>Feature sequence0001 2408 921 gene locus_tag LOCUS_00010 2408 921 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_00010 3118 2408 gene locus_tag LOCUS_00020 3118 2408 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_00020 3820 4530 gene locus_tag LOCUS_00030 3820 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_00030 4934 5425 gene locus_tag LOCUS_00040 4934 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5652 6281 gene locus_tag LOCUS_00050 5652 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7822 6395 gene locus_tag LOCUS_00060 7822 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9167 7833 gene locus_tag LOCUS_00070 9167 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9283 10047 gene locus_tag LOCUS_00080 9283 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11241 10261 gene locus_tag LOCUS_00090 11241 10261 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_00090 11362 11823 gene locus_tag LOCUS_00100 11362 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11824 12429 gene locus_tag LOCUS_00110 11824 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_00110 >Feature sequence0002 513 2042 gene locus_tag LOCUS_00120 513 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 2249 3232 gene locus_tag LOCUS_00130 2249 3232 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107610.1 protein_id gnl|my_center|LOCUS_00130 3295 4275 gene locus_tag LOCUS_00140 3295 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 4272 5054 gene locus_tag LOCUS_00150 4272 5054 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_00150 5643 5146 gene locus_tag LOCUS_00160 5643 5146 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_00160 6253 5690 gene locus_tag LOCUS_00170 6253 5690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 protein_id gnl|my_center|LOCUS_00170 6458 7912 gene locus_tag LOCUS_00180 6458 7912 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_00180 8068 8994 gene locus_tag LOCUS_00190 8068 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869230.1 protein_id gnl|my_center|LOCUS_00190 9721 8984 gene locus_tag LOCUS_00200 9721 8984 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence0003 4388 1833 gene locus_tag LOCUS_00210 4388 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 4497 5357 gene locus_tag LOCUS_00220 4497 5357 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_00220 5391 5813 gene locus_tag LOCUS_00230 5391 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259085.1 protein_id gnl|my_center|LOCUS_00230 6246 6563 gene locus_tag LOCUS_00240 6246 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6563 7750 gene locus_tag LOCUS_00250 gene atpB 6563 7750 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_00250 7785 8045 gene locus_tag LOCUS_00260 7785 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 8117 8611 gene locus_tag LOCUS_00270 gene atpF 8117 8611 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_00270 8622 9179 gene locus_tag LOCUS_00280 gene atpH 8622 9179 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_00280 >Feature sequence0004 758 2083 gene locus_tag LOCUS_00290 758 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 2231 2689 gene locus_tag LOCUS_00300 2231 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 2904 4187 gene locus_tag LOCUS_00310 2904 4187 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_00310 4269 6374 gene locus_tag LOCUS_00320 4269 6374 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_00320 6455 6724 gene locus_tag LOCUS_00330 6455 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 6724 7404 gene locus_tag LOCUS_00340 6724 7404 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143374.1 protein_id gnl|my_center|LOCUS_00340 7410 7640 gene locus_tag LOCUS_00350 7410 7640 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC0 protein_id gnl|my_center|LOCUS_00350 7640 8317 gene locus_tag LOCUS_00360 gene rsmI 7640 8317 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_00360 8904 8314 gene locus_tag LOCUS_00370 8904 8314 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence0005 561 127 gene locus_tag LOCUS_00380 561 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1030 548 gene locus_tag LOCUS_00390 1030 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 1601 1038 gene locus_tag LOCUS_00400 1601 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66416 protein_id gnl|my_center|LOCUS_00400 1894 1610 gene locus_tag LOCUS_00410 1894 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 3580 1949 gene locus_tag LOCUS_00420 gene pruA 3580 1949 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_00420 4353 3658 gene locus_tag LOCUS_00430 4353 3658 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_00430 4739 4356 gene locus_tag LOCUS_00440 4739 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4879 5523 gene locus_tag LOCUS_00450 4879 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6354 5662 gene locus_tag LOCUS_00460 6354 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6460 7176 gene locus_tag LOCUS_00470 6460 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7176 8156 gene locus_tag LOCUS_00480 7176 8156 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_00480 8153 8947 gene locus_tag LOCUS_00490 8153 8947 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence0006 4776 2350 gene locus_tag LOCUS_00500 4776 2350 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_00500 6160 4853 gene locus_tag LOCUS_00510 gene dgt 6160 4853 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence0007 1135 866 gene locus_tag LOCUS_00520 1135 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2297 1284 gene locus_tag LOCUS_00530 2297 1284 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_00530 3954 2290 gene locus_tag LOCUS_00540 3954 2290 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_00540 4102 4509 gene locus_tag LOCUS_00550 4102 4509 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_00550 4506 6071 gene locus_tag LOCUS_00560 4506 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 6125 6673 gene locus_tag LOCUS_00570 gene pyrR1 6125 6673 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_00570 6673 7599 gene locus_tag LOCUS_00580 gene pyrB 6673 7599 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_00580 7606 8586 gene locus_tag LOCUS_00590 7606 8586 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence0008 <1 593 gene locus_tag LOCUS_00600 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962845.1:phosphoribosylformylglycinamidine cyclo-ligase 705 7661 gene locus_tag LOCUS_00610 705 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 >Feature sequence0009 403 2211 gene locus_tag LOCUS_00620 gene uvrC 403 2211 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_00620 3285 2242 gene locus_tag LOCUS_00630 3285 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5098 3287 gene locus_tag LOCUS_00640 5098 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 5923 5111 gene locus_tag LOCUS_00650 gene gldL 5923 5111 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_00650 7125 5977 gene locus_tag LOCUS_00660 7125 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8294 7326 gene locus_tag LOCUS_00670 8294 7326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence0010 539 991 gene locus_tag LOCUS_00680 539 991 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_00680 992 1516 gene locus_tag LOCUS_00690 992 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1513 2079 gene locus_tag LOCUS_00700 1513 2079 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015797.1 protein_id gnl|my_center|LOCUS_00700 2138 2803 gene locus_tag LOCUS_00710 2138 2803 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_00710 2812 3687 gene locus_tag LOCUS_00720 gene nadK 2812 3687 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_00720 3831 4448 gene locus_tag LOCUS_00730 3831 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4532 5269 gene locus_tag LOCUS_00740 gene uppS 4532 5269 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_00740 5311 7935 gene locus_tag LOCUS_00750 5311 7935 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404583.1 protein_id gnl|my_center|LOCUS_00750 7939 8481 gene locus_tag LOCUS_00760 7939 8481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence0011 1515 1979 gene locus_tag LOCUS_00770 1515 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2886 3833 gene locus_tag LOCUS_00780 2886 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3896 6277 gene locus_tag LOCUS_00790 3896 6277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence0012 1404 2396 gene locus_tag LOCUS_00800 gene asd 1404 2396 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_00800 2393 3568 gene locus_tag LOCUS_00810 2393 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_00810 7138 3779 gene locus_tag LOCUS_00820 7138 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7299 7742 gene locus_tag LOCUS_00830 7299 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence0013 247 2631 gene locus_tag LOCUS_00840 247 2631 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_00840 2662 3837 gene locus_tag LOCUS_00850 2662 3837 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_00850 3892 4242 gene locus_tag LOCUS_00860 3892 4242 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_00860 4280 6088 gene locus_tag LOCUS_00870 4280 6088 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_00870 6626 6327 gene locus_tag LOCUS_00880 6626 6327 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_00880 6968 7144 gene locus_tag LOCUS_00890 6968 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7915 7304 gene locus_tag LOCUS_00900 7915 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 >Feature sequence0014 <1 1015 gene locus_tag LOCUS_00910 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125688.1:sodium:alanine symporter 1364 1062 gene locus_tag LOCUS_00920 1364 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1602 2036 gene locus_tag LOCUS_00930 1602 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2247 3395 gene locus_tag LOCUS_00940 2247 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3474 6002 gene locus_tag LOCUS_00950 gene gyrA 3474 6002 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_00950 6034 7206 gene locus_tag LOCUS_00960 6034 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_00960 7307 7852 gene locus_tag LOCUS_00970 7307 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7849 8061 gene locus_tag LOCUS_00980 7849 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence0015 <1 3978 gene locus_tag LOCUS_00990 <1 3978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989777.1:cell wall surface anchor protein 4067 4441 gene locus_tag LOCUS_01000 gene groES-2 4067 4441 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_01000 4535 5638 gene locus_tag LOCUS_01010 4535 5638 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_01010 6603 5635 gene locus_tag LOCUS_01020 gene hemB 6603 5635 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_01020 6856 6647 gene locus_tag LOCUS_01030 6856 6647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_01030 7511 6861 gene locus_tag LOCUS_01040 7511 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 >Feature sequence0016 347 1210 gene locus_tag LOCUS_01050 347 1210 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_01050 1207 2826 gene locus_tag LOCUS_01060 1207 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3173 5035 gene locus_tag LOCUS_01070 3173 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5036 5236 gene locus_tag LOCUS_01080 5036 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence0017 1042 8 gene locus_tag LOCUS_01090 1042 8 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_01090 1734 1054 gene locus_tag LOCUS_01100 1734 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2048 1812 gene locus_tag LOCUS_01110 2048 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2320 2111 gene locus_tag LOCUS_01120 2320 2111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_01120 2510 2650 gene locus_tag LOCUS_01130 2510 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3195 2647 gene locus_tag LOCUS_01140 3195 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3757 3209 gene locus_tag LOCUS_01150 3757 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5212 3782 gene locus_tag LOCUS_01160 5212 3782 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_01160 5286 5879 gene locus_tag LOCUS_01170 5286 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_01170 5879 6319 gene locus_tag LOCUS_01180 5879 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_01180 6321 6899 gene locus_tag LOCUS_01190 6321 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6909 7343 gene locus_tag LOCUS_01200 6909 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence0018 487 1602 gene locus_tag LOCUS_01210 gene dnaJ 487 1602 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_01210 2160 3047 gene locus_tag LOCUS_01220 2160 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3207 4115 gene locus_tag LOCUS_01230 gene natA 3207 4115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01230 4112 5434 gene locus_tag LOCUS_01240 gene natB 4112 5434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_01240 5577 6818 gene locus_tag LOCUS_01250 5577 6818 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence0019 <1 588 gene locus_tag LOCUS_01260 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107495.1:membrane protein 1992 649 gene locus_tag LOCUS_01270 gene purB 1992 649 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_01270 2168 3259 gene locus_tag LOCUS_01280 gene paaE 2168 3259 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_01280 3361 4632 gene locus_tag LOCUS_01290 3361 4632 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_01290 4634 5599 gene locus_tag LOCUS_01300 4634 5599 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_01300 6182 5601 gene locus_tag LOCUS_01310 6182 5601 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_01310 6248 6742 gene locus_tag LOCUS_01320 6248 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 >Feature sequence0020 <1 705 gene locus_tag LOCUS_01330 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460513.1:L-serine dehydratase, iron-sulfur-dependent subunit alpha 713 919 gene locus_tag LOCUS_01340 713 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 2189 1251 gene locus_tag LOCUS_01350 2189 1251 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_01350 2841 2194 gene locus_tag LOCUS_01360 gene upp 2841 2194 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_01360 2921 3844 gene locus_tag LOCUS_01370 2921 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3844 4389 gene locus_tag LOCUS_01380 3844 4389 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_01380 4432 5007 gene locus_tag LOCUS_01390 gene adk 4432 5007 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_01390 5077 5550 gene locus_tag LOCUS_01400 5077 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5550 5816 gene locus_tag LOCUS_01410 5550 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 5714 6544 gene locus_tag LOCUS_01420 5714 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 >Feature sequence0021 1137 895 gene locus_tag LOCUS_01430 gene rpmE2 1137 895 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_01430 1298 2959 gene locus_tag LOCUS_01440 1298 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3000 4832 gene locus_tag LOCUS_01450 gene msbA 3000 4832 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_01450 4897 5484 gene locus_tag LOCUS_01460 gene gmhA 4897 5484 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63222 protein_id gnl|my_center|LOCUS_01460 >Feature sequence0022 <1 1033 gene locus_tag LOCUS_01470 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964031.1:anhydro-N-acetylmuramic acid kinase 1199 2662 gene locus_tag LOCUS_01480 1199 2662 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_01480 2704 2934 gene locus_tag LOCUS_01490 2704 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3323 2931 gene locus_tag LOCUS_01500 3323 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3720 3397 gene locus_tag LOCUS_01510 3720 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_01510 3858 4784 gene locus_tag LOCUS_01520 3858 4784 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 protein_id gnl|my_center|LOCUS_01520 5353 4781 gene locus_tag LOCUS_01530 5353 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6672 5350 gene locus_tag LOCUS_01540 gene gpmI 6672 5350 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_01540 >Feature sequence0023 143 937 gene locus_tag LOCUS_01550 143 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_01550 915 1298 gene locus_tag LOCUS_01560 915 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_01560 1389 1955 gene locus_tag LOCUS_01570 1389 1955 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_01570 2082 2825 gene locus_tag LOCUS_01580 2082 2825 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968036.1 protein_id gnl|my_center|LOCUS_01580 2828 3091 gene locus_tag LOCUS_01590 2828 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01590 3097 4029 gene locus_tag LOCUS_01600 3097 4029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100605.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 4031 5020 gene locus_tag LOCUS_01610 4031 5020 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705351.1 protein_id gnl|my_center|LOCUS_01610 5032 6018 gene locus_tag LOCUS_01620 5032 6018 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973397.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence0024 351 157 gene locus_tag LOCUS_01630 351 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 570 1004 gene locus_tag LOCUS_01640 570 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 997 1770 gene locus_tag LOCUS_01650 997 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 1776 2513 gene locus_tag LOCUS_01660 1776 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2550 3281 gene locus_tag LOCUS_01670 2550 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3443 6181 gene locus_tag LOCUS_01680 3443 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6114 6539 gene locus_tag LOCUS_01690 6114 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence0025 2695 1010 gene locus_tag LOCUS_01700 2695 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867182.1 protein_id gnl|my_center|LOCUS_01700 3358 2774 gene locus_tag LOCUS_01710 3358 2774 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_01710 4830 3361 gene locus_tag LOCUS_01720 4830 3361 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_01720 5987 4869 gene locus_tag LOCUS_01730 5987 4869 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence0026 89 1060 gene locus_tag LOCUS_01740 89 1060 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_01740 1924 1061 gene locus_tag LOCUS_01750 gene rmlA 1924 1061 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNQ3 protein_id gnl|my_center|LOCUS_01750 2970 1921 gene locus_tag LOCUS_01760 gene rmlB 2970 1921 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_01760 3142 4281 gene locus_tag LOCUS_01770 3142 4281 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_01770 4357 4551 gene locus_tag LOCUS_01780 gene rpsU 4357 4551 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_01780 4614 5495 gene locus_tag LOCUS_01790 gene xerC 4614 5495 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_01790 5521 5817 gene locus_tag LOCUS_01800 5521 5817 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence0027 532 1710 gene locus_tag LOCUS_01810 532 1710 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_01810 1856 3016 gene locus_tag LOCUS_01820 1856 3016 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_01820 3013 4305 gene locus_tag LOCUS_01830 3013 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4296 5102 gene locus_tag LOCUS_01840 4296 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5099 5977 gene locus_tag LOCUS_01850 5099 5977 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence0028 419 961 gene locus_tag LOCUS_01860 419 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 966 1484 gene locus_tag LOCUS_01870 966 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_01870 1560 2795 gene locus_tag LOCUS_01880 gene xseA 1560 2795 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_01880 2788 2982 gene locus_tag LOCUS_01890 2788 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2985 5036 gene locus_tag LOCUS_01900 gene ligA 2985 5036 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_01900 5036 5545 gene locus_tag LOCUS_01910 5036 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence0029 4 1815 gene locus_tag LOCUS_01920 4 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3396 2047 gene locus_tag LOCUS_01930 3396 2047 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0030 530 1729 gene locus_tag LOCUS_01940 530 1729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_01940 1748 2800 gene locus_tag LOCUS_01950 1748 2800 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_01950 2803 3801 gene locus_tag LOCUS_01960 2803 3801 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_01960 3782 5659 gene locus_tag LOCUS_01970 3782 5659 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence0031 1339 2736 gene locus_tag LOCUS_01980 1339 2736 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_01980 3754 3254 gene locus_tag LOCUS_01990 3754 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4301 3822 gene locus_tag LOCUS_02000 4301 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5078 4380 gene locus_tag LOCUS_02010 5078 4380 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence0032 <1 1284 gene locus_tag LOCUS_02020 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0E1:tricorn protease 