4011 4736 gene locus_tag LOCUS_13840 4011 4736 CDS product biotin biosynthesis protein BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103332.1 protein_id gnl|my_center|LOCUS_13840 4738 5538 gene locus_tag LOCUS_13850 gene bioC 4738 5538 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB1 protein_id gnl|my_center|LOCUS_13850 5568 6266 gene locus_tag LOCUS_13860 gene bioD 5568 6266 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 protein_id gnl|my_center|LOCUS_13860 6339 6590 gene locus_tag LOCUS_13870 6339 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113246.1 protein_id gnl|my_center|LOCUS_13870 6795 8600 gene locus_tag LOCUS_13880 6795 8600 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_13880 8736 10034 gene locus_tag LOCUS_13890 8736 10034 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 protein_id gnl|my_center|LOCUS_13890 10162 11937 gene locus_tag LOCUS_13900 10162 11937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_13900 12934 12290 gene locus_tag LOCUS_13910 gene msrA 12934 12290 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 protein_id gnl|my_center|LOCUS_13910 <15258 13027 gene locus_tag LOCUS_13920 <15258 13027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114559.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence063 292 921 gene locus_tag LOCUS_13930 292 921 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719783.1 protein_id gnl|my_center|LOCUS_13930 1055 1525 gene locus_tag LOCUS_13940 1055 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719782.1 protein_id gnl|my_center|LOCUS_13940 1579 3834 gene locus_tag LOCUS_13950 1579 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_13950 6757 3923 gene locus_tag LOCUS_13960 6757 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_13960 7443 6754 gene locus_tag LOCUS_13970 7443 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095041.1 protein_id gnl|my_center|LOCUS_13970 8868 7627 gene locus_tag LOCUS_13980 8868 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103378.1 protein_id gnl|my_center|LOCUS_13980 9167 10264 gene locus_tag LOCUS_13990 gene nspC 9167 10264 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG65 protein_id gnl|my_center|LOCUS_13990 10282 11532 gene locus_tag LOCUS_14000 10282 11532 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 protein_id gnl|my_center|LOCUS_14000 11852 13396 gene locus_tag LOCUS_14010 gene leuA 11852 13396 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_14010 13393 14193 gene locus_tag LOCUS_14020 13393 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771509.1 protein_id gnl|my_center|LOCUS_14020 14186 14638 gene locus_tag LOCUS_14030 gene rimI 14186 14638 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB7 protein_id gnl|my_center|LOCUS_14030 >Feature sequence064 488 1570 gene locus_tag LOCUS_14040 gene leuB 488 1570 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_14040 1624 2736 gene locus_tag LOCUS_14050 gene asd 1624 2736 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ3 protein_id gnl|my_center|LOCUS_14050 2944 3942 gene locus_tag LOCUS_14060 gene asd-2 2944 3942 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104739.1 protein_id gnl|my_center|LOCUS_14060 4090 6759 gene locus_tag LOCUS_14070 gene fimV 4090 6759 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_14070 6762 7634 gene locus_tag LOCUS_14080 gene truA 6762 7634 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_14080 7694 8311 gene locus_tag LOCUS_14090 gene trpF 7694 8311 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_14090 8503 9396 gene locus_tag LOCUS_14100 gene accD 8503 9396 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW0 protein_id gnl|my_center|LOCUS_14100 9393 10664 gene locus_tag LOCUS_14110 gene folC 9393 10664 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_14110 10671 11282 gene locus_tag LOCUS_14120 10671 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_14120 11385 11897 gene locus_tag LOCUS_14130 11385 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_14130 11965 13473 gene locus_tag LOCUS_14140 gene purF 11965 13473 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_14140 13507 14718 gene locus_tag LOCUS_14150 gene metZ 13507 14718 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_14150 >Feature sequence065 815 1981 gene locus_tag LOCUS_14160 815 1981 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_14160 2066 2647 gene locus_tag LOCUS_14170 2066 2647 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_14170 4219 2696 gene locus_tag LOCUS_14180 4219 2696 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_14180 4419 5543 gene locus_tag LOCUS_14190 4419 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_14190 5536 6477 gene locus_tag LOCUS_14200 5536 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268798.1 protein_id gnl|my_center|LOCUS_14200 7973 6519 gene locus_tag LOCUS_14210 gene pykA 7973 6519 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 protein_id gnl|my_center|LOCUS_14210 8116 8493 gene locus_tag LOCUS_14220 8116 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120855.1 protein_id gnl|my_center|LOCUS_14220 8524 8946 gene locus_tag LOCUS_14230 8524 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_14230 8995 9405 gene locus_tag LOCUS_14240 8995 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 protein_id gnl|my_center|LOCUS_14240 10780 9413 gene locus_tag LOCUS_14250 10780 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_14250 11789 10773 gene locus_tag LOCUS_14260 11789 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_14260 12955 11786 gene locus_tag LOCUS_14270 12955 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 protein_id gnl|my_center|LOCUS_14270 14469 12952 gene locus_tag LOCUS_14280 14469 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence066 950 153 gene locus_tag LOCUS_14290 950 153 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_14290 1606 959 gene locus_tag LOCUS_14300 1606 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038884.1 protein_id gnl|my_center|LOCUS_14300 2172 1603 gene locus_tag LOCUS_14310 2172 1603 CDS product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038885.1 protein_id gnl|my_center|LOCUS_14310 4644 2371 gene locus_tag LOCUS_14320 4644 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038886.1 protein_id gnl|my_center|LOCUS_14320 5049 4744 gene locus_tag LOCUS_14330 5049 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_14330 6260 5151 gene locus_tag LOCUS_14340 6260 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 6976 6326 gene locus_tag LOCUS_14350 6976 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_14350 7426 7061 gene locus_tag LOCUS_14360 7426 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8127 7516 gene locus_tag LOCUS_14370 8127 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_14370 8734 8183 gene locus_tag LOCUS_14380 8734 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_14380 9443 9078 gene locus_tag LOCUS_14390 9443 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10306 9509 gene locus_tag LOCUS_14400 10306 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038891.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 11313 10597 gene locus_tag LOCUS_14410 11313 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_14410 11956 11564 gene locus_tag LOCUS_14420 11956 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 12219 11983 gene locus_tag LOCUS_14430 12219 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_14430 <14645 12999 gene locus_tag LOCUS_14440 <14645 12999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038895.1:DNA topoisomerase III >Feature sequence067 2888 36 gene locus_tag LOCUS_14450 2888 36 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 protein_id gnl|my_center|LOCUS_14450 3101 5290 gene locus_tag LOCUS_14460 gene uvrD 3101 5290 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_14460 5331 6431 gene locus_tag LOCUS_14470 5331 6431 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_14470 6540 7379 gene locus_tag LOCUS_14480 6540 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 protein_id gnl|my_center|LOCUS_14480 7798 10872 gene locus_tag LOCUS_14490 gene fdnG 7798 10872 CDS product formate dehydrogenase-O major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:8386..8388,aa:Sec) note codon on position 197 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14490 10872 11807 gene locus_tag LOCUS_14500 gene fdnH 10872 11807 CDS product nitrate-inducible formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_14500 11868 12485 gene locus_tag LOCUS_14510 gene fdnI 11868 12485 CDS product nitrate-inducible formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_14510 12596 13513 gene locus_tag LOCUS_14520 gene fdhE 12596 13513 CDS product protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV00 protein_id gnl|my_center|LOCUS_14520 >Feature sequence068 528 139 gene locus_tag LOCUS_14530 gene rbfA 528 139 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_14530 3151 650 gene locus_tag LOCUS_14540 gene infB 3151 650 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_14540 4663 3182 gene locus_tag LOCUS_14550 gene nusA 4663 3182 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ4 protein_id gnl|my_center|LOCUS_14550 5168 4710 gene locus_tag LOCUS_14560 gene rimP 5168 4710 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_14560 5374 5298 gene locus_tag LOCUS_t00170 5374 5298 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5542 5457 gene locus_tag LOCUS_t00180 5542 5457 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5918 5550 gene locus_tag LOCUS_14570 gene secG 5918 5550 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_14570 6678 5923 gene locus_tag LOCUS_14580 gene tpiA 6678 5923 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ1 protein_id gnl|my_center|LOCUS_14580 8077 6743 gene locus_tag LOCUS_14590 gene glmM 8077 6743 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ0 protein_id gnl|my_center|LOCUS_14590 8940 8089 gene locus_tag LOCUS_14600 gene folP 8940 8089 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_14600 10878 8959 gene locus_tag LOCUS_14610 gene ftsH 10878 8959 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_14610 11642 11013 gene locus_tag LOCUS_14620 gene rlmE 11642 11013 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_14620 11723 12034 gene locus_tag LOCUS_14630 11723 12034 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_14630 12435 12049 gene locus_tag LOCUS_14640 12435 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 protein_id gnl|my_center|LOCUS_14640 12931 12455 gene locus_tag LOCUS_14650 gene greA 12931 12455 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_14650 <14556 12928 gene locus_tag LOCUS_14660 <14556 12928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P38100:carbamoyl-phosphate synthase large chain >Feature sequence069 <1 586 gene locus_tag LOCUS_14670 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KGU7:1-deoxy-D-xylulose-5-phosphate synthase 1310 837 gene locus_tag LOCUS_14680 1310 837 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093104.1 protein_id gnl|my_center|LOCUS_14680 1413 2081 gene locus_tag LOCUS_14690 1413 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114321.1 protein_id gnl|my_center|LOCUS_14690 2148 2546 gene locus_tag LOCUS_14700 2148 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_14700 3389 2550 gene locus_tag LOCUS_14710 3389 2550 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_14710 3519 4289 gene locus_tag LOCUS_14720 3519 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093112.1 protein_id gnl|my_center|LOCUS_14720 6396 4261 gene locus_tag LOCUS_14730 6396 4261 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_14730 8364 8762 gene locus_tag LOCUS_14740 8364 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 8752 10392 gene locus_tag LOCUS_14750 8752 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 10533 10850 gene locus_tag LOCUS_14760 10533 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 12219 12923 gene locus_tag LOCUS_14770 12219 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 13190 12990 gene locus_tag LOCUS_14780 13190 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <14510 13430 gene locus_tag LOCUS_14790 <14510 13430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114322.1:ATP-dependent helicase HrpB >Feature sequence070 <1 551 gene locus_tag LOCUS_14800 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87UQ4:transcription termination factor Rho 673 2139 gene locus_tag LOCUS_14810 gene ubiD 673 2139 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV3 protein_id gnl|my_center|LOCUS_14810 2216 3175 gene locus_tag LOCUS_14820 2216 3175 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_14820 3885 3226 gene locus_tag LOCUS_14830 3885 3226 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621218.1 protein_id gnl|my_center|LOCUS_14830 5625 3886 gene locus_tag LOCUS_14840 gene argS 5625 3886 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V03 protein_id gnl|my_center|LOCUS_14840 7946 5724 gene locus_tag LOCUS_14850 gene priA 7946 5724 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_14850 8114 8326 gene locus_tag LOCUS_14860 gene rpmE 8114 8326 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_14860 8344 9135 gene locus_tag LOCUS_14870 8344 9135 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_14870 9295 10560 gene locus_tag LOCUS_14880 9295 10560 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_14880 13113 10702 gene locus_tag LOCUS_14890 gene mrcA 13113 10702 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_14890 >Feature sequence071 1434 97 gene locus_tag LOCUS_14900 1434 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_14900 2287 1565 gene locus_tag LOCUS_14910 gene trmB 2287 1565 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B3 protein_id gnl|my_center|LOCUS_14910 3166 2372 gene locus_tag LOCUS_14920 gene thiG 3166 2372 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_14920 3466 3233 gene locus_tag LOCUS_14930 3466 3233 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_14930 3894 3523 gene locus_tag LOCUS_14940 3894 3523 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_14940 3931 4671 gene locus_tag LOCUS_14950 gene mtgA 3931 4671 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF9 protein_id gnl|my_center|LOCUS_14950 4803 6731 gene locus_tag LOCUS_14960 4803 6731 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266176.1 protein_id gnl|my_center|LOCUS_14960 6864 9422 gene locus_tag LOCUS_14970 6864 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10361 9507 gene locus_tag LOCUS_14980 gene rpoH 10361 9507 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_14980 11499 10477 gene locus_tag LOCUS_14990 11499 10477 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_14990 12167 11496 gene locus_tag LOCUS_15000 12167 11496 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 protein_id gnl|my_center|LOCUS_15000 13426 12164 gene locus_tag LOCUS_15010 gene ftsY 13426 12164 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence072 <1 582 gene locus_tag LOCUS_15020 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZJ3:3-ketoacyl-CoA thiolase 706 933 gene locus_tag LOCUS_15030 706 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_15030 1171 3768 gene locus_tag LOCUS_15040 gene topA 1171 3768 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_15040 3883 4404 gene locus_tag LOCUS_15050 3883 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113979.1 protein_id gnl|my_center|LOCUS_15050 4528 4863 gene locus_tag LOCUS_15060 4528 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5383 4913 gene locus_tag LOCUS_15070 gene sulA 5383 4913 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ8 protein_id gnl|my_center|LOCUS_15070 6006 5398 gene locus_tag LOCUS_15080 gene lexA1 6006 5398 CDS product LexA repressor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB9 protein_id gnl|my_center|LOCUS_15080 6201 6908 gene locus_tag LOCUS_15090 6201 6908 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_15090 6948 7472 gene locus_tag LOCUS_15100 6948 7472 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_15100 7487 8482 gene locus_tag LOCUS_15110 gene nagZ 7487 8482 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK0 protein_id gnl|my_center|LOCUS_15110 8502 9236 gene locus_tag LOCUS_15120 8502 9236 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_15120 9354 9851 gene locus_tag LOCUS_15130 9354 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_15130 10054 10518 gene locus_tag LOCUS_15140 10054 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 10580 13114 gene locus_tag LOCUS_15150 gene quiP 10580 13114 CDS product acyl-homoserine lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U2 protein_id gnl|my_center|LOCUS_15150 >Feature sequence073 1099 14 gene locus_tag LOCUS_15160 1099 14 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_15160 2190 1123 gene locus_tag LOCUS_15170 2190 1123 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_15170 2650 2246 gene locus_tag LOCUS_15180 2650 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268871.1 protein_id gnl|my_center|LOCUS_15180 4206 2758 gene locus_tag LOCUS_15190 gene gatB 4206 2758 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_15190 5669 4218 gene locus_tag LOCUS_15200 gene gatA 5669 4218 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_15200 5971 5684 gene locus_tag LOCUS_15210 gene gatC 5971 5684 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_15210 6258 7295 gene locus_tag LOCUS_15220 gene mreB 6258 7295 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_15220 7431 8372 gene locus_tag LOCUS_15230 gene mreC 7431 8372 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_15230 8369 8854 gene locus_tag LOCUS_15240 gene mreD 8369 8854 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_15240 8974 9564 gene locus_tag LOCUS_15250 8974 9564 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_15250 9595 11100 gene locus_tag LOCUS_15260 gene cafA 9595 11100 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence074 2 265 gene locus_tag LOCUS_15270 2 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 296 2278 gene locus_tag LOCUS_15280 gene mnmC 296 2278 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_15280 2352 2909 gene locus_tag LOCUS_15290 2352 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_15290 3002 3757 gene locus_tag LOCUS_15300 3002 3757 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYE9 protein_id gnl|my_center|LOCUS_15300 3997 3758 gene locus_tag LOCUS_15310 3997 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4091 4945 gene locus_tag LOCUS_15320 4091 4945 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_15320 5437 4949 gene locus_tag LOCUS_15330 5437 4949 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_15330 5600 7372 gene locus_tag LOCUS_15340 gene asnB 5600 7372 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103637.1 protein_id gnl|my_center|LOCUS_15340 7457 9199 gene locus_tag LOCUS_15350 7457 9199 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268627.1 protein_id gnl|my_center|LOCUS_15350 9303 10496 gene locus_tag LOCUS_15360 9303 10496 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402538.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence075 1661 231 gene locus_tag LOCUS_15370 1661 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_15370 3132 1723 gene locus_tag LOCUS_15380 3132 1723 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_15380 3376 3729 gene locus_tag LOCUS_15390 3376 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3726 4418 gene locus_tag LOCUS_15400 3726 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_15400 4512 4727 gene locus_tag LOCUS_15410 4512 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4875 4786 gene locus_tag LOCUS_t00190 4875 4786 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5162 5854 gene locus_tag LOCUS_15420 5162 5854 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_15420 5978 7198 gene locus_tag LOCUS_15430 gene aruC 5978 7198 CDS product succinylornithine transaminase/acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30508 protein_id gnl|my_center|LOCUS_15430 7251 7532 gene locus_tag LOCUS_15440 7251 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085959.1 protein_id gnl|my_center|LOCUS_15440 7905 7543 gene locus_tag LOCUS_15450 7905 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267102.1 protein_id gnl|my_center|LOCUS_15450 10015 7982 gene locus_tag LOCUS_15460 10015 7982 CDS product oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112365.1 protein_id gnl|my_center|LOCUS_15460 10425 12572 gene locus_tag LOCUS_15470 gene fadB 10425 12572 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_15470 >Feature sequence076 1839 430 gene locus_tag LOCUS_15480 gene hldE 1839 430 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF4 protein_id gnl|my_center|LOCUS_15480 3309 1915 gene locus_tag LOCUS_15490 3309 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_15490 4208 3312 gene locus_tag LOCUS_15500 4208 3312 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266468.1 protein_id gnl|my_center|LOCUS_15500 5950 4208 gene locus_tag LOCUS_15510 gene msbA 5950 4208 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_15510 7228 6047 gene locus_tag LOCUS_15520 7228 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7306 8379 gene locus_tag LOCUS_15530 7306 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114898.1 protein_id gnl|my_center|LOCUS_15530 8395 9003 gene locus_tag LOCUS_15540 8395 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_15540 10129 8993 gene locus_tag LOCUS_15550 10129 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11072 10131 gene locus_tag LOCUS_15560 11072 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105261.1 protein_id gnl|my_center|LOCUS_15560 11875 11159 gene locus_tag LOCUS_15570 11875 11159 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105028.1 protein_id gnl|my_center|LOCUS_15570 12993 11872 gene locus_tag LOCUS_15580 12993 11872 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109898.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence077 2721 409 gene locus_tag LOCUS_15590 2721 409 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY72 protein_id gnl|my_center|LOCUS_15590 2879 4441 gene locus_tag LOCUS_15600 2879 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_15600 4514 5317 gene locus_tag LOCUS_15610 4514 5317 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_15610 5321 5590 gene locus_tag LOCUS_15620 5321 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_15620 5690 6487 gene locus_tag LOCUS_15630 gene cbpA 5690 6487 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_15630 7568 6669 gene locus_tag LOCUS_15640 7568 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_15640 7699 8034 gene locus_tag LOCUS_15650 7699 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_15650 8096 9856 gene locus_tag LOCUS_15660 gene dsbD 8096 9856 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_15660 10004 10447 gene locus_tag LOCUS_15670 gene aroQ1 10004 10447 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_15670 10524 10982 gene locus_tag LOCUS_15680 gene accB 10524 10982 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_15680 11000 12349 gene locus_tag LOCUS_15690 gene accC 11000 12349 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_15690 >Feature sequence078 2166 1189 gene locus_tag LOCUS_15700 2166 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 2671 2441 gene locus_tag LOCUS_15710 2671 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111981.1 protein_id gnl|my_center|LOCUS_15710 2980 4518 gene locus_tag LOCUS_15720 2980 4518 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336811.1 protein_id gnl|my_center|LOCUS_15720 4552 6456 gene locus_tag LOCUS_15730 4552 6456 CDS product methoxymalonyl-ACP biosynthesis protein FkbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_15730 6453 6701 gene locus_tag LOCUS_15740 6453 6701 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_15740 6705 7736 gene locus_tag LOCUS_15750 6705 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7851 9803 gene locus_tag LOCUS_15760 7851 9803 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3T9 protein_id gnl|my_center|LOCUS_15760 10569 9811 gene locus_tag LOCUS_15770 gene cobB1 10569 9811 CDS product NAD-dependent protein deacylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4L0 protein_id gnl|my_center|LOCUS_15770 11983 10667 gene locus_tag LOCUS_15780 gene hemN 11983 10667 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_15780 12449 12135 gene locus_tag LOCUS_15790 gene nirM 12449 12135 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 protein_id gnl|my_center|LOCUS_15790 >Feature sequence079 1416 376 gene locus_tag LOCUS_15800 gene amiE 1416 376 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 protein_id gnl|my_center|LOCUS_15800 1885 1538 gene locus_tag LOCUS_15810 1885 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_15810 3194 1965 gene locus_tag LOCUS_15820 gene fmdA 3194 1965 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_15820 3667 3299 gene locus_tag LOCUS_15830 3667 3299 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_15830 4181 3651 gene locus_tag LOCUS_15840 4181 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 protein_id gnl|my_center|LOCUS_15840 4970 4281 gene locus_tag LOCUS_15850 4970 4281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_15850 5884 5126 gene locus_tag LOCUS_15860 5884 5126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_15860 7065 5881 gene locus_tag LOCUS_15870 7065 5881 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_15870 7996 7076 gene locus_tag LOCUS_15880 7996 7076 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104864.1 protein_id gnl|my_center|LOCUS_15880 9242 8073 gene locus_tag LOCUS_15890 9242 8073 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_15890 9127 9450 gene locus_tag LOCUS_15900 9127 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence080 1976 225 gene locus_tag LOCUS_15910 1976 225 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246575.1 protein_id gnl|my_center|LOCUS_15910 3025 2114 gene locus_tag LOCUS_15920 gene rfbD 3025 2114 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056795.1 protein_id gnl|my_center|LOCUS_15920 3567 3022 gene locus_tag LOCUS_15930 gene rfbC-2 3567 3022 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_15930 4436 3564 gene locus_tag LOCUS_15940 gene rfbA 4436 3564 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E7 protein_id gnl|my_center|LOCUS_15940 5506 4433 gene locus_tag LOCUS_15950 5506 4433 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLL0 protein_id gnl|my_center|LOCUS_15950 6849 5722 gene locus_tag LOCUS_15960 6849 5722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_15960 9592 6851 gene locus_tag LOCUS_15970 9592 6851 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_15970 10665 9589 gene locus_tag LOCUS_15980 10665 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_15980 11397 10795 gene locus_tag LOCUS_15990 11397 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_15990 12332 11394 gene locus_tag LOCUS_16000 12332 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_16000 <12891 12333 gene locus_tag LOCUS_16010 <12891 12333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114823.1:ABC transporter ATP-binding protein >Feature sequence081 416 1264 gene locus_tag LOCUS_16020 416 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1279 4716 gene locus_tag LOCUS_16030 1279 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268473.1 protein_id gnl|my_center|LOCUS_16030 5099 5497 gene locus_tag LOCUS_16040 5099 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5587 6354 gene locus_tag LOCUS_16050 5587 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 9031 7076 gene locus_tag LOCUS_16060 9031 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105516.1 protein_id gnl|my_center|LOCUS_16060 9348 9028 gene locus_tag LOCUS_16070 9348 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096910.1 protein_id gnl|my_center|LOCUS_16070 9686 9390 gene locus_tag LOCUS_16080 9686 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096909.1 protein_id gnl|my_center|LOCUS_16080 10098 9781 gene locus_tag LOCUS_16090 10098 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768387.1 protein_id gnl|my_center|LOCUS_16090 10397 10188 gene locus_tag LOCUS_16100 10397 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 11560 10571 gene locus_tag LOCUS_16110 11560 10571 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV78 protein_id gnl|my_center|LOCUS_16110 11656 12543 gene locus_tag LOCUS_16120 11656 12543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence082 22 97 gene locus_tag LOCUS_t00200 22 97 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1046 216 gene locus_tag LOCUS_16130 1046 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16130 1292 1525 gene locus_tag LOCUS_16140 1292 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1738 1565 gene locus_tag LOCUS_16150 1738 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4077 1828 gene locus_tag LOCUS_16160 4077 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_16160 4460 5308 gene locus_tag LOCUS_16170 4460 5308 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_16170 5779 5348 gene locus_tag LOCUS_16180 5779 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_16180 5912 6544 gene locus_tag LOCUS_16190 5912 6544 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268854.1 protein_id gnl|my_center|LOCUS_16190 6610 7971 gene locus_tag LOCUS_16200 gene trpS 6610 7971 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX6 protein_id gnl|my_center|LOCUS_16200 8088 9260 gene locus_tag LOCUS_16210 gene zapE 8088 9260 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_16210 10344 9355 gene locus_tag LOCUS_16220 10344 9355 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 protein_id gnl|my_center|LOCUS_16220 10489 11208 gene locus_tag LOCUS_16230 gene nfi 10489 11208 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A0 protein_id gnl|my_center|LOCUS_16230 11280 11831 gene locus_tag LOCUS_16240 11280 11831 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence083 63 482 gene locus_tag LOCUS_16250 63 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 561 995 gene locus_tag LOCUS_16260 561 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112592.1 protein_id gnl|my_center|LOCUS_16260 995 1399 gene locus_tag LOCUS_16270 995 1399 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103672.1 protein_id gnl|my_center|LOCUS_16270 4995 1642 gene locus_tag LOCUS_16280 4995 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5413 4997 gene locus_tag LOCUS_16290 5413 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6311 5403 gene locus_tag LOCUS_16300 6311 5403 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086312.1 protein_id gnl|my_center|LOCUS_16300 6733 6302 gene locus_tag LOCUS_16310 6733 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 7466 7005 gene locus_tag LOCUS_16320 7466 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 8078 7617 gene locus_tag LOCUS_16330 8078 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 8727 8098 gene locus_tag LOCUS_16340 8727 8098 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_16340 9965 8727 gene locus_tag LOCUS_16350 gene mshG 9965 8727 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_16350 11865 10138 gene locus_tag LOCUS_16360 11865 10138 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence084 1427 600 gene locus_tag LOCUS_16370 gene nadE 1427 600 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUP3 protein_id gnl|my_center|LOCUS_16370 1634 3016 gene locus_tag LOCUS_16380 gene hemN 1634 3016 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_16380 3128 3880 gene locus_tag LOCUS_16390 gene anr 3128 3880 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_16390 3884 4432 gene locus_tag LOCUS_16400 gene apt 3884 4432 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQW4 protein_id gnl|my_center|LOCUS_16400 4451 5068 gene locus_tag LOCUS_16410 gene senC 4451 5068 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_16410 5700 5062 gene locus_tag LOCUS_16420 5700 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6476 5703 gene locus_tag LOCUS_16430 6476 5703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930521.1 protein_id gnl|my_center|LOCUS_16430 7219 6473 gene locus_tag LOCUS_16440 7219 6473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930519.1 protein_id gnl|my_center|LOCUS_16440 8291 7302 gene locus_tag LOCUS_16450 8291 7302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811001.1 protein_id gnl|my_center|LOCUS_16450 9057 8458 gene locus_tag LOCUS_16460 gene recR 9057 8458 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H9 protein_id gnl|my_center|LOCUS_16460 9462 9136 gene locus_tag LOCUS_16470 9462 9136 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_16470 11511 9472 gene locus_tag LOCUS_16480 gene dnaX 11511 9472 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_16480 <12397 11612 gene locus_tag LOCUS_16490 <12397 11612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3W9:erythronate-4-phosphate dehydrogenase >Feature sequence085 3638 561 gene locus_tag LOCUS_16500 3638 561 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_16500 4876 3635 gene locus_tag LOCUS_16510 4876 3635 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267712.1 protein_id gnl|my_center|LOCUS_16510 5114 6580 gene locus_tag LOCUS_16520 5114 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7511 6582 gene locus_tag LOCUS_16530 7511 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8309 7560 gene locus_tag LOCUS_16540 8309 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9249 8341 gene locus_tag LOCUS_16550 9249 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9692 9255 gene locus_tag LOCUS_16560 gene exaB 9692 9255 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_16560 10002 11873 gene locus_tag LOCUS_16570 gene exaA 10002 11873 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4J7 protein_id gnl|my_center|LOCUS_16570 >Feature sequence086 2311 1280 gene locus_tag LOCUS_16580 gene pyrD 2311 1280 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_16580 2624 2403 gene locus_tag LOCUS_16590 2624 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_16590 2792 3715 gene locus_tag LOCUS_16600 2792 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122457.1 protein_id gnl|my_center|LOCUS_16600 8617 3758 gene locus_tag LOCUS_16610 gene gdhB 8617 3758 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_16610 8943 8704 gene locus_tag LOCUS_16620 8943 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 8833 9792 gene locus_tag LOCUS_16630 8833 9792 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_16630 9794 10747 gene locus_tag LOCUS_16640 9794 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_16640 10744 11238 gene locus_tag LOCUS_16650 10744 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104708.