1536 2771 gene locus_tag LOCUS_02030 1536 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_02030 3923 2949 gene locus_tag LOCUS_02040 gene aspG 3923 2949 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_02040 >Feature sequence0033 576 52 gene locus_tag LOCUS_02050 gene paiA 576 52 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_02050 748 4197 gene locus_tag LOCUS_02060 gene pyc 748 4197 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_02060 4555 4307 gene locus_tag LOCUS_02070 4555 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5066 4593 gene locus_tag LOCUS_02080 5066 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5885 5253 gene locus_tag LOCUS_02090 5885 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence0034 <1 1565 gene locus_tag LOCUS_02100 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase 2069 1743 gene locus_tag LOCUS_02110 gene sufA 2069 1743 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_02110 2479 2069 gene locus_tag LOCUS_02120 2479 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2457 3005 gene locus_tag LOCUS_02130 2457 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3113 4144 gene locus_tag LOCUS_02140 gene thiL 3113 4144 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6J9 protein_id gnl|my_center|LOCUS_02140 4947 4132 gene locus_tag LOCUS_02150 4947 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5019 5852 gene locus_tag LOCUS_02160 gene ilvE 5019 5852 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence0035 <1 1237 gene locus_tag LOCUS_02170 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA 1396 1698 gene locus_tag LOCUS_02180 1396 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1749 3113 gene locus_tag LOCUS_02190 1749 3113 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_02190 3700 3110 gene locus_tag LOCUS_02200 3700 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4022 4534 gene locus_tag LOCUS_02210 4022 4534 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_02210 4521 5285 gene locus_tag LOCUS_02220 4521 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence0036 1438 626 gene locus_tag LOCUS_02230 1438 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3046 1442 gene locus_tag LOCUS_02240 3046 1442 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_02240 3490 3224 gene locus_tag LOCUS_02250 3490 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4024 3641 gene locus_tag LOCUS_02260 4024 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence0037 357 1058 gene locus_tag LOCUS_02270 357 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1130 2023 gene locus_tag LOCUS_02280 1130 2023 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_02280 2072 2524 gene locus_tag LOCUS_02290 2072 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2546 2968 gene locus_tag LOCUS_02300 2546 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_02300 3104 3283 gene locus_tag LOCUS_02310 3104 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4065 3280 gene locus_tag LOCUS_02320 4065 3280 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_02320 5201 4065 gene locus_tag LOCUS_02330 5201 4065 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_02330 <5810 5243 gene locus_tag LOCUS_02340 <5810 5243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108299.1:beta-N-acetylglucosaminidase >Feature sequence0038 312 1934 gene locus_tag LOCUS_02350 gene pafA 312 1934 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_02350 2943 1939 gene locus_tag LOCUS_02360 2943 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_02360 4470 3094 gene locus_tag LOCUS_02370 4470 3094 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_02370 4872 4480 gene locus_tag LOCUS_02380 4872 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 <5793 4917 gene locus_tag LOCUS_02390 <5793 4917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYP1:signal peptidase I >Feature sequence0039 2539 1535 gene locus_tag LOCUS_02400 2539 1535 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_02400 2660 4021 gene locus_tag LOCUS_02410 2660 4021 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_02410 4438 4022 gene locus_tag LOCUS_02420 4438 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence0040 841 1926 gene locus_tag LOCUS_02430 841 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2021 2491 gene locus_tag LOCUS_02440 2021 2491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_02440 2497 3000 gene locus_tag LOCUS_02450 gene pyrR2 2497 3000 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_02450 3026 3847 gene locus_tag LOCUS_02460 3026 3847 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_02460 3913 4731 gene locus_tag LOCUS_02470 gene panB 3913 4731 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_02470 >Feature sequence0041 1991 492 gene locus_tag LOCUS_02480 1991 492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_02480 5163 2002 gene locus_tag LOCUS_02490 5163 2002 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence0042 1245 907 gene locus_tag LOCUS_02500 gene ogt2 1245 907 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_02500 1396 2904 gene locus_tag LOCUS_02510 1396 2904 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_02510 3909 3121 gene locus_tag LOCUS_02520 3909 3121 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_02520 3993 4934 gene locus_tag LOCUS_02530 3993 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812474.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence0043 194 784 gene locus_tag LOCUS_02540 194 784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_02540 842 1906 gene locus_tag LOCUS_02550 gene paaE 842 1906 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_02550 1923 2861 gene locus_tag LOCUS_02560 gene paaA 1923 2861 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_02560 3029 3313 gene locus_tag LOCUS_02570 gene paaB 3029 3313 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_02570 3315 4070 gene locus_tag LOCUS_02580 gene paaC 3315 4070 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_02580 4064 4528 gene locus_tag LOCUS_02590 gene paaD 4064 4528 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence0044 688 3249 gene locus_tag LOCUS_02600 688 3249 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_02600 3230 3817 gene locus_tag LOCUS_02610 3230 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4089 3814 gene locus_tag LOCUS_02620 gene acyP 4089 3814 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB0 protein_id gnl|my_center|LOCUS_02620 4732 4073 gene locus_tag LOCUS_02630 gene deoC 4732 4073 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CD4 protein_id gnl|my_center|LOCUS_02630 <5389 4722 gene locus_tag LOCUS_02640 <5389 4722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:alanine dehydrogenase >Feature sequence0045 964 260 gene locus_tag LOCUS_02650 964 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2093 1146 gene locus_tag LOCUS_02660 2093 1146 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_02660 3660 2200 gene locus_tag LOCUS_02670 3660 2200 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255358.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence0046 <1 514 gene locus_tag LOCUS_02680 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963737.1:para-aminobenzoate synthase 795 2264 gene locus_tag LOCUS_02690 gene miaB 795 2264 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_02690 2276 3544 gene locus_tag LOCUS_02700 2276 3544 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_02700 3531 4064 gene locus_tag LOCUS_02710 3531 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4100 4990 gene locus_tag LOCUS_02720 4100 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0047 3065 2142 gene locus_tag LOCUS_02730 3065 2142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_02730 3402 3692 gene locus_tag LOCUS_02740 3402 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 3711 4673 gene locus_tag LOCUS_02750 3711 4673 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence0048 2569 935 gene locus_tag LOCUS_02760 2569 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3019 2591 gene locus_tag LOCUS_02770 3019 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 <5288 3055 gene locus_tag LOCUS_02780 <5288 3055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:permease >Feature sequence0049 485 1072 gene locus_tag LOCUS_02790 gene ctaE 485 1072 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_02790 1088 1855 gene locus_tag LOCUS_02800 1088 1855 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 protein_id gnl|my_center|LOCUS_02800 1869 2243 gene locus_tag LOCUS_02810 1869 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2314 2919 gene locus_tag LOCUS_02820 2314 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2897 3433 gene locus_tag LOCUS_02830 gene yozB 2897 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_02830 3469 3738 gene locus_tag LOCUS_02840 3469 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0050 139 534 gene locus_tag LOCUS_02850 139 534 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_02850 621 1193 gene locus_tag LOCUS_02860 621 1193 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_02860 1369 2490 gene locus_tag LOCUS_02870 1369 2490 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence0051 1627 224 gene locus_tag LOCUS_02880 1627 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_02880 2717 1731 gene locus_tag LOCUS_02890 gene dfrA 2717 1731 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_02890 3462 2722 gene locus_tag LOCUS_02900 3462 2722 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_02900 4004 3459 gene locus_tag LOCUS_02910 gene rmlC 4004 3459 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence0052 >Feature sequence0053 3164 3790 gene locus_tag LOCUS_02920 gene ctaE 3164 3790 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_02920 5092 3863 gene locus_tag LOCUS_02930 5092 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence0054 2109 1870 gene locus_tag LOCUS_02940 2109 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3022 2234 gene locus_tag LOCUS_02950 3022 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4335 3328 gene locus_tag LOCUS_02960 4335 3328 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0055 1368 298 gene locus_tag LOCUS_02970 1368 298 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_02970 2342 1371 gene locus_tag LOCUS_02980 gene kdsD 2342 1371 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_02980 2416 4614 gene locus_tag LOCUS_02990 2416 4614 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence0056 1 492 gene locus_tag LOCUS_03000 1 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 579 1820 gene locus_tag LOCUS_03010 579 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 1823 2734 gene locus_tag LOCUS_03020 1823 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2843 3100 gene locus_tag LOCUS_03030 2843 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3558 4160 gene locus_tag LOCUS_03040 3558 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 <5129 4260 gene locus_tag LOCUS_03050 <5129 4260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HCB3:phosphoenolpyruvate carboxykinase [ATP] >Feature sequence0057 569 1246 gene locus_tag LOCUS_03060 569 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5104 1562 gene locus_tag LOCUS_03070 5104 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence0058 856 1875 gene locus_tag LOCUS_03080 856 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2074 3153 gene locus_tag LOCUS_03090 2074 3153 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4R5 protein_id gnl|my_center|LOCUS_03090 4057 3317 gene locus_tag LOCUS_03100 4057 3317 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_03100 <5094 4054 gene locus_tag LOCUS_03110 <5094 4054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098179.1:membrane protein >Feature sequence0059 328 696 gene locus_tag LOCUS_03120 328 696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_03120 1527 2462 gene locus_tag LOCUS_03130 1527 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2462 4186 gene locus_tag LOCUS_03140 2462 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence0060 71 646 gene locus_tag LOCUS_03150 71 646 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_03150 672 1523 gene locus_tag LOCUS_03160 672 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1520 2323 gene locus_tag LOCUS_03170 1520 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2332 3375 gene locus_tag LOCUS_03180 2332 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3515 4132 gene locus_tag LOCUS_03190 3515 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 <5006 4192 gene locus_tag LOCUS_03200 <5006 4192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727427.1:nitrilase >Feature sequence0061 1278 367 gene locus_tag LOCUS_03210 1278 367 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_03210 1445 2533 gene locus_tag LOCUS_03220 1445 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3922 2588 gene locus_tag LOCUS_03230 3922 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 <4861 4048 gene locus_tag LOCUS_03240 <4861 4048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase >Feature sequence0062 <1 722 gene locus_tag LOCUS_03250 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404049.1:outer membrane protein 724 1317 gene locus_tag LOCUS_03260 724 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2410 1709 gene locus_tag LOCUS_03270 2410 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_03270 2448 2903 gene locus_tag LOCUS_03280 2448 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3911 2880 gene locus_tag LOCUS_03290 3911 2880 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0063 2684 102 gene locus_tag LOCUS_03300 2684 102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_03300 3093 2746 gene locus_tag LOCUS_03310 3093 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4233 3250 gene locus_tag LOCUS_03320 4233 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 >Feature sequence0064 1179 325 gene locus_tag LOCUS_03330 1179 325 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_03330 2003 1230 gene locus_tag LOCUS_03340 gene nagD 2003 1230 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_03340 2959 2009 gene locus_tag LOCUS_03350 2959 2009 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_03350 4005 3127 gene locus_tag LOCUS_03360 4005 3127 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0065 1230 2027 gene locus_tag LOCUS_03370 1230 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3249 2347 gene locus_tag LOCUS_03380 3249 2347 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_03380 4148 3252 gene locus_tag LOCUS_03390 4148 3252 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_03390 <4763 4129 gene locus_tag LOCUS_03400 <4763 4129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A165:peptidyl-prolyl cis-trans isomerase >Feature sequence0066 884 306 gene locus_tag LOCUS_03410 884 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1222 881 gene locus_tag LOCUS_03420 1222 881 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250874.1 protein_id gnl|my_center|LOCUS_03420 2214 1327 gene locus_tag LOCUS_03430 gene lipA 2214 1327 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_03430 3011 2283 gene locus_tag LOCUS_03440 3011 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3069 3473 gene locus_tag LOCUS_03450 3069 3473 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_03450 4125 3457 gene locus_tag LOCUS_03460 4125 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 <4741 4154 gene locus_tag LOCUS_03470 <4741 4154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963874.1:energy-dependent translational throttle protein EttA >Feature sequence0067 194 2152 gene locus_tag LOCUS_03480 gene gyrB 194 2152 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_03480 2785 2240 gene locus_tag LOCUS_03490 gene mobA 2785 2240 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186R9 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0068 313 474 gene locus_tag LOCUS_03500 313 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2904 475 gene locus_tag LOCUS_03510 gene mur/alr 2904 475 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_03510 3252 2914 gene locus_tag LOCUS_03520 gene csaA 3252 2914 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114937.1 protein_id gnl|my_center|LOCUS_03520 3400 3723 gene locus_tag LOCUS_03530 3400 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence0069 1185 121 gene locus_tag LOCUS_03540 1185 121 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_03540 1562 3133 gene locus_tag LOCUS_03550 1562 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3874 3179 gene locus_tag LOCUS_03560 3874 3179 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_03560 3900 4247 gene locus_tag LOCUS_03570 3900 4247 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_03570 4240 4605 gene locus_tag LOCUS_03580 4240 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence0070 2166 1678 gene locus_tag LOCUS_03590 gene aspG 2166 1678 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_03590 3615 2191 gene locus_tag LOCUS_03600 3615 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence0071 1348 458 gene locus_tag LOCUS_03610 1348 458 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_03610 3408 1417 gene locus_tag LOCUS_03620 gene hutU 3408 1417 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_03620 <4632 3420 gene locus_tag LOCUS_03630 <4632 3420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4M1:histidine ammonia-lyase >Feature sequence0072 2709 877 gene locus_tag LOCUS_03640 2709 877 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_03640 3225 2713 gene locus_tag LOCUS_03650 3225 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4067 3225 gene locus_tag LOCUS_03660 4067 3225 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_03660 <4614 4077 gene locus_tag LOCUS_03670 <4614 4077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964505.1:rod shape-determining protein >Feature sequence0073 <1 1028 gene locus_tag LOCUS_03680 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:coproporphyrinogen III oxidase 1154 1462 gene locus_tag LOCUS_03690 1154 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4363 1517 gene locus_tag LOCUS_03700 4363 1517 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence0074 3141 1912 gene locus_tag LOCUS_03710 3141 1912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_03710 3515 3138 gene locus_tag LOCUS_03720 gene rbfA 3515 3138 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHT9 protein_id gnl|my_center|LOCUS_03720 >Feature sequence0075 1664 150 gene locus_tag LOCUS_03730 1664 150 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_03730 2777 1776 gene locus_tag LOCUS_03740 2777 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2913 3818 gene locus_tag LOCUS_03750 2913 3818 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0076 3445 4191 gene locus_tag LOCUS_03760 3445 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4403 4197 gene locus_tag LOCUS_03770 4403 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence0077 1683 715 gene locus_tag LOCUS_03780 1683 715 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_03780 1831 2541 gene locus_tag LOCUS_03790 1831 2541 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_03790 2544 2771 gene locus_tag LOCUS_03800 2544 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3557 2820 gene locus_tag LOCUS_03810 3557 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0078 249 322 gene locus_tag LOCUS_t00010 249 322 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1230 433 gene locus_tag LOCUS_03820 1230 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1857 1270 gene locus_tag LOCUS_03830 gene scpB 1857 1270 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_03830 2243 1857 gene locus_tag LOCUS_03840 2243 1857 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence0079 129 1673 gene locus_tag LOCUS_03850 gene glyS 129 1673 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_03850 3735 1774 gene locus_tag LOCUS_03860 3735 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 <4541 4000 gene locus_tag LOCUS_03870 <4541 4000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974604.1:cell division protein Fic >Feature sequence0080 1028 75 gene locus_tag LOCUS_03880 1028 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_03880 1123 3288 gene locus_tag LOCUS_03890 1123 3288 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_03890 3300 3734 gene locus_tag LOCUS_03900 3300 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence0081 1003 413 gene locus_tag LOCUS_03910 1003 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2829 1900 gene locus_tag LOCUS_03920 2829 1900 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_03920 3743 2829 gene locus_tag LOCUS_03930 3743 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 <4525 3743 gene locus_tag LOCUS_03940 <4525 3743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249955.1:NDP-sugar dehydratase or epimerase >Feature sequence0082 1830 508 gene locus_tag LOCUS_03950 1830 508 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_03950 2974 1979 gene locus_tag LOCUS_03960 2974 1979 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_03960 4149 2977 gene locus_tag LOCUS_03970 4149 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0083 421 2757 gene locus_tag LOCUS_03980 gene pepN 421 2757 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_03980 3690 3082 gene locus_tag LOCUS_03990 3690 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence0084 1941 175 gene locus_tag LOCUS_04000 1941 175 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_04000 4212 2137 gene locus_tag