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence087 880 116 gene locus_tag LOCUS_16660 880 116 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 protein_id gnl|my_center|LOCUS_16660 1305 877 gene locus_tag LOCUS_16670 1305 877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_16670 2729 1302 gene locus_tag LOCUS_16680 gene phrB 2729 1302 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_16680 3655 2726 gene locus_tag LOCUS_16690 3655 2726 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266744.1 protein_id gnl|my_center|LOCUS_16690 4611 3658 gene locus_tag LOCUS_16700 4611 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 protein_id gnl|my_center|LOCUS_16700 4935 4720 gene locus_tag LOCUS_16710 4935 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_16710 5028 5954 gene locus_tag LOCUS_16720 5028 5954 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_16720 5957 7033 gene locus_tag LOCUS_16730 gene hemH 5957 7033 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU9 protein_id gnl|my_center|LOCUS_16730 8954 7086 gene locus_tag LOCUS_16740 8954 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 9515 9069 gene locus_tag LOCUS_16750 9515 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 10144 9623 gene locus_tag LOCUS_16760 10144 9623 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_16760 11376 10141 gene locus_tag LOCUS_16770 11376 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 11888 11373 gene locus_tag LOCUS_16780 11888 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence088 <1 609 gene locus_tag LOCUS_16790 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNV0:arabinose 5-phosphate isomerase 609 1133 gene locus_tag LOCUS_16800 609 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_16800 1145 1717 gene locus_tag LOCUS_16810 gene lptC 1145 1717 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU3 protein_id gnl|my_center|LOCUS_16810 1704 2249 gene locus_tag LOCUS_16820 gene lptA 1704 2249 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV7 protein_id gnl|my_center|LOCUS_16820 2249 2974 gene locus_tag LOCUS_16830 2249 2974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_16830 3124 4629 gene locus_tag LOCUS_16840 gene rpoN 3124 4629 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_16840 4709 5017 gene locus_tag LOCUS_16850 4709 5017 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_16850 5023 5487 gene locus_tag LOCUS_16860 gene ptsN 5023 5487 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_16860 5626 6480 gene locus_tag LOCUS_16870 5626 6480 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_16870 6495 6767 gene locus_tag LOCUS_16880 gene ptsH 6495 6767 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_16880 8157 6811 gene locus_tag LOCUS_16890 gene pmbA 8157 6811 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 protein_id gnl|my_center|LOCUS_16890 8255 8776 gene locus_tag LOCUS_16900 8255 8776 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_16900 10240 8798 gene locus_tag LOCUS_16910 10240 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_16910 11088 10243 gene locus_tag LOCUS_16920 11088 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_16920 <11964 11148 gene locus_tag LOCUS_16930 <11964 11148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105014.1:TIGR02099 family protein >Feature sequence089 2308 761 gene locus_tag LOCUS_16940 2308 761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 protein_id gnl|my_center|LOCUS_16940 3368 2535 gene locus_tag LOCUS_16950 3368 2535 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_16950 4539 3541 gene locus_tag LOCUS_16960 4539 3541 CDS product DMT multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071683.1 protein_id gnl|my_center|LOCUS_16960 5121 6029 gene locus_tag LOCUS_16970 5121 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 6047 6748 gene locus_tag LOCUS_16980 gene csgA 6047 6748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_16980 6885 7856 gene locus_tag LOCUS_16990 6885 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888546.1 protein_id gnl|my_center|LOCUS_16990 9398 7935 gene locus_tag LOCUS_17000 9398 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9596 10783 gene locus_tag LOCUS_17010 9596 10783 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence090 109 1527 gene locus_tag LOCUS_17020 109 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_17020 1592 2668 gene locus_tag LOCUS_17030 1592 2668 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268824.1 protein_id gnl|my_center|LOCUS_17030 2671 3765 gene locus_tag LOCUS_17040 2671 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102648.1 protein_id gnl|my_center|LOCUS_17040 3844 5466 gene locus_tag LOCUS_17050 3844 5466 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104059.1 protein_id gnl|my_center|LOCUS_17050 5716 5486 gene locus_tag LOCUS_17060 5716 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268826.1 protein_id gnl|my_center|LOCUS_17060 7513 5873 gene locus_tag LOCUS_17070 gene groL 7513 5873 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_17070 7855 7562 gene locus_tag LOCUS_17080 gene groS 7855 7562 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP19 protein_id gnl|my_center|LOCUS_17080 8558 8100 gene locus_tag LOCUS_17090 8558 8100 CDS product phage exclusion suppressor FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_17090 9396 8656 gene locus_tag LOCUS_17100 9396 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_17100 9484 10242 gene locus_tag LOCUS_17110 gene speA 9484 10242 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_17110 11365 10316 gene locus_tag LOCUS_17120 11365 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence091 <1 670 gene locus_tag LOCUS_17130 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816572.1:transcriptional regulator 1405 677 gene locus_tag LOCUS_17140 gene phoU 1405 677 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_17140 2409 1582 gene locus_tag LOCUS_17150 gene pstB 2409 1582 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_17150 4158 2488 gene locus_tag LOCUS_17160 gene pstA 4158 2488 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_17160 6454 4178 gene locus_tag LOCUS_17170 6454 4178 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_17170 7587 6622 gene locus_tag LOCUS_17180 gene pstS 7587 6622 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_17180 7799 8203 gene locus_tag LOCUS_17190 7799 8203 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_17190 9402 8206 gene locus_tag LOCUS_17200 9402 8206 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098203.1 protein_id gnl|my_center|LOCUS_17200 9614 10522 gene locus_tag LOCUS_17210 9614 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_17210 10966 10523 gene locus_tag LOCUS_17220 10966 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 <11703 11112 gene locus_tag LOCUS_17230 <11703 11112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQ57:RecBCD enzyme subunit RecD >Feature sequence092 364 1026 gene locus_tag LOCUS_17240 gene agmR 364 1026 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_17240 3691 1106 gene locus_tag LOCUS_17250 gene ercS' 3691 1106 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 protein_id gnl|my_center|LOCUS_17250 4844 3681 gene locus_tag LOCUS_17260 4844 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_17260 6320 5133 gene locus_tag LOCUS_17270 6320 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_17270 9090 6595 gene locus_tag LOCUS_17280 gene pqqF 9090 6595 CDS product coenzyme PQQ synthesis protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2D2 protein_id gnl|my_center|LOCUS_17280 10123 9170 gene locus_tag LOCUS_17290 10123 9170 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_17290 10490 10218 gene locus_tag LOCUS_17300 10490 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 10710 11270 gene locus_tag LOCUS_17310 gene folE 10710 11270 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXP6 protein_id gnl|my_center|LOCUS_17310 >Feature sequence093 <1 1782 gene locus_tag LOCUS_17320 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000605997.1:choline transporter 2018 2791 gene locus_tag LOCUS_17330 2018 2791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096153.1 protein_id gnl|my_center|LOCUS_17330 2807 3562 gene locus_tag LOCUS_17340 2807 3562 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_17340 3678 4373 gene locus_tag LOCUS_17350 3678 4373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 protein_id gnl|my_center|LOCUS_17350 4370 5059 gene locus_tag LOCUS_17360 4370 5059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 protein_id gnl|my_center|LOCUS_17360 5173 6075 gene locus_tag LOCUS_17370 5173 6075 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269392.1 protein_id gnl|my_center|LOCUS_17370 6424 7986 gene locus_tag LOCUS_17380 6424 7986 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105494.1 protein_id gnl|my_center|LOCUS_17380 8019 8525 gene locus_tag LOCUS_17390 8019 8525 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 protein_id gnl|my_center|LOCUS_17390 8552 10030 gene locus_tag LOCUS_17400 8552 10030 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105492.1 protein_id gnl|my_center|LOCUS_17400 10035 10442 gene locus_tag LOCUS_17410 10035 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097809.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence094 1640 984 gene locus_tag LOCUS_17420 1640 984 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_17420 2265 5231 gene locus_tag LOCUS_17430 2265 5231 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 protein_id gnl|my_center|LOCUS_17430 5231 5716 gene locus_tag LOCUS_17440 5231 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037793.1 protein_id gnl|my_center|LOCUS_17440 6020 6685 gene locus_tag LOCUS_17450 6020 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_17450 7691 6696 gene locus_tag LOCUS_17460 gene cysA 7691 6696 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6L0 protein_id gnl|my_center|LOCUS_17460 8563 7688 gene locus_tag LOCUS_17470 gene cysW 8563 7688 CDS product sulfate transporter CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084239.1 protein_id gnl|my_center|LOCUS_17470 9392 8574 gene locus_tag LOCUS_17480 gene cysT 9392 8574 CDS product sulfate transporter CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084241.1 protein_id gnl|my_center|LOCUS_17480 10555 9557 gene locus_tag LOCUS_17490 gene sbp 10555 9557 CDS product sulfate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_17490 10997 10818 gene locus_tag LOCUS_17500 10997 10818 CDS product DUF2292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084246.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence095 1203 1574 gene locus_tag LOCUS_17510 1203 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095286.1 protein_id gnl|my_center|LOCUS_17510 1571 2035 gene locus_tag LOCUS_17520 1571 2035 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102267.1 protein_id gnl|my_center|LOCUS_17520 2137 2042 gene locus_tag LOCUS_t00210 2137 2042 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2775 2146 gene locus_tag LOCUS_17530 2775 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2936 2772 gene locus_tag LOCUS_17540 2936 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3317 3544 gene locus_tag LOCUS_17550 3317 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3812 5167 gene locus_tag LOCUS_17560 3812 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6110 5481 gene locus_tag LOCUS_17570 gene acrR 6110 5481 CDS product DNA-binding transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 protein_id gnl|my_center|LOCUS_17570 7296 6226 gene locus_tag LOCUS_17580 7296 6226 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706453.1 protein_id gnl|my_center|LOCUS_17580 8672 7308 gene locus_tag LOCUS_17590 8672 7308 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_17590 8811 9830 gene locus_tag LOCUS_17600 8811 9830 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHN5 protein_id gnl|my_center|LOCUS_17600 10689 9850 gene locus_tag LOCUS_17610 10689 9850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392005.1 protein_id gnl|my_center|LOCUS_17610 <11491 10686 gene locus_tag LOCUS_17620 <11491 10686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140177.1:ABC transporter permease >Feature sequence096 826 200 gene locus_tag LOCUS_17630 826 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1603 926 gene locus_tag LOCUS_17640 1603 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1817 2782 gene locus_tag LOCUS_17650 gene int 1817 2782 CDS product integrase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62592 protein_id gnl|my_center|LOCUS_17650 4790 2970 gene locus_tag LOCUS_17660 gene typA 4790 2970 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_17660 6396 4912 gene locus_tag LOCUS_17670 gene thiI 6396 4912 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_17670 6741 8147 gene locus_tag LOCUS_17680 6741 8147 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLX8 protein_id gnl|my_center|LOCUS_17680 8346 8879 gene locus_tag LOCUS_17690 8346 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096024.1 protein_id gnl|my_center|LOCUS_17690 8882 9499 gene locus_tag LOCUS_17700 8882 9499 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_17700 9668 10750 gene locus_tag LOCUS_17710 9668 10750 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence097 490 98 gene locus_tag LOCUS_17720 490 98 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_17720 1112 633 gene locus_tag LOCUS_17730 1112 633 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_17730 2069 1422 gene locus_tag LOCUS_17740 gene coq7 2069 1422 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_17740 2461 2120 gene locus_tag LOCUS_17750 2461 2120 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_17750 2541 4019 gene locus_tag LOCUS_17760 2541 4019 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_17760 4924 4025 gene locus_tag LOCUS_17770 4924 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113171.1 protein_id gnl|my_center|LOCUS_17770 5386 4958 gene locus_tag LOCUS_17780 5386 4958 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_17780 5521 6555 gene locus_tag LOCUS_17790 gene argC 5521 6555 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_17790 6668 7018 gene locus_tag LOCUS_17800 gene erpA 6668 7018 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_17800 8158 7067 gene locus_tag LOCUS_17810 gene anmK 8158 7067 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q5 protein_id gnl|my_center|LOCUS_17810 9549 8161 gene locus_tag LOCUS_17820 9549 8161 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_17820 9776 10924 gene locus_tag LOCUS_17830 gene tyrS2 9776 10924 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q3 protein_id gnl|my_center|LOCUS_17830 >Feature sequence098 <1 657 gene locus_tag LOCUS_17840 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113607.1:AraC family transcriptional regulator 737 1921 gene locus_tag LOCUS_17850 737 1921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113605.1 protein_id gnl|my_center|LOCUS_17850 2329 3732 gene locus_tag LOCUS_17860 2329 3732 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_17860 3861 4640 gene locus_tag LOCUS_17870 gene anr 3861 4640 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_17870 5625 4687 gene locus_tag LOCUS_17880 gene fdhE 5625 4687 CDS product protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV00 protein_id gnl|my_center|LOCUS_17880 6326 5622 gene locus_tag LOCUS_17890 gene fdoI 6326 5622 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_17890 7261 6323 gene locus_tag LOCUS_17900 gene fdnH 7261 6323 CDS product nitrate-inducible formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_17900 10340 7275 gene locus_tag LOCUS_17910 gene fdnG 10340 7275 CDS product formate dehydrogenase-O major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:complement(9747..9749),aa:Sec) note codon on position 198 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17910 11368 10448 gene locus_tag LOCUS_17920 11368 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence099 2238 658 gene locus_tag LOCUS_17930 2238 658 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QK7 protein_id gnl|my_center|LOCUS_17930 2412 3686 gene locus_tag LOCUS_17940 gene nhaP 2412 3686 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_17940 5093 3693 gene locus_tag LOCUS_17950 5093 3693 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113503.1 protein_id gnl|my_center|LOCUS_17950 6484 5144 gene locus_tag LOCUS_17960 gene atoE 6484 5144 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490027.1 protein_id gnl|my_center|LOCUS_17960 6591 7019 gene locus_tag LOCUS_17970 6591 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 8955 7045 gene locus_tag LOCUS_17980 8955 7045 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 protein_id gnl|my_center|LOCUS_17980 9565 9098 gene locus_tag LOCUS_17990 9565 9098 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence100 <1 1494 gene locus_tag LOCUS_18000 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUF4:glutamate-ammonia-ligase adenylyltransferase 1545 2468 gene locus_tag LOCUS_18010 gene ilvE 1545 2468 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_18010 2553 3587 gene locus_tag LOCUS_18020 gene waaF 2553 3587 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_18020 3588 4586 gene locus_tag LOCUS_18030 gene waaC 3588 4586 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_18030 4586 5707 gene locus_tag LOCUS_18040 gene waaG 4586 5707 CDS product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_18040 5838 6644 gene locus_tag LOCUS_18050 gene rfaP 5838 6644 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 protein_id gnl|my_center|LOCUS_18050 6644 7378 gene locus_tag LOCUS_18060 6644 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_18060 7380 8123 gene locus_tag LOCUS_18070 7380 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_18070 8120 9544 gene locus_tag LOCUS_18080 8120 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence101 1490 351 gene locus_tag LOCUS_18090 1490 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113608.1 protein_id gnl|my_center|LOCUS_18090 3032 1590 gene locus_tag LOCUS_18100 3032 1590 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113609.1 protein_id gnl|my_center|LOCUS_18100 4394 3258 gene locus_tag LOCUS_18110 4394 3258 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_18110 5147 4404 gene locus_tag LOCUS_18120 5147 4404 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230777.1 protein_id gnl|my_center|LOCUS_18120 6429 5239 gene locus_tag LOCUS_18130 6429 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_18130 7693 6662 gene locus_tag LOCUS_18140 7693 6662 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194381.1 protein_id gnl|my_center|LOCUS_18140 8194 8009 gene locus_tag LOCUS_18150 8194 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 8814 8221 gene locus_tag LOCUS_18160 gene nosL 8814 8221 CDS product acessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_18160 9657 8830 gene locus_tag LOCUS_18170 gene nosY 9657 8830 CDS product membrane protein NosY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYK9 protein_id gnl|my_center|LOCUS_18170 10580 9654 gene locus_tag LOCUS_18180 gene nosF 10580 9654 CDS product copper ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_18180 <11260 10577 gene locus_tag LOCUS_18190 <11260 10577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYL1:copper-binding periplasmic protein >Feature sequence102 874 629 gene locus_tag LOCUS_18200 874 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1064 780 gene locus_tag LOCUS_18210 1064 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1138 1800 gene locus_tag LOCUS_18220 1138 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1934 2446 gene locus_tag LOCUS_18230 1934 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2450 2890 gene locus_tag LOCUS_18240 2450 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3005 3202 gene locus_tag LOCUS_18250 3005 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3199 4254 gene locus_tag LOCUS_18260 3199 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4266 4541 gene locus_tag LOCUS_18270 4266 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4538 4936 gene locus_tag LOCUS_18280 4538 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4933 5196 gene locus_tag LOCUS_18290 4933 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5217 5564 gene locus_tag LOCUS_18300 5217 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553171.1 protein_id gnl|my_center|LOCUS_18300 5603 6415 gene locus_tag LOCUS_18310 5603 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268024.1 protein_id gnl|my_center|LOCUS_18310 6480 6983 gene locus_tag LOCUS_18320 6480 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6994 7596 gene locus_tag LOCUS_18330 6994 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7589 8338 gene locus_tag LOCUS_18340 7589 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8345 8656 gene locus_tag LOCUS_18350 8345 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 8643 8843 gene locus_tag LOCUS_18360 8643 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 10046 8847 gene locus_tag LOCUS_18370 10046 8847 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence103 330 1070 gene locus_tag LOCUS_18380 330 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110110.1 protein_id gnl|my_center|LOCUS_18380 1147 1698 gene locus_tag LOCUS_18390 1147 1698 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_18390 2000 4045 gene locus_tag LOCUS_18400 2000 4045 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_18400 4321 5589 gene locus_tag LOCUS_18410 gene oprB 4321 5589 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887J6 protein_id gnl|my_center|LOCUS_18410 7100 5685 gene locus_tag LOCUS_18420 7100 5685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_18420 8161 7163 gene locus_tag LOCUS_18430 8161 7163 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_18430 8358 9263 gene locus_tag LOCUS_18440 8358 9263 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975422.1 protein_id gnl|my_center|LOCUS_18440 9930 9316 gene locus_tag LOCUS_18450 gene thrH 9930 9316 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_18450 10562 9945 gene locus_tag LOCUS_18460 10562 9945 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707553.1 protein_id gnl|my_center|LOCUS_18460 10823 10611 gene locus_tag LOCUS_18470 10823 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence104 2 1096 gene locus_tag LOCUS_18480 2 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1770 1144 gene locus_tag LOCUS_18490 1770 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038252.1 protein_id gnl|my_center|LOCUS_18490 1874 2173 gene locus_tag LOCUS_18500 1874 2173 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 protein_id gnl|my_center|LOCUS_18500 4050 2200 gene locus_tag LOCUS_18510 4050 2200 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_18510 5173 4253 gene locus_tag LOCUS_18520 5173 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_18520 5924 5166 gene locus_tag LOCUS_18530 5924 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038853.1 protein_id gnl|my_center|LOCUS_18530 6148 6522 gene locus_tag LOCUS_18540 6148 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038854.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18540 8062 6539 gene locus_tag LOCUS_18550 8062 6539 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038855.1 protein_id gnl|my_center|LOCUS_18550 8431 8078 gene locus_tag LOCUS_18560 8431 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 9834 8428 gene locus_tag LOCUS_18570 9834 8428 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_18570 10789 9845 gene locus_tag LOCUS_18580 10789 9845 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence105 1629 511 gene locus_tag LOCUS_18590 1629 511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887493.1 protein_id gnl|my_center|LOCUS_18590 2803 1634 gene locus_tag LOCUS_18600 2803 1634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_18600 4572 2800 gene locus_tag LOCUS_18610 4572 2800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887495.1 protein_id gnl|my_center|LOCUS_18610 5614 4574 gene locus_tag LOCUS_18620 5614 4574 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389546.1 protein_id gnl|my_center|LOCUS_18620 6067 5642 gene locus_tag LOCUS_18630 6067 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 6623 6255 gene locus_tag LOCUS_18640 6623 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6864 6595 gene locus_tag LOCUS_18650 6864 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7148 8044 gene locus_tag LOCUS_18660 7148 8044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038906.1 protein_id gnl|my_center|LOCUS_18660 8524 9336 gene locus_tag LOCUS_18670 8524 9336 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 protein_id gnl|my_center|LOCUS_18670 <11118 9402 gene locus_tag LOCUS_18680 <11118 9402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931283.1:outer membrane protein >Feature sequence106 1340 528 gene locus_tag LOCUS_18690 gene norQ 1340 528 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_18690 2698 1337 gene locus_tag LOCUS_18700 gene norB 2698 1337 CDS product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 protein_id gnl|my_center|LOCUS_18700 3600 2752 gene locus_tag LOCUS_18710 3600 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4336 5088 gene locus_tag LOCUS_18720 4336 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5759 5202 gene locus_tag LOCUS_18730 5759 5202 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812203.1 protein_id gnl|my_center|LOCUS_18730 6221 5907 gene locus_tag LOCUS_18740 6221 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6646 6284 gene locus_tag LOCUS_18750 6646 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 7122 7907 gene locus_tag LOCUS_18760 7122 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 8533 8345 gene locus_tag LOCUS_18770 8533 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 8745 8599 gene locus_tag LOCUS_18780 8745 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 10060 9014 gene locus_tag LOCUS_18790 gene ltaE 10060 9014 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTF1 protein_id gnl|my_center|LOCUS_18790 <11076 10245 gene locus_tag LOCUS_18800 <11076 10245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZP7:electron transfer flavoprotein subunit alpha >Feature sequence107 <1 712 gene locus_tag LOCUS_18810 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104155.1:hybrid sensor histidine kinase/response regulator 1299 784 gene locus_tag LOCUS_18820 gene hcpC 1299 784 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_248954.1 protein_id gnl|my_center|LOCUS_18820 3041 1578 gene locus_tag LOCUS_18830 3041 1578 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE6 protein_id gnl|my_center|LOCUS_18830 6434 3132 gene locus_tag LOCUS_18840 6434 3132 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266444.1 protein_id gnl|my_center|LOCUS_18840 8270 6525 gene locus_tag LOCUS_18850 gene nhaP2 8270 6525 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE8 protein_id gnl|my_center|LOCUS_18850 10224 8422 gene locus_tag LOCUS_18860 10224 8422 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence108 1246 152 gene locus_tag LOCUS_18870 1246 152 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC8 protein_id gnl|my_center|LOCUS_18870 1428 3470 gene locus_tag LOCUS_18880 gene metG 1428 3470 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_18880 3737 4429 gene locus_tag LOCUS_18890 gene rsuA 3737 4429 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5J6 protein_id gnl|my_center|LOCUS_18890 4505 4578 gene locus_tag LOCUS_t00220 4505 4578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5191 4715 gene locus_tag LOCUS_18900 5191 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039686.1 protein_id gnl|my_center|LOCUS_18900 5820 5188 gene locus_tag LOCUS_18910 5820 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_18910 6984 5926 gene locus_tag LOCUS_18920 6984 5926 CDS product phage late control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104523.1 protein_id gnl|my_center|LOCUS_18920 8078 7113 gene locus_tag LOCUS_18930 8078 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 8314 8144 gene locus_tag LOCUS_18940 8314 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8441 8905 gene locus_tag LOCUS_18950 8441 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 9191 8949 gene locus_tag LOCUS_18960 9191 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 9190 9615 gene locus_tag LOCUS_18970 9190 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 9835 9629 gene locus_tag LOCUS_18980 9835 9629 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104524.1 protein_id gnl|my_center|LOCUS_18980 10763 9810 gene locus_tag LOCUS_18990 10763 9810 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104525.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence109 <1 918 gene locus_tag LOCUS_19000 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266704.1:methyl-accepting chemotaxis protein 2389 1595 gene locus_tag LOCUS_19010 2389 1595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765329.1 protein_id gnl|my_center|LOCUS_19010 4375 2825 gene locus_tag LOCUS_19020 4375 2825 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_19020 7199 4446 gene locus_tag LOCUS_19030 7199 4446 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_19030 8614 7385 gene locus_tag LOCUS_19040 8614 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_19040 9210 8698 gene locus_tag LOCUS_19050 gene allA 9210 8698 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J9 protein_id gnl|my_center|LOCUS_19050 10337 9342 gene locus_tag LOCUS_19060 gene alc 10337 9342 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVG8 protein_id gnl|my_center|LOCUS_19060 10932 10417 gene locus_tag LOCUS_19070 10932 10417 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence110 628 1779 gene locus_tag LOCUS_19080 628 1779 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_19080 2149 1784 gene locus_tag LOCUS_19090 2149 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2654 2187 gene locus_tag LOCUS_19100 2654 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3429 2764 gene locus_tag LOCUS_19110 3429 2764 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_19110 3590 5299 gene locus_tag LOCUS_19120 3590 5299 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_19120 5362 5679 gene locus_tag LOCUS_19130 5362 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6966 5737 gene locus_tag LOCUS_19140 gene serA 6966 5737 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_19140 7165 8559 gene locus_tag LOCUS_19150 7165 8559 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_19150 8647 9312 gene locus_tag LOCUS_19160 8647 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_19160 9414 10316 gene locus_tag LOCUS_19170 9414 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121726.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence111 <1 757 gene locus_tag LOCUS_19180 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113836.1:FMN oxidoreductase 782 1516 gene locus_tag LOCUS_19190 782 1516 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765900.1 protein_id gnl|my_center|LOCUS_19190 1811 2725 gene locus_tag LOCUS_19200 gene prfB 1811 2725 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E1JGJ8 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 2821 4326 gene locus_tag LOCUS_19210 gene lysS 2821 4326 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_19210 4443 5738 gene locus_tag LOCUS_19220 4443 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_19220 5791 6450 gene locus_tag LOCUS_19230 5791 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070540.1 protein_id gnl|my_center|LOCUS_19230 6510 7256 gene locus_tag LOCUS_19240 6510 7256 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_19240 7312 7650 gene locus_tag LOCUS_19250 7312 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_19250 7647 8144 gene locus_tag LOCUS_19260 7647 8144 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU7 protein_id gnl|my_center|LOCUS_19260 9011 8229 gene locus_tag LOCUS_19270 9011 8229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 protein_id gnl|my_center|LOCUS_19270 9445 9050 gene locus_tag LOCUS_19280 9445 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113848.1 protein_id gnl|my_center|LOCUS_19280 9987 9643 gene locus_tag LOCUS_19290 9987 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence112 464 1450 gene locus_tag LOCUS_19300 gene holB 464 1450 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_19300 1483 1839 gene locus_tag LOCUS_19310 gene pilZ 1483 1839 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_19310 1902 2696 gene locus_tag LOCUS_19320 1902 2696 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104742.1 protein_id gnl|my_center|LOCUS_19320 2912 4297 gene locus_tag LOCUS_19330 gene aroP1 2912 4297 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113982.1 protein_id gnl|my_center|LOCUS_19330 4414 5247 gene locus_tag LOCUS_19340 4414 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112483.1 protein_id gnl|my_center|LOCUS_19340 5327 5470 gene locus_tag LOCUS_19350 5327 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 5562 5702 gene locus_tag LOCUS_19360 5562 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6366 5731 gene locus_tag LOCUS_19370 6366 5731 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_19370 6430 6831 gene locus_tag LOCUS_19380 6430 6831 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_19380 6890 7729 gene locus_tag LOCUS_19390 gene pcaR 6890 7729 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083866.1 protein_id gnl|my_center|LOCUS_19390 7853 8704 gene locus_tag LOCUS_19400 7853 8704 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_19400 8704 9486 gene locus_tag LOCUS_19410 8704 9486 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_19410 9486 10703 gene locus_tag LOCUS_19420 gene pcaF 9486 10703 CDS product beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6R0 protein_id gnl|my_center|LOCUS_19420 >Feature sequence113 1106 789 gene locus_tag LOCUS_19430 gene pntAB 1106 789 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_19430 2240 1119 gene locus_tag LOCUS_19440 gene pntAA 2240 1119 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_19440 2762 4276 gene locus_tag LOCUS_19450 gene xcpR 2762 4276 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_19450 4367 5581 gene locus_tag LOCUS_19460 gene xcpS 4367 5581 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_19460 5586 6020 gene locus_tag LOCUS_19470 gene xcpT 5586 6020 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_19470 6024 6599 gene locus_tag LOCUS_19480 gene xcpU 6024 6599 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_19480 6596 6994 gene locus_tag LOCUS_19490 gene xcpV 6596 6994 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_19490 6996 7727 gene locus_tag LOCUS_19500 gene xcpW 6996 7727 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_19500 7724 8695 gene locus_tag LOCUS_19510 gene xcpX 7724 8695 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_19510 8692 9822 gene locus_tag LOCUS_19520 gene xcpY 8692 9822 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_19520 9819 10328 gene locus_tag LOCUS_19530 9819 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence114 165 494 gene locus_tag LOCUS_19540 165 494 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_19540 944 564 gene locus_tag LOCUS_19550 944 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1876 1058 gene locus_tag LOCUS_19560 1876 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_19560 3325 2030 gene locus_tag LOCUS_19570 3325 2030 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104674.1 protein_id gnl|my_center|LOCUS_19570 3750 3322 gene locus_tag LOCUS_19580 3750 3322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765365.1 protein_id gnl|my_center|LOCUS_19580 4362 4018 gene locus_tag LOCUS_19590 4362 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_19590 4934 4428 gene locus_tag LOCUS_19600 4934 4428 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_19600 5207 5887 gene locus_tag LOCUS_19610 5207 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 7116 5881 gene locus_tag LOCUS_19620 gene codA 7116 5881 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 protein_id gnl|my_center|LOCUS_19620 8407 7130 gene locus_tag LOCUS_19630 gene codB 8407 7130 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205458.1 protein_id gnl|my_center|LOCUS_19630 9147 8698 gene locus_tag LOCUS_19640 gene cynS 9147 8698 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IA8 protein_id gnl|my_center|LOCUS_19640 9986 9231 gene locus_tag LOCUS_19650 9986 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <10708 10045 gene locus_tag LOCUS_19660 <10708 10045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114138.1:glutamine synthetase >Feature sequence115 612 1067 gene locus_tag LOCUS_19670 gene mraZ 612 1067 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_19670 1064 2011 gene locus_tag LOCUS_19680 gene rsmH 1064 2011 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_19680 2008 2298 gene locus_tag LOCUS_19690 gene ftsL 2008 2298 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY3 protein_id gnl|my_center|LOCUS_19690 2295 4022 gene locus_tag LOCUS_19700 gene ftsI 2295 4022 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_19700 4022 5485 gene locus_tag LOCUS_19710 gene murE 4022 5485 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_19710 5478 6854 gene locus_tag LOCUS_19720 gene murF 5478 6854 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_19720 6854 7936 gene locus_tag LOCUS_19730 gene mraY 6854 7936 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_19730 7933 9285 gene locus_tag LOCUS_19740 gene murD 7933 9285 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 protein_id gnl|my_center|LOCUS_19740 9285 10511 gene locus_tag LOCUS_19750 gene ftsW 9285 10511 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_19750 >Feature sequence116 1259 312 gene locus_tag LOCUS_19760 1259 312 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525098.1 protein_id gnl|my_center|LOCUS_19760 1599 2594 gene locus_tag LOCUS_19770 1599 2594 CDS product c4-dicarboxylate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_19770 3028 2633 gene locus_tag LOCUS_19780 3028 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 protein_id gnl|my_center|LOCUS_19780 3216 3566 gene locus_tag LOCUS_19790 3216 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3651 4091 gene locus_tag LOCUS_19800 3651 4091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928030.1 protein_id gnl|my_center|LOCUS_19800 4254 5501 gene locus_tag LOCUS_19810 4254 5501 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_19810 5722 7896 gene locus_tag LOCUS_19820 gene nosR 5722 7896 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL3 protein_id gnl|my_center|LOCUS_19820 7968 9878 gene locus_tag LOCUS_19830 gene nosZ 7968 9878 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL2 protein_id gnl|my_center|LOCUS_19830 >Feature sequence117 713 366 gene locus_tag LOCUS_19840 713 366 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G2 protein_id gnl|my_center|LOCUS_19840 1467 796 gene locus_tag LOCUS_19850 gene rpiA 1467 796 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_19850 1643 3157 gene locus_tag LOCUS_19860 gene ilvA 1643 3157 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLU9 protein_id gnl|my_center|LOCUS_19860 3178 3618 gene locus_tag LOCUS_19870 3178 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112958.1 protein_id gnl|my_center|LOCUS_19870 4284 3631 gene locus_tag LOCUS_19880 4284 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_19880 4495 4974 gene locus_tag LOCUS_19890 gene rppH 4495 4974 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL1 protein_id gnl|my_center|LOCUS_19890 4991 7270 gene locus_tag LOCUS_19900 4991 7270 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_19900 8038 7280 gene locus_tag LOCUS_19910 8038 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_19910 8074 8949 gene locus_tag LOCUS_19920 8074 8949 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_19920 8960 9760 gene locus_tag LOCUS_19930 gene lgt 8960 9760 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_19930 >Feature sequence118 252 1055 gene locus_tag LOCUS_19940 252 1055 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_19940 1081 1452 gene locus_tag LOCUS_19950 1081 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_19950 2049 1840 gene locus_tag LOCUS_19960 2049 1840 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_19960 4093 2255 gene locus_tag LOCUS_19970 4093 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_19970 4838 4107 gene locus_tag LOCUS_19980 4838 4107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_19980 5758 4835 gene locus_tag LOCUS_19990 5758 4835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_19990 6193 7164 gene locus_tag LOCUS_20000 6193 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 7101 7415 gene locus_tag LOCUS_20010 7101 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20010 7424 7993 gene locus_tag LOCUS_20020 7424 7993 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 protein_id gnl|my_center|LOCUS_20020 8072 9214 gene locus_tag LOCUS_20030 8072 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9581 9949 gene locus_tag LOCUS_20040 9581 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10114 9836 gene locus_tag LOCUS_20050 10114 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence119 291 698 gene locus_tag LOCUS_20060 291 698 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768316.1 protein_id gnl|my_center|LOCUS_20060 705 1082 gene locus_tag LOCUS_20070 705 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 protein_id gnl|my_center|LOCUS_20070 2068 1079 gene locus_tag LOCUS_20080 2068 1079 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105543.1 protein_id gnl|my_center|LOCUS_20080 2197 2565 gene locus_tag LOCUS_20090 2197 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099679.1 protein_id gnl|my_center|LOCUS_20090 3110 2592 gene locus_tag LOCUS_20100 3110 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 protein_id gnl|my_center|LOCUS_20100 3742 3341 gene locus_tag LOCUS_20110 3742 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_20110 5763 3739 gene locus_tag LOCUS_20120 5763 3739 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_20120 6849 5896 gene locus_tag LOCUS_20130 6849 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_20130 7200 7442 gene locus_tag LOCUS_20140 7200 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 8014 7460 gene locus_tag LOCUS_20150 gene phnN 8014 7460 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM8 protein_id gnl|my_center|LOCUS_20150 8701 8090 gene locus_tag LOCUS_20160 8701 8090 CDS product carbon-phosphorus lyase complex subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 protein_id gnl|my_center|LOCUS_20160 8943 9707 gene locus_tag LOCUS_20170 8943 9707 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_20170 9950 9717 gene locus_tag LOCUS_20180 9950 9717 CDS product redox-active disulfide protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence120 1021 260 gene locus_tag LOCUS_20190 1021 260 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_20190 1237 2241 gene locus_tag LOCUS_20200 1237 2241 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_20200 2976 2281 gene locus_tag LOCUS_20210 gene pyrF 2976 2281 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59654 protein_id gnl|my_center|LOCUS_20210 3114 3281 gene locus_tag LOCUS_20220 3114 3281 CDS product DUF2897 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766904.1 protein_id gnl|my_center|LOCUS_20220 3403 5988 gene locus_tag LOCUS_20230 3403 5988 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817171.1 protein_id gnl|my_center|LOCUS_20230 6490 5999 gene locus_tag LOCUS_20240 6490 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7947 6487 gene locus_tag LOCUS_20250 7947 6487 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_20250 8860 8057 gene locus_tag LOCUS_20260 8860 8057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267374.1 protein_id gnl|my_center|LOCUS_20260 9222 8857 gene locus_tag LOCUS_20270 9222 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091008.1 protein_id gnl|my_center|LOCUS_20270 10027 9224 gene locus_tag LOCUS_20280 10027 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence121 2300 171 gene locus_tag LOCUS_20290 2300 171 CDS product putative signaling protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT3 protein_id gnl|my_center|LOCUS_20290 2872 2405 gene locus_tag LOCUS_20300 2872 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_20300 3676 3011 gene locus_tag LOCUS_20310 3676 3011 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_20310 3972 4985 gene locus_tag LOCUS_20320 gene hemB 3972 4985 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_20320 4999 7206 gene locus_tag LOCUS_20330 gene ppk 4999 7206 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP6 protein_id gnl|my_center|LOCUS_20330 8776 7274 gene locus_tag LOCUS_20340 gene ppx 8776 7274 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_20340 8966 9292 gene locus_tag LOCUS_20350 gene trxA 8966 9292 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence122 309 620 gene locus_tag LOCUS_20360 309 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 724 1152 gene locus_tag LOCUS_20370 724 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1230 1475 gene locus_tag LOCUS_20380 1230 1475 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_20380 1566 4403 gene locus_tag LOCUS_20390 gene cyaA 1566 4403 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 protein_id gnl|my_center|LOCUS_20390 4898 4494 gene locus_tag LOCUS_20400 gene rnk 4898 4494 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246537.1 protein_id gnl|my_center|LOCUS_20400 5365 5033 gene locus_tag LOCUS_20410 gene cyaY 5365 5033 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTS5 protein_id gnl|my_center|LOCUS_20410 5687 6934 gene locus_tag LOCUS_20420 gene lysA 5687 6934 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_20420 6945 7775 gene locus_tag LOCUS_20430 gene dapF 6945 7775 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B09 protein_id gnl|my_center|LOCUS_20430 7772 8470 gene locus_tag LOCUS_20440 7772 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_20440 8542 9444 gene locus_tag LOCUS_20450 gene xerC 8542 9444 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_20450 9441 10145 gene locus_tag LOCUS_20460 9441 10145 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence123 <1 603 gene locus_tag LOCUS_20470 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU43:1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase 746 1516 gene locus_tag LOCUS_20480 gene hisF1 746 1516 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_20480 1605 2354 gene locus_tag LOCUS_20490 1605 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_20490 3246 2389 gene locus_tag LOCUS_20500 gene qmcA 3246 2389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_20500 3734 3291 gene locus_tag LOCUS_20510 3734 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876332.1 protein_id gnl|my_center|LOCUS_20510 4601 3810 gene locus_tag LOCUS_20520 4601 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 protein_id gnl|my_center|LOCUS_20520 5935 4604 gene locus_tag LOCUS_20530 5935 4604 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_20530 7204 5960 gene locus_tag LOCUS_20540 7204 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_20540 8840 7302 gene locus_tag LOCUS_20550 gene gpmI 8840 7302 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_20550 8982 9395 gene locus_tag LOCUS_20560 8982 9395 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_20560 9398 9652 gene locus_tag LOCUS_20570 gene grx 9398 9652 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU55 protein_id gnl|my_center|LOCUS_20570 9703 10185 gene locus_tag LOCUS_20580 gene secB 9703 10185 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_20580 >Feature sequence124 691 125 gene locus_tag LOCUS_20590 691 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_20590 1251 709 gene locus_tag LOCUS_20600 1251 709 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318496.1 protein_id gnl|my_center|LOCUS_20600 2152 1499 gene locus_tag LOCUS_20610 2152 1499 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_20610 2192 3322 gene locus_tag LOCUS_20620 2192 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_20620 3572 3985 gene locus_tag LOCUS_20630 3572 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 protein_id gnl|my_center|LOCUS_20630 4058 4759 gene locus_tag LOCUS_20640 4058 4759 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102425.1 protein_id gnl|my_center|LOCUS_20640 4759 6096 gene locus_tag LOCUS_20650 4759 6096 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_20650 6222 8276 gene locus_tag LOCUS_20660 6222 8276 CDS product outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001005769.2 protein_id gnl|my_center|LOCUS_20660 8388 8690 gene locus_tag LOCUS_20670 8388 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence125 1945 1370 gene locus_tag LOCUS_20680 1945 1370 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_20680 2523 1969 gene locus_tag LOCUS_20690 2523 1969 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266415.1 protein_id gnl|my_center|LOCUS_20690 2686 4089 gene locus_tag LOCUS_20700 gene bioA 2686 4089 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 protein_id gnl|my_center|LOCUS_20700 4161 4880 gene locus_tag LOCUS_20710 4161 4880 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_20710 5363 4893 gene locus_tag LOCUS_20720 gene chpC 5363 4893 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_20720 6412 5375 gene locus_tag LOCUS_20730 gene chpB 6412 5375 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_20730 <9903 6405 gene locus_tag LOCUS_20740 <9903 6405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein >Feature sequence126 4628 3861 gene locus_tag LOCUS_20750 4628 3861 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 protein_id gnl|my_center|LOCUS_20750 5732 4638 gene locus_tag LOCUS_20760 5732 4638 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_20760 6924 5740 gene locus_tag LOCUS_20770 6924 5740 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103488.1 protein_id gnl|my_center|LOCUS_20770 8037 7009 gene locus_tag LOCUS_20780 8037 7009 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 protein_id gnl|my_center|LOCUS_20780 8329 8985 gene locus_tag LOCUS_20790 8329 8985 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266805.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence127 919 569 gene locus_tag LOCUS_20800 919 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1111 920 gene locus_tag LOCUS_20810 1111 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2387 1227 gene locus_tag LOCUS_20820 gene pgk 2387 1227 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y4 protein_id gnl|my_center|LOCUS_20820 3481 2435 gene locus_tag LOCUS_20830 gene epd 3481 2435 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_20830 5584 3587 gene locus_tag LOCUS_20840 gene tktA 5584 3587 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_20840 6636 5698 gene locus_tag LOCUS_20850 6636 5698 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767830.1 protein_id gnl|my_center|LOCUS_20850 6757 7653 gene locus_tag LOCUS_20860 6757 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 7650 8252 gene locus_tag LOCUS_20870 7650 8252 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616684.1 protein_id gnl|my_center|LOCUS_20870 8340 9341 gene locus_tag LOCUS_20880 8340 9341 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence128 589 2772 gene locus_tag LOCUS_20890 589 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3115 4791 gene locus_tag LOCUS_20900 gene deaD 3115 4791 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC1 protein_id gnl|my_center|LOCUS_20900 6161 4929 gene locus_tag LOCUS_20910 6161 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6467 8416 gene locus_tag LOCUS_20920 gene acsA1 6467 8416 CDS product acetyl-coenzyme A synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I558 protein_id gnl|my_center|LOCUS_20920 9542 8448 gene locus_tag LOCUS_20930 9542 8448 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096867.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence129 405 764 gene locus_tag LOCUS_20940 405 764 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883347.1 protein_id gnl|my_center|LOCUS_20940 784 2310 gene locus_tag LOCUS_20950 784 2310 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_20950 3046 2327 gene locus_tag LOCUS_20960 3046 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3459 3962 gene locus_tag LOCUS_20970 3459 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_20970 4020 5597 gene locus_tag LOCUS_20980 4020 5597 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_20980 5621 6610 gene locus_tag LOCUS_20990 gene acoA 5621 6610 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 protein_id gnl|my_center|LOCUS_20990 6867 7955 gene locus_tag LOCUS_21000 6867 7955 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 protein_id gnl|my_center|LOCUS_21000 7969 8991 gene locus_tag LOCUS_21010 7969 8991 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_21010 8997 9230 gene locus_tag LOCUS_21020 8997 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence130 2070 1501 gene locus_tag LOCUS_21030 2070 1501 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_21030 2386 2105 gene locus_tag LOCUS_21040 2386 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2834 2610 gene locus_tag LOCUS_21050 2834 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4397 3741 gene locus_tag LOCUS_21060 4397 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6256 4421 gene locus_tag LOCUS_21070 gene glmS 6256 4421 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_21070 7041 6259 gene locus_tag LOCUS_21080 7041 6259 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269443.1 protein_id gnl|my_center|LOCUS_21080 8494 7130 gene locus_tag LOCUS_21090 gene glmU 8494 7130 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_21090 9025 8603 gene locus_tag LOCUS_21100 gene atpC 9025 8603 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT5 protein_id gnl|my_center|LOCUS_21100 >Feature sequence131 257 1633 gene locus_tag LOCUS_21110 gene fleR 257 1633 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_21110 1687 2343 gene locus_tag LOCUS_21120 gene tpm 1687 2343 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_21120 3011 2358 gene locus_tag LOCUS_21130 3011 2358 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_21130 3964 3092 gene locus_tag LOCUS_21140 gene htpX 3964 3092 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I013 protein_id gnl|my_center|LOCUS_21140 4509 4045 gene locus_tag LOCUS_21150 4509 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_21150 5726 4515 gene locus_tag LOCUS_21160 5726 4515 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_21160 5913 6311 gene locus_tag LOCUS_21170 gene msrB 5913 6311 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_21170 6328 6810 gene locus_tag LOCUS_21180 6328 6810 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I017 protein_id gnl|my_center|LOCUS_21180 6857 7747 gene locus_tag LOCUS_21190 6857 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098802.1 protein_id gnl|my_center|LOCUS_21190 8445 7771 gene locus_tag LOCUS_21200 8445 7771 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_21200 9249 8482 gene locus_tag LOCUS_21210 9249 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114771.1 protein_id gnl|my_center|LOCUS_21210 9472 9547 gene locus_tag LOCUS_t00230 9472 9547 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 1517 1065 gene locus_tag LOCUS_21220 1517 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21220 2118 1591 gene locus_tag LOCUS_21230 2118 1591 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_21230 2906 2115 gene locus_tag LOCUS_21240 2906 2115 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_21240 4473 3226 gene locus_tag LOCUS_21250 4473 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21250 5037 4477 gene locus_tag LOCUS_21260 5037 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6714 5053 gene locus_tag LOCUS_21270 6714 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038900.1 protein_id gnl|my_center|LOCUS_21270 6967 6707 gene locus_tag LOCUS_21280 6967 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7826 6951 gene locus_tag LOCUS_21290 7826 6951 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 protein_id gnl|my_center|LOCUS_21290 8081 7869 gene locus_tag LOCUS_21300 8081 7869 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346894.2 protein_id gnl|my_center|LOCUS_21300 8946 8200 gene locus_tag LOCUS_21310 8946 8200 CDS product receptor protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038902.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence133 <1 527 gene locus_tag LOCUS_21320 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUK1:DNA topoisomerase 4 subunit A 648 1370 gene locus_tag LOCUS_21330 648 1370 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244601.1 protein_id gnl|my_center|LOCUS_21330 2959 1436 gene locus_tag LOCUS_21340 2959 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102052.1 protein_id gnl|my_center|LOCUS_21340 3145 4359 gene locus_tag LOCUS_21350 3145 4359 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_21350 5475 4402 gene locus_tag LOCUS_21360 5475 4402 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_21360 7630 5567 gene locus_tag LOCUS_21370 gene fimX 7630 5567 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence134 <1 846 gene locus_tag LOCUS_21380 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112970.1:gamma-glutamyltranspeptidase 2668 830 gene locus_tag LOCUS_21390 2668 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3104 2763 gene locus_tag LOCUS_21400 3104 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_21400 4022 3210 gene locus_tag LOCUS_21410 gene mutM 4022 3210 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_21410 4944 4078 gene locus_tag LOCUS_21420 4944 4078 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_21420 5075 5611 gene locus_tag LOCUS_21430 5075 5611 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372548.1 protein_id gnl|my_center|LOCUS_21430 6860 5775 gene locus_tag LOCUS_21440 6860 5775 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_21440 7037 8233 gene locus_tag LOCUS_21450 7037 8233 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_21450 8557 8237 gene locus_tag LOCUS_21460 8557 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence135 <1 951 gene locus_tag LOCUS_21470 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXJ8:GTPase Der 1023 2171 gene locus_tag LOCUS_21480 1023 2171 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_21480 2159 2953 gene locus_tag LOCUS_21490 2159 2953 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_21490 3147 2944 gene locus_tag LOCUS_21500 3147 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3527 3144 gene locus_tag LOCUS_21510 3527 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_21510 4164 3529 gene locus_tag LOCUS_21520 4164 3529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_21520 4579 4232 gene locus_tag LOCUS_21530 4579 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5892 4588 gene locus_tag LOCUS_21540 5892 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 7022 5970 gene locus_tag LOCUS_21550 7022 5970 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762626.1 protein_id gnl|my_center|LOCUS_21550 8836 7166 gene locus_tag LOCUS_21560 gene leuA 8836 7166 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXK5 protein_id gnl|my_center|LOCUS_21560 >Feature sequence136 1389 589 gene locus_tag LOCUS_21570 1389 589 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104164.1 protein_id gnl|my_center|LOCUS_21570 3111 1504 gene locus_tag LOCUS_21580 gene liuB 3111 1504 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_21580 4378 3215 gene locus_tag LOCUS_21590 4378 3215 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_21590 4633 5631 gene locus_tag LOCUS_21600 4633 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6819 5719 gene locus_tag LOCUS_21610 gene ychF 6819 5719 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_21610 7428 6844 gene locus_tag LOCUS_21620 gene pth 7428 6844 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_21620 8074 7460 gene locus_tag LOCUS_21630 gene rplY 8074 7460 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_21630 9124 8183 gene locus_tag LOCUS_21640 gene prs 9124 8183 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_21640 9277 9203 gene locus_tag LOCUS_t00240 9277 9203 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence137 1710 418 gene locus_tag LOCUS_21650 1710 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114807.1 protein_id gnl|my_center|LOCUS_21650 1934 2326 gene locus_tag LOCUS_21660 1934 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3876 2287 gene locus_tag LOCUS_21670 gene ndvC 3876 2287 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_21670 4280 4594 gene locus_tag LOCUS_21680 4280 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_21680 4596 6251 gene locus_tag LOCUS_21690 4596 6251 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_21690 6422 7228 gene locus_tag LOCUS_21700 6422 7228 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_21700 7308 8456 gene locus_tag LOCUS_21710 7308 8456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_21710 8569 9030 gene locus_tag LOCUS_21720 8569 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_21720 9223 8993 gene locus_tag LOCUS_21730 9223 8993 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYE3 protein_id gnl|my_center|LOCUS_21730 >Feature sequence138 <1 516 gene locus_tag LOCUS_21740 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV71:2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase 675 1475 gene locus_tag LOCUS_21750 gene panB 675 1475 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_21750 1472 2335 gene locus_tag LOCUS_21760 gene panC 1472 2335 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY87 protein_id gnl|my_center|LOCUS_21760 2416 2796 gene locus_tag LOCUS_21770 gene panD 2416 2796 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_21770 2998 4665 gene locus_tag LOCUS_21780 gene pgi 2998 4665 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV67 protein_id gnl|my_center|LOCUS_21780 4685 5560 gene locus_tag LOCUS_21790 4685 5560 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103368.1 protein_id gnl|my_center|LOCUS_21790 5586 8528 gene locus_tag LOCUS_21800 5586 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105020.1 protein_id gnl|my_center|LOCUS_21800 8528 8827 gene locus_tag LOCUS_21810 8528 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100541.1 protein_id gnl|my_center|LOCUS_21810 8836 9144 gene locus_tag LOCUS_21820 8836 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253425.2 protein_id gnl|my_center|LOCUS_21820 >Feature sequence139 1687 2583 gene locus_tag LOCUS_21830 1687 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2721 4406 gene locus_tag LOCUS_21840 2721 4406 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266164.1 protein_id gnl|my_center|LOCUS_21840 7041 4492 gene locus_tag LOCUS_21850 7041 4492 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_21850 8125 7160 gene locus_tag LOCUS_21860 8125 7160 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704329.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence140 1956 1657 gene locus_tag LOCUS_21870 1956 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2230 2499 gene locus_tag LOCUS_21880 2230 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2826 2503 gene locus_tag LOCUS_21890 2826 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3400 2870 gene locus_tag LOCUS_21900 3400 2870 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 protein_id gnl|my_center|LOCUS_21900 3559 4710 gene locus_tag LOCUS_21910 3559 4710 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_21910 5222 4722 gene locus_tag LOCUS_21920 5222 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147560.1 protein_id gnl|my_center|LOCUS_21920 5508 7058 gene locus_tag LOCUS_21930 gene glgA 5508 7058 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS46 protein_id gnl|my_center|LOCUS_21930 7067 8833 gene locus_tag LOCUS_21940 7067 8833 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS45 protein_id gnl|my_center|LOCUS_21940 >Feature sequence141 <1 1076 gene locus_tag LOCUS_21950 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035286.1:cellulase 1271 1495 gene locus_tag LOCUS_21960 1271 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1479 2213 gene locus_tag LOCUS_21970 1479 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2210 2647 gene locus_tag LOCUS_21980 2210 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090756.1 protein_id gnl|my_center|LOCUS_21980 2634 3395 gene locus_tag LOCUS_21990 2634 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525135.1 protein_id gnl|my_center|LOCUS_21990 3471 3546 gene locus_tag LOCUS_t00250 3471 3546 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4202 3870 gene locus_tag LOCUS_22000 4202 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113680.1 protein_id gnl|my_center|LOCUS_22000 4489 5364 gene locus_tag LOCUS_22010 4489 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_22010 5522 6637 gene locus_tag LOCUS_22020 5522 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_22020 6630 7391 gene locus_tag LOCUS_22030 6630 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_22030 7388 7735 gene locus_tag LOCUS_22040 7388 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22040 7778 8386 gene locus_tag LOCUS_22050 7778 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22050 8443 8634 gene locus_tag LOCUS_22060 8443 8634 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402493.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence142 1100 216 gene locus_tag LOCUS_22070 1100 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_22070 1834 1097 gene locus_tag LOCUS_22080 1834 1097 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_22080 2619 1834 gene locus_tag LOCUS_22090 2619 1834 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_22090 3652 2621 gene locus_tag LOCUS_22100 3652 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4703 3696 gene locus_tag LOCUS_22110 4703 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_22110 6062 5091 gene locus_tag LOCUS_22120 6062 5091 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 protein_id gnl|my_center|LOCUS_22120 6184 6324 gene locus_tag LOCUS_22130 6184 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 6416 7717 gene locus_tag LOCUS_22140 6416 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 <9183 7894 gene locus_tag LOCUS_22150 <9183 7894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268766.1:allophanate hydrolase >Feature sequence143 1420 104 gene locus_tag LOCUS_22160 gene ycaD 1420 104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_22160 2913 1588 gene locus_tag LOCUS_22170 2913 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3879 2947 gene locus_tag LOCUS_22180 3879 2947 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_22180 4005 4826 gene locus_tag LOCUS_22190 4005 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 protein_id gnl|my_center|LOCUS_22190 5061 6224 gene locus_tag LOCUS_22200 5061 6224 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_22200 6553 6957 gene locus_tag LOCUS_22210 6553 6957 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_22210 6954 8306 gene locus_tag LOCUS_22220 6954 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence144 1267 1743 gene locus_tag LOCUS_22230 1267 1743 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_22230 2619 1759 gene locus_tag LOCUS_22240 2619 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_22240 2796 3401 gene locus_tag LOCUS_22250 2796 3401 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_22250 4125 3403 gene locus_tag LOCUS_22260 gene lpxH 4125 3403 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V0 protein_id gnl|my_center|LOCUS_22260 4616 4122 gene locus_tag LOCUS_22270 gene ppiB 4616 4122 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_22270 4755 6446 gene locus_tag LOCUS_22280 gene glnS 4755 6446 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U8 protein_id gnl|my_center|LOCUS_22280 6450 7835 gene locus_tag LOCUS_22290 gene cysS 6450 7835 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_22290 8747 7893 gene locus_tag LOCUS_22300 gene folD 8747 7893 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_22300 9016 9092 gene locus_tag LOCUS_t00260 9016 9092 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence145 <1 682 gene locus_tag LOCUS_22310 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002555721.1:nitrogen regulation protein NR(I) 1137 697 gene locus_tag LOCUS_22320 1137 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114476.1 protein_id gnl|my_center|LOCUS_22320 1136 1630 gene locus_tag LOCUS_22330 gene trmL 1136 1630 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU57 protein_id gnl|my_center|LOCUS_22330 1708 2244 gene locus_tag LOCUS_22340 gene hslV 1708 2244 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC6 protein_id gnl|my_center|LOCUS_22340 2352 3695 gene locus_tag LOCUS_22350 gene hslU 2352 3695 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_22350 3744 4118 gene locus_tag LOCUS_22360 3744 4118 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105334.1 protein_id gnl|my_center|LOCUS_22360 4520 4245 gene locus_tag LOCUS_22370 4520 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_22370 4703 5473 gene locus_tag LOCUS_22380 gene ubiE 4703 5473 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_22380 5473 6096 gene locus_tag LOCUS_22390 5473 6096 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105338.1 protein_id gnl|my_center|LOCUS_22390 6093 7703 gene locus_tag LOCUS_22400 gene ubiB 6093 7703 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG5 protein_id gnl|my_center|LOCUS_22400 7754 8149 gene locus_tag LOCUS_22410 gene hisI 7754 8149 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_22410 8142 8474 gene locus_tag LOCUS_22420 gene hisE 8142 8474 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_22420 8495 8725 gene locus_tag LOCUS_22430 gene tatA 8495 8725 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB5 protein_id gnl|my_center|LOCUS_22430 >Feature sequence146 1443 778 gene locus_tag LOCUS_22440 1443 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1765 1448 gene locus_tag LOCUS_22450 1765 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2034 1762 gene locus_tag LOCUS_22460 2034 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2483 2031 gene locus_tag LOCUS_22470 2483 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2821 2480 gene locus_tag LOCUS_22480 2821 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3080 2823 gene locus_tag LOCUS_22490 3080 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4123 3143 gene locus_tag LOCUS_22500 4123 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5449 4223 gene locus_tag LOCUS_22510 5449 4223 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105434.1 protein_id gnl|my_center|LOCUS_22510 5698 5623 gene locus_tag LOCUS_t00270 5698 5623 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6091 5819 gene locus_tag LOCUS_22520 6091 5819 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_22520 7155 6088 gene locus_tag LOCUS_22530 gene mutY 7155 6088 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence147 <1 563 gene locus_tag LOCUS_22540 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114121.1:GGDEF domain-containing protein 653 1432 gene locus_tag LOCUS_22550 gene ampDh2 653 1432 CDS product protein AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_22550 1840 1436 gene locus_tag LOCUS_22560 1840 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3651 1864 gene locus_tag LOCUS_22570 3651 1864 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103101.1 protein_id gnl|my_center|LOCUS_22570 4994 3648 gene locus_tag LOCUS_22580 4994 3648 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318895.1 protein_id gnl|my_center|LOCUS_22580 5245 5676 gene locus_tag LOCUS_22590 5245 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5859 6095 gene locus_tag LOCUS_22600 5859 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 6170 6340 gene locus_tag LOCUS_22610 6170 6340 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT88 protein_id gnl|my_center|LOCUS_22610 6694 7923 gene locus_tag LOCUS_22620 6694 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence148 1718 771 gene locus_tag LOCUS_22630 gene glyQ 1718 771 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_22630 1836 2399 gene locus_tag LOCUS_22640 gene tag 