LOCUS_04010 4212 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence0085 793 248 gene locus_tag LOCUS_04020 793 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 1017 1211 gene locus_tag LOCUS_04030 1017 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1212 2540 gene locus_tag LOCUS_04040 1212 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04040 2537 4144 gene locus_tag LOCUS_04050 2537 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0086 298 1305 gene locus_tag LOCUS_04060 298 1305 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_04060 1953 1306 gene locus_tag LOCUS_04070 gene yqfA 1953 1306 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 protein_id gnl|my_center|LOCUS_04070 2750 1950 gene locus_tag LOCUS_04080 2750 1950 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_04080 4375 2747 gene locus_tag LOCUS_04090 gene mscS1 4375 2747 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence0087 <1 565 gene locus_tag LOCUS_04100 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003724156.1:polyisoprenoid-binding protein 2298 637 gene locus_tag LOCUS_04110 2298 637 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_04110 3891 2470 gene locus_tag LOCUS_04120 gene xylE 3891 2470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence0088 4223 2688 gene locus_tag LOCUS_04130 4223 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence0089 2343 601 gene locus_tag LOCUS_04140 2343 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2840 2361 gene locus_tag LOCUS_04150 2840 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3052 3264 gene locus_tag LOCUS_04160 3052 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4162 3431 gene locus_tag LOCUS_04170 4162 3431 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence0090 479 1261 gene locus_tag LOCUS_04180 479 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1461 1258 gene locus_tag LOCUS_04190 1461 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2639 1554 gene locus_tag LOCUS_04200 2639 1554 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109390.1 protein_id gnl|my_center|LOCUS_04200 2628 3752 gene locus_tag LOCUS_04210 2628 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_04210 <4344 3734 gene locus_tag LOCUS_04220 <4344 3734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H070:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence0091 >Feature sequence0092 2384 2103 gene locus_tag LOCUS_04230 2384 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2955 2410 gene locus_tag LOCUS_04240 2955 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3446 3108 gene locus_tag LOCUS_04250 3446 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3905 3492 gene locus_tag LOCUS_04260 3905 3492 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0093 363 2774 gene locus_tag LOCUS_04270 363 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence0094 1171 1959 gene locus_tag LOCUS_04280 1171 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1974 2369 gene locus_tag LOCUS_04290 1974 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2400 2924 gene locus_tag LOCUS_04300 2400 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_04300 2917 3780 gene locus_tag LOCUS_04310 2917 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence0095 <1 1092 gene locus_tag LOCUS_04320 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWB6:aspartate--tRNA ligase 1191 3215 gene locus_tag LOCUS_04330 1191 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3236 3580 gene locus_tag LOCUS_04340 gene rsbV 3236 3580 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4J8 protein_id gnl|my_center|LOCUS_04340 3570 3983 gene locus_tag LOCUS_04350 3570 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence0096 1378 1103 gene locus_tag LOCUS_04360 gene rpsO 1378 1103 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_04360 3229 1451 gene locus_tag LOCUS_04370 3229 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3696 3301 gene locus_tag LOCUS_04380 3696 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3853 3927 gene locus_tag LOCUS_t00020 3853 3927 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0097 87 620 gene locus_tag LOCUS_04390 87 620 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_04390 965 669 gene locus_tag LOCUS_04400 965 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1124 2497 gene locus_tag LOCUS_04410 gene hisS 1124 2497 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_04410 >Feature sequence0098 2412 2768 gene locus_tag LOCUS_04420 2412 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence0099 <1 627 gene locus_tag LOCUS_04430 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:maltose phosphorylase 1522 920 gene locus_tag LOCUS_04440 1522 920 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723074.1 protein_id gnl|my_center|LOCUS_04440 2148 1846 gene locus_tag LOCUS_04450 gene ybzH 2148 1846 CDS product putative HTH-type transcriptional regulator YbzH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S9 protein_id gnl|my_center|LOCUS_04450 3130 2219 gene locus_tag LOCUS_04460 3130 2219 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_04460 3644 3132 gene locus_tag LOCUS_04470 3644 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 <4233 3671 gene locus_tag LOCUS_04480 <4233 3671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120056.1:oxidoreductase >Feature sequence0100 1204 419 gene locus_tag LOCUS_04490 gene truA 1204 419 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F1W2 protein_id gnl|my_center|LOCUS_04490 2068 1370 gene locus_tag LOCUS_04500 2068 1370 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_04500 2555 3385 gene locus_tag LOCUS_04510 gene proC 2555 3385 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 protein_id gnl|my_center|LOCUS_04510 3389 4168 gene locus_tag LOCUS_04520 3389 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence0101 1005 85 gene locus_tag LOCUS_04530 1005 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3151 2618 gene locus_tag LOCUS_04540 3151 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3769 3245 gene locus_tag LOCUS_04550 3769 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence0102 <1 958 gene locus_tag LOCUS_04560 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203179.1:thiol:disulfide interchange protein 968 3163 gene locus_tag LOCUS_04570 968 3163 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence0103 1748 453 gene locus_tag LOCUS_04580 1748 453 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_04580 2577 1768 gene locus_tag LOCUS_04590 2577 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 <4193 2637 gene locus_tag LOCUS_04600 <4193 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963306.1:peptidyl-prolyl cis-trans isomerase >Feature sequence0104 632 1693 gene locus_tag LOCUS_04610 gene ribD 632 1693 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_04610 2069 2551 gene locus_tag LOCUS_04620 2069 2551 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_04620 3335 2673 gene locus_tag LOCUS_04630 gene psd 3335 2673 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_04630 <4191 3340 gene locus_tag LOCUS_04640 <4191 3340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S582:glutamate dehydrogenase >Feature sequence0105 730 350 gene locus_tag LOCUS_04650 730 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1697 915 gene locus_tag LOCUS_04660 1697 915 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_04660 3748 1685 gene locus_tag LOCUS_04670 3748 1685 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence0106 359 847 gene locus_tag LOCUS_04680 359 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 861 1082 gene locus_tag LOCUS_04690 861 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1711 2766 gene locus_tag LOCUS_04700 1711 2766 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107390.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence0107 <1 654 gene locus_tag LOCUS_04710 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2F2:phosphoribosylamine--glycine ligase 682 2019 gene locus_tag LOCUS_04720 682 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2003 2470 gene locus_tag LOCUS_04730 2003 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 <4148 2534 gene locus_tag LOCUS_04740 <4148 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865167.1:ATPase AAA >Feature sequence0108 <1 585 gene locus_tag LOCUS_04750 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3A8:glycerol-3-phosphate dehydrogenase [NAD(P)+] 1819 572 gene locus_tag LOCUS_04760 1819 572 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_04760 2864 1830 gene locus_tag LOCUS_04770 2864 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence0109 377 1063 gene locus_tag LOCUS_04780 377 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1113 1913 gene locus_tag LOCUS_04790 1113 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2833 2045 gene locus_tag LOCUS_04800 2833 2045 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_04800 <4114 2847 gene locus_tag LOCUS_04810 <4114 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962913.1:Fe-S oxidoreductase >Feature sequence0110 <1 2766 gene locus_tag LOCUS_04820 <1 2766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NJ8:DNA-directed RNA polymerase subunit beta' 2770 3093 gene locus_tag LOCUS_04830 2770 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_04830 3429 3665 gene locus_tag LOCUS_04840 3429 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence0111 1 2172 gene locus_tag LOCUS_04850 1 2172 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_04850 2204 2419 gene locus_tag LOCUS_04860 2204 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2566 2934 gene locus_tag LOCUS_04870 2566 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0112 1916 1221 gene locus_tag LOCUS_04880 1916 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230948.1 protein_id gnl|my_center|LOCUS_04880 3120 1981 gene locus_tag LOCUS_04890 3120 1981 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_04890 3207 3926 gene locus_tag LOCUS_04900 3207 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence0113 >Feature sequence0114 1627 587 gene locus_tag LOCUS_04910 1627 587 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_04910 2594 1686 gene locus_tag LOCUS_04920 2594 1686 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_04920 3955 2921 gene locus_tag LOCUS_04930 gene cydB 3955 2921 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence0115 1287 184 gene locus_tag LOCUS_04940 gene bioB 1287 184 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_04940 1362 1850 gene locus_tag LOCUS_04950 gene folK 1362 1850 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_04950 2599 1847 gene locus_tag LOCUS_04960 2599 1847 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_04960 2768 2938 gene locus_tag LOCUS_04970 2768 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3766 2894 gene locus_tag LOCUS_04980 gene fabD 3766 2894 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_04980 >Feature sequence0116 871 2385 gene locus_tag LOCUS_04990 871 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3075 2548 gene locus_tag LOCUS_05000 3075 2548 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence0117 3114 715 gene locus_tag LOCUS_05010 3114 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0118 1520 2056 gene locus_tag LOCUS_05020 1520 2056 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_05020 2053 2493 gene locus_tag LOCUS_05030 2053 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2490 2864 gene locus_tag LOCUS_05040 gene crcB 2490 2864 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_05040 3913 2861 gene locus_tag LOCUS_05050 3913 2861 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence0119 641 1138 gene locus_tag LOCUS_05060 641 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_05060 1202 3241 gene locus_tag LOCUS_05070 1202 3241 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence0120 2907 367 gene locus_tag LOCUS_05080 2907 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3060 3593 gene locus_tag LOCUS_05090 3060 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence0121 1731 250 gene locus_tag LOCUS_05100 1731 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3573 1738 gene locus_tag LOCUS_05110 3573 1738 CDS product L-ascorbate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence0122 372 1148 gene locus_tag LOCUS_05120 372 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_05120 1153 2007 gene locus_tag LOCUS_05130 1153 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881733.1 protein_id gnl|my_center|LOCUS_05130 2068 3096 gene locus_tag LOCUS_05140 2068 3096 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004202.1 protein_id gnl|my_center|LOCUS_05140 3235 3642 gene locus_tag LOCUS_05150 gene mscL 3235 3642 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6A4 protein_id gnl|my_center|LOCUS_05150 >Feature sequence0123 1609 992 gene locus_tag LOCUS_05160 gene tdk 1609 992 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_05160 1910 1611 gene locus_tag LOCUS_05170 1910 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1968 2981 gene locus_tag LOCUS_05180 1968 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence0124 <1 645 gene locus_tag LOCUS_05190 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XW6:orotidine 5'-phosphate decarboxylase 671 1945 gene locus_tag LOCUS_05200 671 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_05200 1998 2630 gene locus_tag LOCUS_05210 1998 2630 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088734.1 protein_id gnl|my_center|LOCUS_05210 2744 3709 gene locus_tag LOCUS_05220 2744 3709 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109281.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence0125 36 1421 gene locus_tag LOCUS_05230 gene speA 36 1421 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_05230 1597 3210 gene locus_tag LOCUS_05240 1597 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence0126 2542 2177 gene locus_tag LOCUS_05250 2542 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2674 3552 gene locus_tag LOCUS_05260 2674 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence0127 685 191 gene locus_tag LOCUS_05270 685 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 <3891 704 gene locus_tag LOCUS_05280 <3891 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:biofilm-promoting protein BpfA >Feature sequence0128 934 209 gene locus_tag LOCUS_05290 gene algR 934 209 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_05290 1997 945 gene locus_tag LOCUS_05300 1997 945 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_05300 3396 2080 gene locus_tag LOCUS_05310 gene ndh 3396 2080 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence0129 <1 1985 gene locus_tag LOCUS_05320 <1 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A8:Lon protease 2016 3056 gene locus_tag LOCUS_05330 2016 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence0130 >Feature sequence0131 >Feature sequence0132 301 1635 gene locus_tag LOCUS_05340 301 1635 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_05340 1637 3298 gene locus_tag LOCUS_05350 1637 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence0133 803 1702 gene locus_tag LOCUS_05360 803 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1702 2490 gene locus_tag LOCUS_05370 1702 2490 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_05370 3157 2459 gene locus_tag LOCUS_05380 3157 2459 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173233.1 protein_id gnl|my_center|LOCUS_05380 3481 3281 gene locus_tag LOCUS_05390 3481 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence0134 2053 1751 gene locus_tag LOCUS_05400 gene nuoK 2053 1751 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_05400 2570 2043 gene locus_tag LOCUS_05410 gene ndhG 2570 2043 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_05410 <3811 2571 gene locus_tag LOCUS_05420 <3811 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932453.1:4Fe-4S ferredoxin >Feature sequence0135 721 299 gene locus_tag LOCUS_05430 721 299 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_05430 1152 724 gene locus_tag LOCUS_05440 1152 724 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139954.1 protein_id gnl|my_center|LOCUS_05440 1772 1251 gene locus_tag LOCUS_05450 1772 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 <3808 2066 gene locus_tag LOCUS_05460 <3808 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A329:leucine--tRNA ligase >Feature sequence0136 1366 221 gene locus_tag LOCUS_05470 1366 221 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_05470 2632 1400 gene locus_tag LOCUS_05480 gene yegT 2632 1400 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 protein_id gnl|my_center|LOCUS_05480 3455 2667 gene locus_tag LOCUS_05490 3455 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0137 319 978 gene locus_tag LOCUS_05500 319 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1014 2075 gene locus_tag LOCUS_05510 1014 2075 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_05510 2086 2514 gene locus_tag LOCUS_05520 2086 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2492 3142 gene locus_tag LOCUS_05530 gene wbbJ 2492 3142 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181527.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0138 355 861 gene locus_tag LOCUS_05540 355 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1194 958 gene locus_tag LOCUS_05550 1194 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2295 1465 gene locus_tag LOCUS_05560 gene fecB 2295 1465 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_05560 3362 2295 gene locus_tag LOCUS_05570 3362 2295 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence0139 709 122 gene locus_tag LOCUS_05580 709 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 <3767 779 gene locus_tag LOCUS_05590 <3767 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZR9:CRISPR-associated endonuclease Cas9 >Feature sequence0140 69 1199 gene locus_tag LOCUS_05600 gene porR 69 1199 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_05600 1336 1860 gene locus_tag LOCUS_05610 1336 1860 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_05610 1853 2359 gene locus_tag LOCUS_05620 1853 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence0141 1597 758 gene locus_tag LOCUS_05630 1597 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1864 3168 gene locus_tag LOCUS_05640 1864 3168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence0142 1547 2299 gene locus_tag LOCUS_05650 1547 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2290 2769 gene locus_tag LOCUS_05660 2290 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_05660 3436 2699 gene locus_tag LOCUS_05670 3436 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3747 3559 gene locus_tag LOCUS_05680 3747 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence0143 185 1555 gene locus_tag LOCUS_05690 185 1555 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_05690 1545 2873 gene locus_tag LOCUS_05700 1545 2873 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107804.1 protein_id gnl|my_center|LOCUS_05700 2930 3439 gene locus_tag LOCUS_05710 gene lspA 2930 3439 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H98 protein_id gnl|my_center|LOCUS_05710 3730 3569 gene locus_tag LOCUS_05720 3730 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence0144 <1 573 gene locus_tag LOCUS_05730 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase 694 2007 gene locus_tag LOCUS_05740 694 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2009 2287 gene locus_tag LOCUS_05750 2009 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence0145 >Feature sequence0146 1112 717 gene locus_tag LOCUS_05760 1112 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1351 2667 gene locus_tag LOCUS_05770 1351 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 <3696 2729 gene locus_tag LOCUS_05780 <3696 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H092:valine--tRNA ligase >Feature sequence0147 760 185 gene locus_tag LOCUS_05790 760 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 831 1523 gene locus_tag LOCUS_05800 831 1523 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_05800 1510 2823 gene locus_tag LOCUS_05810 1510 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence0148 <1 605 gene locus_tag LOCUS_05820 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY00:peptide chain release factor 2 690 1799 gene locus_tag LOCUS_05830 gene glpT 690 1799 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_05830 1799 2470 gene locus_tag LOCUS_05840 1799 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_05840 3451 2750 gene locus_tag LOCUS_05850 3451 2750 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404628.