1836 2399 CDS product DNA-3-methyladenine glycosidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097280.1 protein_id gnl|my_center|LOCUS_22640 2445 3326 gene locus_tag LOCUS_22650 2445 3326 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_22650 3362 3625 gene locus_tag LOCUS_22660 3362 3625 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_22660 3950 3633 gene locus_tag LOCUS_22670 3950 3633 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 protein_id gnl|my_center|LOCUS_22670 4852 4040 gene locus_tag LOCUS_22680 4852 4040 CDS product putative amino-acid ABC transporter ATP-binding protein y4tH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55662 protein_id gnl|my_center|LOCUS_22680 5508 4852 gene locus_tag LOCUS_22690 5508 4852 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812579.1 protein_id gnl|my_center|LOCUS_22690 6164 5505 gene locus_tag LOCUS_22700 6164 5505 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459281.1 protein_id gnl|my_center|LOCUS_22700 7155 6298 gene locus_tag LOCUS_22710 7155 6298 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039638.1 protein_id gnl|my_center|LOCUS_22710 8914 7541 gene locus_tag LOCUS_22720 gene trkA 8914 7541 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence149 3000 970 gene locus_tag LOCUS_22730 3000 970 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706418.1 protein_id gnl|my_center|LOCUS_22730 4926 3154 gene locus_tag LOCUS_22740 4926 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5288 5022 gene locus_tag LOCUS_22750 5288 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5193 5582 gene locus_tag LOCUS_22760 5193 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22760 5579 6484 gene locus_tag LOCUS_22770 5579 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 6605 7525 gene locus_tag LOCUS_22780 gene malM 6605 7525 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817303.1 protein_id gnl|my_center|LOCUS_22780 7575 8813 gene locus_tag LOCUS_22790 gene malE 7575 8813 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence150 <1 1836 gene locus_tag LOCUS_22800 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5Q2:error-prone DNA polymerase 3088 1859 gene locus_tag LOCUS_22810 3088 1859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_22810 3306 4319 gene locus_tag LOCUS_22820 3306 4319 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_22820 4399 4725 gene locus_tag LOCUS_22830 4399 4725 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_22830 4811 5425 gene locus_tag LOCUS_22840 4811 5425 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_22840 5739 6593 gene locus_tag LOCUS_22850 5739 6593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930232.1 protein_id gnl|my_center|LOCUS_22850 6674 7144 gene locus_tag LOCUS_22860 6674 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_22860 7415 8380 gene locus_tag LOCUS_22870 7415 8380 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_22870 8447 8788 gene locus_tag LOCUS_22880 gene nuoA1 8447 8788 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_22880 >Feature sequence151 1125 907 gene locus_tag LOCUS_22890 1125 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2005 1250 gene locus_tag LOCUS_22900 2005 1250 CDS product receptor protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038902.1 protein_id gnl|my_center|LOCUS_22900 3471 2560 gene locus_tag LOCUS_22910 3471 2560 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038904.1 protein_id gnl|my_center|LOCUS_22910 3939 4373 gene locus_tag LOCUS_22920 3939 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22920 4946 4485 gene locus_tag LOCUS_22930 4946 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6206 5007 gene locus_tag LOCUS_22940 6206 5007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_22940 7069 6203 gene locus_tag LOCUS_22950 7069 6203 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_22950 8478 7069 gene locus_tag LOCUS_22960 8478 7069 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_22960 8689 8486 gene locus_tag LOCUS_22970 8689 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence152 945 82 gene locus_tag LOCUS_22980 gene ispE 945 82 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_22980 1565 945 gene locus_tag LOCUS_22990 gene lolB 1565 945 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX0 protein_id gnl|my_center|LOCUS_22990 3299 1569 gene locus_tag LOCUS_23000 3299 1569 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_23000 3483 4751 gene locus_tag LOCUS_23010 gene hemA 3483 4751 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_23010 4748 5830 gene locus_tag LOCUS_23020 gene prfA 4748 5830 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_23020 5834 6691 gene locus_tag LOCUS_23030 gene prmC 5834 6691 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC8 protein_id gnl|my_center|LOCUS_23030 6681 7436 gene locus_tag LOCUS_23040 gene moeB 6681 7436 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_23040 7426 8229 gene locus_tag LOCUS_23050 gene murI 7426 8229 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_23050 8305 8823 gene locus_tag LOCUS_23060 8305 8823 CDS product lipid A deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW3 protein_id gnl|my_center|LOCUS_23060 >Feature sequence153 103 178 gene locus_tag LOCUS_t00280 103 178 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 233 317 gene locus_tag LOCUS_t00290 233 317 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1823 1449 gene locus_tag LOCUS_23070 1823 1449 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_23070 3257 1845 gene locus_tag LOCUS_23080 3257 1845 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970431.1 protein_id gnl|my_center|LOCUS_23080 4173 3517 gene locus_tag LOCUS_23090 4173 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_23090 4763 4404 gene locus_tag LOCUS_23100 4763 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6825 5398 gene locus_tag LOCUS_23110 6825 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 protein_id gnl|my_center|LOCUS_23110 8816 7527 gene locus_tag LOCUS_23120 8816 7527 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence154 146 634 gene locus_tag LOCUS_23130 146 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_23130 621 1583 gene locus_tag LOCUS_23140 621 1583 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_23140 1603 2754 gene locus_tag LOCUS_23150 gene degP 1603 2754 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_23150 3834 3262 gene locus_tag LOCUS_23160 3834 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 6140 3834 gene locus_tag LOCUS_23170 6140 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 6740 6273 gene locus_tag LOCUS_23180 6740 6273 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_23180 <8834 6751 gene locus_tag LOCUS_23190 <8834 6751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971984.1:histidine kinase >Feature sequence155 1038 358 gene locus_tag LOCUS_23200 1038 358 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_23200 1279 2346 gene locus_tag LOCUS_23210 1279 2346 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779635.1 protein_id gnl|my_center|LOCUS_23210 2343 3428 gene locus_tag LOCUS_23220 2343 3428 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387073.1 protein_id gnl|my_center|LOCUS_23220 3577 4665 gene locus_tag LOCUS_23230 3577 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_23230 4658 5626 gene locus_tag LOCUS_23240 4658 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 5633 6601 gene locus_tag LOCUS_23250 5633 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_23250 6670 7443 gene locus_tag LOCUS_23260 6670 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_23260 8229 7465 gene locus_tag LOCUS_23270 8229 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence156 1506 472 gene locus_tag LOCUS_23280 1506 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2433 1519 gene locus_tag LOCUS_23290 gene lfgL 2433 1519 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_23290 3853 2456 gene locus_tag LOCUS_23300 gene flgK 3853 2456 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI0 protein_id gnl|my_center|LOCUS_23300 4842 3850 gene locus_tag LOCUS_23310 4842 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 5177 5007 gene locus_tag LOCUS_23320 5177 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5113 5367 gene locus_tag LOCUS_23330 5113 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5749 5504 gene locus_tag LOCUS_23340 5749 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 5903 7339 gene locus_tag LOCUS_23350 5903 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269426.1 protein_id gnl|my_center|LOCUS_23350 7357 8310 gene locus_tag LOCUS_23360 7357 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113669.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence157 <1 917 gene locus_tag LOCUS_23370 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104887.1:DNA ligase-associated DEXH box helicase 914 1567 gene locus_tag LOCUS_23380 914 1567 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_23380 1794 1564 gene locus_tag LOCUS_23390 1794 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1978 3315 gene locus_tag LOCUS_23400 1978 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3540 3388 gene locus_tag LOCUS_23410 3540 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4175 3636 gene locus_tag LOCUS_23420 4175 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616372.1 protein_id gnl|my_center|LOCUS_23420 5113 4283 gene locus_tag LOCUS_23430 5113 4283 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_23430 7499 5256 gene locus_tag LOCUS_23440 gene relA 7499 5256 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_23440 <8706 7595 gene locus_tag LOCUS_23450 <8706 7595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q885Y8:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence158 1827 922 gene locus_tag LOCUS_23460 1827 922 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 protein_id gnl|my_center|LOCUS_23460 1972 2754 gene locus_tag LOCUS_23470 1972 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_23470 3518 2751 gene locus_tag LOCUS_23480 3518 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_23480 3923 5131 gene locus_tag LOCUS_23490 3923 5131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528530.1 protein_id gnl|my_center|LOCUS_23490 5134 5931 gene locus_tag LOCUS_23500 5134 5931 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528529.1 protein_id gnl|my_center|LOCUS_23500 5924 6628 gene locus_tag LOCUS_23510 5924 6628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528528.1 protein_id gnl|my_center|LOCUS_23510 6628 7515 gene locus_tag LOCUS_23520 6628 7515 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_23520 7515 8504 gene locus_tag LOCUS_23530 7515 8504 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709544.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence159 2864 2409 gene locus_tag LOCUS_23540 2864 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3435 2908 gene locus_tag LOCUS_23550 3435 2908 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937474.1 protein_id gnl|my_center|LOCUS_23550 3850 3446 gene locus_tag LOCUS_23560 gene shp 3850 3446 CDS product cytochrome c-type protein SHP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81238 protein_id gnl|my_center|LOCUS_23560 3989 5533 gene locus_tag LOCUS_23570 3989 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 7066 5675 gene locus_tag LOCUS_23580 7066 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123120.1 protein_id gnl|my_center|LOCUS_23580 8630 7179 gene locus_tag LOCUS_23590 8630 7179 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence160 40 888 gene locus_tag LOCUS_23600 gene atpG 40 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009972311.1 protein_id gnl|my_center|LOCUS_23600 1666 899 gene locus_tag LOCUS_23610 1666 899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_23610 2496 1663 gene locus_tag LOCUS_23620 2496 1663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_23620 3287 2490 gene locus_tag LOCUS_23630 gene phnC1 3287 2490 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889G0 protein_id gnl|my_center|LOCUS_23630 4141 3290 gene locus_tag LOCUS_23640 4141 3290 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403547.1 protein_id gnl|my_center|LOCUS_23640 4256 4606 gene locus_tag LOCUS_23650 4256 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4677 5564 gene locus_tag LOCUS_23660 4677 5564 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_23660 5561 6343 gene locus_tag LOCUS_23670 gene hyi 5561 6343 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_23670 6429 7817 gene locus_tag LOCUS_23680 6429 7817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104878.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence161 1636 1911 gene locus_tag LOCUS_23690 gene rpsT 1636 1911 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_23690 2446 1988 gene locus_tag LOCUS_23700 2446 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_23700 3599 2454 gene locus_tag LOCUS_23710 gene proB 3599 2454 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_23710 4869 3652 gene locus_tag LOCUS_23720 gene obg 4869 3652 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_23720 5267 5010 gene locus_tag LOCUS_23730 gene rpmA 5267 5010 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL7 protein_id gnl|my_center|LOCUS_23730 5614 5303 gene locus_tag LOCUS_23740 gene rplU 5614 5303 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_23740 5856 6824 gene locus_tag LOCUS_23750 5856 6824 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_23750 6940 7167 gene locus_tag LOCUS_23760 6940 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555214.1 protein_id gnl|my_center|LOCUS_23760 7800 7183 gene locus_tag LOCUS_23770 gene fklB 7800 7183 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL2 protein_id gnl|my_center|LOCUS_23770 8175 7867 gene locus_tag LOCUS_23780 8175 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268921.1 protein_id gnl|my_center|LOCUS_23780 8584 8216 gene locus_tag LOCUS_23790 8584 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence162 1709 2128 gene locus_tag LOCUS_23800 1709 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2154 2321 gene locus_tag LOCUS_23810 2154 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2953 3213 gene locus_tag LOCUS_23820 2953 3213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_23820 3219 4988 gene locus_tag LOCUS_23830 3219 4988 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_23830 5090 5611 gene locus_tag LOCUS_23840 5090 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 6455 5748 gene locus_tag LOCUS_23850 6455 5748 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_23850 8410 6452 gene locus_tag LOCUS_23860 8410 6452 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence163 540 328 gene locus_tag LOCUS_23870 540 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_23870 703 1233 gene locus_tag LOCUS_23880 703 1233 CDS product putative ankyrin repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYV6 protein_id gnl|my_center|LOCUS_23880 2329 1241 gene locus_tag LOCUS_23890 2329 1241 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103632.1 protein_id gnl|my_center|LOCUS_23890 3146 2421 gene locus_tag LOCUS_23900 3146 2421 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_23900 3504 3175 gene locus_tag LOCUS_23910 3504 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3793 5355 gene locus_tag LOCUS_23920 3793 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082751.1 protein_id gnl|my_center|LOCUS_23920 5557 6786 gene locus_tag LOCUS_23930 gene glt-4 5557 6786 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_23930 7273 6797 gene locus_tag LOCUS_23940 7273 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence164 <1 2541 gene locus_tag LOCUS_23950 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104174.1:acriflavine resistance protein B 2580 4013 gene locus_tag LOCUS_23960 2580 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_23960 5019 4030 gene locus_tag LOCUS_23970 5019 4030 CDS product c4-dicarboxylate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_23970 6573 5191 gene locus_tag LOCUS_23980 gene oprN 6573 5191 CDS product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_23980 <8549 6570 gene locus_tag LOCUS_23990 <8549 6570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089834.1:resistance-nodulation-cell division multidrug efflux transporter MexF >Feature sequence165 1275 262 gene locus_tag LOCUS_24000 gene gap 1275 262 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ73 protein_id gnl|my_center|LOCUS_24000 1388 2050 gene locus_tag LOCUS_24010 1388 2050 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_24010 2239 2811 gene locus_tag LOCUS_24020 gene xpt 2239 2811 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500M2 protein_id gnl|my_center|LOCUS_24020 3333 2848 gene locus_tag LOCUS_24030 3333 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706396.1 protein_id gnl|my_center|LOCUS_24030 3905 3480 gene locus_tag LOCUS_24040 gene cycB 3905 3480 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_24040 4579 4049 gene locus_tag LOCUS_24050 4579 4049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_24050 5088 4714 gene locus_tag LOCUS_24060 5088 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098273.1 protein_id gnl|my_center|LOCUS_24060 6361 5063 gene locus_tag LOCUS_24070 gene dadA 6361 5063 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW4 protein_id gnl|my_center|LOCUS_24070 6513 7001 gene locus_tag LOCUS_24080 gene lrp 6513 7001 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_24080 7101 8423 gene locus_tag LOCUS_24090 7101 8423 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence166 1291 749 gene locus_tag LOCUS_24100 1291 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_24100 2490 1357 gene locus_tag LOCUS_24110 2490 1357 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087724.1 protein_id gnl|my_center|LOCUS_24110 2708 2923 gene locus_tag LOCUS_24120 2708 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_24120 3120 3590 gene locus_tag LOCUS_24130 3120 3590 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ5 protein_id gnl|my_center|LOCUS_24130 4018 3692 gene locus_tag LOCUS_24140 4018 3692 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_24140 4296 5213 gene locus_tag LOCUS_24150 gene argF 4296 5213 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 protein_id gnl|my_center|LOCUS_24150 5210 6319 gene locus_tag LOCUS_24160 5210 6319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_24160 6814 6323 gene locus_tag LOCUS_24170 gene tadA 6814 6323 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX04 protein_id gnl|my_center|LOCUS_24170 8202 6832 gene locus_tag LOCUS_24180 8202 6832 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence167 1739 1257 gene locus_tag LOCUS_24190 1739 1257 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_24190 2319 1834 gene locus_tag LOCUS_24200 gene slyD 2319 1834 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A3 protein_id gnl|my_center|LOCUS_24200 2564 3751 gene locus_tag LOCUS_24210 gene ackA 2564 3751 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A4 protein_id gnl|my_center|LOCUS_24210 3904 6000 gene locus_tag LOCUS_24220 gene pta 3904 6000 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_24220 6129 7034 gene locus_tag LOCUS_24230 6129 7034 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_24230 <8494 7044 gene locus_tag LOCUS_24240 <8494 7044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105270.1:two-component system response regulator >Feature sequence168 951 1187 gene locus_tag LOCUS_24250 951 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1259 2425 gene locus_tag LOCUS_24260 1259 2425 CDS product putative kinase Y4mE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55564 protein_id gnl|my_center|LOCUS_24260 2587 2958 gene locus_tag LOCUS_24270 2587 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104024.1 protein_id gnl|my_center|LOCUS_24270 2961 3146 gene locus_tag LOCUS_24280 2961 3146 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315517.1 protein_id gnl|my_center|LOCUS_24280 4126 3317 gene locus_tag LOCUS_24290 gene trpA 4126 3317 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_24290 5334 4123 gene locus_tag LOCUS_24300 gene trpB 5334 4123 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07345 protein_id gnl|my_center|LOCUS_24300 5544 6428 gene locus_tag LOCUS_24310 gene trpI 5544 6428 CDS product HTH-type transcriptional regulator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11720 protein_id gnl|my_center|LOCUS_24310 7581 6439 gene locus_tag LOCUS_24320 7581 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence169 <1 1731 gene locus_tag LOCUS_24330 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87UX7:alpha-1,4 glucan phosphorylase 1852 2862 gene locus_tag LOCUS_24340 gene fbp 1852 2862 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU73 protein_id gnl|my_center|LOCUS_24340 2866 3468 gene locus_tag LOCUS_24350 2866 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_24350 3529 3783 gene locus_tag LOCUS_24360 3529 3783 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403102.1 protein_id gnl|my_center|LOCUS_24360 3794 4333 gene locus_tag LOCUS_24370 gene blc 3794 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114468.1 protein_id gnl|my_center|LOCUS_24370 4773 4342 gene locus_tag LOCUS_24380 4773 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4855 5829 gene locus_tag LOCUS_24390 4855 5829 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_24390 5829 6266 gene locus_tag LOCUS_24400 gene dtd 5829 6266 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH6 protein_id gnl|my_center|LOCUS_24400 6684 6244 gene locus_tag LOCUS_24410 6684 6244 CDS product UPF0158 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB0 protein_id gnl|my_center|LOCUS_24410 7476 6769 gene locus_tag LOCUS_24420 7476 6769 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_24420 8273 7473 gene locus_tag LOCUS_24430 gene tatC 8273 7473 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY5 protein_id gnl|my_center|LOCUS_24430 >Feature sequence170 1042 2424 gene locus_tag LOCUS_24440 1042 2424 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 protein_id gnl|my_center|LOCUS_24440 2417 3367 gene locus_tag LOCUS_24450 2417 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3484 3786 gene locus_tag LOCUS_24460 3484 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4074 6707 gene locus_tag LOCUS_24470 gene mutS 4074 6707 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_24470 6848 7171 gene locus_tag LOCUS_24480 gene fdxA 6848 7171 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_24480 >Feature sequence171 <1 1286 gene locus_tag LOCUS_24490 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase 1374 1679 gene locus_tag LOCUS_24500 1374 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1743 1934 gene locus_tag LOCUS_24510 1743 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 3122 1941 gene locus_tag LOCUS_24520 3122 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_24520 5374 3179 gene locus_tag LOCUS_24530 5374 3179 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_24530 5556 7034 gene locus_tag LOCUS_24540 5556 7034 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037744.1 protein_id gnl|my_center|LOCUS_24540 7931 7038 gene locus_tag LOCUS_24550 7931 7038 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence172 3900 1828 gene locus_tag LOCUS_24560 gene prc 3900 1828 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_24560 4085 5047 gene locus_tag LOCUS_24570 4085 5047 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_24570 6375 5086 gene locus_tag LOCUS_24580 gene apeB 6375 5086 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_24580 7076 6441 gene locus_tag LOCUS_24590 gene rluA 7076 6441 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114801.1 protein_id gnl|my_center|LOCUS_24590 7523 7266 gene locus_tag LOCUS_24600 gene minE 7523 7266 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC6 protein_id gnl|my_center|LOCUS_24600 8335 7520 gene locus_tag LOCUS_24610 gene minD 8335 7520 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_24610 >Feature sequence173 <1 843 gene locus_tag LOCUS_24620 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266134.1:DNA protecting protein DprA 905 1462 gene locus_tag LOCUS_24630 gene tsaC 905 1462 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_24630 2450 1473 gene locus_tag LOCUS_24640 gene qor 2450 1473 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43903 protein_id gnl|my_center|LOCUS_24640 2592 3506 gene locus_tag LOCUS_24650 gene hemF 2592 3506 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_24650 3625 4011 gene locus_tag LOCUS_24660 3625 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4129 4380 gene locus_tag LOCUS_24670 4129 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4338 6158 gene locus_tag LOCUS_24680 4338 6158 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103731.1 protein_id gnl|my_center|LOCUS_24680 6164 7684 gene locus_tag LOCUS_24690 6164 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence174 <1 657 gene locus_tag LOCUS_24700 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889F7:selenide, water dikinase 657 1760 gene locus_tag LOCUS_24710 gene selU 657 1760 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_24710 1784 2068 gene locus_tag LOCUS_24720 1784 2068 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316607.1 protein_id gnl|my_center|LOCUS_24720 2220 2038 gene locus_tag LOCUS_24730 2220 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2219 3136 gene locus_tag LOCUS_24740 2219 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_24740 3258 4121 gene locus_tag LOCUS_24750 3258 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_24750 4118 6115 gene locus_tag LOCUS_24760 gene tgpA 4118 6115 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_24760 6233 7030 gene locus_tag LOCUS_24770 6233 7030 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_24770 <8188 7037 gene locus_tag LOCUS_24780 <8188 7037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110283.1:chemotaxis transducer >Feature sequence175 <1 840 gene locus_tag LOCUS_24790 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZZU6:acetylornithine deacetylase 870 2168 gene locus_tag LOCUS_24800 gene argA 870 2168 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_24800 4030 2456 gene locus_tag LOCUS_24810 gene gshA 4030 2456 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_24810 3917 4189 gene locus_tag LOCUS_24820 3917 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4527 4138 gene locus_tag LOCUS_24830 4527 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096263.1 protein_id gnl|my_center|LOCUS_24830 6842 4530 gene locus_tag LOCUS_24840 6842 4530 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_24840 <8104 6948 gene locus_tag LOCUS_24850 <8104 6948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817392.1:cellulose biosynthesis protein BcsC >Feature sequence176 420 4619 gene locus_tag LOCUS_24860 gene rpoC 420 4619 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN8 protein_id gnl|my_center|LOCUS_24860 4758 5129 gene locus_tag LOCUS_24870 gene rpsL 4758 5129 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_24870 5227 5697 gene locus_tag LOCUS_24880 gene rpsG 5227 5697 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X5 protein_id gnl|my_center|LOCUS_24880 5728 7833 gene locus_tag LOCUS_24890 gene fusA 5728 7833 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD2 protein_id gnl|my_center|LOCUS_24890 >Feature sequence177 1917 502 gene locus_tag LOCUS_24900 gene pykF 1917 502 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L4 protein_id gnl|my_center|LOCUS_24900 3209 1938 gene locus_tag LOCUS_24910 3209 1938 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_24910 4430 3540 gene locus_tag LOCUS_24920 4430 3540 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_24920 5275 4493 gene locus_tag LOCUS_24930 5275 4493 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L1 protein_id gnl|my_center|LOCUS_24930 7236 5455 gene locus_tag LOCUS_24940 gene gcl 7236 5455 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence178 1814 408 gene locus_tag LOCUS_24950 1814 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_24950 2023 2268 gene locus_tag LOCUS_24960 2023 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3847 2324 gene locus_tag LOCUS_24970 3847 2324 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 protein_id gnl|my_center|LOCUS_24970 4238 4738 gene locus_tag LOCUS_24980 gene folA 4238 4738 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E3 protein_id gnl|my_center|LOCUS_24980 4805 5452 gene locus_tag LOCUS_24990 4805 5452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710111.1 protein_id gnl|my_center|LOCUS_24990 5900 5445 gene locus_tag LOCUS_25000 5900 5445 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_25000 6426 5974 gene locus_tag LOCUS_25010 6426 5974 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105468.1 protein_id gnl|my_center|LOCUS_25010 6957 6556 gene locus_tag LOCUS_25020 6957 6556 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123521.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence179 22 295 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgcctgcggggaacgc 660 361 gene locus_tag LOCUS_25030 gene ygbF 660 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_404470.2 protein_id gnl|my_center|LOCUS_25030 1586 660 gene locus_tag LOCUS_25040 gene cas1 1586 660 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XWV9 protein_id gnl|my_center|LOCUS_25040 2400 1588 gene locus_tag LOCUS_25050 2400 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_25050 3086 2424 gene locus_tag LOCUS_25060 3086 2424 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_25060 3847 3083 gene locus_tag LOCUS_25070 3847 3083 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_25070 4884 3850 gene locus_tag LOCUS_25080 4884 3850 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_25080 5519 4881 gene locus_tag LOCUS_25090 5519 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 7081 5516 gene locus_tag LOCUS_25100 7081 5516 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602845.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence180 <1 1595 gene locus_tag LOCUS_25110 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXZ1:DNA polymerase III subunit alpha 1781 2731 gene locus_tag LOCUS_25120 gene accA 1781 2731 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M7 protein_id gnl|my_center|LOCUS_25120 3795 3073 gene locus_tag LOCUS_25130 3795 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086461.1 protein_id gnl|my_center|LOCUS_25130 4139 5431 gene locus_tag LOCUS_25140 gene tilS 4139 5431 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ3 protein_id gnl|my_center|LOCUS_25140 5706 7229 gene locus_tag LOCUS_25150 gene pyrG 5706 7229 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_25150 >Feature sequence181 <1 874 gene locus_tag LOCUS_25160 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246574.1:Fis family transcriptional regulator 1150 2145 gene locus_tag LOCUS_25170 gene dctP 1150 2145 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_25170 2409 3041 gene locus_tag LOCUS_25180 gene dctQ 2409 3041 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU17 protein_id gnl|my_center|LOCUS_25180 3038 4318 gene locus_tag LOCUS_25190 gene dctM 3038 4318 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_25190 5063 4455 gene locus_tag LOCUS_25200 5063 4455 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105413.1 protein_id gnl|my_center|LOCUS_25200 5324 6091 gene locus_tag LOCUS_25210 5324 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 protein_id gnl|my_center|LOCUS_25210 7651 6269 gene locus_tag LOCUS_25220 7651 6269 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706579.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence182 793 530 gene locus_tag LOCUS_25230 793 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1041 868 gene locus_tag LOCUS_25240 1041 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1315 2499 gene locus_tag LOCUS_25250 1315 2499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816300.1 protein_id gnl|my_center|LOCUS_25250 3128 2634 gene locus_tag LOCUS_25260 gene sprT 3128 2634 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ34 protein_id gnl|my_center|LOCUS_25260 3903 3202 gene locus_tag LOCUS_25270 3903 3202 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_25270 4661 4062 gene locus_tag LOCUS_25280 4661 4062 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_25280 5399 4803 gene locus_tag LOCUS_25290 5399 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_25290 5529 6353 gene locus_tag LOCUS_25300 gene ttcA 5529 6353 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_25300 >Feature sequence183 481 1890 gene locus_tag LOCUS_25310 gene pmpM 481 1890 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_25310 2617 1868 gene locus_tag LOCUS_25320 2617 1868 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ6 protein_id gnl|my_center|LOCUS_25320 2727 3683 gene locus_tag LOCUS_25330 2727 3683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_25330 4029 3616 gene locus_tag LOCUS_25340 4029 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5054 4194 gene locus_tag LOCUS_25350 gene speE 5054 4194 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB1 protein_id gnl|my_center|LOCUS_25350 5199 6086 gene locus_tag LOCUS_25360 gene alkA 5199 6086 CDS product 3-methyladenine DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_25360 6277 6083 gene locus_tag LOCUS_25370 6277 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 protein_id gnl|my_center|LOCUS_25370 6486 6277 gene locus_tag LOCUS_25380 6486 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_25380 7158 6613 gene locus_tag LOCUS_25390 gene mtnD 7158 6613 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 protein_id gnl|my_center|LOCUS_25390 <7748 7195 gene locus_tag LOCUS_25400 <7748 7195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVC0:methylthioribulose-1-phosphate dehydratase >Feature sequence184 <1 3090 gene locus_tag LOCUS_25410 <1 3090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52002:multidrug resistance protein MexB 3087 4523 gene locus_tag LOCUS_25420 gene oprM 3087 4523 CDS product outer membrane protein OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51487 protein_id gnl|my_center|LOCUS_25420 6395 4584 gene locus_tag LOCUS_25430 gene rhlE 6395 4584 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ94 protein_id gnl|my_center|LOCUS_25430 7474 6623 gene locus_tag LOCUS_25440 gene metF 7474 6623 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 protein_id gnl|my_center|LOCUS_25440 >Feature sequence185 423 644 gene locus_tag LOCUS_25450 423 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_25450 660 3167 gene locus_tag LOCUS_25460 660 3167 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_25460 3548 3189 gene locus_tag LOCUS_25470 3548 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 3817 3620 gene locus_tag LOCUS_25480 3817 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25480 4517 3822 gene locus_tag LOCUS_25490 4517 3822 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_25490 5315 4545 gene locus_tag LOCUS_25500 gene bdhA 5315 4545 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_25500 6753 5362 gene locus_tag LOCUS_25510 6753 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_25510 7046 7555 gene locus_tag LOCUS_25520 gene sixA 7046 7555 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence186 21 1332 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccgcaggcgcggggatgaaccg 1777 3288 gene locus_tag LOCUS_25530 1777 3288 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429812.1 protein_id gnl|my_center|LOCUS_25530 3477 4952 gene locus_tag LOCUS_25540 gene amn 3477 4952 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VZ0 protein_id gnl|my_center|LOCUS_25540 7055 4986 gene locus_tag LOCUS_25550 gene gcd 7055 4986 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537475.