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence0149 <1 1524 gene locus_tag LOCUS_05860 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66936:1,4-alpha-glucan branching enzyme GlgB >Feature sequence0150 860 2101 gene locus_tag LOCUS_05870 860 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_05870 <3676 2239 gene locus_tag LOCUS_05880 <3676 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798729.1:cation transporter >Feature sequence0151 1272 1673 gene locus_tag LOCUS_05890 1272 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1673 2113 gene locus_tag LOCUS_05900 gene ybeY 1673 2113 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_05900 >Feature sequence0152 1861 3036 gene locus_tag LOCUS_05910 1861 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3023 3556 gene locus_tag LOCUS_05920 3023 3556 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_05920 >Feature sequence0153 2036 729 gene locus_tag LOCUS_05930 2036 729 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 protein_id gnl|my_center|LOCUS_05930 2215 2802 gene locus_tag LOCUS_05940 2215 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence0154 2339 231 gene locus_tag LOCUS_05950 gene feoB 2339 231 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_05950 2566 2345 gene locus_tag LOCUS_05960 2566 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 <3663 2636 gene locus_tag LOCUS_05970 <3663 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963606.1:type I deoxyribonuclease HsdR >Feature sequence0155 1216 380 gene locus_tag LOCUS_05980 1216 380 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769324.1 protein_id gnl|my_center|LOCUS_05980 1292 2368 gene locus_tag LOCUS_05990 1292 2368 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_05990 3034 2369 gene locus_tag LOCUS_06000 gene cutC 3034 2369 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6Q4 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0156 1751 702 gene locus_tag LOCUS_06010 1751 702 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence0157 402 1403 gene locus_tag LOCUS_06020 402 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2044 1373 gene locus_tag LOCUS_06030 2044 1373 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_06030 2846 2352 gene locus_tag LOCUS_06040 gene cdd 2846 2352 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence0158 2316 1945 gene locus_tag LOCUS_06050 2316 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2831 2328 gene locus_tag LOCUS_06060 2831 2328 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_06060 3130 2837 gene locus_tag LOCUS_06070 3130 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence0159 874 3180 gene locus_tag LOCUS_06080 874 3180 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence0160 1048 3132 gene locus_tag LOCUS_06090 1048 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence0161 2185 3486 gene locus_tag LOCUS_06100 gene phrB1 2185 3486 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence0162 <3623 535 gene locus_tag LOCUS_06110 <3623 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650K6:tricorn protease >Feature sequence0163 <1 2280 gene locus_tag LOCUS_06120 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073389.1:peptidase M16 >Feature sequence0164 885 3155 gene locus_tag LOCUS_06130 885 3155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence0165 248 802 gene locus_tag LOCUS_06140 248 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1769 804 gene locus_tag LOCUS_06150 1769 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2060 2284 gene locus_tag LOCUS_06160 2060 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2288 2587 gene locus_tag LOCUS_06170 2288 2587 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_06170 2904 3296 gene locus_tag LOCUS_06180 2904 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0166 1027 227 gene locus_tag LOCUS_06190 1027 227 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_06190 1677 1027 gene locus_tag LOCUS_06200 1677 1027 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_06200 2297 1656 gene locus_tag LOCUS_06210 gene thiE 2297 1656 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LQ9 protein_id gnl|my_center|LOCUS_06210 3055 2294 gene locus_tag LOCUS_06220 gene thiM 3055 2294 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I7 protein_id gnl|my_center|LOCUS_06220 >Feature sequence0167 962 1198 gene locus_tag LOCUS_06230 962 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1710 1240 gene locus_tag LOCUS_06240 1710 1240 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_06240 1861 1694 gene locus_tag LOCUS_06250 1861 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2620 1886 gene locus_tag LOCUS_06260 2620 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3528 2623 gene locus_tag LOCUS_06270 gene ardC 3528 2623 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0168 1193 48 gene locus_tag LOCUS_06280 gene nusB 1193 48 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_06280 2465 1290 gene locus_tag LOCUS_06290 gene vdh 2465 1290 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence0169 >Feature sequence0170 1581 901 gene locus_tag LOCUS_06300 1581 901 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence0171 2347 296 gene locus_tag LOCUS_06310 2347 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2637 2356 gene locus_tag LOCUS_06320 2637 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 <3587 3034 gene locus_tag LOCUS_06330 <3587 3034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140317.1:ferrichrome-iron receptor >Feature sequence0172 116 802 gene locus_tag LOCUS_06340 116 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 958 2445 gene locus_tag LOCUS_06350 958 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence0173 1271 1071 gene locus_tag LOCUS_06360 1271 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2259 1297 gene locus_tag LOCUS_06370 2259 1297 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_06370 2358 3536 gene locus_tag LOCUS_06380 gene iscS 2358 3536 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224029.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0174 3 75 gene locus_tag LOCUS_t00030 3 75 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 253 1383 gene locus_tag LOCUS_06390 253 1383 CDS product beta-carotene 15,15'-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_06390 2193 1384 gene locus_tag LOCUS_06400 2193 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2622 2251 gene locus_tag LOCUS_06410 2622 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 <3562 2759 gene locus_tag LOCUS_06420 <3562 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000442797.1:oxidoreductase >Feature sequence0175 1467 586 gene locus_tag LOCUS_06430 1467 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2671 1472 gene locus_tag LOCUS_06440 2671 1472 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_06440 3039 2671 gene locus_tag LOCUS_06450 3039 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3464 3039 gene locus_tag LOCUS_06460 3464 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence0176 614 474 gene locus_tag LOCUS_06470 614 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1701 712 gene locus_tag LOCUS_06480 1701 712 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_06480 1823 2536 gene locus_tag LOCUS_06490 1823 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 <3555 2549 gene locus_tag LOCUS_06500 <3555 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase >Feature sequence0177 1052 201 gene locus_tag LOCUS_06510 1052 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_06510 1233 1838 gene locus_tag LOCUS_06520 gene miaE 1233 1838 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_06520 2573 1950 gene locus_tag LOCUS_06530 gene ydeI 2573 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0178 <1 1707 gene locus_tag LOCUS_06540 <1 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:cation transporter 1727 2188 gene locus_tag LOCUS_06550 1727 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2254 2817 gene locus_tag LOCUS_06560 2254 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence0179 1415 843 gene locus_tag LOCUS_06570 gene ygfA 1415 843 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_06570 2991 1408 gene locus_tag LOCUS_06580 gene bshC 2991 1408 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence0180 >Feature sequence0181 <1 759 gene locus_tag LOCUS_06590 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2U5:cell division protein FtsX 761 973 gene locus_tag LOCUS_06600 761 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 974 1765 gene locus_tag LOCUS_06610 gene uppP 974 1765 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_06610 1765 2466 gene locus_tag LOCUS_06620 gene truB 1765 2466 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_06620 2463 3395 gene locus_tag LOCUS_06630 gene ribF 2463 3395 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_06630 >Feature sequence0182 2058 388 gene locus_tag LOCUS_06640 2058 388 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_06640 2200 2952 gene locus_tag LOCUS_06650 gene dnrN 2200 2952 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_06650 2952 3368 gene locus_tag LOCUS_06660 2952 3368 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0183 487 1248 gene locus_tag LOCUS_06670 487 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_06670 1943 1245 gene locus_tag LOCUS_06680 gene yoqW 1943 1245 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_06680 >Feature sequence0184 141 1160 gene locus_tag LOCUS_06690 141 1160 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_06690 1259 2575 gene locus_tag LOCUS_06700 1259 2575 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0185 1662 1111 gene locus_tag LOCUS_06710 1662 1111 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_06710 2418 1666 gene locus_tag LOCUS_06720 2418 1666 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence0186 3108 1927 gene locus_tag LOCUS_06730 3108 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence0187 262 1314 gene locus_tag LOCUS_06740 gene czcB 262 1314 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence0188 <1 1146 gene locus_tag LOCUS_06750 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0189 1150 1563 gene locus_tag LOCUS_06760 1150 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3438 1615 gene locus_tag LOCUS_06770 3438 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence0190 <1 1597 gene locus_tag LOCUS_06780 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease >Feature sequence0191 <1 1734 gene locus_tag LOCUS_06790 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:membrane protein 1822 3264 gene locus_tag LOCUS_06800 1822 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence0192 <3414 424 gene locus_tag LOCUS_06810 <3414 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:membrane protein >Feature sequence0193 1139 483 gene locus_tag LOCUS_06820 1139 483 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_06820 <3414 1226 gene locus_tag LOCUS_06830 <3414 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence0194 <1 639 gene locus_tag LOCUS_06840 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 1673 684 gene locus_tag LOCUS_06850 1673 684 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_06850 2599 2261 gene locus_tag LOCUS_06860 2599 2261 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022200.1 protein_id gnl|my_center|LOCUS_06860 <3404 2612 gene locus_tag LOCUS_06870 <3404 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405434.1:aminopeptidase >Feature sequence0195 <1 522 gene locus_tag LOCUS_06880 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0P8:S-adenosylmethionine:tRNA ribosyltransferase-isomerase 549 1718 gene locus_tag LOCUS_06890 549 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1800 3140 gene locus_tag LOCUS_06900 1800 3140 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence0196 33 106 gene locus_tag LOCUS_t00040 33 106 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 384 887 gene locus_tag LOCUS_06910 384 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1434 2240 gene locus_tag LOCUS_06920 gene murI 1434 2240 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_06920 >Feature sequence0197 >Feature sequence0198 337 1374 gene locus_tag LOCUS_06930 337 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1790 1371 gene locus_tag LOCUS_06940 1790 1371 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_06940 2260 1841 gene locus_tag LOCUS_06950 2260 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2994 2386 gene locus_tag LOCUS_06960 2994 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence0199 173 1450 gene locus_tag LOCUS_06970 173 1450 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_06970 1431 2198 gene locus_tag LOCUS_06980 1431 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2297 3358 gene locus_tag LOCUS_06990 gene mnmA 2297 3358 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0200 509 1195 gene locus_tag LOCUS_07000 509 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1197 1895 gene locus_tag LOCUS_07010 1197 1895 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622398.1 protein_id gnl|my_center|LOCUS_07010 1892 2239 gene locus_tag LOCUS_07020 1892 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2236 3036 gene locus_tag LOCUS_07030 gene fdhD 2236 3036 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_07030 >Feature sequence0201 193 1239 gene locus_tag LOCUS_07040 193 1239 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_07040 1582 2235 gene locus_tag LOCUS_07050 1582 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0202 1108 1761 gene locus_tag LOCUS_07060 1108 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 <3376 2018 gene locus_tag LOCUS_07070 <3376 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762276.1:ribonuclease G >Feature sequence0203 585 43 gene locus_tag LOCUS_07080 585 43 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_07080 1550 582 gene locus_tag LOCUS_07090 1550 582 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_07090 <3369 1623 gene locus_tag LOCUS_07100 <3369 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H115:DNA topoisomerase 1 >Feature sequence0204 2657 1410 gene locus_tag LOCUS_07110 2657 1410 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_07110 3205 2693 gene locus_tag LOCUS_07120 3205 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0205 1145 261 gene locus_tag LOCUS_07130 1145 261 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_07130 1829 1182 gene locus_tag LOCUS_07140 1829 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_07140 3035 2001 gene locus_tag LOCUS_07150 3035 2001 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z17 protein_id gnl|my_center|LOCUS_07150 >Feature sequence0206 1284 415 gene locus_tag LOCUS_07160 1284 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878718.1 protein_id gnl|my_center|LOCUS_07160 1859 1383 gene locus_tag LOCUS_07170 1859 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2824 1967 gene locus_tag LOCUS_07180 2824 1967 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_07180 3265 2849 gene locus_tag LOCUS_07190 3265 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence0207 1406 507 gene locus_tag LOCUS_07200 1406 507 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_07200 2378 1464 gene locus_tag LOCUS_07210 2378 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_07210 2710 2378 gene locus_tag LOCUS_07220 2710 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2793 3314 gene locus_tag LOCUS_07230 2793 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence0208 633 3281 gene locus_tag LOCUS_07240 633 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence0209 810 1169 gene locus_tag LOCUS_07250 810 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2351 1170 gene locus_tag LOCUS_07260 gene hisC 2351 1170 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_07260 <3299 2694 gene locus_tag LOCUS_07270 <3299 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CHJ7:Na(+)-translocating NADH-quinone reductase subunit E >Feature sequence0210 <1 1038 gene locus_tag LOCUS_07280 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964462.1:saccharopine dehydrogenase <3295 1043 gene locus_tag LOCUS_07290 <3295 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A >Feature sequence0211 1174 470 gene locus_tag LOCUS_07300 1174 470 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_07300 1854 1174 gene locus_tag LOCUS_07310 1854 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2032 2163 gene locus_tag LOCUS_07320 2032 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2440 3099 gene locus_tag LOCUS_07330 2440 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence0212 362 625 gene locus_tag LOCUS_07340 362 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1213 599 gene locus_tag LOCUS_07350 gene coaE 1213 599 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_07350 2174 1206 gene locus_tag LOCUS_07360 2174 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2497 2177 gene locus_tag LOCUS_07370 2497 2177 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_07370 3034 2504 gene locus_tag LOCUS_07380 3034 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3282 3046 gene locus_tag LOCUS_07390 3282 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0213 <1 1256 gene locus_tag LOCUS_07400 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291837.1:isocitrate dehydrogenase 1740 1384 gene locus_tag LOCUS_07410 1740 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2868 1912 gene locus_tag LOCUS_07420 gene ltd 2868 1912 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_07420 2970 3224 gene locus_tag LOCUS_07430 2970 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0214 <1 600 gene locus_tag LOCUS_07440 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A681:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 697 1431 gene locus_tag LOCUS_07450 697 1431 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_07450 1475 2179 gene locus_tag LOCUS_07460 1475 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3088 2366 gene locus_tag LOCUS_07470 gene cysH 3088 2366 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence0215 1957 1262 gene locus_tag LOCUS_07480 1957 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2383 2006 gene locus_tag LOCUS_07490 2383 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0216 <1 1018 gene locus_tag LOCUS_07500 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJK7:DNA polymerase IV 2 1077 1544 gene locus_tag LOCUS_07510 1077 1544 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_07510 2175 1762 gene locus_tag LOCUS_07520 2175 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053574.1 protein_id gnl|my_center|LOCUS_07520 2255 2689 gene locus_tag LOCUS_07530 gene ppi 2255 2689 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_07530 >Feature sequence0217 268 1338 gene locus_tag LOCUS_07540 gene ddlA 268 1338 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1F1 protein_id gnl|my_center|LOCUS_07540 1335 1883 gene locus_tag LOCUS_07550 1335 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1961 2332 gene locus_tag LOCUS_07560 1961 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0218 558 145 gene locus_tag LOCUS_07570 558 145 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_07570 2452 563 gene locus_tag LOCUS_07580 2452 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence0219 <1 564 gene locus_tag LOCUS_07590 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A8T6:recombination protein RecR 570 1766 gene locus_tag LOCUS_07600 570 1766 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_07600 1767 2762 gene locus_tag LOCUS_07610 1767 2762 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_07610 2762 3085 gene locus_tag LOCUS_07620 2762 3085 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence0220 1307 1723 gene locus_tag LOCUS_07630 1307 1723 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_07630 2459 1761 gene locus_tag LOCUS_07640 2459 1761 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence0221 <1 1137 gene locus_tag LOCUS_07650 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:ABC transporter substrate-binding protein 1137 1829 gene locus_tag LOCUS_07660 gene recO 1137 1829 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_07660 1873 2847 gene locus_tag LOCUS_07670 1873 2847 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence0222 88 2640 gene locus_tag LOCUS_07680 88 2640 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence0223 261 1094 gene locus_tag LOCUS_07690 261 1094 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_07690 2008 1091 gene locus_tag LOCUS_07700 2008 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence0224 2136 451 gene locus_tag LOCUS_07710 2136 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 <3199 2412 gene locus_tag LOCUS_07720 <3199 2412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A2D4:acetylornithine deacetylase >Feature sequence0225 2106 1276 gene locus_tag LOCUS_07730 gene prmA 2106 1276 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_07730 2867 2106 gene locus_tag LOCUS_07740 gene tpiA 2867 2106 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_07740 >Feature sequence0226 1128 1055 gene locus_tag LOCUS_t00050 1128 1055 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1220 2107 gene locus_tag LOCUS_07750 gene era 1220 2107 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_07750 2091 2492 gene locus_tag LOCUS_07760 2091 2492 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence0227 <3197 1070 gene locus_tag LOCUS_07770 <3197 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0228 <1 614 gene locus_tag LOCUS_07780 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887835.1:phosphatase 2208 916 gene locus_tag LOCUS_07790 2208 916 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_07790 <3196 2251 gene locus_tag LOCUS_07800 <3196 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW7:homoserine kinase >Feature sequence0229 280 2931 gene locus_tag LOCUS_07810 280 2931 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0230 2626 653 gene locus_tag LOCUS_07820 2626 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence0231 146 727 gene locus_tag LOCUS_07830 146 727 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_07830 754 1380 gene locus_tag LOCUS_07840 gene udk 754 1380 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_07840 1416 1778 gene locus_tag LOCUS_07850 1416 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0232 1026 202 gene locus_tag LOCUS_07860 1026 202 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_07860 1124 1732 gene locus_tag LOCUS_07870 1124 1732 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0233 <1 2170 gene locus_tag LOCUS_07880 <1 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109046.1:acriflavine resistance protein B >Feature sequence0234 >Feature sequence0235 804 13 gene locus_tag LOCUS_07890 804 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 protein_id gnl|my_center|LOCUS_07890 2259 904 gene locus_tag LOCUS_07900 gene ykoK 2259 904 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM21 protein_id gnl|my_center|LOCUS_07900 <3135 2340 gene locus_tag LOCUS_07910 <3135 2340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962397.1:succinylglutamate desuccinylase >Feature sequence0236 1212 97 gene locus_tag LOCUS_07920 1212 97 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence0237 <1 1008 gene locus_tag LOCUS_07930 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase 1018 1629 gene locus_tag LOCUS_07940 gene bioD 1018 1629 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_07940 1622 2896 gene locus_tag LOCUS_07950 gene bioA 1622 2896 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence0238 372 1055 gene locus_tag LOCUS_07960 gene czcR 372 1055 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_07960 1057 2406 gene locus_tag LOCUS_07970 1057 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 <3126 2381 gene locus_tag LOCUS_07980 <3126 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405392.1:NAD-dependent epimerase >Feature sequence0239 2386 518 gene locus_tag LOCUS_07990 2386 518 CDS product tryptophan 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267081.