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25550 7423 7052 gene locus_tag LOCUS_25560 7423 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25560 >Feature sequence187 1502 162 gene locus_tag LOCUS_25570 1502 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114376.1 protein_id gnl|my_center|LOCUS_25570 2901 1600 gene locus_tag LOCUS_25580 gene phoR 2901 1600 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_25580 3677 2988 gene locus_tag LOCUS_25590 gene phoB 3677 2988 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_25590 4688 3798 gene locus_tag LOCUS_25600 gene ubiA 4688 3798 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_25600 5274 4735 gene locus_tag LOCUS_25610 gene ubiC 5274 4735 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_25610 5407 6357 gene locus_tag LOCUS_25620 5407 6357 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039910.1 protein_id gnl|my_center|LOCUS_25620 7208 6435 gene locus_tag LOCUS_25630 gene glcC 7208 6435 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence188 793 185 gene locus_tag LOCUS_25640 gene msrQ 793 185 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA5 protein_id gnl|my_center|LOCUS_25640 1797 793 gene locus_tag LOCUS_25650 gene msrP 1797 793 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N2 protein_id gnl|my_center|LOCUS_25650 2694 1855 gene locus_tag LOCUS_25660 gene pssA 2694 1855 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_25660 3856 2840 gene locus_tag LOCUS_25670 gene ilvC 3856 2840 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_25670 4426 3935 gene locus_tag LOCUS_25680 gene ilvH 4426 3935 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_25680 6162 4429 gene locus_tag LOCUS_25690 gene ilvI 6162 4429 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_25690 6558 6995 gene locus_tag LOCUS_25700 6558 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_25700 7302 6982 gene locus_tag LOCUS_25710 7302 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence189 968 1954 gene locus_tag LOCUS_25720 968 1954 CDS product renalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888A4 protein_id gnl|my_center|LOCUS_25720 2039 2881 gene locus_tag LOCUS_25730 gene pomA 2039 2881 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_25730 2883 3599 gene locus_tag LOCUS_25740 2883 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 4538 3609 gene locus_tag LOCUS_25750 4538 3609 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930758.1 protein_id gnl|my_center|LOCUS_25750 4462 4632 gene locus_tag LOCUS_25760 4462 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4732 5913 gene locus_tag LOCUS_25770 4732 5913 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087405.1 protein_id gnl|my_center|LOCUS_25770 5917 7137 gene locus_tag LOCUS_25780 5917 7137 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence190 3198 1786 gene locus_tag LOCUS_25790 gene narK2 3198 1786 CDS product nitrite extrusion protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105301.1 protein_id gnl|my_center|LOCUS_25790 4479 3217 gene locus_tag LOCUS_25800 4479 3217 CDS product nitrite extrusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_25800 4709 6517 gene locus_tag LOCUS_25810 gene narX 4709 6517 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD66 protein_id gnl|my_center|LOCUS_25810 6514 7161 gene locus_tag LOCUS_25820 gene narL 6514 7161 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence191 9 84 gene locus_tag LOCUS_t00300 9 84 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 129 497 gene locus_tag LOCUS_25830 gene secE 129 497 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN1 protein_id gnl|my_center|LOCUS_25830 507 1040 gene locus_tag LOCUS_25840 gene nusG 507 1040 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_25840 1150 1581 gene locus_tag LOCUS_25850 gene rplK 1150 1581 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_25850 1581 2276 gene locus_tag LOCUS_25860 gene rplA 1581 2276 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_25860 2469 2969 gene locus_tag LOCUS_25870 gene rplJ 2469 2969 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC7 protein_id gnl|my_center|LOCUS_25870 3045 3413 gene locus_tag LOCUS_25880 gene rplL 3045 3413 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC8 protein_id gnl|my_center|LOCUS_25880 >Feature sequence192 1267 578 gene locus_tag LOCUS_25890 1267 578 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_25890 1799 1389 gene locus_tag LOCUS_25900 1799 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1853 2797 gene locus_tag LOCUS_25910 1853 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_25910 2953 3366 gene locus_tag LOCUS_25920 2953 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4183 3443 gene locus_tag LOCUS_25930 4183 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112760.1 protein_id gnl|my_center|LOCUS_25930 6181 4223 gene locus_tag LOCUS_25940 6181 4223 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_25940 6284 6967 gene locus_tag LOCUS_25950 6284 6967 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence193 <1 1463 gene locus_tag LOCUS_25960 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNP0:transporter 1704 1919 gene locus_tag LOCUS_25970 1704 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1946 3031 gene locus_tag LOCUS_25980 gene hpd 1946 3031 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I576 protein_id gnl|my_center|LOCUS_25980 3215 4354 gene locus_tag LOCUS_25990 3215 4354 CDS product putative dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSB4 protein_id gnl|my_center|LOCUS_25990 4354 5337 gene locus_tag LOCUS_26000 4354 5337 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_26000 5428 6078 gene locus_tag LOCUS_26010 gene maiA 5428 6078 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence194 1350 715 gene locus_tag LOCUS_26020 gene senC 1350 715 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_26020 2267 1368 gene locus_tag LOCUS_26030 gene cyoE1 2267 1368 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_26030 3342 2284 gene locus_tag LOCUS_26040 3342 2284 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_26040 3987 3406 gene locus_tag LOCUS_26050 3987 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_26050 4739 3984 gene locus_tag LOCUS_26060 4739 3984 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_26060 4690 4962 gene locus_tag LOCUS_26070 4690 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 5864 4968 gene locus_tag LOCUS_26080 gene coIII 5864 4968 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_26080 6421 5861 gene locus_tag LOCUS_26090 6421 5861 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_26090 7502 6540 gene locus_tag LOCUS_26100 7502 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence195 1399 926 gene locus_tag LOCUS_26110 gene ispF 1399 926 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L7 protein_id gnl|my_center|LOCUS_26110 1319 1528 gene locus_tag LOCUS_26120 1319 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1572 1874 gene locus_tag LOCUS_26130 1572 1874 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405921.1 protein_id gnl|my_center|LOCUS_26130 1924 2973 gene locus_tag LOCUS_26140 gene xenB 1924 2973 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_26140 3424 3128 gene locus_tag LOCUS_26150 3424 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4414 3569 gene locus_tag LOCUS_26160 4414 3569 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY02 protein_id gnl|my_center|LOCUS_26160 5616 4501 gene locus_tag LOCUS_26170 gene adhC 5616 4501 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY01 protein_id gnl|my_center|LOCUS_26170 5726 6619 gene locus_tag LOCUS_26180 5726 6619 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 protein_id gnl|my_center|LOCUS_26180 6756 7067 gene locus_tag LOCUS_26190 6756 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence196 343 990 gene locus_tag LOCUS_26200 343 990 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_26200 1768 998 gene locus_tag LOCUS_26210 gene rsmJ 1768 998 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_26210 2523 1828 gene locus_tag LOCUS_26220 2523 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_26220 3437 2580 gene locus_tag LOCUS_26230 3437 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_26230 3788 3441 gene locus_tag LOCUS_26240 3788 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098661.1 protein_id gnl|my_center|LOCUS_26240 4528 3851 gene locus_tag LOCUS_26250 4528 3851 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_26250 5304 4657 gene locus_tag LOCUS_26260 gene adk 5304 4657 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_26260 <7416 5536 gene locus_tag LOCUS_26270 <7416 5536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWV3:phosphoenolpyruvate carboxylase >Feature sequence197 1347 13 gene locus_tag LOCUS_26280 1347 13 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268822.1 protein_id gnl|my_center|LOCUS_26280 1519 2091 gene locus_tag LOCUS_26290 1519 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_26290 2093 2983 gene locus_tag LOCUS_26300 2093 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_26300 5039 2988 gene locus_tag LOCUS_26310 gene bifA 5039 2988 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_26310 5886 5308 gene locus_tag LOCUS_26320 gene sodB 5886 5308 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_26320 6836 6225 gene locus_tag LOCUS_26330 6836 6225 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence198 2801 1650 gene locus_tag LOCUS_26340 2801 1650 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038782.1 protein_id gnl|my_center|LOCUS_26340 4155 2914 gene locus_tag LOCUS_26350 gene rfbD 4155 2914 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_26350 5327 4143 gene locus_tag LOCUS_26360 5327 4143 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_26360 5742 6797 gene locus_tag LOCUS_26370 gene galE 5742 6797 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104263.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence199 1090 164 gene locus_tag LOCUS_26380 gene metR 1090 164 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_26380 1327 3633 gene locus_tag LOCUS_26390 gene metE 1327 3633 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_26390 5191 3647 gene locus_tag LOCUS_26400 gene glpD 5191 3647 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 protein_id gnl|my_center|LOCUS_26400 5311 5781 gene locus_tag LOCUS_26410 5311 5781 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL2 protein_id gnl|my_center|LOCUS_26410 7249 5789 gene locus_tag LOCUS_26420 gene mltF 7249 5789 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_26420 >Feature sequence200 722 21 gene locus_tag LOCUS_26430 722 21 CDS product high-affinity branched-chain amino acid transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPP3 protein_id gnl|my_center|LOCUS_26430 1493 726 gene locus_tag LOCUS_26440 gene braF 1493 726 CDS product high-affinity branched-chain amino acid transport ATP-binding protein BraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21629 protein_id gnl|my_center|LOCUS_26440 2746 1490 gene locus_tag LOCUS_26450 gene livM 2746 1490 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268694.1 protein_id gnl|my_center|LOCUS_26450 3666 2743 gene locus_tag LOCUS_26460 gene braD 3666 2743 CDS product high-affinity branched-chain amino acid transport system permease protein BraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21627 protein_id gnl|my_center|LOCUS_26460 5035 3917 gene locus_tag LOCUS_26470 gene braC 5035 3917 CDS product leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21175 protein_id gnl|my_center|LOCUS_26470 5235 5546 gene locus_tag LOCUS_26480 5235 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_26480 5646 7058 gene locus_tag LOCUS_26490 gene atpD2 5646 7058 CDS product ATP synthase subunit beta 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IW3 protein_id gnl|my_center|LOCUS_26490 >Feature sequence201 <1 1362 gene locus_tag LOCUS_26500 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2W9:phosphoenolpyruvate synthase 1485 1973 gene locus_tag LOCUS_26510 1485 1973 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_26510 2039 3025 gene locus_tag LOCUS_26520 gene cmaX 2039 3025 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_26520 3080 3322 gene locus_tag LOCUS_26530 gene crfX 3080 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120308.1 protein_id gnl|my_center|LOCUS_26530 3325 4149 gene locus_tag LOCUS_26540 3325 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_26540 4228 4818 gene locus_tag LOCUS_26550 4228 4818 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_26550 4918 5907 gene locus_tag LOCUS_26560 gene oprF 4918 5907 CDS product outer membrane porin F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13794 protein_id gnl|my_center|LOCUS_26560 <7332 6125 gene locus_tag LOCUS_26570 <7332 6125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2V5:aconitate hydratase B >Feature sequence202 520 1506 gene locus_tag LOCUS_26580 520 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_26580 2602 1520 gene locus_tag LOCUS_26590 2602 1520 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114591.1 protein_id gnl|my_center|LOCUS_26590 3474 2683 gene locus_tag LOCUS_26600 3474 2683 CDS product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097863.1 protein_id gnl|my_center|LOCUS_26600 4591 3734 gene locus_tag LOCUS_26610 4591 3734 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_26610 5397 4588 gene locus_tag LOCUS_26620 5397 4588 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_26620 5973 5533 gene locus_tag LOCUS_26630 5973 5533 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_26630 6483 6025 gene locus_tag LOCUS_26640 6483 6025 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_26640 6821 6480 gene locus_tag LOCUS_26650 6821 6480 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_26650 7277 6843 gene locus_tag LOCUS_26660 7277 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence203 216 1835 gene locus_tag LOCUS_26670 gene mcp40H-26 216 1835 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_26670 3482 1866 gene locus_tag LOCUS_26680 3482 1866 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I6 protein_id gnl|my_center|LOCUS_26680 3378 3611 gene locus_tag LOCUS_26690 3378 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 4863 3640 gene locus_tag LOCUS_26700 gene araJ 4863 3640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence204 157 483 gene locus_tag LOCUS_26710 157 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 933 508 gene locus_tag LOCUS_26720 933 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091632.1 protein_id gnl|my_center|LOCUS_26720 1183 1019 gene locus_tag LOCUS_26730 1183 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1339 1740 gene locus_tag LOCUS_26740 1339 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1813 3069 gene locus_tag LOCUS_26750 1813 3069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_26750 3705 3070 gene locus_tag LOCUS_26760 3705 3070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088941.1 protein_id gnl|my_center|LOCUS_26760 4459 3698 gene locus_tag LOCUS_26770 4459 3698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532065.1 protein_id gnl|my_center|LOCUS_26770 5442 4456 gene locus_tag LOCUS_26780 5442 4456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969567.1 protein_id gnl|my_center|LOCUS_26780 5967 5521 gene locus_tag LOCUS_26790 5967 5521 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113165.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence205 3113 2199 gene locus_tag LOCUS_26800 3113 2199 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 protein_id gnl|my_center|LOCUS_26800 3274 4698 gene locus_tag LOCUS_26810 gene aspA 3274 4698 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTD7 protein_id gnl|my_center|LOCUS_26810 4760 6019 gene locus_tag LOCUS_26820 4760 6019 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_26820 <7183 6040 gene locus_tag LOCUS_26830 <7183 6040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114099.1:transcriptional regulator >Feature sequence206 <1 1487 gene locus_tag LOCUS_26840 <1 1487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246501.1:phospholipase D family protein 1615 2358 gene locus_tag LOCUS_26850 1615 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_26850 2925 2371 gene locus_tag LOCUS_26860 2925 2371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_26860 4564 2999 gene locus_tag LOCUS_26870 4564 2999 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_26870 6239 4725 gene locus_tag LOCUS_26880 6239 4725 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113884.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence207 <1 775 gene locus_tag LOCUS_26890 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268741.1:glycosyl transferase family 51 1108 890 gene locus_tag LOCUS_26900 1108 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1010 1609 gene locus_tag LOCUS_26910 1010 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2508 1582 gene locus_tag LOCUS_26920 2508 1582 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065109.1 protein_id gnl|my_center|LOCUS_26920 2652 4157 gene locus_tag LOCUS_26930 gene mmsA 2652 4157 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 protein_id gnl|my_center|LOCUS_26930 4200 4973 gene locus_tag LOCUS_26940 4200 4973 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268167.1 protein_id gnl|my_center|LOCUS_26940 5139 6038 gene locus_tag LOCUS_26950 5139 6038 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYL2 protein_id gnl|my_center|LOCUS_26950 6031 7122 gene locus_tag LOCUS_26960 6031 7122 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267228.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence208 <1 1246 gene locus_tag LOCUS_26970 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706304.1:peptide synthetase 3007 1334 gene locus_tag LOCUS_26980 3007 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 4264 3491 gene locus_tag LOCUS_26990 4264 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5011 4271 gene locus_tag LOCUS_27000 5011 4271 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104582.1 protein_id gnl|my_center|LOCUS_27000 5805 5077 gene locus_tag LOCUS_27010 5805 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 6647 5802 gene locus_tag LOCUS_27020 6647 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104581.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence209 <1 728 gene locus_tag LOCUS_27030 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104372.1:FruR family transcriptional regulator 900 1205 gene locus_tag LOCUS_27040 900 1205 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770099.1 protein_id gnl|my_center|LOCUS_27040 1202 1951 gene locus_tag LOCUS_27050 gene cmoM 1202 1951 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYR1 protein_id gnl|my_center|LOCUS_27050 1968 2597 gene locus_tag LOCUS_27060 1968 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102259.1 protein_id gnl|my_center|LOCUS_27060 2655 3212 gene locus_tag LOCUS_27070 2655 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095282.1 protein_id gnl|my_center|LOCUS_27070 3307 3756 gene locus_tag LOCUS_27080 3307 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095321.1 protein_id gnl|my_center|LOCUS_27080 4688 3768 gene locus_tag LOCUS_27090 4688 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_27090 4907 5200 gene locus_tag LOCUS_27100 4907 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 protein_id gnl|my_center|LOCUS_27100 5268 6647 gene locus_tag LOCUS_27110 5268 6647 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence210 <1 667 gene locus_tag LOCUS_27120 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038863.1:integrating conjugative element protein 657 2090 gene locus_tag LOCUS_27130 657 2090 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_27130 2071 2505 gene locus_tag LOCUS_27140 2071 2505 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_27140 2505 5393 gene locus_tag LOCUS_27150 2505 5393 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_27150 5407 6150 gene locus_tag LOCUS_27160 5407 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_27160 6346 6840 gene locus_tag LOCUS_27170 6346 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence211 1040 261 gene locus_tag LOCUS_27180 1040 261 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 protein_id gnl|my_center|LOCUS_27180 1181 2224 gene locus_tag LOCUS_27190 1181 2224 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_27190 2442 3830 gene locus_tag LOCUS_27200 2442 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_27200 3932 4402 gene locus_tag LOCUS_27210 gene moaC 3932 4402 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_27210 4399 4647 gene locus_tag LOCUS_27220 gene moaD 4399 4647 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX96 protein_id gnl|my_center|LOCUS_27220 4650 5108 gene locus_tag LOCUS_27230 gene moaE 4650 5108 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_27230 5277 5113 gene locus_tag LOCUS_27240 5277 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 6805 5399 gene locus_tag LOCUS_27250 gene rhlB 6805 5399 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_27250 >Feature sequence212 <1 541 gene locus_tag LOCUS_27260 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q880D3:protein TonB 574 2535 gene locus_tag LOCUS_27270 574 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_27270 2848 2570 gene locus_tag LOCUS_27280 gene ppiC-2 2848 2570 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880W6 protein_id gnl|my_center|LOCUS_27280 3025 4155 gene locus_tag LOCUS_27290 3025 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4207 5484 gene locus_tag LOCUS_27300 gene yiaN 4207 5484 CDS product 2,3-diketo-L-gulonate TRAP transporter large permease protein YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37675 protein_id gnl|my_center|LOCUS_27300 5525 6541 gene locus_tag LOCUS_27310 5525 6541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887001.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence213 807 397 gene locus_tag LOCUS_27320 gene yedX 807 397 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIG6 protein_id gnl|my_center|LOCUS_27320 1327 824 gene locus_tag LOCUS_27330 1327 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207181.1 protein_id gnl|my_center|LOCUS_27330 1546 2142 gene locus_tag LOCUS_27340 1546 2142 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407375.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27340 2139 3497 gene locus_tag LOCUS_27350 2139 3497 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099516.1 protein_id gnl|my_center|LOCUS_27350 3574 4371 gene locus_tag LOCUS_27360 3574 4371 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101332.1 protein_id gnl|my_center|LOCUS_27360 4472 5710 gene locus_tag LOCUS_27370 4472 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 6321 5707 gene locus_tag LOCUS_27380 6321 5707 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376205.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence214 1885 1808 gene locus_tag LOCUS_t00310 1885 1808 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3449 2307 gene locus_tag LOCUS_27390 3449 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_27390 3600 3818 gene locus_tag LOCUS_27400 3600 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719741.1 protein_id gnl|my_center|LOCUS_27400 3885 4610 gene locus_tag LOCUS_27410 3885 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112501.1 protein_id gnl|my_center|LOCUS_27410 4698 5468 gene locus_tag LOCUS_27420 4698 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 5549 6094 gene locus_tag LOCUS_27430 5549 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268647.1 protein_id gnl|my_center|LOCUS_27430 6299 6111 gene locus_tag LOCUS_27440 6299 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence215 1644 736 gene locus_tag LOCUS_27450 1644 736 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968174.1 protein_id gnl|my_center|LOCUS_27450 1762 2484 gene locus_tag LOCUS_27460 gene azoR 1762 2484 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 protein_id gnl|my_center|LOCUS_27460 2561 2911 gene locus_tag LOCUS_27470 2561 2911 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_27470 3050 3745 gene locus_tag LOCUS_27480 3050 3745 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 protein_id gnl|my_center|LOCUS_27480 4505 3762 gene locus_tag LOCUS_27490 4505 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_27490 5079 7046 gene locus_tag LOCUS_27500 5079 7046 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence216 1830 469 gene locus_tag LOCUS_27510 1830 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_27510 3821 1923 gene locus_tag LOCUS_27520 3821 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 protein_id gnl|my_center|LOCUS_27520 4808 4251 gene locus_tag LOCUS_27530 4808 4251 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_27530 5033 5671 gene locus_tag LOCUS_27540 gene upp 5033 5671 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU7 protein_id gnl|my_center|LOCUS_27540 5674 6933 gene locus_tag LOCUS_27550 gene uraA 5674 6933 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094970.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence217 2303 474 gene locus_tag LOCUS_27560 2303 474 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_27560 3486 2686 gene locus_tag LOCUS_27570 3486 2686 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L8 protein_id gnl|my_center|LOCUS_27570 4337 3507 gene locus_tag LOCUS_27580 4337 3507 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_27580 5577 4363 gene locus_tag LOCUS_27590 gene trpS-1 5577 4363 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_27590 6244 5621 gene locus_tag LOCUS_27600 6244 5621 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_27600 <6946 6257 gene locus_tag LOCUS_27610 <6946 6257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767709.1:phosphatase >Feature sequence218 3232 644 gene locus_tag LOCUS_27620 gene ndvB 3232 644 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_27620 3403 4212 gene locus_tag LOCUS_27630 3403 4212 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_27630 4413 5702 gene locus_tag LOCUS_27640 gene oprO 4413 5702 CDS product porin O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32977 protein_id gnl|my_center|LOCUS_27640 >Feature sequence219 1440 511 gene locus_tag LOCUS_27650 1440 511 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_27650 1544 2578 gene locus_tag LOCUS_27660 1544 2578 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 protein_id gnl|my_center|LOCUS_27660 2568 4121 gene locus_tag LOCUS_27670 2568 4121 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130539.1 protein_id gnl|my_center|LOCUS_27670 6159 4144 gene locus_tag LOCUS_27680 gene uvrB 6159 4144 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_27680 >Feature sequence220 3318 2428 gene locus_tag LOCUS_27690 gene malG 3318 2428 CDS product maltose transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_27690 4885 3329 gene locus_tag LOCUS_27700 gene malF 4885 3329 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705559.1 protein_id gnl|my_center|LOCUS_27700 6139 4952 gene locus_tag LOCUS_27710 gene malE 6139 4952 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence221 331 804 gene locus_tag LOCUS_27720 331 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093155.1 protein_id gnl|my_center|LOCUS_27720 891 2204 gene locus_tag LOCUS_27730 gene miaB 891 2204 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_27730 2345 3349 gene locus_tag LOCUS_27740 2345 3349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_27740 3346 3828 gene locus_tag LOCUS_27750 gene ybeY 3346 3828 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX9 protein_id gnl|my_center|LOCUS_27750 3839 4687 gene locus_tag LOCUS_27760 3839 4687 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_27760 4814 6331 gene locus_tag LOCUS_27770 gene lnt 4814 6331 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_27770 >Feature sequence222 408 1577 gene locus_tag LOCUS_27780 408 1577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_27780 1657 2652 gene locus_tag LOCUS_27790 gene rlmF 1657 2652 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_27790 2847 2656 gene locus_tag LOCUS_27800 2847 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4324 3110 gene locus_tag LOCUS_27810 4324 3110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_27810 4446 5453 gene locus_tag LOCUS_27820 4446 5453 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI3 protein_id gnl|my_center|LOCUS_27820 5461 6282 gene locus_tag LOCUS_27830 5461 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704814.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence223 169 462 gene locus_tag LOCUS_27840 169 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719753.1 protein_id gnl|my_center|LOCUS_27840 2242 473 gene locus_tag LOCUS_27850 2242 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_27850 2876 2388 gene locus_tag LOCUS_27860 2876 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_27860 4130 3063 gene locus_tag LOCUS_27870 gene hemE 4130 3063 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_27870 5664 4246 gene locus_tag LOCUS_27880 gene gltD 5664 4246 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_27880 <6568 5754 gene locus_tag LOCUS_27890 <6568 5754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence224 449 2068 gene locus_tag LOCUS_27900 449 2068 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_27900 2781 2065 gene locus_tag LOCUS_27910 2781 2065 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268601.1 protein_id gnl|my_center|LOCUS_27910 2922 4415 gene locus_tag LOCUS_27920 2922 4415 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_27920 4529 5713 gene locus_tag LOCUS_27930 4529 5713 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_27930 <6555 5929 gene locus_tag LOCUS_27940 <6555 5929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQ79:fumarate hydratase class II >Feature sequence225 990 196 gene locus_tag LOCUS_27950 gene thiD 990 196 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_27950 1258 3249 gene locus_tag LOCUS_27960 gene ladS 1258 3249 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_27960 3370 5013 gene locus_tag LOCUS_27970 3370 5013 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_27970 5012 6517 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcaggcgcggggatgaaccg >Feature sequence226 141 539 gene locus_tag LOCUS_27980 141 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_27980 582 1760 gene locus_tag LOCUS_27990 582 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_27990 2296 1781 gene locus_tag LOCUS_28000 2296 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_28000 3072 2290 gene locus_tag LOCUS_28010 3072 2290 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619831.1 protein_id gnl|my_center|LOCUS_28010 3592 3113 gene locus_tag LOCUS_28020 3592 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390927.1 protein_id gnl|my_center|LOCUS_28020 3789 4229 gene locus_tag LOCUS_28030 3789 4229 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_28030 4963 4268 gene locus_tag LOCUS_28040 4963 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_28040 <6527 5085 gene locus_tag LOCUS_28050 <6527 5085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113976.1:ABC transporter ATP-binding protein >Feature sequence227 1318 404 gene locus_tag LOCUS_28060 1318 404 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 protein_id gnl|my_center|LOCUS_28060 2239 1439 gene locus_tag LOCUS_28070 gene narI 2239 1439 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_28070 2984 2232 gene locus_tag LOCUS_28080 2984 2232 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 protein_id gnl|my_center|LOCUS_28080 4525 2987 gene locus_tag LOCUS_28090 gene narH 4525 2987 CDS product respiratory nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_28090 <6498 4537 gene locus_tag LOCUS_28100 <6498 4537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105302.1:nitrate reductase subunit alpha >Feature sequence228 774 307 gene locus_tag LOCUS_28110 gene nrdR 774 307 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_28110 892 1314 gene locus_tag LOCUS_28120 892 1314 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379143.1 protein_id gnl|my_center|LOCUS_28120 1311 1979 gene locus_tag LOCUS_28130 1311 1979 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 protein_id gnl|my_center|LOCUS_28130 1976 2512 gene locus_tag LOCUS_28140 gene ligT 1976 2512 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY3 protein_id gnl|my_center|LOCUS_28140 2755 2519 gene locus_tag LOCUS_28150 2755 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092358.1 protein_id gnl|my_center|LOCUS_28150 3950 2727 gene locus_tag LOCUS_28160 3950 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098565.1 protein_id gnl|my_center|LOCUS_28160 4137 5006 gene locus_tag LOCUS_28170 4137 5006 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_28170 5354 5013 gene locus_tag LOCUS_28180 5354 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269049.1 protein_id gnl|my_center|LOCUS_28180 5464 6060 gene locus_tag LOCUS_28190 5464 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence229 <1 971 gene locus_tag LOCUS_28200 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004152116.1:ATPase 989 1162 gene locus_tag LOCUS_28210 989 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1223 3103 gene locus_tag LOCUS_28220 gene ftsH 1223 3103 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_28220 3100 3540 gene locus_tag LOCUS_28230 gene trx 3100 3540 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_28230 3547 5253 gene locus_tag LOCUS_28240 3547 5253 CDS product glutathione-regulated potassium-efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706148.1 protein_id gnl|my_center|LOCUS_28240 5477 6043 gene locus_tag LOCUS_28250 5477 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28250 6019 6273 gene locus_tag LOCUS_28260 6019 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28260 >Feature sequence230 <1 908 gene locus_tag LOCUS_28270 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706307.1:non-ribosomal peptide synthetase 922 1674 gene locus_tag LOCUS_28280 922 1674 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706306.1 protein_id gnl|my_center|LOCUS_28280 1683 6236 gene locus_tag LOCUS_28290 1683 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence231 826 233 gene locus_tag LOCUS_28300 826 233 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6A8 protein_id gnl|my_center|LOCUS_28300 1245 823 gene locus_tag LOCUS_28310 1245 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_28310 1871 1272 gene locus_tag LOCUS_28320 1871 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_28320 3020 1881 gene locus_tag LOCUS_28330 gene metX 3020 1881 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_28330 5054 3078 gene locus_tag LOCUS_28340 5054 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_28340 5823 5233 gene locus_tag LOCUS_28350 5823 5233 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 protein_id gnl|my_center|LOCUS_28350 <6345 5833 gene locus_tag LOCUS_28360 <6345 5833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P22008:pyrroline-5-carboxylate reductase >Feature sequence232 327 121 gene locus_tag LOCUS_28370 327 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2768 369 gene locus_tag LOCUS_28380 2768 369 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_28380 3274 2768 gene locus_tag LOCUS_28390 3274 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_28390 4697 3285 gene locus_tag LOCUS_28400 4697 3285 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_28400 5754 4837 gene locus_tag LOCUS_28410 gene ccoP1 5754 4837 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_28410 5937 5755 gene locus_tag LOCUS_28420 gene ccoQ2 5937 5755 CDS product cytochrome C oxidase cbb3-type subunit CcoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence233 <1 673 gene locus_tag LOCUS_28430 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112769.1:1-acyl-sn-glycerol-3-phosphate acyltransferase 699 1280 gene locus_tag LOCUS_28440 699 1280 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_28440 2044 1268 gene locus_tag LOCUS_28450 2044 1268 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_28450 2592 2140 gene locus_tag LOCUS_28460 2592 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH1 protein_id gnl|my_center|LOCUS_28460 2767 3390 gene locus_tag LOCUS_28470 2767 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707082.1 protein_id gnl|my_center|LOCUS_28470 3448 4158 gene locus_tag LOCUS_28480 gene folM 3448 4158 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_28480 4172 4546 gene locus_tag LOCUS_28490 gene folX 4172 4546 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_28490 4634 4927 gene locus_tag LOCUS_28500 4634 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_28500 4924 5259 gene locus_tag LOCUS_28510 4924 5259 CDS product type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719767.1 protein_id gnl|my_center|LOCUS_28510 5460 6248 gene locus_tag LOCUS_28520 gene cysZ 5460 6248 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXQ1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence234 <1 1357 gene locus_tag LOCUS_28530 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I104:thiol:disulfide interchange protein DsbD 2 1357 2172 gene locus_tag LOCUS_28540 1357 2172 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_28540 2169 2930 gene locus_tag LOCUS_28550 gene dsbG 2169 2930 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_28550 4104 3433 gene locus_tag LOCUS_28560 4104 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_28560 <6314 4142 gene locus_tag LOCUS_28570 <6314 4142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXW7:glycerol-3-phosphate acyltransferase >Feature sequence235 833 666 gene locus_tag LOCUS_28580 833 666 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 protein_id gnl|my_center|LOCUS_28580 2653 950 gene locus_tag LOCUS_28590 2653 950 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_28590 5068 2885 gene locus_tag LOCUS_28600 gene glcB2 5068 2885 CDS product malate synthase G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z72 protein_id gnl|my_center|LOCUS_28600 5493 5089 gene locus_tag LOCUS_28610 gene glcG 5493 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 protein_id gnl|my_center|LOCUS_28610 <6312 5637 gene locus_tag LOCUS_28620 <6312 5637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52074:glycolate oxidase iron-sulfur subunit >Feature sequence236 966 640 gene locus_tag LOCUS_28630 966 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1679 963 gene locus_tag LOCUS_28640 1679 963 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_28640 2376 1813 gene locus_tag LOCUS_28650 2376 1813 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119682.1 protein_id gnl|my_center|LOCUS_28650 2607 6068 gene locus_tag LOCUS_28660 2607 6068 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence237 327 40 gene locus_tag LOCUS_28670 327 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 450 833 gene locus_tag LOCUS_28680 450 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251963.2 protein_id gnl|my_center|LOCUS_28680 2623 848 gene locus_tag LOCUS_28690 2623 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086721.1 protein_id gnl|my_center|LOCUS_28690 3987 2692 gene locus_tag LOCUS_28700 3987 2692 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_28700 4121 4936 gene locus_tag LOCUS_28710 4121 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_28710 5634 4939 gene locus_tag LOCUS_28720 5634 4939 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_28720 5954 5643 gene locus_tag LOCUS_28730 5954 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098204.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence238 348 653 gene locus_tag LOCUS_28740 348 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28740 665 814 gene locus_tag LOCUS_28750 665 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1302 871 gene locus_tag LOCUS_28760 1302 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_28760 2487 1330 gene locus_tag LOCUS_28770 2487 1330 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_28770 4478 2688 gene locus_tag LOCUS_28780 4478 2688 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114060.1 protein_id gnl|my_center|LOCUS_28780 5716 4475 gene locus_tag LOCUS_28790 5716 4475 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114059.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence239 4479 772 gene locus_tag LOCUS_28800 4479 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 5289 4633 gene locus_tag LOCUS_28810 5289 4633 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_28810 6048 5404 gene locus_tag LOCUS_28820 6048 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence240 1716 1165 gene locus_tag LOCUS_28830 1716 1165 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_28830 2009 3109 gene locus_tag LOCUS_28840 2009 3109 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_28840 3611 3186 gene locus_tag LOCUS_28850 gene osmC 3611 3186 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_28850 3968 3654 gene locus_tag LOCUS_28860 3968 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096280.1 protein_id gnl|my_center|LOCUS_28860 <6129 4040 gene locus_tag LOCUS_28870 <6129 4040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268130.1:PAS domain-containing sensor histidine kinase >Feature sequence241 <1 833 gene locus_tag LOCUS_28880 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267165.1:carbon-nitrogen hydrolase 830 1867 gene locus_tag LOCUS_28890 830 1867 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267164.1 protein_id gnl|my_center|LOCUS_28890 2280 2131 gene locus_tag LOCUS_28900 2280 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3304 2297 gene locus_tag LOCUS_28910 gene cioB 3304 2297 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 protein_id gnl|my_center|LOCUS_28910 4746 3307 gene locus_tag LOCUS_28920 gene cioA 4746 3307 CDS product cyanide insensitive terminal oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 protein_id gnl|my_center|LOCUS_28920 4910 5203 gene locus_tag LOCUS_28930 4910 5203 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 protein_id gnl|my_center|LOCUS_28930 5873 5229 gene locus_tag LOCUS_28940 5873 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence242 723 1229 gene locus_tag LOCUS_28950 gene yfgH 723 1229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602838.1 protein_id gnl|my_center|LOCUS_28950 1233 1760 gene locus_tag LOCUS_28960 1233 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1807 2133 gene locus_tag LOCUS_28970 1807 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2966 2205 gene locus_tag LOCUS_28980 2966 2205 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A334 protein_id gnl|my_center|LOCUS_28980 3892 2963 gene locus_tag LOCUS_28990 3892 2963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_28990 4057 5385 gene locus_tag LOCUS_29000 4057 5385 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810093.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence243 1336 68 gene locus_tag LOCUS_29010 gene ltrA 1336 68 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_29010 2368 1829 gene locus_tag LOCUS_29020 2368 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3361 2423 gene locus_tag LOCUS_29030 3361 2423 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526295.1 protein_id gnl|my_center|LOCUS_29030 4471 3482 gene locus_tag LOCUS_29040 gene dctP 4471 3482 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_29040 5353 4526 gene locus_tag LOCUS_29050 5353 4526 CDS product acyl-CoA lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 protein_id gnl|my_center|LOCUS_29050 <6048 5374 gene locus_tag LOCUS_29060 <6048 5374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085918.1:CoA transferase >Feature sequence244 <1 583 gene locus_tag LOCUS_29070 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXL8:exodeoxyribonuclease 7 large subunit 653 1477 gene locus_tag LOCUS_29080 653 1477 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_29080 1494 2036 gene locus_tag LOCUS_29090 1494 2036 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_29090 2129 3421 gene locus_tag LOCUS_29100 2129 3421 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_29100 5764 3566 gene locus_tag LOCUS_29110 gene oprC 5764 3566 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence245 <1 1572 gene locus_tag LOCUS_29120 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK3:transcription-repair-coupling factor 1582 2103 gene locus_tag LOCUS_29130 1582 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_29130 2123 4459 gene locus_tag LOCUS_29140 2123 4459 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267302.1 protein_id gnl|my_center|LOCUS_29140 4535 5068 gene locus_tag LOCUS_29150 4535 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence246 <1 1045 gene locus_tag LOCUS_29160 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105476.1:type IV secretion protein Rhs 1094 3481 gene locus_tag LOCUS_29170 1094 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3478 4239 gene locus_tag LOCUS_29180 3478 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 4272 4706 gene locus_tag LOCUS_29190 4272 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 4854 5135 gene locus_tag LOCUS_29200 4854 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29200 5338 5045 gene locus_tag LOCUS_29210 5338 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence247 3622 1898 gene locus_tag LOCUS_29220 3622 1898 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104170.1 protein_id gnl|my_center|LOCUS_29220 4407 3769 gene locus_tag LOCUS_29230 4407 3769 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345438.1 protein_id gnl|my_center|LOCUS_29230 4583 5395 gene locus_tag LOCUS_29240 gene xthA 4583 5395 CDS product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence248 <1 776 gene locus_tag LOCUS_29250 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027104.1:membrane protein 1095 1316 gene locus_tag LOCUS_29260 1095 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2168 1806 gene locus_tag LOCUS_29270 2168 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2399 4882 gene locus_tag LOCUS_29280 2399 4882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence249 <1 1098 gene locus_tag LOCUS_29290 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33639:sensor protein PilS 1205 2542 gene locus_tag LOCUS_29300 gene pilR 1205 2542 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_29300 3639 2587 gene locus_tag LOCUS_29310 3639 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_29310 3832 5427 gene locus_tag LOCUS_29320 3832 5427 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence250 <1 1254 gene locus_tag LOCUS_29330 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001298766.1:acyl-CoA synthetase 1257 2168 gene locus_tag LOCUS_29340 1257 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29340 2180 2464 gene locus_tag LOCUS_29350 2180 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_29350 2448 3680 gene locus_tag LOCUS_29360 2448 3680 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_29360 3796 5511 gene locus_tag LOCUS_29370 3796 5511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence251 1612 230 gene locus_tag LOCUS_29380 1612 230 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_29380 2292 1609 gene locus_tag LOCUS_29390 2292 1609 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267054.1 protein_id gnl|my_center|LOCUS_29390 2438 2641 gene locus_tag LOCUS_29400 2438 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2628 5045 gene locus_tag LOCUS_29410 2628 5045 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_29410 5056 5325 gene locus_tag LOCUS_29420 5056 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence252 1994 2830 gene locus_tag LOCUS_29430 gene galU 1994 2830 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_29430 3311 2883 gene locus_tag LOCUS_29440 3311 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_29440 3366 4724 gene locus_tag LOCUS_29450 gene gor 3366 4724 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_29450 5266 4775 gene locus_tag LOCUS_29460 5266 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_29460 5533 5366 gene locus_tag LOCUS_29470 5533 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence253 605 63 gene locus_tag LOCUS_29480 gene orn 605 63 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_29480 1440 634 gene locus_tag LOCUS_29490 1440 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1558 2589 gene locus_tag LOCUS_29500 gene rsgA 1558 2589 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI5 protein_id gnl|my_center|LOCUS_29500 3616 2606 gene locus_tag LOCUS_29510 gene motB 3616 2606 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_29510 4477 3626 gene locus_tag LOCUS_29520 gene motA 4477 3626 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence254 93 2285 gene locus_tag LOCUS_29530 93 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3035 2286 gene locus_tag LOCUS_29540 3035 2286 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_29540 2922 3194 gene locus_tag LOCUS_29550 2922 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence255 1818 880 gene locus_tag LOCUS_29560 gene lip 1818 880 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_29560 2607 2110 gene locus_tag LOCUS_29570 gene greB 2607 2110 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_29570 5158 2657 gene locus_tag LOCUS_29580 5158 2657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_29580 5517 5155 gene locus_tag LOCUS_29590 5517 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence256 196 1596 gene locus_tag LOCUS_29600 196 1596 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_29600 3156 1663 gene locus_tag LOCUS_29610 3156 1663 CDS product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 protein_id gnl|my_center|LOCUS_29610 3423 4748 gene locus_tag LOCUS_29620 3423 4748 CDS product omega amino acid--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895702.1 protein_id gnl|my_center|LOCUS_29620 4977 4822 gene locus_tag LOCUS_29630 gene rpmG 4977 4822 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZX4 protein_id gnl|my_center|LOCUS_29630 5225 4989 gene locus_tag LOCUS_29640 gene rpmB 5225 4989 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_29640 >Feature sequence257 1587 565 gene locus_tag LOCUS_29650 1587 565 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 protein_id gnl|my_center|LOCUS_29650 3395 1605 gene locus_tag LOCUS_29660 3395 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120358.1 protein_id gnl|my_center|LOCUS_29660 4160 3450 gene locus_tag LOCUS_29670 4160 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 4782 4147 gene locus_tag LOCUS_29680 4782 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence258 493 26 gene locus_tag LOCUS_29690 gene algQ 493 26 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_29690 1226 735 gene locus_tag LOCUS_29700 gene dsbB1 1226 735 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_29700 2569 1349 gene locus_tag LOCUS_29710 2569 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_29710 3759 2566 gene locus_tag LOCUS_29720 3759 2566 CDS product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096392.1 protein_id gnl|my_center|LOCUS_29720 4545 3775 gene locus_tag LOCUS_29730 gene hemD 4545 3775 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_29730 5480 4542 gene locus_tag LOCUS_29740 gene hemC 5480 4542 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_29740 >Feature sequence259 2082 304 gene locus_tag LOCUS_29750 2082 304 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_29750 2707 2075 gene locus_tag LOCUS_29760 2707 2075 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_29760 3745 2810 gene locus_tag LOCUS_29770 3745 2810 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_29770 4169 3873 gene locus_tag LOCUS_29780 gene bolA 4169 3873 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245140.1 protein_id gnl|my_center|LOCUS_29780 4686 4180 gene locus_tag LOCUS_29790 4686 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence260 78 965 gene locus_tag LOCUS_29800 78 965 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_29800 1776 979 gene locus_tag LOCUS_29810 gene speD 1776 979 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_29810 2394 1972 gene locus_tag LOCUS_29820 2394 1972 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_29820 2558 3262 gene locus_tag LOCUS_29830 gene vfr 2558 3262 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_29830 4170 3337 gene locus_tag LOCUS_29840 gene trpC 4170 3337 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML3 protein_id gnl|my_center|LOCUS_29840 5213 4167 gene locus_tag LOCUS_29850 gene trpD 5213 4167 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_29850 >Feature sequence261 1040 1492 gene locus_tag LOCUS_29860 1040 1492 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YX7 protein_id gnl|my_center|LOCUS_29860 1553 1735 gene locus_tag LOCUS_29870 1553 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2974 2348 gene locus_tag LOCUS_29880 2974 2348 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 protein_id gnl|my_center|LOCUS_29880 4385 3039 gene locus_tag LOCUS_29890 4385 3039 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_29890 4726 5469 gene locus_tag LOCUS_29900 4726 5469 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence262 1008 34 gene locus_tag LOCUS_29910 1008 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_29910 2298 1036 gene locus_tag LOCUS_29920 gene opdH 2298 1036 CDS product cis-aconitate porin Opd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 protein_id gnl|my_center|LOCUS_29920 2470 3141 gene locus_tag LOCUS_29930 2470 3141 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085524.1 protein_id gnl|my_center|LOCUS_29930 3134 4534 gene locus_tag LOCUS_29940 3134 4534 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_29940 5582 4545 gene locus_tag LOCUS_29950 5582 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence263 2376 1579 gene locus_tag LOCUS_29960 2376 1579 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_29960 2463 3194 gene locus_tag LOCUS_29970 2463 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267639.1 protein_id gnl|my_center|LOCUS_29970 3792 3196 gene locus_tag LOCUS_29980 3792 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence264 1014 52 gene locus_tag LOCUS_29990 gene cmoB 1014 52 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_29990 1754 1011 gene locus_tag LOCUS_30000 gene cmoA 1754 1011 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG6 protein_id gnl|my_center|LOCUS_30000 2220 1819 gene locus_tag LOCUS_30010 gene icp 2220 1819 CDS product inhibitor of cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085581.1 protein_id gnl|my_center|LOCUS_30010 4757 2376 gene locus_tag LOCUS_30020 gene lon 4757 2376 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_30020 >Feature sequence265 459 130 gene locus_tag LOCUS_30030 459 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098240.1 protein_id gnl|my_center|LOCUS_30030 960 535 gene locus_tag LOCUS_30040 960 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318084.1 protein_id gnl|my_center|LOCUS_30040 2355 1105 gene locus_tag LOCUS_30050 2355 1105 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_30050 3783 2467 gene locus_tag LOCUS_30060 gene amt-1 3783 2467 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_30060 4159 3821 gene locus_tag LOCUS_30070 gene glnK 4159 3821 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_30070 4550 4813 gene locus_tag LOCUS_30080 4550 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence266 1827 3446 gene locus_tag LOCUS_30090 gene groL5 1827 3446 CDS product 60 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LB1 protein_id gnl|my_center|LOCUS_30090 4570 3455 gene locus_tag LOCUS_30100 4570 3455 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557566.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence267 2309 615 gene locus_tag LOCUS_30110 2309 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114085.1 protein_id gnl|my_center|LOCUS_30110 2836 2381 gene locus_tag LOCUS_30120 2836 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_30120 3005 3367 gene locus_tag LOCUS_30130 3005 3367 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 protein_id gnl|my_center|LOCUS_30130 3364 4083 gene locus_tag LOCUS_30140 3364 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_30140 4094 4684 gene locus_tag LOCUS_30150 4094 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence268 1304 2584 gene locus_tag LOCUS_30160 1304 2584 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_30160 2869 4362 gene locus_tag LOCUS_30170 2869 4362 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_30170 4377 5225 gene locus_tag LOCUS_30180 4377 5225 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence269 1548 1462 gene locus_tag LOCUS_t00320 1548 1462 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1747 2151 gene locus_tag LOCUS_30190 1747 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2145 2837 gene locus_tag LOCUS_30200 2145 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205686.1 protein_id gnl|my_center|LOCUS_30200 4032 2884 gene locus_tag LOCUS_30210 4032 2884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013563.1 protein_id gnl|my_center|LOCUS_30210 4434 4228 gene locus_tag LOCUS_30220 4434 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 4875 5114 gene locus_tag LOCUS_30230 4875 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 5248 5175 gene locus_tag LOCUS_t00330 5248 5175 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence270 1211 276 gene locus_tag LOCUS_30240 1211 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064124.1 protein_id gnl|my_center|LOCUS_30240 1522 1208 gene locus_tag LOCUS_30250 1522 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_30250 3727 1577 gene locus_tag LOCUS_30260 3727 1577 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348031.1 protein_id gnl|my_center|LOCUS_30260 3894 4850 gene locus_tag LOCUS_30270 3894 4850 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence271 <1 696 gene locus_tag LOCUS_30280 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084070.1:3-oxoadipate enol-lactonase 882 1835 gene locus_tag LOCUS_30290 gene xylS 882 1835 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_30290 2075 3436 gene locus_tag LOCUS_30300 gene xylX 2075 3436 CDS product toluate 1,2-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113315.1 protein_id gnl|my_center|LOCUS_30300 3437 3925 gene locus_tag LOCUS_30310 gene xylY 3437 3925 CDS product toluate 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113314.1 protein_id gnl|my_center|LOCUS_30310 4003 5013 gene locus_tag LOCUS_30320 gene xylZ 4003 5013 CDS product toluate 1,2-dioxygenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence272 55 993 gene locus_tag LOCUS_30330 55 993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105301.1 protein_id gnl|my_center|LOCUS_30330 2659 1400 gene locus_tag LOCUS_30340 gene dadA3 2659 1400 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_30340 3938 3174 gene locus_tag LOCUS_30350 3938 3174 CDS product malonate transporter MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_30350 4357 3944 gene locus_tag LOCUS_30360 4357 3944 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_30360 <5191 4475 gene locus_tag LOCUS_30370 <5191 4475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87V60:malonyl CoA-acyl carrier protein transacylase >Feature sequence273 1615 131 gene locus_tag LOCUS_30380 gene putP 1615 131 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_30380 2511 1792 gene locus_tag LOCUS_30390 2511 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30390 4951 2396 gene locus_tag LOCUS_30400 4951 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 >Feature sequence274 2276 141 gene locus_tag LOCUS_30410 2276 141 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR9 protein_id gnl|my_center|LOCUS_30410 2534 3541 gene locus_tag LOCUS_30420 gene metN2 2534 3541 CDS product methionine import ATP-binding protein MetN 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT70 protein_id gnl|my_center|LOCUS_30420 3541 4218 gene locus_tag LOCUS_30430 3541 4218 CDS product D-methionine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_30430 4267 5040 gene locus_tag LOCUS_30440 4267 5040 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence275 <1 936 gene locus_tag LOCUS_30450 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109962.1:chemotaxis transducer 1121 2350 gene locus_tag LOCUS_30460 gene sstT 1121 2350 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I273 protein_id gnl|my_center|LOCUS_30460 3706 2489 gene locus_tag LOCUS_30470 gene fabB 3706 2489 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_30470 4233 3718 gene locus_tag LOCUS_30480 gene fabA 4233 3718 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_30480 4246 4446 gene locus_tag LOCUS_30490 4246 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence276 1984 1598 gene locus_tag LOCUS_30500 1984 1598 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_30500 4392 1981 gene locus_tag LOCUS_30510 4392 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 4828 4442 gene locus_tag LOCUS_30520 4828 4442 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence277 330 1403 gene locus_tag LOCUS_30530 330 1403 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 protein_id gnl|my_center|LOCUS_30530 1587 2756 gene locus_tag LOCUS_30540 1587 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 2771 3493 gene locus_tag LOCUS_30550 2771 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 4429 3911 gene locus_tag LOCUS_30560 4429 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525009.1 protein_id gnl|my_center|LOCUS_30560 <5084 4488 gene locus_tag LOCUS_30570 <5084 4488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525010.1:glutathione-dependent formaldehyde dehydrogenase >Feature sequence278 1523 306 gene locus_tag LOCUS_30580 1523 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113582.1 protein_id gnl|my_center|LOCUS_30580 3235 1604 gene locus_tag LOCUS_30590 3235 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_30590 4929 3232 gene locus_tag LOCUS_30600 4929 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence279 107 1846 gene locus_tag LOCUS_30610 107 1846 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103366.1 protein_id gnl|my_center|LOCUS_30610 1967 4366 gene locus_tag LOCUS_30620 gene gcd 1967 4366 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089344.1 protein_id gnl|my_center|LOCUS_30620 4965 4513 gene locus_tag LOCUS_30630 4965 4513 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence280 423 2081 gene locus_tag LOCUS_30640 423 2081 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121292.1 protein_id gnl|my_center|LOCUS_30640 4080 2113 gene locus_tag LOCUS_30650 4080 2113 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_30650 <4963 4197 gene locus_tag LOCUS_30660 <4963 4197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413980.1:magnesium chelatase subunit ChlI >Feature sequence281 1231 329 gene locus_tag LOCUS_30670 gene cysM 1231 329 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_30670 2248 1355 gene locus_tag LOCUS_30680 2248 1355 CDS product chromosome replication initiation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 protein_id gnl|my_center|LOCUS_30680 2378 3004 gene locus_tag LOCUS_30690 2378 3004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188612.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence282 156 905 gene locus_tag LOCUS_30700 156 905 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_30700 1229 942 gene locus_tag LOCUS_30710 1229 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1321 1473 gene locus_tag LOCUS_30720 1321 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1527 1910 gene locus_tag LOCUS_30730 1527 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 1907 2140 gene locus_tag LOCUS_30740 1907 2140 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_30740 2157 2516 gene locus_tag LOCUS_30750 2157 2516 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_30750 2530 2928 gene locus_tag LOCUS_30760 2530 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103320.1 protein_id gnl|my_center|LOCUS_30760 2925 3617 gene locus_tag LOCUS_30770 2925 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3614 4540 gene locus_tag LOCUS_30780 3614 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence283 691 452 gene locus_tag LOCUS_30790 691 452 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_30790 1280 786 gene locus_tag LOCUS_30800 1280 786 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_30800 1606 1295 gene locus_tag LOCUS_30810 1606 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112744.1 protein_id gnl|my_center|LOCUS_30810 2246 1599 gene locus_tag LOCUS_30820 2246 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_30820 2717 2259 gene locus_tag LOCUS_30830 2717 2259 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_30830 3514 2717 gene locus_tag LOCUS_30840 3514 2717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_30840 4322 3507 gene locus_tag LOCUS_30850 4322 3507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence284 596 102 gene locus_tag LOCUS_30860 596 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769473.1 protein_id gnl|my_center|LOCUS_30860 967 668 gene locus_tag LOCUS_30870 967 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 848 2551 gene locus_tag LOCUS_30880 848 2551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_30880 2548 3132 gene locus_tag LOCUS_30890 2548 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 protein_id gnl|my_center|LOCUS_30890 3136 3894 gene locus_tag LOCUS_30900 3136 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_30900 3926 4558 gene locus_tag LOCUS_30910 3926 4558 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence285 464 1141 gene locus_tag LOCUS_30920 gene dnr 464 1141 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_30920 1208 1399 gene locus_tag LOCUS_30930 1208 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113235.1 protein_id gnl|my_center|LOCUS_30930 3730 1451 gene locus_tag LOCUS_30940 3730 1451 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_30940 3865 4545 gene locus_tag LOCUS_30950 gene piuC 3865 4545 CDS product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 protein_id gnl|my_center|LOCUS_30950 >Feature sequence286 700 2622 gene locus_tag LOCUS_30960 700 2622 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268340.1 protein_id gnl|my_center|LOCUS_30960 3430 2627 gene locus_tag LOCUS_30970 3430 2627 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_30970 4342 3479 gene locus_tag LOCUS_30980 4342 3479 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence287 97 2721 gene locus_tag LOCUS_30990 gene alaS 97 2721 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_30990 2816 4051 gene locus_tag LOCUS_31000 2816 4051 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_31000 4230 4415 gene locus_tag LOCUS_31010 gene csrA 4230 4415 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_31010 4478 4568 gene locus_tag LOCUS_t00340 4478 4568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4651 4727 gene locus_tag LOCUS_t00350 4651 4727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 234 1139 gene locus_tag LOCUS_31020 234 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 1284 2111 gene locus_tag LOCUS_31030 1284 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362797.1 protein_id gnl|my_center|LOCUS_31030 2206 2895 gene locus_tag LOCUS_31040 2206 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_31040 2990 3328 gene locus_tag LOCUS_31050 2990 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3435 3842 gene locus_tag LOCUS_31060 3435 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3859 4119 gene locus_tag LOCUS_31070 3859 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4196 4843 gene locus_tag LOCUS_31080 4196 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence289 653 54 gene locus_tag LOCUS_31090 653 54 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZF61 protein_id gnl|my_center|LOCUS_31090 1442 744 gene locus_tag LOCUS_31100 1442 744 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_31100 2104 1565 gene locus_tag LOCUS_31110 2104 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 2988 2197 gene locus_tag LOCUS_31120 2988 2197 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038483.1 protein_id gnl|my_center|LOCUS_31120 3528 3070 gene locus_tag LOCUS_31130 3528 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 4843 3581 gene locus_tag LOCUS_31140 4843 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence290 <1 1038 gene locus_tag LOCUS_31150 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103589.1:cysteine sulfinate desulfinase 1035 1445 gene locus_tag LOCUS_31160 1035 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092439.1 protein_id gnl|my_center|LOCUS_31160 2586 1465 gene locus_tag LOCUS_31170 2586 1465 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_31170 3731 2820 gene locus_tag LOCUS_31180 3731 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_31180 4379 3744 gene locus_tag LOCUS_31190 4379 3744 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence291 2753 474 gene locus_tag LOCUS_31200 2753 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038886.1 protein_id gnl|my_center|LOCUS_31200 3194 2889 gene locus_tag LOCUS_31210 3194 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_31210 3605 3285 gene locus_tag LOCUS_31220 3605 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038887.1 protein_id gnl|my_center|LOCUS_31220 4765 3656 gene locus_tag LOCUS_31230 4765 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence292 2 247 gene locus_tag LOCUS_31240 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 250 669 gene locus_tag LOCUS_31250 250 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_31250 685 876 gene locus_tag LOCUS_31260 685 876 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_31260 1337 918 gene locus_tag LOCUS_31270 1337 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933003.1 protein_id gnl|my_center|LOCUS_31270 1746 1366 gene locus_tag LOCUS_31280 1746 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3526 1730 gene locus_tag LOCUS_31290 3526 1730 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_31290 4421 3558 gene locus_tag LOCUS_31300 4421 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence293 1682 486 gene locus_tag LOCUS_31310 1682 486 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_31310 3830 1725 gene locus_tag LOCUS_31320 3830 1725 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_31320 <4813 3984 gene locus_tag LOCUS_31330 <4813 3984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112926.1:response regulator >Feature sequence294 <1 919 gene locus_tag LOCUS_31340 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088811.1:alcohol dehydrogenase 1077 1001 gene locus_tag LOCUS_t00360 1077 1001 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1243 1938 gene locus_tag LOCUS_31350 1243 1938 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_31350 2414 1947 gene locus_tag LOCUS_31360 2414 1947 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_31360 2708 4156 gene locus_tag LOCUS_31370 gene davD 2708 4156 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_31370 >Feature sequence295 <1 598 gene locus_tag LOCUS_31380 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113689.1:NADP-dependent oxidoreductase 680 1687 gene locus_tag LOCUS_31390 680 1687 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365244.1 protein_id gnl|my_center|LOCUS_31390 2375 1692 gene locus_tag LOCUS_31400 2375 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 2726 2652 gene locus_tag LOCUS_t00370 2726 2652 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3222 2971 gene locus_tag LOCUS_31410 3222 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_31410 4501 3416 gene locus_tag LOCUS_31420 gene purK 4501 3416 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U22 protein_id gnl|my_center|LOCUS_31420 >Feature sequence296 1637 69 gene locus_tag LOCUS_31430 1637 69 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_31430 2208 1648 gene locus_tag LOCUS_31440 2208 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_31440 2498 2836 gene locus_tag LOCUS_31450 2498 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_31450 2925 3455 gene locus_tag LOCUS_31460 gene gloA 2925 3455 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU72 protein_id gnl|my_center|LOCUS_31460 4118 3462 gene locus_tag LOCUS_31470 4118 3462 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_31470 <4793 4115 gene locus_tag LOCUS_31480 <4793 4115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526170.1:phosphoribosyltransferase >Feature sequence297 861 2291 gene locus_tag LOCUS_31490 gene sbcB 861 2291 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_31490 2731 2351 gene locus_tag LOCUS_31500 2731 2351 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 protein_id gnl|my_center|LOCUS_31500 3096 3947 gene locus_tag LOCUS_31510 gene purU1 3096 3947 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_31510 3961 4131 gene locus_tag LOCUS_31520 3961 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence298 <1 946 gene locus_tag LOCUS_31530 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105238.1:protease modulator HflK 946 1812 gene locus_tag LOCUS_31540 gene hflC 946 1812 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_31540 2088 3275 gene locus_tag LOCUS_31550 gene hisZ 2088 3275 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_31550 3363 4658 gene locus_tag LOCUS_31560 gene purA 3363 4658 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_31560 >Feature sequence299 1787 1110 gene locus_tag LOCUS_31570 1787 1110 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_31570 1898 3262 gene locus_tag LOCUS_31580 1898 3262 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114052.