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0240 186 1217 gene locus_tag LOCUS_08000 gene pdhA 186 1217 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_08000 1277 1960 gene locus_tag LOCUS_08010 1277 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403954.1 protein_id gnl|my_center|LOCUS_08010 2027 2503 gene locus_tag LOCUS_08020 gene ribH 2027 2503 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_08020 >Feature sequence0241 123 683 gene locus_tag LOCUS_08030 123 683 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_08030 774 1322 gene locus_tag LOCUS_08040 774 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1379 1825 gene locus_tag LOCUS_08050 1379 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1876 2286 gene locus_tag LOCUS_08060 1876 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_08060 2297 2923 gene locus_tag LOCUS_08070 2297 2923 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0242 272 1054 gene locus_tag LOCUS_08080 272 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0243 1922 9 gene locus_tag LOCUS_08090 1922 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2401 1919 gene locus_tag LOCUS_08100 2401 1919 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0244 1353 502 gene locus_tag LOCUS_08110 1353 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1473 2402 gene locus_tag LOCUS_08120 1473 2402 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0245 1588 314 gene locus_tag LOCUS_08130 gene glyA 1588 314 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_08130 2167 1664 gene locus_tag LOCUS_08140 2167 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2385 2924 gene locus_tag LOCUS_08150 2385 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence0246 <1 1371 gene locus_tag LOCUS_08160 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875999.1:sensor histidine kinase 1462 1845 gene locus_tag LOCUS_08170 1462 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1906 2295 gene locus_tag LOCUS_08180 1906 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2569 3024 gene locus_tag LOCUS_08190 2569 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence0247 635 333 gene locus_tag LOCUS_08200 635 333 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_08200 920 1837 gene locus_tag LOCUS_08210 gene mutY 920 1837 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_08210 1876 2301 gene locus_tag LOCUS_08220 gene ssb-1 1876 2301 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B90 protein_id gnl|my_center|LOCUS_08220 >Feature sequence0248 2204 1203 gene locus_tag LOCUS_08230 gene nrdB 2204 1203 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_08230 2675 2986 gene locus_tag LOCUS_08240 2675 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0249 <1 801 gene locus_tag LOCUS_08250 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001967602.1:ADP-heptosyltransferase 1437 787 gene locus_tag LOCUS_08260 1437 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1901 1449 gene locus_tag LOCUS_08270 1901 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence0250 <1 535 gene locus_tag LOCUS_08280 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 760 2313 gene locus_tag LOCUS_08290 760 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2356 2787 gene locus_tag LOCUS_08300 2356 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence0251 1270 59 gene locus_tag LOCUS_08310 gene putA 1270 59 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_08310 1350 2450 gene locus_tag LOCUS_08320 1350 2450 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_08320 2443 2982 gene locus_tag LOCUS_08330 2443 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence0252 1295 726 gene locus_tag LOCUS_08340 1295 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1837 1328 gene locus_tag LOCUS_08350 1837 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence0253 2389 2727 gene locus_tag LOCUS_08360 2389 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence0254 68 1312 gene locus_tag LOCUS_08370 gene actA 68 1312 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0255 1531 1604 gene locus_tag LOCUS_t00060 1531 1604 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1822 2157 gene locus_tag LOCUS_08380 1822 2157 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence0256 1880 1425 gene locus_tag LOCUS_08390 1880 1425 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_08390 2140 2718 gene locus_tag LOCUS_08400 2140 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence0257 >Feature sequence0258 125 1147 gene locus_tag LOCUS_08410 125 1147 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_08410 1113 1592 gene locus_tag LOCUS_08420 1113 1592 CDS product cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_08420 1594 2280 gene locus_tag LOCUS_08430 1594 2280 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence0259 2284 1187 gene locus_tag LOCUS_08440 2284 1187 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0260 >Feature sequence0261 1356 769 gene locus_tag LOCUS_08450 1356 769 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_08450 <2977 1614 gene locus_tag LOCUS_08460 <2977 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000581323.1:histidine kinase >Feature sequence0262 444 1520 gene locus_tag LOCUS_08470 gene aroC 444 1520 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_08470 1539 2936 gene locus_tag LOCUS_08480 gene gltP 1539 2936 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence0263 1743 1069 gene locus_tag LOCUS_08490 1743 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389679.1 protein_id gnl|my_center|LOCUS_08490 1870 2214 gene locus_tag LOCUS_08500 1870 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0264 1803 2636 gene locus_tag LOCUS_08510 1803 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence0265 313 1164 gene locus_tag LOCUS_08520 313 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_08520 1168 1311 gene locus_tag LOCUS_08530 1168 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1314 1475 gene locus_tag LOCUS_08540 1314 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1687 2067 gene locus_tag LOCUS_08550 1687 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2808 2059 gene locus_tag LOCUS_08560 2808 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0266 70 468 gene locus_tag LOCUS_08570 70 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08570 536 1201 gene locus_tag LOCUS_08580 536 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1198 2046 gene locus_tag LOCUS_08590 1198 2046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_08590 2048 2839 gene locus_tag LOCUS_08600 2048 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence0267 186 605 gene locus_tag LOCUS_08610 186 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 852 1325 gene locus_tag LOCUS_08620 852 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1493 2077 gene locus_tag LOCUS_08630 1493 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2284 2775 gene locus_tag LOCUS_08640 2284 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence0268 887 1309 gene locus_tag LOCUS_08650 887 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence0269 1380 211 gene locus_tag LOCUS_08660 gene dinB 1380 211 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_08660 1510 2085 gene locus_tag LOCUS_08670 1510 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0270 <1 1965 gene locus_tag LOCUS_08680 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963302.1:aconitate hydratase 2053 2394 gene locus_tag LOCUS_08690 gene mmcA 2053 2394 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence0271 <1 673 gene locus_tag LOCUS_08700 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962253.1:serine--tRNA ligase 779 1171 gene locus_tag LOCUS_08710 779 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence0272 953 618 gene locus_tag LOCUS_08720 953 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1140 2045 gene locus_tag LOCUS_08730 1140 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_08730 2070 2783 gene locus_tag LOCUS_08740 2070 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence0273 <1 1963 gene locus_tag LOCUS_08750 <1 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence0274 586 1461 gene locus_tag LOCUS_08760 586 1461 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_08760 2223 1474 gene locus_tag LOCUS_08770 2223 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2665 2213 gene locus_tag LOCUS_08780 2665 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0275 819 1373 gene locus_tag LOCUS_08790 819 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 protein_id gnl|my_center|LOCUS_08790 2193 1351 gene locus_tag LOCUS_08800 2193 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2612 2193 gene locus_tag LOCUS_08810 2612 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence0276 <1 1788 gene locus_tag LOCUS_08820 <1 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962188.1:helicase 1944 2310 gene locus_tag LOCUS_tm00010 1944 2310 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0277 338 1390 gene locus_tag LOCUS_08830 gene pyrD 338 1390 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0278 2103 607 gene locus_tag LOCUS_08840 2103 607 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence0279 >Feature sequence0280 58 1437 gene locus_tag LOCUS_08850 58 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2032 1409 gene locus_tag LOCUS_08860 2032 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2092 2511 gene locus_tag LOCUS_08870 2092 2511 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0281 <1 2615 gene locus_tag LOCUS_08880 <1 2615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964496.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence0282 <1 1391 gene locus_tag LOCUS_08890 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964324.1:penicillin-binding protein 1C <2914 2063 gene locus_tag LOCUS_08900 <2914 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EE02:peptide methionine sulfoxide reductase MsrA >Feature sequence0283 123 1205 gene locus_tag LOCUS_08910 123 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1331 2587 gene locus_tag LOCUS_08920 1331 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0284 951 2036 gene locus_tag LOCUS_08930 951 2036 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_08930 <2901 2033 gene locus_tag LOCUS_08940 <2901 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:membrane protein >Feature sequence0285 88 2502 gene locus_tag LOCUS_08950 gene pheT 88 2502 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_08950 2502 2795 gene locus_tag LOCUS_08960 2502 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0286 83 1027 gene locus_tag LOCUS_08970 83 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1626 1024 gene locus_tag LOCUS_08980 1626 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1993 2232 gene locus_tag LOCUS_08990 1993 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2351 2641 gene locus_tag LOCUS_09000 2351 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence0287 1371 85 gene locus_tag LOCUS_09010 gene hisD 1371 85 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_09010 2228 1368 gene locus_tag LOCUS_09020 gene hisG 2228 1368 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_09020 >Feature sequence0288 156 1007 gene locus_tag LOCUS_09030 156 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence0289 960 181 gene locus_tag LOCUS_09040 960 181 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096756.1 protein_id gnl|my_center|LOCUS_09040 1609 965 gene locus_tag LOCUS_09050 1609 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 <2874 1584 gene locus_tag LOCUS_09060 <2874 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203672.1:RNA polymerase sigma-54 factor >Feature sequence0290 687 2027 gene locus_tag LOCUS_09070 687 2027 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_09070 2104 2376 gene locus_tag LOCUS_09080 2104 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence0291 1967 600 gene locus_tag LOCUS_09090 1967 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2402 2055 gene locus_tag LOCUS_09100 2402 2055 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0292 <1 2016 gene locus_tag LOCUS_09110 <1 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:organic solvent tolerance protein OstA <2830 2075 gene locus_tag LOCUS_09120 <2830 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW2:lysine--tRNA ligase >Feature sequence0293 1684 797 gene locus_tag LOCUS_09130 1684 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2025 1819 gene locus_tag LOCUS_09140 2025 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 <2828 2148 gene locus_tag LOCUS_09150 <2828 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962898.1:ornithine--oxo-acid transaminase >Feature sequence0294 >Feature sequence0295 2035 1277 gene locus_tag LOCUS_09160 2035 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2508 2158 gene locus_tag LOCUS_09170 gene ydeP 2508 2158 CDS product putative HTH-type transcriptional regulator YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96673 protein_id gnl|my_center|LOCUS_09170 >Feature sequence0296 <1 1170 gene locus_tag LOCUS_09180 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252880.1:two-component sensor histidine kinase >Feature sequence0297 >Feature sequence0298 1440 1054 gene locus_tag LOCUS_09190 1440 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1684 2580 gene locus_tag LOCUS_09200 1684 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence0299 561 28 gene locus_tag LOCUS_09210 gene rplJ 561 28 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_09210 1262 564 gene locus_tag LOCUS_09220 gene rplA 1262 564 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_09220 1717 1274 gene locus_tag LOCUS_09230 gene rplK 1717 1274 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_09230 2276 1719 gene locus_tag LOCUS_09240 gene nusG 2276 1719 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_09240 2476 2288 gene locus_tag LOCUS_09250 gene secE 2476 2288 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ1 protein_id gnl|my_center|LOCUS_09250 2571 2498 gene locus_tag LOCUS_t00070 2571 2498 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0300 <1 882 gene locus_tag LOCUS_09260 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962832.1:NAD-dependent epimerase 986 1690 gene locus_tag LOCUS_09270 986 1690 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_09270 1690 2343 gene locus_tag LOCUS_09280 1690 2343 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532759.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0301 115 984 gene locus_tag LOCUS_09290 115 984 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 protein_id gnl|my_center|LOCUS_09290 1037 1900 gene locus_tag LOCUS_09300 1037 1900 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 protein_id gnl|my_center|LOCUS_09300 <2787 1904 gene locus_tag LOCUS_09310 <2787 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0302 868 1728 gene locus_tag LOCUS_09320 868 1728 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_09320 1725 2408 gene locus_tag LOCUS_09330 1725 2408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence0303 83 694 gene locus_tag LOCUS_09340 83 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 <2774 1143 gene locus_tag LOCUS_09350 <2774 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202101.1:aminopeptidase N >Feature sequence0304 <1 1911 gene locus_tag LOCUS_09360 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease 2089 2427 gene locus_tag LOCUS_09370 2089 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence0305 2639 96 gene locus_tag LOCUS_09380 2639 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0306 350 1762 gene locus_tag LOCUS_09390 350 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2398 1931 gene locus_tag LOCUS_09400 2398 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0307 258 674 gene locus_tag LOCUS_09410 258 674 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_09410 902 2131 gene locus_tag LOCUS_09420 902 2131 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_09420 2128 2574 gene locus_tag LOCUS_09430 gene iscU 2128 2574 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0308 2686 281 gene locus_tag LOCUS_09440 2686 281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0309 <1 734 gene locus_tag LOCUS_09450 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEM2:glucose-6-phosphate isomerase 731 1717 gene locus_tag LOCUS_09460 731 1717 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_09460 1732 1920 gene locus_tag LOCUS_09470 1732 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1953 2672 gene locus_tag LOCUS_09480 gene lipB 1953 2672 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence0310 >Feature sequence0311 335 409 gene locus_tag LOCUS_t00080 335 409 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1325 1113 gene locus_tag LOCUS_09490 1325 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1981 1433 gene locus_tag LOCUS_09500 1981 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0312 370 1506 gene locus_tag LOCUS_09510 370 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence0313 1680 307 gene locus_tag LOCUS_09520 gene radA 1680 307 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_09520 <2735 1689 gene locus_tag LOCUS_09530 <2735 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108785.1:helicase >Feature sequence0314 354 4 gene locus_tag LOCUS_09540 354 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 <2734 409 gene locus_tag LOCUS_09550 <2734 409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:sensor histidine kinase >Feature sequence0315 986 312 gene locus_tag LOCUS_09560 986 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1414 1013 gene locus_tag LOCUS_09570 1414 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1796 1416 gene locus_tag LOCUS_09580 gene gcvH 1796 1416 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_09580 <2724 1850 gene locus_tag LOCUS_09590 <2724 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence0316 153 329 gene locus_tag LOCUS_09600 153 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1377 316 gene locus_tag LOCUS_09610 1377 316 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_09610 1720 2421 gene locus_tag LOCUS_09620 1720 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence0317 1204 497 gene locus_tag LOCUS_09630 gene rprY 1204 497 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_09630 <2717 1197 gene locus_tag LOCUS_09640 <2717 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963934.1:two-component sensor histidine kinase >Feature sequence0318 <1 1166 gene locus_tag LOCUS_09650 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964490.1:RND transporter >Feature sequence0319 <1 725 gene locus_tag LOCUS_09660 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QUV5:putative S-adenosylmethionine-dependent methyltransferase 1095 727 gene locus_tag LOCUS_09670 1095 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1326 1535 gene locus_tag LOCUS_09680 1326 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1555 1866 gene locus_tag LOCUS_09690 1555 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 <2715 1939 gene locus_tag LOCUS_09700 <2715 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108712.1:membrane protein >Feature sequence0320 <1 687 gene locus_tag LOCUS_09710 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0321 1186 1647 gene locus_tag LOCUS_09720 1186 1647 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_09720 1649 2050 gene locus_tag LOCUS_09730 1649 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2180 2040 gene locus_tag LOCUS_09740 2180 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence0322 >Feature sequence0323 <2701 2147 gene locus_tag LOCUS_09750 <2701 2147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846673.1:sugar ABC transporter ATP-binding protein >Feature sequence0324 <1 1013 gene locus_tag LOCUS_09760 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 1602 1015 gene locus_tag LOCUS_09770 1602 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2353 1664 gene locus_tag LOCUS_09780 2353 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0325 814 623 gene locus_tag