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence300 593 1057 gene locus_tag LOCUS_31590 593 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2775 1132 gene locus_tag LOCUS_31600 gene aceF 2775 1132 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59638 protein_id gnl|my_center|LOCUS_31600 <4769 2787 gene locus_tag LOCUS_31610 <4769 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q59637:pyruvate dehydrogenase E1 component >Feature sequence301 528 19 gene locus_tag LOCUS_31620 528 19 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766304.1 protein_id gnl|my_center|LOCUS_31620 656 1489 gene locus_tag LOCUS_31630 656 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637618.2 protein_id gnl|my_center|LOCUS_31630 1513 1668 gene locus_tag LOCUS_31640 1513 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2004 2162 gene locus_tag LOCUS_31650 2004 2162 CDS product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 protein_id gnl|my_center|LOCUS_31650 >Feature sequence302 443 1483 gene locus_tag LOCUS_31660 443 1483 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064041.1 protein_id gnl|my_center|LOCUS_31660 2822 1470 gene locus_tag LOCUS_31670 2822 1470 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898106.1 protein_id gnl|my_center|LOCUS_31670 <4700 2915 gene locus_tag LOCUS_31680 <4700 2915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115040.1:chemotaxis transducer >Feature sequence303 <1 837 gene locus_tag LOCUS_31690 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090990.1:conjugal transfer protein TrbL 850 1554 gene locus_tag LOCUS_31700 gene trbF 850 1554 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 protein_id gnl|my_center|LOCUS_31700 1551 2537 gene locus_tag LOCUS_31710 gene trbG 1551 2537 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_31710 2540 3817 gene locus_tag LOCUS_31720 gene trbI 2540 3817 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084435.1 protein_id gnl|my_center|LOCUS_31720 3814 4035 gene locus_tag LOCUS_31730 3814 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_31730 4103 4588 gene locus_tag LOCUS_31740 4103 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence304 161 637 gene locus_tag LOCUS_31750 161 637 CDS product type VI secretion lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114612.1 protein_id gnl|my_center|LOCUS_31750 642 1973 gene locus_tag LOCUS_31760 642 1973 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105481.1 protein_id gnl|my_center|LOCUS_31760 1976 2842 gene locus_tag LOCUS_31770 1976 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105480.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence305 1316 111 gene locus_tag LOCUS_31780 1316 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2986 1427 gene locus_tag LOCUS_31790 2986 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 4017 2971 gene locus_tag LOCUS_31800 4017 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31800 >Feature sequence306 1490 834 gene locus_tag LOCUS_31810 1490 834 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_31810 2270 1620 gene locus_tag LOCUS_31820 2270 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_31820 3106 2267 gene locus_tag LOCUS_31830 3106 2267 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_31830 3764 3093 gene locus_tag LOCUS_31840 3764 3093 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_31840 <4612 3773 gene locus_tag LOCUS_31850 <4612 3773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706993.1:long-chain acyl-CoA synthetase >Feature sequence307 243 1325 gene locus_tag LOCUS_31860 243 1325 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 protein_id gnl|my_center|LOCUS_31860 1466 2440 gene locus_tag LOCUS_31870 1466 2440 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_31870 2616 4064 gene locus_tag LOCUS_31880 gene xdhA 2616 4064 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence308 2109 1132 gene locus_tag LOCUS_31890 2109 1132 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105477.1 protein_id gnl|my_center|LOCUS_31890 2837 2106 gene locus_tag LOCUS_31900 2837 2106 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105478.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence309 1492 848 gene locus_tag LOCUS_31910 1492 848 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB9 protein_id gnl|my_center|LOCUS_31910 2966 1578 gene locus_tag LOCUS_31920 gene otsA 2966 1578 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SB4 protein_id gnl|my_center|LOCUS_31920 3757 2963 gene locus_tag LOCUS_31930 3757 2963 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUM9 protein_id gnl|my_center|LOCUS_31930 3901 4464 gene locus_tag LOCUS_31940 3901 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence310 2091 265 gene locus_tag LOCUS_31950 2091 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2629 3087 gene locus_tag LOCUS_31960 2629 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3084 3641 gene locus_tag LOCUS_31970 3084 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 4080 3700 gene locus_tag LOCUS_31980 4080 3700 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence311 <1 1566 gene locus_tag LOCUS_31990 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O68822:cytosol aminopeptidase 1605 2024 gene locus_tag LOCUS_32000 gene holC 1605 2024 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_32000 2059 2427 gene locus_tag LOCUS_32010 2059 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100590.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence312 1 993 gene locus_tag LOCUS_32020 1 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1007 1582 gene locus_tag LOCUS_32030 1007 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529959.1 protein_id gnl|my_center|LOCUS_32030 3675 1585 gene locus_tag LOCUS_32040 3675 1585 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104156.1 protein_id gnl|my_center|LOCUS_32040 <4508 3933 gene locus_tag LOCUS_32050 <4508 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728108.1:transcriptional regulator >Feature sequence313 120 689 gene locus_tag LOCUS_32060 120 689 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_32060 2027 693 gene locus_tag LOCUS_32070 2027 693 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 protein_id gnl|my_center|LOCUS_32070 2522 2112 gene locus_tag LOCUS_32080 2522 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114831.1 protein_id gnl|my_center|LOCUS_32080 3326 2649 gene locus_tag LOCUS_32090 3326 2649 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 protein_id gnl|my_center|LOCUS_32090 3717 3337 gene locus_tag LOCUS_32100 3717 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4077 3778 gene locus_tag LOCUS_32110 4077 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence314 <1 639 gene locus_tag LOCUS_32120 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112390.1:DDE transposase 1718 819 gene locus_tag LOCUS_32130 1718 819 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_32130 1832 2260 gene locus_tag LOCUS_32140 1832 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2257 2844 gene locus_tag LOCUS_32150 2257 2844 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_32150 >Feature sequence315 <1 1276 gene locus_tag LOCUS_32160 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038895.1:DNA topoisomerase III 2193 2750 gene locus_tag LOCUS_32170 2193 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3084 3305 gene locus_tag LOCUS_32180 3084 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_32180 3327 3719 gene locus_tag LOCUS_32190 3327 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32190 >Feature sequence316 1593 34 gene locus_tag LOCUS_32200 1593 34 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_32200 1840 2145 gene locus_tag LOCUS_32210 1840 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 2142 3227 gene locus_tag LOCUS_32220 2142 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3224 4366 gene locus_tag LOCUS_32230 gene lysA1 3224 4366 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence317 <1 794 gene locus_tag LOCUS_32240 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889Q9:riboflavin biosynthesis protein RibD 1202 1822 gene locus_tag LOCUS_32250 gene ribC 1202 1822 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_32250 1833 2909 gene locus_tag LOCUS_32260 gene ribBA-1 1833 2909 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q7 protein_id gnl|my_center|LOCUS_32260 2968 3444 gene locus_tag LOCUS_32270 gene ribH 2968 3444 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_32270 3441 3926 gene locus_tag LOCUS_32280 gene nusB 3441 3926 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_32280 >Feature sequence318 <1 846 gene locus_tag LOCUS_32290 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038862.1:integrating conjugative element protein 827 1279 gene locus_tag LOCUS_32300 827 1279 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_32300 1386 1628 gene locus_tag LOCUS_32310 1386 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 1959 2309 gene locus_tag LOCUS_32320 1959 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2473 2919 gene locus_tag LOCUS_32330 2473 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2916 3863 gene locus_tag LOCUS_32340 2916 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638462.2 protein_id gnl|my_center|LOCUS_32340 >Feature sequence319 2340 1738 gene locus_tag LOCUS_32350 2340 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2672 2337 gene locus_tag LOCUS_32360 2672 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 4191 2674 gene locus_tag LOCUS_32370 4191 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence320 2529 898 gene locus_tag LOCUS_32380 gene fan1 2529 898 CDS product Fanconi-associated nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N0 protein_id gnl|my_center|LOCUS_32380 4054 2666 gene locus_tag LOCUS_32390 gene hemN 4054 2666 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RM6 protein_id gnl|my_center|LOCUS_32390 >Feature sequence321 1977 784 gene locus_tag LOCUS_32400 1977 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2540 1980 gene locus_tag LOCUS_32410 2540 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 4216 2558 gene locus_tag LOCUS_32420 4216 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038900.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence322 82 1509 gene locus_tag LOCUS_32430 82 1509 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_32430 1502 3052 gene locus_tag LOCUS_32440 1502 3052 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_32440 3052 3648 gene locus_tag LOCUS_32450 3052 3648 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG6 protein_id gnl|my_center|LOCUS_32450 4046 3645 gene locus_tag LOCUS_32460 4046 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence323 <1 990 gene locus_tag LOCUS_32470 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0K4:isocitrate lyase 2120 1068 gene locus_tag LOCUS_32480 2120 1068 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268279.1 protein_id gnl|my_center|LOCUS_32480 3527 2211 gene locus_tag LOCUS_32490 3527 2211 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence324 166 242 gene locus_tag LOCUS_t00380 166 242 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 765 370 gene locus_tag LOCUS_32500 765 370 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762545.1 protein_id gnl|my_center|LOCUS_32500 2002 824 gene locus_tag LOCUS_32510 gene atoB 2002 824 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A8 protein_id gnl|my_center|LOCUS_32510 3103 2135 gene locus_tag LOCUS_32520 gene liuE 3103 2135 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_32520 <4285 3202 gene locus_tag LOCUS_32530 <4285 3202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113506.1:methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence325 673 1761 gene locus_tag LOCUS_32540 gene trmA 673 1761 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV78 protein_id gnl|my_center|LOCUS_32540 1834 3321 gene locus_tag LOCUS_32550 1834 3321 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553906.1 protein_id gnl|my_center|LOCUS_32550 3400 3798 gene locus_tag LOCUS_32560 3400 3798 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_32560 >Feature sequence326 351 2018 gene locus_tag LOCUS_32570 351 2018 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266405.1 protein_id gnl|my_center|LOCUS_32570 2018 2890 gene locus_tag LOCUS_32580 gene mdcB 2018 2890 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6S9 protein_id gnl|my_center|LOCUS_32580 2893 3192 gene locus_tag LOCUS_32590 gene mdcC 2893 3192 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V56 protein_id gnl|my_center|LOCUS_32590 3185 4051 gene locus_tag LOCUS_32600 gene mdcD 3185 4051 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084003.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence327 529 140 gene locus_tag LOCUS_32610 529 140 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095177.1 protein_id gnl|my_center|LOCUS_32610 2962 788 gene locus_tag LOCUS_32620 gene pnp 2962 788 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ8 protein_id gnl|my_center|LOCUS_32620 3333 3064 gene locus_tag LOCUS_32630 gene rpsO 3333 3064 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 protein_id gnl|my_center|LOCUS_32630 <4255 3444 gene locus_tag LOCUS_32640 <4255 3444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNR4:tRNA pseudouridine synthase B >Feature sequence328 1324 3195 gene locus_tag LOCUS_32650 1324 3195 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_32650 3282 4058 gene locus_tag LOCUS_32660 3282 4058 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence329 816 31 gene locus_tag LOCUS_32670 816 31 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_32670 1131 889 gene locus_tag LOCUS_32680 1131 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2223 1180 gene locus_tag LOCUS_32690 2223 1180 CDS product bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706139.1 protein_id gnl|my_center|LOCUS_32690 2386 3264 gene locus_tag LOCUS_32700 2386 3264 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_32700 <4217 3271 gene locus_tag LOCUS_32710 <4217 3271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399927.1:histone deacetylase >Feature sequence330 <1 890 gene locus_tag LOCUS_32720 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1X7:multifunctional non-homologous end joining protein LigD 1058 2107 gene locus_tag LOCUS_32730 1058 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2375 2148 gene locus_tag LOCUS_32740 2375 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3537 2575 gene locus_tag LOCUS_32750 3537 2575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895497.1 protein_id gnl|my_center|LOCUS_32750 <4208 3582 gene locus_tag LOCUS_32760 <4208 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039234.1:RND transporter >Feature sequence331 3953 3753 gene locus_tag LOCUS_32770 3953 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence332 1517 567 gene locus_tag LOCUS_32780 gene pcoB 1517 567 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_32780 1812 1507 gene locus_tag LOCUS_32790 1812 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3325 1838 gene locus_tag LOCUS_32800 gene pcoA 3325 1838 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32800 4105 3755 gene locus_tag LOCUS_32810 4105 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence333 219 2129 gene locus_tag LOCUS_32820 gene selB 219 2129 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_32820 2598 3413 gene locus_tag LOCUS_32830 2598 3413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence334 313 648 gene locus_tag LOCUS_32840 313 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 737 2050 gene locus_tag LOCUS_32850 737 2050 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103384.1 protein_id gnl|my_center|LOCUS_32850 2150 4153 gene locus_tag LOCUS_32860 2150 4153 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence335 130 861 gene locus_tag LOCUS_32870 130 861 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764729.1 protein_id gnl|my_center|LOCUS_32870 1002 1637 gene locus_tag LOCUS_32880 1002 1637 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence336 1092 2015 gene locus_tag LOCUS_32890 1092 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2015 2626 gene locus_tag LOCUS_32900 2015 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 2645 2950 gene locus_tag LOCUS_32910 gene nuoK 2645 2950 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_32910 >Feature sequence337 <1 2012 gene locus_tag LOCUS_32920 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:diguanylate cyclase 2083 2853 gene locus_tag LOCUS_32930 2083 2853 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKF0 protein_id gnl|my_center|LOCUS_32930 2926 3168 gene locus_tag LOCUS_32940 gene xseB 2926 3168 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU6 protein_id gnl|my_center|LOCUS_32940 3165 4052 gene locus_tag LOCUS_32950 3165 4052 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_32950 >Feature sequence338 1302 121 gene locus_tag LOCUS_32960 gene nirF 1302 121 CDS product protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51480 protein_id gnl|my_center|LOCUS_32960 1637 1299 gene locus_tag LOCUS_32970 gene nirC 1637 1299 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51479 protein_id gnl|my_center|LOCUS_32970 1969 1655 gene locus_tag LOCUS_32980 gene nirM 1969 1655 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 protein_id gnl|my_center|LOCUS_32980 3732 2023 gene locus_tag LOCUS_32990 gene nirS 3732 2023 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 protein_id gnl|my_center|LOCUS_32990 >Feature sequence339 491 192 gene locus_tag LOCUS_33000 491 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 656 1831 gene locus_tag LOCUS_33010 gene hmp 656 1831 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H4 protein_id gnl|my_center|LOCUS_33010 1876 2109 gene locus_tag LOCUS_33020 1876 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2326 2502 gene locus_tag LOCUS_33030 2326 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2658 2843 gene locus_tag LOCUS_33040 2658 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 2886 4085 gene locus_tag LOCUS_33050 gene pncB2 2886 4085 CDS product nicotinate phosphoribosyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW26 protein_id gnl|my_center|LOCUS_33050 >Feature sequence340 <1 1139 gene locus_tag LOCUS_33060 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266740.1:amine oxidase 1136 1945 gene locus_tag LOCUS_33070 1136 1945 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_33070 1932 3248 gene locus_tag LOCUS_33080 1932 3248 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence341 1497 538 gene locus_tag LOCUS_33090 gene hprA 1497 538 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_33090 1568 2197 gene locus_tag LOCUS_33100 1568 2197 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_33100 2292 3974 gene locus_tag LOCUS_33110 2292 3974 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence342 1142 888 gene locus_tag LOCUS_33120 1142 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 2821 1139 gene locus_tag LOCUS_33130 gene cstA 2821 1139 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_33130 3092 3571 gene locus_tag LOCUS_33140 3092 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3568 3819 gene locus_tag LOCUS_33150 3568 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence343 840 301 gene locus_tag LOCUS_33160 840 301 CDS product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095105.1 protein_id gnl|my_center|LOCUS_33160 1007 1222 gene locus_tag LOCUS_33170 1007 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33170 1232 1441 gene locus_tag LOCUS_33180 1232 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33180 1510 2367 gene locus_tag LOCUS_33190 1510 2367 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 protein_id gnl|my_center|LOCUS_33190 3037 2447 gene locus_tag LOCUS_33200 3037 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_33200 3903 3034 gene locus_tag LOCUS_33210 gene tesB 3903 3034 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence344 1521 1048 gene locus_tag LOCUS_33220 1521 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_33220 1858 1580 gene locus_tag LOCUS_33230 1858 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315128.1 protein_id gnl|my_center|LOCUS_33230 2656 2030 gene locus_tag LOCUS_33240 2656 2030 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812158.1 protein_id gnl|my_center|LOCUS_33240 2904 3302 gene locus_tag LOCUS_33250 2904 3302 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267689.1 protein_id gnl|my_center|LOCUS_33250 <4000 3399 gene locus_tag LOCUS_33260 <4000 3399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5Y1:fructose-bisphosphate aldolase >Feature sequence345 1506 67 gene locus_tag LOCUS_33270 1506 67 CDS product AGCS sodium/alanine/glycine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 protein_id gnl|my_center|LOCUS_33270 1679 2497 gene locus_tag LOCUS_33280 1679 2497 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_33280 2942 2502 gene locus_tag LOCUS_33290 2942 2502 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_33290 3588 2956 gene locus_tag LOCUS_33300 3588 2956 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence346 1671 484 gene locus_tag LOCUS_33310 1671 484 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 protein_id gnl|my_center|LOCUS_33310 1861 2874 gene locus_tag LOCUS_33320 1861 2874 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_33320 3514 2879 gene locus_tag LOCUS_33330 gene bfiR 3514 2879 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence347 778 2013 gene locus_tag LOCUS_33340 gene sbcD 778 2013 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB9 protein_id gnl|my_center|LOCUS_33340 >Feature sequence348 682 2169 gene locus_tag LOCUS_33350 gene ndhD 682 2169 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_33350 2169 3590 gene locus_tag LOCUS_33360 gene nuoN-1 2169 3590 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_33360 >Feature sequence349 <1 965 gene locus_tag LOCUS_33370 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113084.1:L-serine dehydratase 1053 3563 gene locus_tag LOCUS_33380 1053 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence350 <1 529 gene locus_tag LOCUS_33390 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091026.1:transcriptional regulator 626 1222 gene locus_tag LOCUS_33400 626 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_33400 2219 1224 gene locus_tag LOCUS_33410 gene rnz 2219 1224 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_33410 2414 3196 gene locus_tag LOCUS_33420 2414 3196 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 protein_id gnl|my_center|LOCUS_33420 3778 3353 gene locus_tag LOCUS_33430 3778 3353 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence351 2208 1468 gene locus_tag LOCUS_33440 gene atpF 2208 1468 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCB8 protein_id gnl|my_center|LOCUS_33440 2464 2216 gene locus_tag LOCUS_33450 gene atpE 2464 2216 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IW8 protein_id gnl|my_center|LOCUS_33450 3152 2487 gene locus_tag LOCUS_33460 gene atpB 3152 2487 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKH7 protein_id gnl|my_center|LOCUS_33460 3415 3149 gene locus_tag LOCUS_33470 3415 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3710 3426 gene locus_tag LOCUS_33480 3710 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836234.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence352 1935 154 gene locus_tag LOCUS_33490 gene nuoC 1935 154 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J9 protein_id gnl|my_center|LOCUS_33490 2678 2004 gene locus_tag LOCUS_33500 gene nuoB 2678 2004 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ2 protein_id gnl|my_center|LOCUS_33500 3096 2689 gene locus_tag LOCUS_33510 gene nuoA2 3096 2689 CDS product NADH-quinone oxidoreductase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K1 protein_id gnl|my_center|LOCUS_33510 >Feature sequence353 312 2444 gene locus_tag LOCUS_33520 312 2444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_33520 2570 3346 gene locus_tag LOCUS_33530 2570 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence354 754 29 gene locus_tag LOCUS_33540 754 29 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266838.1 protein_id gnl|my_center|LOCUS_33540 1484 771 gene locus_tag LOCUS_33550 gene pgl 1484 771 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2N2 protein_id gnl|my_center|LOCUS_33550 2940 1471 gene locus_tag LOCUS_33560 gene zwf 2940 1471 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXE8 protein_id gnl|my_center|LOCUS_33560 >Feature sequence355 478 3360 gene locus_tag LOCUS_33570 gene fruI 478 3360 CDS product PTS fructose transporter subunit FruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence356 391 2820 gene locus_tag LOCUS_33580 391 2820 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 protein_id gnl|my_center|LOCUS_33580 2983 3318 gene locus_tag LOCUS_33590 2983 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094775.1 protein_id gnl|my_center|LOCUS_33590 3430 3633 gene locus_tag LOCUS_33600 3430 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence357 2684 1455 gene locus_tag LOCUS_33610 gene mexE 2684 1455 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_33610 <3657 2988 gene locus_tag LOCUS_33620 <3657 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895622.1:transcriptional regulator MexT >Feature sequence358 90 15 gene locus_tag LOCUS_t00390 90 15 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2818 254 gene locus_tag LOCUS_33630 gene clpB 2818 254 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_33630 <3646 2974 gene locus_tag LOCUS_33640 <3646 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33663:laccase domain protein >Feature sequence359 <3632 1037 gene locus_tag LOCUS_33650 <3632 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNK9:histidine kinase >Feature sequence360 163 1875 gene locus_tag LOCUS_33660 163 1875 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 protein_id gnl|my_center|LOCUS_33660 1880 2806 gene locus_tag LOCUS_33670 1880 2806 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence361 402 1784 gene locus_tag LOCUS_33680 402 1784 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_33680 1810 2106 gene locus_tag LOCUS_33690 1810 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence362 <1 724 gene locus_tag LOCUS_33700 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266147.1:oligopeptidase A 724 999 gene locus_tag LOCUS_33710 724 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_33710 2543 1473 gene locus_tag LOCUS_33720 gene nodX 2543 1473 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence363 31 531 gene locus_tag LOCUS_33730 gene ureE 31 531 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS2 protein_id gnl|my_center|LOCUS_33730 615 1208 gene locus_tag LOCUS_33740 gene ureF 615 1208 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMZ0 protein_id gnl|my_center|LOCUS_33740 2370 2984 gene locus_tag LOCUS_33750 gene ureG 2370 2984 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS0 protein_id gnl|my_center|LOCUS_33750 >Feature sequence364 500 1951 gene locus_tag LOCUS_33760 500 1951 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQE7 protein_id gnl|my_center|LOCUS_33760 2889 1945 gene locus_tag LOCUS_33770 2889 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_33770 <3508 2929 gene locus_tag LOCUS_33780 <3508 2929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114821.1:transcriptional regulator >Feature sequence365 913 1464 gene locus_tag LOCUS_33790 913 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266917.1 protein_id gnl|my_center|LOCUS_33790 1558 3027 gene locus_tag LOCUS_33800 gene guaB 1558 3027 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM5 protein_id gnl|my_center|LOCUS_33800 >Feature sequence366 1404 25 gene locus_tag LOCUS_33810 1404 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33810 1931 1422 gene locus_tag LOCUS_33820 1931 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33820 >Feature sequence367 179 1015 gene locus_tag LOCUS_33830 179 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_33830 1608 1018 gene locus_tag LOCUS_33840 1608 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_33840 1814 1605 gene locus_tag LOCUS_33850 1814 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence368 <1 834 gene locus_tag LOCUS_33860 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110888.1:type 4 fimbrial biogenesis protein PilM 834 1406 gene locus_tag LOCUS_33870 gene pilN 834 1406 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_33870 1403 2026 gene locus_tag LOCUS_33880 gene pilO 1403 2026 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_33880 2023 2550 gene locus_tag LOCUS_33890 gene pilP 2023 2550 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence369 1533 2597 gene locus_tag LOCUS_33900 gene algZ 1533 2597 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence370 424 2421 gene locus_tag LOCUS_33910 424 2421 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_33910 3135 2461 gene locus_tag LOCUS_33920 3135 2461 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence371 2241 1237 gene locus_tag LOCUS_33930 gene gapA 2241 1237 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_33930 2583 2257 gene locus_tag LOCUS_33940 2583 2257 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_33940 <3248 2597 gene locus_tag LOCUS_33950 <3248 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113752.1:arsenical resistance protein ArsH >Feature sequence372 808 392 gene locus_tag LOCUS_33960 808 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence373 2088 139 gene locus_tag LOCUS_33970 2088 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 <3218 2263 gene locus_tag LOCUS_33980 <3218 2263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933520.1:peptidoglycan-binding protein >Feature sequence374 <1 585 gene locus_tag LOCUS_33990 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061780.1:IclR family transcriptional regulator 1190 573 gene locus_tag LOCUS_34000 1190 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_34000 <3191 1279 gene locus_tag LOCUS_34010 <3191 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q500M3:ATP-dependent DNA helicase Rep >Feature sequence375 530 279 gene locus_tag LOCUS_34020 gene fdx1 530 279 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_34020 1108 626 gene locus_tag LOCUS_34030 gene coaD 1108 626 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH3 protein_id gnl|my_center|LOCUS_34030 2802 1216 gene locus_tag LOCUS_34040 2802 1216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence376 1727 240 gene locus_tag LOCUS_34050 1727 240 CDS product regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202523.1 protein_id gnl|my_center|LOCUS_34050 <3183 1919 gene locus_tag LOCUS_34060 <3183 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113383.1:chemotaxis transducer >Feature sequence377 1566 385 gene locus_tag LOCUS_34070 gene nirJ 1566 385 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_34070 1968 1711 gene locus_tag LOCUS_34080 1968 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 2567 1980 gene locus_tag LOCUS_34090 2567 1980 CDS product cytochrome C oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_34090 <3177 2551 gene locus_tag LOCUS_34100 <3177 2551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51481:denitrification regulatory protein NirQ >Feature sequence378 <1 1998 gene locus_tag LOCUS_34110 <1 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4G3:periplasmic nitrate reductase 2010 2498 gene locus_tag LOCUS_34120 gene napB 2010 2498 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G4 protein_id gnl|my_center|LOCUS_34120 2509 3105 gene locus_tag LOCUS_34130 gene napC 2509 3105 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_34130 >Feature sequence379 <1 1202 gene locus_tag LOCUS_34140 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104152.1:two-component system sensor histidine kinase/response regulator 1204 2022 gene locus_tag LOCUS_34150 1204 2022 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104153.1 protein_id gnl|my_center|LOCUS_34150 2019 2618 gene locus_tag LOCUS_34160 2019 2618 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence380 725 1141 gene locus_tag LOCUS_34170 725 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 1471 1148 gene locus_tag LOCUS_34180 1471 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091533.1 protein_id gnl|my_center|LOCUS_34180 1542 2453 gene locus_tag LOCUS_34190 1542 2453 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 protein_id gnl|my_center|LOCUS_34190 2478 3032 gene locus_tag LOCUS_34200 gene ppiA 2478 3032 CDS product peptidyl-prolyl cis-trans isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59641 protein_id gnl|my_center|LOCUS_34200 >Feature sequence381 <1 2886 gene locus_tag LOCUS_34210 <1 2886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY7:RecBCD enzyme subunit RecB >Feature sequence382 322 1767 gene locus_tag LOCUS_34220 gene algA 322 1767 CDS product alginate biosynthesis protein AlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07874 protein_id gnl|my_center|LOCUS_34220 1969 2184 gene locus_tag LOCUS_34230 1969 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554967.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence383 <1 947 gene locus_tag LOCUS_34240 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971701.1:phosphoglucomutase, alpha-D-glucose phosphate-specific 1143 1469 gene locus_tag LOCUS_34250 1143 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 2540 1641 gene locus_tag LOCUS_34260 gene pbpG 2540 1641 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence384 983 159 gene locus_tag LOCUS_34270 983 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_34270 1538 1059 gene locus_tag LOCUS_34280 1538 1059 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP05 protein_id gnl|my_center|LOCUS_34280 1681 2658 gene locus_tag LOCUS_34290 1681 2658 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence385 <1 1193 gene locus_tag LOCUS_34300 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100681.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence386 1232 507 gene locus_tag LOCUS_34310 1232 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 2953 2420 gene locus_tag LOCUS_34320 2953 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence387 2212 1685 gene locus_tag LOCUS_34330 2212 1685 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266485.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence388 413 2170 gene locus_tag LOCUS_34340 gene uvrC 413 2170 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_34340 2195 2761 gene locus_tag LOCUS_34350 gene pgsA 2195 2761 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104334.1 protein_id gnl|my_center|LOCUS_34350 2830 2905 gene locus_tag LOCUS_t00400 2830 2905 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence389 2560 1628 gene locus_tag LOCUS_34360 gene ccoP2 2560 1628 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G2 protein_id gnl|my_center|LOCUS_34360 >Feature sequence390 177 695 gene locus_tag LOCUS_34370 177 695 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368718.1 protein_id gnl|my_center|LOCUS_34370 611 1678 gene locus_tag LOCUS_34380 611 1678 CDS product hydroxylase molybdopterin-containing subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence391 1901 792 gene locus_tag LOCUS_34390 gene coxB 1901 792 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_34390 2559 2197 gene locus_tag LOCUS_34400 2559 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence392 708 475 gene locus_tag LOCUS_34410 708 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266590.1 protein_id gnl|my_center|LOCUS_34410 2033 789 gene locus_tag LOCUS_34420 gene bamD 2033 789 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_34420 >Feature sequence393 1064 387 gene locus_tag LOCUS_34430 1064 387 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_34430 1175 1741 gene locus_tag LOCUS_34440 1175 1741 CDS product ADP-ribose diphosphatase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_34440 1738 2556 gene locus_tag LOCUS_34450 gene cysQ 1738 2556 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence394 <2854 1123 gene locus_tag LOCUS_34460 <2854 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HT80:DNA polymerase I >Feature sequence395 975 580 gene locus_tag LOCUS_34470 gene dgkA 975 580 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_34470 1690 965 gene locus_tag LOCUS_34480 1690 965 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_34480 2370 1693 gene locus_tag LOCUS_34490 2370 1693 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence396 <1 512 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcaggcgcggggatgaaccgc >Feature sequence397 63 707 gene locus_tag LOCUS_34500 63 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 720 1460 gene locus_tag LOCUS_34510 720 1460 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_34510 1463 2032 gene locus_tag LOCUS_34520 1463 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_34520 2029 2577 gene locus_tag LOCUS_34530 2029 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence398 1285 350 gene locus_tag LOCUS_34540 1285 350 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_34540 1981 1304 gene locus_tag LOCUS_34550 gene pcm 1981 1304 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_34550 2727 1978 gene locus_tag LOCUS_34560 gene surE 2727 1978 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY05 protein_id gnl|my_center|LOCUS_34560 >Feature sequence399 290 694 gene locus_tag LOCUS_34570 290 694 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_34570 900 700 gene locus_tag LOCUS_34580 900 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1460 996 gene locus_tag LOCUS_34590 gene bfr 1460 996 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF9 protein_id gnl|my_center|LOCUS_34590 >Feature sequence400 2811 1930 gene locus_tag LOCUS_34600 2811 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence401 807 37 gene locus_tag LOCUS_34610 807 37 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099547.1 protein_id gnl|my_center|LOCUS_34610 1472 804 gene locus_tag LOCUS_34620 1472 804 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_34620 2488 1469 gene locus_tag LOCUS_34630 2488 1469 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence402 1549 389 gene locus_tag LOCUS_34640 1549 389 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence403 890 273 gene locus_tag LOCUS_34650 890 273 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_34650 1655 900 gene locus_tag LOCUS_34660 1655 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2260 1652 gene locus_tag LOCUS_34670 2260 1652 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705671.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence404 383 910 gene locus_tag LOCUS_34680 383 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 1115 2461 gene locus_tag LOCUS_34690 1115 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence405 <2778 2009 gene locus_tag LOCUS_34700 <2778 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113000.1:transcriptional regulator AcoR >Feature sequence406 <1 520 gene locus_tag LOCUS_34710 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096239.1:transcriptional regulator 663 938 gene locus_tag LOCUS_34720 663 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 997 1203 gene locus_tag LOCUS_34730 997 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 1274 1825 gene locus_tag LOCUS_34740 1274 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113679.1 protein_id gnl|my_center|LOCUS_34740 2139 2762 gene locus_tag LOCUS_34750 2139 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence407 36 584 gene locus_tag LOCUS_34760 36 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence408 >Feature sequence409 160 897 gene locus_tag LOCUS_34770 160 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_34770 994 1272 gene locus_tag LOCUS_34780 994 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 1561 2373 gene locus_tag LOCUS_34790 1561 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038891.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34790 2519 2707 gene locus_tag LOCUS_34800 2519 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence410 1853 351 gene locus_tag LOCUS_34810 gene mmsA-1 1853 351 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_34810 <2725 1858 gene locus_tag LOCUS_34820 <2725 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727646.1:alcohol dehydrogenase >Feature sequence411 606 797 gene locus_tag LOCUS_34830 606 797 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 protein_id gnl|my_center|LOCUS_34830 1463 816 gene locus_tag LOCUS_34840 gene nalD 1463 816 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_34840 >Feature sequence412 1775 921 gene locus_tag LOCUS_34850 1775 921 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113640.1 protein_id gnl|my_center|LOCUS_34850 <2711 1876 gene locus_tag LOCUS_34860 <2711 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113302.1:oxidoreductase >Feature sequence413 1 708 gene locus_tag LOCUS_34870 1 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 807 882 gene locus_tag LOCUS_t00410 807 882 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1479 1108 gene locus_tag LOCUS_34880 1479 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2370 1618 gene locus_tag LOCUS_34890 2370 1618 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_34890 2691 2615 gene locus_tag LOCUS_t00420 2691 2615 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence414 891 28 gene locus_tag LOCUS_34900 891 28 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_34900 2624 903 gene locus_tag LOCUS_34910 2624 903 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence415 <1 864 gene locus_tag LOCUS_34920 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269166.1:peptidase S9 946 2112 gene locus_tag LOCUS_34930 946 2112 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence416 531 1544 gene locus_tag LOCUS_34940 531 1544 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_34940 <2708 1548 gene locus_tag LOCUS_34950 <2708 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084679.1:CoA transferase >Feature sequence417 <1 1685 gene locus_tag LOCUS_34960 <1 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113331.1:translocation/assembly module TamB >Feature sequence418 1486 131 gene locus_tag LOCUS_34970 gene atzB 1486 131 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence419 >Feature sequence420 >Feature sequence421 1404 25 gene locus_tag LOCUS_34980 1404 25 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114749.1 protein_id gnl|my_center|LOCUS_34980 1589 2398 gene locus_tag LOCUS_34990 1589 2398 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence422 2120 1254 gene locus_tag LOCUS_35000 2120 1254 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706308.1 protein_id gnl|my_center|LOCUS_35000 <2684 2132 gene locus_tag LOCUS_35010 <2684 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706309.1:2,3-dihydroxybenzoate-AMP ligase >Feature sequence423 1161 496 gene locus_tag LOCUS_35020 1161 496 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 protein_id gnl|my_center|LOCUS_35020 1466 1161 gene locus_tag LOCUS_35030 1466 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_35030 1774 1466 gene locus_tag LOCUS_35040 1774 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 protein_id gnl|my_center|LOCUS_35040 1932 2306 gene locus_tag LOCUS_35050 1932 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 2394 2654 gene locus_tag LOCUS_35060 2394 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence424 <1 1260 gene locus_tag LOCUS_35070 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104464.1:nitrite reductase large subunit 1262 1648 gene locus_tag LOCUS_35080 1262 1648 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 protein_id gnl|my_center|LOCUS_35080 1710 2522 gene locus_tag LOCUS_35090 1710 2522 CDS product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085585.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence425 994 227 gene locus_tag LOCUS_35100 gene hdhA 994 227 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483371.1 protein_id gnl|my_center|LOCUS_35100 2594 1479 gene locus_tag LOCUS_35110 gene malK 2594 1479 CDS product maltose/maltodextrin import ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1U0 protein_id gnl|my_center|LOCUS_35110 >Feature sequence426 148 996 gene locus_tag LOCUS_35120 148 996 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_35120 1134 2438 gene locus_tag LOCUS_35130 1134 2438 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence427 <2626 1830 gene locus_tag LOCUS_35140 <2626 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113855.1:resistance-nodulation-cell division efflux membrane fusion protein >Feature sequence428 1240 215 gene locus_tag LOCUS_35150 1240 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_35150 1388 1894 gene locus_tag LOCUS_35160 gene def 1388 1894 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_35160 >Feature sequence429 1265 315 gene locus_tag LOCUS_35170 gene ssuA 1265 315 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230639.1 protein_id gnl|my_center|LOCUS_35170 <2621 1364 gene locus_tag LOCUS_35180 <2621 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096703.1:RND efflux system hypothetical protein >Feature sequence430 1100 105 gene locus_tag LOCUS_35190 1100 105 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266178.1 protein_id gnl|my_center|LOCUS_35190 2434 1244 gene locus_tag LOCUS_35200 gene desA 2434 1244 CDS product delta-9 fatty acid desaturase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence431 1524 145 gene locus_tag LOCUS_35210 1524 145 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813002.1 protein_id gnl|my_center|LOCUS_35210 2304 1555 gene locus_tag LOCUS_35220 gene lptA 2304 1555 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence432 3 233 gene locus_tag LOCUS_35230 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 264 2174 gene locus_tag LOCUS_35240 264 2174 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267451.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence433 <2573 1287 gene locus_tag LOCUS_35250 <2573 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZJ2:fatty acid oxidation complex subunit alpha >Feature sequence434 1848 1048 gene locus_tag LOCUS_35260 1848 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 2129 2497 gene locus_tag LOCUS_35270 2129 2497 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence435 370 1719 gene locus_tag LOCUS_35280 370 1719 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_35280 >Feature sequence436 257 895 gene locus_tag LOCUS_35290 257 895 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence437 <2526 1146 gene locus_tag LOCUS_35300 <2526 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I6E0:dihydroxy-acid dehydratase >Feature sequence438 >Feature sequence439 <1 1375 gene locus_tag LOCUS_35310 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34750:fimbrial assembly protein PilQ 1380 1925 gene locus_tag LOCUS_35320 gene aroK 1380 1925 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_35320 >Feature sequence440 790 1941 gene locus_tag LOCUS_35330 gene yghO 790 1941 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence441 >Feature sequence442 <1 805 gene locus_tag LOCUS_35340 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113579.1:nitrite reductase large subunit >Feature sequence443 581 1975 gene locus_tag LOCUS_35350 581 1975 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence444 1627 1013 gene locus_tag LOCUS_35360 1627 1013 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_35360 1863 1788 gene locus_tag LOCUS_t00430 1863 1788 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence445 <1 1840 gene locus_tag LOCUS_35370 <1 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY8:RecBCD enzyme subunit RecC >Feature sequence446 <1 659 gene locus_tag LOCUS_35380 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266221.1:methyl-accepting chemotaxis protein >Feature sequence447 1141 302 gene locus_tag LOCUS_35390 gene rlmJ 1141 302 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF0 protein_id gnl|my_center|LOCUS_35390 1280 2323 gene locus_tag LOCUS_35400 1280 2323 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence448 384 1199 gene locus_tag LOCUS_35410 gene rhdA 384 1199 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_35410 1211 2077 gene locus_tag LOCUS_35420 1211 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence449 191 502 gene locus_tag LOCUS_35430 191 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942311.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence450 2298 1057 gene locus_tag LOCUS_35440 2298 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence451 883 398 gene locus_tag LOCUS_35450 gene np20 883 398 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_35450 946 1953 gene locus_tag LOCUS_35460 946 1953 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence452 366 944 gene locus_tag LOCUS_35470 366 944 CDS product Mg(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 protein_id gnl|my_center|LOCUS_35470 982 1386 gene locus_tag LOCUS_35480 982 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 protein_id gnl|my_center|LOCUS_35480 1571 2104 gene locus_tag LOCUS_35490 1571 2104 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence453 1640 216 gene locus_tag LOCUS_35500 gene ccoN2 1640 216 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence454 1411 545 gene locus_tag LOCUS_35510 gene atpG 1411 545 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_35510 2271 1462 gene locus_tag LOCUS_35520 2271 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence455 868 251 gene locus_tag LOCUS_35530 868 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_35530 1364 1041 gene locus_tag LOCUS_35540 1364 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 <2253 1361 gene locus_tag LOCUS_35550 <2253 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704244.1:cation transporter >Feature sequence456 1541 873 gene locus_tag LOCUS_35560 1541 873 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence457 336 674 gene locus_tag LOCUS_35570 336 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35570 >Feature sequence458 >Feature sequence459 788 63 gene locus_tag LOCUS_35580 gene minC 788 63 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW11 protein_id gnl|my_center|LOCUS_35580 945 1874 gene locus_tag LOCUS_35590 gene lpxL 945 1874 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_35590 >Feature sequence460 2166 871 gene locus_tag LOCUS_35600 2166 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence461 <1 792 gene locus_tag LOCUS_35610 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZS44:4-alpha-glucanotransferase >Feature sequence462 1392 772 gene locus_tag LOCUS_35620 1392 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096613.1 protein_id gnl|my_center|LOCUS_35620 <2185 1455 gene locus_tag LOCUS_35630 <2185 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114367.1:transcriptional regulator >Feature sequence463 1370 189 gene locus_tag LOCUS_35640 gene gcdH 1370 189 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence464 1483 17 gene locus_tag LOCUS_35650 gene dacB 1483 17 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765687.1 protein_id gnl|my_center|LOCUS_35650 1691 2029 gene locus_tag LOCUS_35660 1691 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence465 244 669 gene locus_tag LOCUS_35670 244 669 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244922.1 protein_id gnl|my_center|LOCUS_35670 738 1733 gene locus_tag LOCUS_35680 738 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence466 225 1139 gene locus_tag LOCUS_35690 225 1139 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016572.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence467 289 531 gene locus_tag LOCUS_35700 289 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 628 1620 gene locus_tag LOCUS_35710 gene rpoS 628 1620 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_35710 >Feature sequence468 446 1039 gene locus_tag LOCUS_35720 gene hisB 446 1039 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLP8 protein_id gnl|my_center|LOCUS_35720 1039 1677 gene locus_tag LOCUS_35730 gene hisH1 1039 1677 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_35730 1678 1938 gene locus_tag LOCUS_35740 1678 1938 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 protein_id gnl|my_center|LOCUS_35740 >Feature sequence469 >Feature sequence470 692 1258 gene locus_tag LOCUS_35750 gene efp 692 1258 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ2 protein_id gnl|my_center|LOCUS_35750 <2113 1357 gene locus_tag LOCUS_35760 <2113 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter >Feature sequence471 <1 735 gene locus_tag LOCUS_35770 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G3XD24:methyl-accepting chemotaxis protein PctA 823 1506 gene locus_tag LOCUS_35780 823 1506 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_35780 2100 1507 gene locus_tag LOCUS_35790 2100 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence472 142 67 gene locus_tag LOCUS_t00440 142 67 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 346 1266 gene locus_tag LOCUS_35800 gene rdgC 346 1266 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW36 protein_id gnl|my_center|LOCUS_35800 <2100 1303 gene locus_tag LOCUS_35810 <2100 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407259.1:MFS transporter >Feature sequence473 539 1750 gene locus_tag LOCUS_35820 539 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35820 >Feature sequence474 465 16 gene locus_tag LOCUS_35830 465 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 protein_id gnl|my_center|LOCUS_35830 979 542 gene locus_tag LOCUS_35840 979 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence475 827 1540 gene locus_tag LOCUS_35850 827 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence476 588 1502 gene locus_tag LOCUS_35860 588 1502 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_35860 <2070 1530 gene locus_tag LOCUS_35870 <2070 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005765154.1:LacI family transcriptional regulator >Feature sequence477 421 1038 gene locus_tag LOCUS_35880 gene ribA 421 1038 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_35880 1035 1442 gene locus_tag LOCUS_35890 1035 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102818.1 protein_id gnl|my_center|LOCUS_35890 1980 1447 gene locus_tag LOCUS_35900 1980 1447 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707846.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence478 951 1223 gene locus_tag LOCUS_35910 951 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1679 1230 gene locus_tag LOCUS_35920 1679 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_35920 2023 1948 gene locus_tag LOCUS_t00450 2023 1948 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence479 <1 822 gene locus_tag LOCUS_35930 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114306.1:molybdopterin molybdenumtransferase MoeA 1430 882 gene locus_tag LOCUS_35940 1430 882 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_35940 <2017 1489 gene locus_tag LOCUS_35950 <2017 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406386.1:two-component sensor histidine kinase >Feature sequence480 1028 645 gene locus_tag LOCUS_35960 1028 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 1573 1025 gene locus_tag LOCUS_35970 1573 1025 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence481 319 828 gene locus_tag LOCUS_35980 gene nirL 319 828 CDS product protein NirL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95413 protein_id gnl|my_center|LOCUS_35980 821 1264 gene locus_tag LOCUS_35990 gene nirG 821 1264 CDS product protein NirG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95414 protein_id gnl|my_center|LOCUS_35990 1239 1742 gene locus_tag LOCUS_36000 gene nirH 1239 1742 CDS product protein NirH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95415 protein_id gnl|my_center|LOCUS_36000 >Feature sequence482 142 1485 gene locus_tag LOCUS_36010 142 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence483 >Feature sequence484 1728 445 gene locus_tag LOCUS_36020 gene hemL 1728 445 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_36020 >Feature sequence485 <1 834 gene locus_tag LOCUS_36030 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089998.1:acyl-CoA dehydrogenase >Feature sequence486 126 1826 gene locus_tag LOCUS_36040 gene ampG 126 1826 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112756.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence487 704 438 gene locus_tag LOCUS_36050 704 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 1031 1912 gene locus_tag LOCUS_36060 1031 1912 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence488 <1 1860 gene locus_tag LOCUS_36070 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268160.1:indolepyruvate ferredoxin oxidoreductase >Feature sequence489 572 1522 gene locus_tag LOCUS_36080 572 1522 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889J2 protein_id gnl|my_center|LOCUS_36080 1610 1771 gene locus_tag LOCUS_36090 1610 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104346.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence490 <1 1638 gene locus_tag LOCUS_36100 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037253.1:transposase >Feature sequence491 414 199 gene locus_tag LOCUS_36110 414 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 701 537 gene locus_tag LOCUS_36120 701 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 740 1612 gene locus_tag LOCUS_36130 740 1612 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence492 433 1830 gene locus_tag LOCUS_36140 433 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence493 756 382 gene locus_tag LOCUS_36150 756 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096629.1 protein_id gnl|my_center|LOCUS_36150 1169 897 gene locus_tag LOCUS_36160 gene hupA 1169 897 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_36160 <1824 1319 gene locus_tag LOCUS_36170 <1824 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269384.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence494 467 21 gene locus_tag LOCUS_36180 467 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_36180 1300 515 gene locus_tag LOCUS_36190 gene znuB 1300 515 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 protein_id gnl|my_center|LOCUS_36190 >Feature sequence495 656 375 gene locus_tag LOCUS_36200 656 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 546 1349 gene locus_tag LOCUS_36210 546 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence496 <1 1765 gene locus_tag LOCUS_36220 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUX1:biosynthetic arginine decarboxylase >Feature sequence497 1587 253 gene locus_tag LOCUS_36230 1587 253 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence498 1647 19 gene locus_tag LOCUS_36240 gene aglA 1647 19 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence499 <1 633 gene locus_tag LOCUS_36250 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147345.1:multidrug efflux pump outer membrane protein >Feature sequence500 <1 948 gene locus_tag LOCUS_36260 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114885.1:YggW family oxidoreductase 958 1281 gene locus_tag LOCUS_36270 958 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_36270 1668 1297 gene locus_tag LOCUS_36280 1668 1297 CDS product DUF5064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082140.1 protein_id gnl|my_center|LOCUS_36280 >Feature sequence501 >Feature sequence502 >Feature sequence503 594 28 gene locus_tag LOCUS_36290 gene dcd 594 28 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_36290 906 1115 gene locus_tag LOCUS_36300 gene capB 906 1115 CDS product cold shock protein CapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A105 protein_id gnl|my_center|LOCUS_36300 <1779 1246 gene locus_tag LOCUS_36310 <1779 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266183.1:transposase >Feature sequence504 >Feature sequence505 >Feature sequence506 1393 488 gene locus_tag LOCUS_36320 gene fusE 1393 488 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039233.1 protein_id gnl|my_center|LOCUS_36320 1598 1395 gene locus_tag LOCUS_36330 1598 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence507 <1742 1172 gene locus_tag LOCUS_36340 <1742 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34002:3-dehydroquinate synthase >Feature sequence508 >Feature sequence509 >Feature sequence510 >Feature sequence511 >Feature sequence512 1142 204 gene locus_tag LOCUS_36350 1142 204 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_36350 1498 1199 gene locus_tag LOCUS_36360 1498 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence513 404 595 gene locus_tag LOCUS_36370 404 595 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_36370 605 946 gene locus_tag LOCUS_36380 605 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_36380 995 1609 gene locus_tag LOCUS_36390 995 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence514 57 641 gene locus_tag LOCUS_36400 57 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence515 1635 313 gene locus_tag LOCUS_36410 1635 313 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence516 1201 275 gene locus_tag LOCUS_36420 1201 275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266555.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence517 <1 1487 gene locus_tag LOCUS_36430 <1 1487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L >Feature sequence518 <1615 31 gene locus_tag LOCUS_36440 <1615 31 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920765.1:TonB-dependent receptor >Feature sequence519 >Feature sequence520 >Feature sequence521 258 1415 gene locus_tag LOCUS_36450 258 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence522 1146 433 gene locus_tag LOCUS_36460 gene tolQ-1 1146 433 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245914.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence523 226 930 gene locus_tag LOCUS_36470 226 930 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037009.1 protein_id gnl|my_center|LOCUS_36470 992 1543 gene locus_tag LOCUS_36480 992 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093439.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence524 <1 690 gene locus_tag LOCUS_36490 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXD6:GTP 3',8-cyclase 1 910 1455 gene locus_tag LOCUS_36500 gene moaB2 910 1455 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_36500 >Feature sequence525 <1 892 gene locus_tag LOCUS_36510 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402871.1:multidrug transporter AcrB >Feature sequence526 948 331 gene locus_tag LOCUS_36520 gene mdcG 948 331 CDS product phosphoribosyl-dephospho-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6S5 protein_id gnl|my_center|LOCUS_36520 <1548 1021 gene locus_tag LOCUS_36530 <1548 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112668.1:biotin-independent malonate decarboxylase subunit gamma >Feature sequence527 >Feature sequence528 1220 1300 gene locus_tag LOCUS_t00460 1220 1300 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence529 <1528 241 gene locus_tag LOCUS_36540 <1528 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q500T7:glycine--tRNA ligase beta subunit >Feature sequence530 >Feature sequence531 >Feature sequence532 1510 920 gene locus_tag LOCUS_36550 1510 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence533 922 260 gene locus_tag LOCUS_36560 922 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049938.1 protein_id gnl|my_center|LOCUS_36560 >Feature sequence534 <1 1125 gene locus_tag LOCUS_36570 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9XCL6:glutamate--tRNA ligase 1269 1344 gene locus_tag LOCUS_t00470 1269 1344 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1400 1475 gene locus_tag LOCUS_t00480 1400 1475 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence535 1067 534 gene locus_tag LOCUS_36580 1067 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_36580 1471 1064 gene locus_tag LOCUS_36590 1471 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence536 >Feature sequence537 782 618 gene locus_tag LOCUS_36600 782 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence538 >Feature sequence539 <1 857 gene locus_tag LOCUS_36610 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103939.1:protein kinase >Feature sequence540 >Feature sequence541 220 11 gene locus_tag LOCUS_36620 220 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 302 1120 gene locus_tag LOCUS_36630 302 1120 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence542 1242 355 gene locus_tag LOCUS_36640 1242 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_36640 >Feature sequence543 >Feature sequence544 <1395 532 gene locus_tag LOCUS_36650 <1395 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967807.1:cation:proton antiporter >Feature sequence545 663 1250 gene locus_tag LOCUS_36660 663 1250 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence546 >Feature sequence547 <1 991 gene locus_tag LOCUS_36670 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113578.1:assimilatory nitrate reductase >Feature sequence548 <1 1241 gene locus_tag LOCUS_36680 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093598.1:acyl-CoA synthetase >Feature sequence549 >Feature sequence550 553 1182 gene locus_tag LOCUS_36690 553 1182 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence551 <1332 359 gene locus_tag LOCUS_36700 <1332 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZLZ9:DNA ligase B >Feature sequence552 946 1146 gene locus_tag LOCUS_36710 946 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36710 >Feature sequence553 >Feature sequence554 910 173 gene locus_tag LOCUS_36720 910 173 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence555 >Feature sequence556 359 850 gene locus_tag LOCUS_36730 359 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_36730 1312 854 gene locus_tag LOCUS_36740 1312 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence557 245 1030 gene locus_tag LOCUS_36750 245 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_36750 >Feature sequence558 58 807 gene locus_tag LOCUS_36760 58 807 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence559 >Feature sequence560 <1 552 gene locus_tag LOCUS_36770 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267690.1:hybrid sensor histidine kinase/response regulator >Feature sequence561 >Feature sequence562 839 90 gene locus_tag LOCUS_36780 839 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence563 117 509 gene locus_tag LOCUS_36790 gene phhB 117 509 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43335 protein_id gnl|my_center|LOCUS_36790 >Feature sequence564 929 429 gene locus_tag LOCUS_36800 gene pgpA 929 429 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX8 protein_id gnl|my_center|LOCUS_36800 >Feature sequence565 613 1143 gene locus_tag LOCUS_36810 613 1143 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence566 >Feature sequence567 >Feature sequence568 <1191 103 gene locus_tag LOCUS_36820 <1191 103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810851.1:membrane protein >Feature sequence569 >Feature sequence570 <1178 194 gene locus_tag LOCUS_36830 <1178 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227551.1:acyl-CoA dehydrogenase >Feature sequence571 1151 651 gene locus_tag LOCUS_36840 1151 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence572 <1 955 gene locus_tag LOCUS_36850 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114824.1:ABC transporter permease >Feature sequence573 <1 1010 gene locus_tag LOCUS_36860 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004542866.1:cation efflux system protein >Feature sequence574 37 1080 gene locus_tag LOCUS_36870 37 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence575 3 251 gene locus_tag LOCUS_36880 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 918 316 gene locus_tag LOCUS_36890 918 316 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence576 <1127 373 gene locus_tag LOCUS_36900 <1127 373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719558.1:ABC transporter permease >Feature sequence577 >Feature sequence578 2 541 gene locus_tag LOCUS_36910 2 541 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence579 >Feature sequence580 56 1084 gene locus_tag LOCUS_36920 56 1084 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704119.1 protein_id gnl|my_center|LOCUS_36920 >Feature sequence581 559 344 gene locus_tag LOCUS_36930 559 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence582 381 815 gene locus_tag LOCUS_36940 381 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence583 402 791 gene locus_tag LOCUS_36950 402 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 >Feature sequence588 <1057 381 gene locus_tag LOCUS_36960 <1057 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198292.1:acyl-CoA dehydrogenase >Feature sequence589 999 115 gene locus_tag LOCUS_36970 999 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence590 <1 709 gene locus_tag LOCUS_36980 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038619.1:endonuclease >Feature sequence591 >Feature sequence592 <1014 174 gene locus_tag LOCUS_36990 <1014 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I6C8:putative coniferyl aldehyde dehydrogenase >Feature sequence593 <1 945 gene locus_tag LOCUS_37000 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXB0:peptide chain release factor 3 >Feature sequence594 170 412 gene locus_tag LOCUS_37010 170 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 >Feature sequence595