LOCUS_09790 814 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2302 971 gene locus_tag LOCUS_09800 2302 971 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence0326 1119 1580 gene locus_tag LOCUS_09810 1119 1580 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence0327 <1 802 gene locus_tag LOCUS_09820 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963233.1:dihydroorotase 804 1334 gene locus_tag LOCUS_09830 804 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1450 1995 gene locus_tag LOCUS_09840 1450 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0328 <1 2655 gene locus_tag LOCUS_09850 <1 2655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:Oar protein >Feature sequence0329 <1 1148 gene locus_tag LOCUS_09860 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002936352.1:glycosyl transferase 1149 2258 gene locus_tag LOCUS_09870 1149 2258 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence0330 776 2086 gene locus_tag LOCUS_09880 776 2086 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0331 1163 714 gene locus_tag LOCUS_09890 1163 714 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_09890 2038 1304 gene locus_tag LOCUS_09900 2038 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 <2689 2035 gene locus_tag LOCUS_09910 <2689 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974367.1:antirestriction protein >Feature sequence0332 552 193 gene locus_tag LOCUS_09920 552 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 759 2165 gene locus_tag LOCUS_09930 759 2165 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_09930 2268 2546 gene locus_tag LOCUS_09940 2268 2546 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence0333 1522 647 gene locus_tag LOCUS_09950 gene folD 1522 647 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_09950 1931 1554 gene locus_tag LOCUS_09960 1931 1554 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_09960 <2683 1941 gene locus_tag LOCUS_09970 <2683 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1S4:elongation factor 4 >Feature sequence0334 1268 306 gene locus_tag LOCUS_09980 1268 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_09980 1753 1322 gene locus_tag LOCUS_09990 1753 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 <2683 1827 gene locus_tag LOCUS_10000 <2683 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence0335 1971 1288 gene locus_tag LOCUS_10010 gene trmH 1971 1288 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_10010 <2681 2177 gene locus_tag LOCUS_10020 <2681 2177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403228.1:pyrroloquinoline-quinone glucose dehydrogenase >Feature sequence0336 1000 2481 gene locus_tag LOCUS_10030 1000 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0337 1347 466 gene locus_tag LOCUS_10040 1347 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1546 1358 gene locus_tag LOCUS_10050 1546 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 <2674 1550 gene locus_tag LOCUS_10060 <2674 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II >Feature sequence0338 1227 2324 gene locus_tag LOCUS_10070 1227 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence0339 1317 595 gene locus_tag LOCUS_10080 1317 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence0340 <1 1295 gene locus_tag LOCUS_10090 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H197:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence0341 331 723 gene locus_tag LOCUS_10100 gene rpsK 331 723 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 protein_id gnl|my_center|LOCUS_10100 742 1347 gene locus_tag LOCUS_10110 gene rpsD 742 1347 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_10110 1418 2368 gene locus_tag LOCUS_10120 gene rpoA 1418 2368 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_10120 >Feature sequence0342 348 1112 gene locus_tag LOCUS_10130 gene pcrB 348 1112 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_10130 2021 1098 gene locus_tag LOCUS_10140 2021 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0343 665 432 gene locus_tag LOCUS_10150 665 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence0344 <1 605 gene locus_tag LOCUS_10160 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212588.1:transporter 1830 2237 gene locus_tag LOCUS_10170 1830 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence0345 <1 654 gene locus_tag LOCUS_10180 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000031032.1:acid phosphatase 2182 656 gene locus_tag LOCUS_10190 2182 656 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0346 1602 913 gene locus_tag LOCUS_10200 1602 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2184 1606 gene locus_tag LOCUS_10210 2184 1606 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence0347 1396 2112 gene locus_tag LOCUS_10220 1396 2112 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0348 1242 334 gene locus_tag LOCUS_10230 1242 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 <2618 1337 gene locus_tag LOCUS_10240 <2618 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405424.1:acylaminoacyl-peptidase >Feature sequence0349 270 1496 gene locus_tag LOCUS_10250 270 1496 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_10250 2188 1508 gene locus_tag LOCUS_10260 2188 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence0350 1437 1766 gene locus_tag LOCUS_10270 1437 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0351 3 197 gene locus_tag LOCUS_10280 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 200 1342 gene locus_tag LOCUS_10290 200 1342 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_10290 1892 1329 gene locus_tag LOCUS_10300 1892 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1985 2365 gene locus_tag LOCUS_10310 1985 2365 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence0352 800 285 gene locus_tag LOCUS_10320 800 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_10320 1383 865 gene locus_tag LOCUS_10330 1383 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0353 <2604 353 gene locus_tag LOCUS_10340 <2604 353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0354 <2601 495 gene locus_tag LOCUS_10350 <2601 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0355 129 2450 gene locus_tag LOCUS_10360 gene uvrA1 129 2450 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_10360 >Feature sequence0356 >Feature sequence0357 965 105 gene locus_tag LOCUS_10370 965 105 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_10370 1775 993 gene locus_tag LOCUS_10380 1775 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_10380 <2579 1828 gene locus_tag LOCUS_10390 <2579 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084098.1:isopenicillin-N epimerase >Feature sequence0358 <1 1059 gene locus_tag LOCUS_10400 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY30:succinate--CoA ligase [ADP-forming] subunit beta 1078 1152 gene locus_tag LOCUS_t00090 1078 1152 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1278 2231 gene locus_tag LOCUS_10410 1278 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0359 1389 193 gene locus_tag LOCUS_10420 1389 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2572 1379 gene locus_tag LOCUS_10430 2572 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence0360 694 1266 gene locus_tag LOCUS_10440 694 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1387 1788 gene locus_tag LOCUS_10450 1387 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence0361 180 1235 gene locus_tag LOCUS_10460 180 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2518 1340 gene locus_tag LOCUS_10470 2518 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence0362 <1 2123 gene locus_tag LOCUS_10480 <1 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence0363 146 2176 gene locus_tag LOCUS_10490 146 2176 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0364 29 241 gene locus_tag LOCUS_10500 29 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 751 1239 gene locus_tag LOCUS_10510 751 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2138 1884 gene locus_tag LOCUS_10520 2138 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0365 >Feature sequence0366 <1 2155 gene locus_tag LOCUS_10530 <1 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974525.1:histidine kinase >Feature sequence0367 1122 349 gene locus_tag LOCUS_10540 1122 349 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence0368 >Feature sequence0369 607 1110 gene locus_tag LOCUS_10550 607 1110 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_10550 1467 2195 gene locus_tag LOCUS_10560 1467 2195 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence0370 <1 633 gene locus_tag LOCUS_10570 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976269.1:AraC family transcriptional regulator >Feature sequence0371 1431 742 gene locus_tag LOCUS_10580 1431 742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence0372 348 1121 gene locus_tag LOCUS_10590 348 1121 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 protein_id gnl|my_center|LOCUS_10590 2145 1168 gene locus_tag LOCUS_10600 2145 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0373 525 217 gene locus_tag LOCUS_10610 525 217 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_10610 759 1730 gene locus_tag LOCUS_10620 759 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0374 530 1141 gene locus_tag LOCUS_10630 530 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1182 1775 gene locus_tag LOCUS_10640 1182 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 <2548 1920 gene locus_tag LOCUS_10650 <2548 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7Z9:aspartokinase >Feature sequence0375 2091 199 gene locus_tag LOCUS_10660 gene htpG 2091 199 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_10660 >Feature sequence0376 506 802 gene locus_tag LOCUS_10670 gene gatC 506 802 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF4 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0377 1811 717 gene locus_tag LOCUS_10680 1811 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0378 <1 540 gene locus_tag LOCUS_10690 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787762.1:phosphonate ABC transporter ATP-binding protein 1294 596 gene locus_tag LOCUS_10700 gene crtO 1294 596 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_10700 2155 1310 gene locus_tag LOCUS_10710 gene ispH 2155 1310 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0379 46 660 gene locus_tag LOCUS_10720 gene hisIE 46 660 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_10720 >Feature sequence0380 <1 666 gene locus_tag LOCUS_10730 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964285.1:permease 1359 628 gene locus_tag LOCUS_10740 1359 628 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_10740 1463 2089 gene locus_tag LOCUS_10750 1463 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence0381 556 98 gene locus_tag LOCUS_10760 556 98 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_10760 936 568 gene locus_tag LOCUS_10770 936 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1123 2415 gene locus_tag LOCUS_10780 1123 2415 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920587.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence0382 215 976 gene locus_tag LOCUS_10790 215 976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_10790 978 1688 gene locus_tag LOCUS_10800 978 1688 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0383 <1 551 gene locus_tag LOCUS_10810 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G3:Holliday junction ATP-dependent DNA helicase RuvB 608 1147 gene locus_tag LOCUS_10820 608 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_10820 1144 1797 gene locus_tag LOCUS_10830 1144 1797 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_10830 1787 2239 gene locus_tag LOCUS_10840 1787 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence0384 407 799 gene locus_tag LOCUS_10850 407 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence0385 >Feature sequence0386 <1 742 gene locus_tag LOCUS_10860 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963942.1:outer membrane protein assembly factor BamD 744 1064 gene locus_tag LOCUS_10870 744 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_10870 1077 2273 gene locus_tag LOCUS_10880 1077 2273 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence0387 144 647 gene locus_tag LOCUS_10890 144 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 701 1552 gene locus_tag LOCUS_10900 701 1552 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_10900 1706 2101 gene locus_tag LOCUS_10910 1706 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0388 563 979 gene locus_tag LOCUS_10920 563 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1924 989 gene locus_tag LOCUS_10930 1924 989 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 protein_id gnl|my_center|LOCUS_10930 <2501 1906 gene locus_tag LOCUS_10940 <2501 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97EY6:putative 3-methyladenine DNA glycosylase >Feature sequence0389 287 120 gene locus_tag LOCUS_10950 287 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1750 443 gene locus_tag LOCUS_10960 1750 443 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_10960 2401 1817 gene locus_tag LOCUS_10970 2401 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence0390 64 1017 gene locus_tag LOCUS_10980 gene argC 64 1017 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_10980 1269 2402 gene locus_tag LOCUS_10990 gene argD 1269 2402 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_10990 >Feature sequence0391 926 414 gene locus_tag LOCUS_11000 926 414 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_11000 1063 1806 gene locus_tag LOCUS_11010 1063 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence0392 >Feature sequence0393 <1 967 gene locus_tag LOCUS_11020 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761518.1:membrane protein 967 1890 gene locus_tag LOCUS_11030 967 1890 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0394 1917 469 gene locus_tag LOCUS_11040 1917 469 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence0395 3 1598 gene locus_tag LOCUS_11050 3 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1650 2369 gene locus_tag LOCUS_11060 1650 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0396 3 611 gene locus_tag LOCUS_11070 3 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence0397 <2454 478 gene locus_tag LOCUS_11080 <2454 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T17:UvrABC system protein A >Feature sequence0398 1221 358 gene locus_tag LOCUS_11090 1221 358 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_11090 2453 1224 gene locus_tag LOCUS_11100 2453 1224 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0399 1486 476 gene locus_tag LOCUS_11110 1486 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764441.1 protein_id gnl|my_center|LOCUS_11110 2376 1486 gene locus_tag LOCUS_11120 2376 1486 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0400 868 464 gene locus_tag LOCUS_11130 868 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_11130 1066 1989 gene locus_tag LOCUS_11140 1066 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0401 791 1372 gene locus_tag LOCUS_11150 791 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_11150 1510 2016 gene locus_tag LOCUS_11160 1510 2016 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0402 1110 145 gene locus_tag LOCUS_11170 1110 145 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_11170 1760 1179 gene locus_tag LOCUS_11180 1760 1179 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence0403 414 977 gene locus_tag LOCUS_11190 414 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1189 1872 gene locus_tag LOCUS_11200 1189 1872 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0404 904 1494 gene locus_tag LOCUS_11210 904 1494 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_11210 1644 2174 gene locus_tag LOCUS_11220 1644 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0405 <1 656 gene locus_tag LOCUS_11230 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073592.1:membrane protein 911 645 gene locus_tag LOCUS_11240 911 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1899 943 gene locus_tag LOCUS_11250 1899 943 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0406 301 630 gene locus_tag LOCUS_11260 301 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1341 925 gene locus_tag LOCUS_11270 gene yqiW 1341 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_11270 1757 1437 gene locus_tag LOCUS_11280 1757 1437 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_11280 <2428 1802 gene locus_tag LOCUS_11290 <2428 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700625.1:oxidoreductase >Feature sequence0407 <2424 1415 gene locus_tag LOCUS_11300 <2424 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118819.1:multidrug transporter >Feature sequence0408 665 1183 gene locus_tag LOCUS_11310 665 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_11310 1180 1365 gene locus_tag LOCUS_11320 1180 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1572 1369 gene locus_tag LOCUS_11330 1572 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 <2424 1576 gene locus_tag LOCUS_11340 <2424 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NI3:glutamate--tRNA ligase >Feature sequence0409 1090 173 gene locus_tag LOCUS_11350 1090 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2033 1161 gene locus_tag LOCUS_11360 2033 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0410 300 875 gene locus_tag LOCUS_11370 300 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 936 1376 gene locus_tag LOCUS_11380 gene pcaC 936 1376 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ90 protein_id gnl|my_center|LOCUS_11380 1501 1683 gene locus_tag LOCUS_11390 gene rpmG 1501 1683 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 protein_id gnl|my_center|LOCUS_11390 1686 1841 gene locus_tag LOCUS_11400 1686 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0411 2288 642 gene locus_tag LOCUS_11410 2288 642 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence0412 1009 92 gene locus_tag LOCUS_11420 1009 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1551 1036 gene locus_tag LOCUS_11430 1551 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 <2413 1767 gene locus_tag LOCUS_11440 <2413 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880049.1:Fis family transcriptional regulator >Feature sequence0413 <1 1235 gene locus_tag LOCUS_11450 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787651.1:carbon-nitrogen hydrolase 1353 1799 gene locus_tag LOCUS_11460 1353 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0414 1404 61 gene locus_tag LOCUS_11470 1404 61 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_11470 <2411 1404 gene locus_tag LOCUS_11480 <2411 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228370.1:RND transporter >Feature sequence0415 1220 642 gene locus_tag LOCUS_11490 1220 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1996 1415 gene locus_tag LOCUS_11500 1996 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence0416 850 80 gene locus_tag LOCUS_11510 gene rpsB 850 80 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_11510 1261 875 gene locus_tag LOCUS_11520 gene rpsI 1261 875 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_11520 1715 1272 gene locus_tag LOCUS_11530 gene rplM 1715 1272 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_11530 <2409 1851 gene locus_tag LOCUS_11540 <2409 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680560.1:RNA pseudouridine synthase >Feature sequence0417 <1 774 gene locus_tag LOCUS_11550 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529828.1:DNA topoisomerase 2144 795 gene locus_tag LOCUS_11560 2144 795 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence0418 >Feature sequence0419 1337 465 gene locus_tag LOCUS_11570 1337 465 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_11570 1440 1838 gene locus_tag LOCUS_11580 1440 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_11580 <2406 1840 gene locus_tag LOCUS_11590 <2406 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702575.1:endonuclease >Feature sequence0420 1313 954 gene locus_tag LOCUS_11600 1313 954 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence0421 >Feature sequence0422 1780 998 gene locus_tag LOCUS_11610 1780 998 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0423 505 296 gene locus_tag LOCUS_11620 505 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1215 685 gene locus_tag LOCUS_11630 1215 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence0424 148 843 gene locus_tag LOCUS_11640 148 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0425 <1 1071 gene locus_tag LOCUS_11650 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme 1143 1523 gene locus_tag LOCUS_11660 1143 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 <2389 1556 gene locus_tag LOCUS_11670 <2389 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1T2:asparagine--tRNA ligase >Feature sequence0426 >Feature sequence0427 1573 2238 gene locus_tag LOCUS_11680 1573 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0428 87 1088 gene locus_tag LOCUS_11690 87 1088 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_11690 1312 1094 gene locus_tag LOCUS_11700 1312 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0429 <1 747 gene locus_tag LOCUS_11710 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYX5:diaminopimelate epimerase >Feature sequence0430 20 337 gene locus_tag LOCUS_11720 20 337 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ7 protein_id gnl|my_center|LOCUS_11720 1028 477 gene locus_tag LOCUS_11730 1028 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1677 1018 gene locus_tag LOCUS_11740 1677 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 <2373 1706 gene locus_tag LOCUS_11750 <2373 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405041.1:magnesium chelatase >Feature sequence0431 421 1518 gene locus_tag LOCUS_11760 421 1518 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_11760 <2372 1602 gene locus_tag LOCUS_11770 <2372 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121679.1:3-carboxymuconate cyclase >Feature sequence0432 2172 1102 gene locus_tag LOCUS_11780 2172 1102 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence0433 1548 961 gene locus_tag LOCUS_11790 1548 961 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence0434 835 1254 gene locus_tag LOCUS_11800 gene ndk 835 1254 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_11800 2278 1292 gene locus_tag LOCUS_11810 2278 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0435 625 1305 gene locus_tag LOCUS_11820 625 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1651 2205 gene locus_tag LOCUS_11830 1651 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0436 <1 608 gene locus_tag LOCUS_11840 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932054.1:glycosyl transferase 589 1461 gene locus_tag LOCUS_11850 589 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence0437 1649 24 gene locus_tag LOCUS_11860 1649 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 <2348 1658 gene locus_tag LOCUS_11870 <2348 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAR6:alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase >Feature sequence0438 684 908 gene locus_tag LOCUS_11880 684 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 945 1538 gene locus_tag LOCUS_11890 945 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 <2341 1586 gene locus_tag LOCUS_11900 <2341 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867978.1:malate dehydrogenase >Feature sequence0439 >Feature sequence0440 1151 261 gene locus_tag LOCUS_11910 gene menA 1151 261 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_11910 1606 1154 gene locus_tag LOCUS_11920 1606 1154 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y8C5 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0441 >Feature sequence0442 1702 1163 gene locus_tag LOCUS_11930 1702 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence0443 >Feature sequence0444 1329 1988 gene locus_tag LOCUS_11940 1329 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0445 558 1370 gene locus_tag LOCUS_11950 gene murQ 558 1370 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_11950 1357 2181 gene locus_tag LOCUS_11960 1357 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence0446 279 1385 gene locus_tag LOCUS_11970 279 1385 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_11970 <2325 1783 gene locus_tag LOCUS_11980 <2325 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877664.1:heavy metal translocating P-type ATPase >Feature sequence0447 757 224 gene locus_tag LOCUS_11990 757 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0448 1892 618 gene locus_tag LOCUS_12000 1892 618 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0449 <1 1046 gene locus_tag LOCUS_12010 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase 1125 1895 gene locus_tag LOCUS_12020 gene coaX 1125 1895 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM55 protein_id gnl|my_center|LOCUS_12020 1888 2103 gene locus_tag LOCUS_12030 1888 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence0450 >Feature sequence0451 >Feature sequence0452 <1 806 gene locus_tag LOCUS_12040 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119920.1:mechanosensitive ion channel protein MscS >Feature sequence0453 401 733 gene locus_tag LOCUS_12050 401 733 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_12050 736 2013 gene locus_tag LOCUS_12060 736 2013 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_12060 2283 2065 gene locus_tag LOCUS_12070 2283 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0454 >Feature sequence0455 2049 346 gene locus_tag LOCUS_12080 2049 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence0456 486 1265 gene locus_tag LOCUS_12090 486 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0457 468 1427 gene locus_tag LOCUS_12100 468 1427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_12100 1786 1424 gene locus_tag LOCUS_12110 1786 1424 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 protein_id gnl|my_center|LOCUS_12110 <2298 1786 gene locus_tag LOCUS_12120 <2298 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RYG9:aldehyde dehydrogenase >Feature sequence0458 1108 1563 gene locus_tag LOCUS_12130 1108 1563 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence0459 577 1737 gene locus_tag LOCUS_12140 577 1737 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0460 2162 861 gene locus_tag LOCUS_12150 2162 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0461 1263 1874 gene locus_tag LOCUS_12160 1263 1874 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence0462 611 36 gene locus_tag LOCUS_12170 611 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2295 1699 gene locus_tag LOCUS_12180 2295 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0463 >Feature sequence0464 <2288 220 gene locus_tag LOCUS_12190 <2288 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528058.1:copper-translocating P-type ATPase >Feature sequence0465 <1 1705 gene locus_tag LOCUS_12200 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:alkaline phosphatase >Feature sequence0466 >Feature sequence0467 <1 989 gene locus_tag LOCUS_12210 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108113.1:isoprenyl synthetase 989 1594 gene locus_tag LOCUS_12220 989 1594 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0468 1175 741 gene locus_tag LOCUS_12230 1175 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_12230 1422 2129 gene locus_tag LOCUS_12240 1422 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0469 <1 1373 gene locus_tag LOCUS_12250 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946128.1:ribosomal protein S6 modification protein >Feature sequence0470 676 1116 gene locus_tag LOCUS_12260 676 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1224 1568 gene locus_tag LOCUS_12270 1224 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence0471 1515 352 gene locus_tag LOCUS_12280 1515 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405252.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0472 >Feature sequence0473 1156 236 gene locus_tag LOCUS_12290 1156 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_12290 2183 1149 gene locus_tag LOCUS_12300 2183 1149 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence0474 411 2228 gene locus_tag LOCUS_12310 411 2228 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0475 1947 913 gene locus_tag LOCUS_12320 1947 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence0476 146 1267 gene locus_tag LOCUS_12330 gene dnaN 146 1267 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_12330 1343 1762 gene locus_tag LOCUS_12340 1343 1762 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0477 >Feature sequence0478 33 845 gene locus_tag LOCUS_12350 gene dapD 33 845 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_12350 1113 1712 gene locus_tag LOCUS_12360 1113 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence0479 918 1373 gene locus_tag LOCUS_12370 918 1373 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_12370 <2253 1375 gene locus_tag LOCUS_12380 <2253 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0480 <2252 1388 gene locus_tag LOCUS_12390 <2252 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788554.1:type I deoxyribonuclease HsdR >Feature sequence0481 <1 1603 gene locus_tag LOCUS_12400 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA >Feature sequence0482 1570 881 gene locus_tag LOCUS_12410 1570 881 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0483 521 1462 gene locus_tag LOCUS_12420 521 1462 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0484 <2246 93 gene locus_tag LOCUS_12430 <2246 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0485 21 665 gene locus_tag LOCUS_12440 gene pdxH 21 665 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE19 protein_id gnl|my_center|LOCUS_12440 1445 729 gene locus_tag LOCUS_12450 1445 729 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_12450 <2244 1474 gene locus_tag LOCUS_12460 <2244 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962776.1:thioredoxin-disulfide reductase >Feature sequence0486 >Feature sequence0487 884 1816 gene locus_tag LOCUS_12470 884 1816 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence0488 <1 885 gene locus_tag LOCUS_12480 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase 968 1963 gene locus_tag LOCUS_12490 968 1963 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0489 <1 2073 gene locus_tag LOCUS_12500 <1 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence0490 >Feature sequence0491 2142 670 gene locus_tag LOCUS_12510 2142 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence0492 <1 1402 gene locus_tag LOCUS_12520 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108993.1:peptidase S74 >Feature sequence0493 >Feature sequence0494 1352 2119 gene locus_tag LOCUS_12530 1352 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0495 >Feature sequence0496 727 1146 gene locus_tag LOCUS_12540 gene aroQ 727 1146 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_12540 1143 1541 gene locus_tag LOCUS_12550 1143 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2010 1597 gene locus_tag LOCUS_12560 2010 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0497 1076 1759 gene locus_tag LOCUS_12570 1076 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence0498 >Feature sequence0499 977 1723 gene locus_tag LOCUS_12580 977 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0500 45 1058 gene locus_tag LOCUS_12590 45 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484988.1 protein_id gnl|my_center|LOCUS_12590 1326 2081 gene locus_tag LOCUS_12600 1326 2081 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0501 <1 1055 gene locus_tag LOCUS_12610 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860915.1:sodium:solute symporter 1055 2164 gene locus_tag LOCUS_12620 gene yihF 1055 2164 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905594.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence0502 >Feature sequence0503 1206 1775 gene locus_tag LOCUS_12630 1206 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence0504 851 1747 gene locus_tag LOCUS_12640 851 1747 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0505 >Feature sequence0506 460 585 gene locus_tag LOCUS_12650 460 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2078 636 gene locus_tag LOCUS_12660 2078 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence0507 1400 384 gene locus_tag LOCUS_12670 gene ltaE 1400 384 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_12670 <2206 1390 gene locus_tag LOCUS_12680 <2206 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404286.1:glycerophosphoryl diester phosphodiesterase >Feature sequence0508 430 2079 gene locus_tag LOCUS_12690 430 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence0509 1627 851 gene locus_tag LOCUS_12700 1627 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0510 1721 1146 gene locus_tag LOCUS_12710 1721 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence0511 55 1041 gene locus_tag LOCUS_12720 55 1041 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974991.1 protein_id gnl|my_center|LOCUS_12720 1262 1047 gene locus_tag LOCUS_12730 1262 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 <2198 1519 gene locus_tag LOCUS_12740 <2198 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919028.1:aminopeptidase >Feature sequence0512 >Feature sequence0513 <1 2192 gene locus_tag LOCUS_12750 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHB7:DNA-directed DNA polymerase >Feature sequence0514 1289 1876 gene locus_tag LOCUS_12760 1289 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence0515 1375 908 gene locus_tag LOCUS_12770 1375 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence0516 355 1083 gene locus_tag LOCUS_12780 355 1083 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence0517 <1 717 gene locus_tag LOCUS_12790 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase 717 2162 gene locus_tag LOCUS_12800 gene gltD 717 2162 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence0518 1506 862 gene locus_tag LOCUS_12810 1506 862 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_12810 <2175 1506 gene locus_tag LOCUS_12820 <2175 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108756.1:peptidase M16 >Feature sequence0519 <1 1451 gene locus_tag LOCUS_12830 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein 1448 1837 gene locus_tag LOCUS_12840 1448 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0520 <2173 1489 gene locus_tag LOCUS_12850 <2173 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89T28:D-amino acid dehydrogenase >Feature sequence0521 <1 772 gene locus_tag LOCUS_12860 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460338.1:DNA mismatch repair protein 827 1963 gene locus_tag LOCUS_12870 gene purK 827 1963 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0522 <1 585 gene locus_tag LOCUS_12880 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963177.1:phosphorylase 1153 572 gene locus_tag LOCUS_12890 1153 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0523 1047 184 gene locus_tag LOCUS_12900 1047 184 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_12900 <2167 1264 gene locus_tag LOCUS_12910 <2167 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEB0:3-deoxy-alpha-D-manno-octulosonate 8-oxidase >Feature sequence0524 <1 1318 gene locus_tag LOCUS_12920 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404908.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0525 515 952 gene locus_tag LOCUS_12930 515 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence0526 342 1247 gene locus_tag LOCUS_12940 342 1247 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_12940 1247 1822 gene locus_tag LOCUS_12950 1247 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0527 <2157 660 gene locus_tag LOCUS_12960 <2157 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT6:peptide chain release factor 3 >Feature sequence0528 159 563 gene locus_tag LOCUS_12970 159 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_12970 1274 633 gene locus_tag LOCUS_12980 1274 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence0529 2142 1348 gene locus_tag LOCUS_12990 2142 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0530 785 1522 gene locus_tag LOCUS_13000 785 1522 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_13000 <2150 1519 gene locus_tag LOCUS_13010 <2150 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036538.1:membrane protein >Feature sequence0531 670 89 gene locus_tag LOCUS_13020 670 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1164 889 gene locus_tag LOCUS_13030 1164 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1728 2078 gene locus_tag LOCUS_13040 1728 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0532 210 578 gene locus_tag LOCUS_13050 gene rplN 210 578 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_13050 581 928 gene locus_tag LOCUS_13060 gene rplX 581 928 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_13060 921 1481 gene locus_tag LOCUS_13070 gene rplE 921 1481 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_13070 1484 1753 gene locus_tag LOCUS_13080 gene rpsN 1484 1753 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_13080 >Feature sequence0533 166 534 gene locus_tag LOCUS_13090 166 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1485 595 gene locus_tag LOCUS_13100 1485 595 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_13100 <2140 1478 gene locus_tag LOCUS_13110 <2140 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P60495:kinase A inhibitor >Feature sequence0534 39 1088 gene locus_tag LOCUS_13120 gene des 39 1088 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 protein_id gnl|my_center|LOCUS_13120 1574 1116 gene locus_tag LOCUS_13130 1574 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0535 >Feature sequence0536 >Feature sequence0537 <1 1476 gene locus_tag LOCUS_13140 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter note possible pseudo, frameshifted >Feature sequence0538 2004 718 gene locus_tag LOCUS_13150 2004 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0539 101 631 gene locus_tag LOCUS_13160 101 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 628 1473 gene locus_tag LOCUS_13170 gene kdsA 628 1473 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX5 protein_id gnl|my_center|LOCUS_13170 >Feature sequence0540 246 986 gene locus_tag LOCUS_13180 246 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1062 1676 gene locus_tag LOCUS_13190 1062 1676 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13190 >Feature sequence0541 <1 1720 gene locus_tag LOCUS_13200 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001128510.1:sensor histidine kinase >Feature sequence0542 1313 27 gene locus_tag LOCUS_13210 gene kynU 1313 27 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_13210 1807 1310 gene locus_tag LOCUS_13220 gene ogt1 1807 1310 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0543 412 1164 gene locus_tag LOCUS_13230 412 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <2116 1153 gene locus_tag LOCUS_13240 <2116 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940450.1:glycosyl transferase >Feature sequence0544 354 530 gene locus_tag LOCUS_13250 354 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0545 <2115 1407 gene locus_tag LOCUS_13260 <2115 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201961.1:acetylornithine deacetylase >Feature sequence0546 >Feature sequence0547 137 886 gene locus_tag LOCUS_13270 137 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_13270 1503 919 gene locus_tag LOCUS_13280 1503 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_13280 2044 1526 gene locus_tag LOCUS_13290 2044 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence0548 <2105 67 gene locus_tag LOCUS_13300 <2105 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0549 804 343 gene locus_tag LOCUS_13310 804 343 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_13310 1468 806 gene locus_tag LOCUS_13320 1468 806 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_13320 1835 1473 gene locus_tag LOCUS_13330 1835 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0550 244 1191 gene locus_tag LOCUS_13340 244 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 <2103 1503 gene locus_tag LOCUS_13350 <2103 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948289.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence0551 893 1315 gene locus_tag LOCUS_13360 893 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1305 1859 gene locus_tag LOCUS_13370 1305 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0552 1243 1013 gene locus_tag LOCUS_13380 1243 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence0553 1161 1349 gene locus_tag LOCUS_13390 1161 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <2096 1387 gene locus_tag LOCUS_13400 <2096 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G2:epoxyqueuosine reductase >Feature sequence0554 >Feature sequence0555 <1 1207 gene locus_tag LOCUS_13410 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZR4:translation initiation factor IF-2 >Feature sequence0556 97 1455 gene locus_tag LOCUS_13420 97 1455 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0557 657 13 gene locus_tag LOCUS_13430 657 13 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_13430 <2085 712 gene locus_tag LOCUS_13440 <2085 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107693.1:glycosyl transferase >Feature sequence0558 410 583 gene locus_tag LOCUS_13450 410 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 627 1547 gene locus_tag LOCUS_13460 gene pqqB 627 1547 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6N0 protein_id gnl|my_center|LOCUS_13460 >Feature sequence0559 792 1583 gene locus_tag LOCUS_13470 792 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence0560 539 661 gene locus_tag LOCUS_13480 539 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1005 1358 gene locus_tag LOCUS_13490 1005 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0561 78 1295 gene locus_tag LOCUS_13500 gene nuoD 78 1295 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_13500 2029 1292 gene locus_tag LOCUS_13510 2029 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence0562 >Feature sequence0563 <2069 1335 gene locus_tag LOCUS_13520 <2069 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZH6:tRNA pseudouridine synthase A >Feature sequence0564 1500 613 gene locus_tag LOCUS_13530 1500 613 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence0565 567 779 gene locus_tag LOCUS_13540 567 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 790 1332 gene locus_tag LOCUS_13550 790 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence0566 1420 338 gene locus_tag LOCUS_13560 1420 338 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_13560 1556 1632 gene locus_tag LOCUS_t00100 1556 1632 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2018 1782 gene locus_tag LOCUS_13570 2018 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0567 <2064 980 gene locus_tag LOCUS_13580 <2064 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202496.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0568 468 346 gene locus_tag LOCUS_13590 468 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 626 1690 gene locus_tag LOCUS_13600 626 1690 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence0569 101 1075 gene locus_tag LOCUS_13610 101 1075 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_13610 1093 2043 gene locus_tag LOCUS_13620 1093 2043 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWL5 protein_id gnl|my_center|LOCUS_13620 >Feature sequence0570 599 168 gene locus_tag LOCUS_13630 599 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 <2063 602 gene locus_tag LOCUS_13640 <2063 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000399994.1:sodium:proton antiporter >Feature sequence0571 1245 1574 gene locus_tag LOCUS_13650 1245 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence0572 2059 1229 gene locus_tag LOCUS_13660 gene dltE 2059 1229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0573 <1 888 gene locus_tag LOCUS_13670 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249899.1:threonylcarbamoyl-AMP synthase >Feature sequence0574 418 53 gene locus_tag LOCUS_13680 418 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1011 421 gene locus_tag LOCUS_13690 1011 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 <2053 1048 gene locus_tag LOCUS_13700 <2053 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362014.1:ATP-dependent DNA helicase RecQ2 >Feature sequence0575 >Feature sequence0576 >Feature sequence0577 >Feature sequence0578 >Feature sequence0579 20 1072 gene locus_tag LOCUS_13710 gene fjo30 20 1072 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence0580 1236 688 gene locus_tag LOCUS_13720 1236 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence0581 1851 1264 gene locus_tag LOCUS_13730 1851 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence0582 511 864 gene locus_tag LOCUS_13740 gene rsfS 511 864 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_13740 >Feature sequence0583 127 687 gene locus_tag LOCUS_13750 gene gpmA 127 687 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_13750 791 1564 gene locus_tag LOCUS_13760 791 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence0584 >Feature sequence0585 487 29 gene locus_tag LOCUS_13770 487 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence0586 1577 969 gene locus_tag LOCUS_13780 1577 969 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence0587 1 1245 gene locus_tag LOCUS_13790 1 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1342 1713 gene locus_tag LOCUS_13800 1342 1713 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0588 123 752 gene locus_tag LOCUS_13810 123 752 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_13810 856 1398 gene locus_tag LOCUS_13820 856 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770281.1 protein_id gnl|my_center|LOCUS_13820 1422 1613 gene locus_tag LOCUS_13830 gene rpmF 1422 1613 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_13830 >Feature sequence0589 1358 528 gene locus_tag LOCUS_13840 1358 528 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 protein_id gnl|my_center|LOCUS_13840 1425 1868 gene locus_tag LOCUS_13850 1425 1868 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0590 <2023 527 gene locus_tag LOCUS_13860 <2023 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 >Feature sequence0591 912 391 gene locus_tag LOCUS_13870 gene nuoB 912 391 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_13870 1379 912 gene locus_tag LOCUS_13880 gene nuoA 1379 912 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 protein_id gnl|my_center|LOCUS_13880 2014 1382 gene locus_tag LOCUS_13890 2014 1382 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0592 1043 468 gene locus_tag LOCUS_13900 1043 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2018 1047 gene locus_tag LOCUS_13910 gene trpS 2018 1047 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence0593 <2016 780 gene locus_tag LOCUS_13920 <2016 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha >Feature sequence0594 >Feature sequence0595 23 739 gene locus_tag LOCUS_13930 23 739 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_13930 934 1359 gene locus_tag LOCUS_13940 934 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_13940 1361 1969 gene locus_tag LOCUS_13950 gene arsC 1361 1969 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence0596 2 616 gene locus_tag LOCUS_13960 2 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_13960 613 1146 gene locus_tag LOCUS_13970 613 1146 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence0597 291 1556 gene locus_tag LOCUS_13980 gene atoE 291 1556 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence0598 727 20 gene locus_tag LOCUS_13990 gene pyrH 727 20 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_13990 1291 734 gene locus_tag LOCUS_14000 1291 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1531 1616 gene locus_tag LOCUS_t00110 1531 1616 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1693 1766 gene locus_tag LOCUS_t00120 1693 1766 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1843 1917 gene locus_tag LOCUS_t00130 1843 1917 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0599 <1 1287 gene locus_tag LOCUS_14010 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828556.1:methylmalonyl-CoA mutase 1284 1685 gene locus_tag LOCUS_14020 1284 1685 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence0600 >Feature sequence0601 991 428 gene locus_tag LOCUS_14030 gene tag 991 428 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence0602 901 461 gene locus_tag LOCUS_14040 901 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <1992 905 gene locus_tag LOCUS_14050 <1992 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG >Feature sequence0603 1588 845 gene locus_tag LOCUS_14060 1588 845 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0604 97 1278 gene locus_tag LOCUS_14070 gene trpB 97 1278 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence0605 73 1170 gene locus_tag LOCUS_14080 73 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence0606 >Feature sequence0607 131 1069 gene locus_tag LOCUS_14090 131 1069 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence0608 1 558 gene locus_tag LOCUS_14100 1 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1629 718 gene locus_tag LOCUS_14110 1629 718 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence0609 41 346 gene locus_tag LOCUS_14120 gene rpsJ 41 346 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_14120 558 1190 gene locus_tag LOCUS_14130 gene rplC 558 1190 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_14130 1195 1824 gene locus_tag LOCUS_14140 gene rplD 1195 1824 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK9 protein_id gnl|my_center|LOCUS_14140 >Feature sequence0610 <1982 983 gene locus_tag LOCUS_14150 <1982 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962550.1:cytochrome-c oxidase >Feature sequence0611 1912 1265 gene locus_tag LOCUS_14160 1912 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0612 1235 372 gene locus_tag LOCUS_14170 1235 372 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_14170 <1977 1319 gene locus_tag LOCUS_14180 <1977 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N73:polyribonucleotide nucleotidyltransferase >Feature sequence0613 626 1636 gene locus_tag LOCUS_14190 626 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence0614 281 1360 gene locus_tag LOCUS_14200 gene serC 281 1360 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Y1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0615 >Feature sequence0616 767 1759 gene locus_tag LOCUS_14210 767 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0617 >Feature sequence0618 1219 668 gene locus_tag LOCUS_14220 1219 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1802 1281 gene locus_tag LOCUS_14230 1802 1281 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_14230 1969 1802 gene locus_tag LOCUS_14240 1969 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence0619 1177 62 gene locus_tag LOCUS_14250 1177 62 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_14250 >Feature sequence0620 <1 703 gene locus_tag LOCUS_14260 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase 693 1418 gene locus_tag LOCUS_14270 693 1418 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence0621 >Feature sequence0622 78 890 gene locus_tag LOCUS_14280 78 890 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_14280 937 1752 gene locus_tag LOCUS_14290 gene ispE 937 1752 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_14290 1776 1952 gene locus_tag LOCUS_14300 1776 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0623 1110 700 gene locus_tag LOCUS_14310 1110 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 <1960 1107 gene locus_tag LOCUS_14320 <1960 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1W0:uroporphyrinogen decarboxylase >Feature sequence0624 1189 479 gene locus_tag LOCUS_14330 1189 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 <1956 1192 gene locus_tag LOCUS_14340 <1956 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405241.1:GMC family oxidoreductase >Feature sequence0625 1349 876 gene locus_tag LOCUS_14350 1349 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 <1956 1443 gene locus_tag LOCUS_14360 <1956 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964140.1:flavin oxidoreductase >Feature sequence0626 >Feature sequence0627 >Feature sequence0628 496 1320 gene locus_tag LOCUS_14370 496 1320 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957563.1 protein_id gnl|my_center|LOCUS_14370 <1953 1298 gene locus_tag LOCUS_14380 <1953 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JY72:thymidylate synthase >Feature sequence0629 >Feature sequence0630 1468 428 gene locus_tag LOCUS_14390 1468 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence0631 >Feature sequence0632 1070 822 gene locus_tag LOCUS_14400 1070 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1913 1320 gene locus_tag LOCUS_14410 1913 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence0633 <1 735 gene locus_tag LOCUS_14420 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260929.1:TatD family hydrolase 728 1789 gene locus_tag LOCUS_14430 gene ansA 728 1789 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0634 790 200 gene locus_tag LOCUS_14440 790 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence0635 >Feature sequence0636 455 12 gene locus_tag LOCUS_14450 455 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 565 945 gene locus_tag LOCUS_14460 565 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 942 1382 gene locus_tag LOCUS_14470 gene dinB 942 1382 CDS product protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02886 protein_id gnl|my_center|LOCUS_14470 1379 1753 gene locus_tag LOCUS_14480 1379 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0637 >Feature sequence0638 1818 826 gene locus_tag LOCUS_14490 gene fbp 1818 826 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 protein_id gnl|my_center|LOCUS_14490 >Feature sequence0639 570 1394 gene locus_tag LOCUS_14500 570 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence0640 1310 903 gene locus_tag LOCUS_14510 1310 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 <1917 1320 gene locus_tag LOCUS_14520 <1917 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403573.1:mechanosensitive ion channel protein MscS >Feature sequence0641 819 454 gene locus_tag LOCUS_14530 819 454 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_14530 946 1761 gene locus_tag LOCUS_14540 946 1761 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence0642 382 1806 gene locus_tag LOCUS_14550 382 1806 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence0643 1906 122 gene locus_tag LOCUS_14560 1906 122 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence0644 89 967 gene locus_tag LOCUS_14570 89 967 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence0645 796 284 gene locus_tag LOCUS_14580 796 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1382 831 gene locus_tag LOCUS_14590 1382 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 <1902 1372 gene locus_tag LOCUS_14600 <1902 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404975.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0646 741 334 gene locus_tag LOCUS_14610 741 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1374 808 gene locus_tag LOCUS_14620 1374 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence0647 >Feature sequence0648 292 1530 gene locus_tag LOCUS_14630 gene nhaP 292 1530 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_14630 >Feature sequence0649 <1 1427 gene locus_tag LOCUS_14640 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783463.1:TonB-dependent receptor >Feature sequence0650 <1 596 gene locus_tag LOCUS_14650 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530537.1:AraC family transcriptional regulator >Feature sequence0651 >Feature sequence0652 596 450 gene locus_tag LOCUS_14660 596 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1772 612 gene locus_tag LOCUS_14670 gene kmo 1772 612 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0653 >Feature sequence0654 1492 572 gene locus_tag LOCUS_14680 gene mdh 1492 572 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0655 1482 523 gene locus_tag LOCUS_14690 1482 523 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence0656 99 668 gene locus_tag LOCUS_14700 99 668 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_14700 <1879 778 gene locus_tag LOCUS_14710 <1879 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter >Feature sequence0657 <1879 5 gene locus_tag LOCUS_14720 <1879 5 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257017.1:peptidase M14 >Feature sequence0658 >Feature sequence0659 <1877 1229 gene locus_tag LOCUS_14730 <1877 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203131.1:anti-sigma factor >Feature sequence0660 <1 1051 gene locus_tag LOCUS_14740 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793798.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0661 341 1417 gene locus_tag LOCUS_14750 341 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence0662 1 600 gene locus_tag LOCUS_14760 1 600 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence0663 >Feature sequence0664 >Feature sequence0665 1674 676 gene locus_tag LOCUS_14770 1674 676 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence0666 >Feature sequence0667 <1 1453 gene locus_tag LOCUS_14780 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946770.1:copper oxidase >Feature sequence0668 348 7 gene locus_tag LOCUS_14790 348 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 806 345 gene locus_tag LOCUS_14800 gene fur 806 345 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_14800 <1863 857 gene locus_tag LOCUS_14810 <1863 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein >Feature sequence0669 295 792 gene locus_tag LOCUS_14820 295 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 919 1674 gene locus_tag LOCUS_14830 919 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence0670 771 193 gene locus_tag LOCUS_14840 771 193 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098216.1 protein_id gnl|my_center|LOCUS_14840 <1857 771 gene locus_tag LOCUS_14850 <1857 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583012.1:multidrug ABC transporter ATP-binding protein >Feature sequence0671 401 174 gene locus_tag LOCUS_14860 401 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1284 385 gene locus_tag LOCUS_14870 1284 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1462 1307 gene locus_tag LOCUS_14880 1462 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence0672 955 575 gene locus_tag LOCUS_14890 955 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence0673 1368 556 gene locus_tag LOCUS_14900 1368 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1737 1408 gene locus_tag LOCUS_14910 1737 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence0674 <1 1745 gene locus_tag LOCUS_14920 <1 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease >Feature sequence0675 >Feature sequence0676 1241 315 gene locus_tag LOCUS_14930 1241 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0677 875 420 gene locus_tag LOCUS_14940 875 420 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_14940 908 1681 gene locus_tag LOCUS_14950 908 1681 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence0678 22 1395 gene locus_tag LOCUS_14960 22 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence0679 >Feature sequence0680 1388 219 gene locus_tag LOCUS_14970 1388 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1482 1835 gene locus_tag LOCUS_14980 1482 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence0681 742 1044 gene locus_tag LOCUS_14990 742 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1733 1110 gene locus_tag LOCUS_15000 gene ybbC 1733 1110 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0682 972 1565 gene locus_tag LOCUS_15010 gene ruvA 972 1565 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0683 1737 1075 gene locus_tag LOCUS_15020 gene ung 1737 1075 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V6 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0684 118 202 gene locus_tag LOCUS_t00140 118 202 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0685 592 125 gene locus_tag LOCUS_15030 592 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_15030 <1830 618 gene locus_tag LOCUS_15040 <1830 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963149.1:peptidase M1 >Feature sequence0686 1693 422 gene locus_tag LOCUS_15050 gene phrB3 1693 422 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence0687 <1 1459 gene locus_tag LOCUS_15060 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704676.1:peptidase M16 >Feature sequence0688 <1 908 gene locus_tag LOCUS_15070 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963604.1:DUF4856 domain-containing protein >Feature sequence0689 92 643 gene locus_tag LOCUS_15080 gene rplF 92 643 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_15080 652 996 gene locus_tag LOCUS_15090 gene rplR 652 996 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1V8 protein_id gnl|my_center|LOCUS_15090 1003 1518 gene locus_tag LOCUS_15100 gene rpsE 1003 1518 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_15100 1523 1702 gene locus_tag LOCUS_15110 gene rpmD 1523 1702 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J24 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0690 1316 426 gene locus_tag LOCUS_15120 1316 426 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence0691 <1814 927 gene locus_tag LOCUS_15130 <1814 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787751.1:ABC transporter permease >Feature sequence0692 687 1670 gene locus_tag LOCUS_15140 687 1670 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence0693 371 87 gene locus_tag LOCUS_15150 gene groS 371 87 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_15150 651 1364 gene locus_tag LOCUS_15160 651 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence0694 <1808 1107 gene locus_tag LOCUS_15170 <1808 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NU8:methylenetetrahydrofolate reductase >Feature sequence0695 273 974 gene locus_tag LOCUS_15180 273 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence0696 1666 1058 gene locus_tag LOCUS_15190 1666 1058 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence0697 1666 11 gene locus_tag LOCUS_15200 1666 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence0698 <1 1366 gene locus_tag LOCUS_15210 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase >Feature sequence0699 524 1555 gene locus_tag LOCUS_15220 gene cobT 524 1555 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0700 1106 543 gene locus_tag LOCUS_15230 1106 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1615 1112 gene locus_tag LOCUS_15240 1615 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0701 1305 622 gene locus_tag LOCUS_15250 1305 622 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence0702 >Feature sequence0703 1012 143 gene locus_tag LOCUS_15260 1012 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707077.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence0704 7 1533 gene locus_tag LOCUS_15270 7 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0705 >Feature sequence0706 >Feature sequence0707 <1 1586 gene locus_tag LOCUS_15280 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:restriction endonuclease subunit M >Feature sequence0708 <1 1680 gene locus_tag LOCUS_15290 <1 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202810.1:membrane protein >Feature sequence0709 >Feature sequence0710 844 113 gene locus_tag LOCUS_15300 gene kdsB 844 113 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_15300 <1786 844 gene locus_tag LOCUS_15310 <1786 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEB1:8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase >Feature sequence0711 1671 103 gene locus_tag LOCUS_15320 gene aldH 1671 103 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence0712 368 844 gene locus_tag LOCUS_15330 368 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_15330 889 1560 gene locus_tag LOCUS_15340 gene msrA 889 1560 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_15340 >Feature sequence0713 >Feature sequence0714 >Feature sequence0715 830 267 gene locus_tag LOCUS_15350 830 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_15350 1612 827 gene locus_tag LOCUS_15360 1612 827 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence0716 >Feature sequence0717 884 267 gene locus_tag LOCUS_15370 gene gacA.2 884 267 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768956.1 protein_id gnl|my_center|LOCUS_15370 <1773 1130 gene locus_tag LOCUS_15380 <1773 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202497.1:membrane protein >Feature sequence0718 >Feature sequence0719 821 522 gene locus_tag LOCUS_15390 821 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1045 806 gene locus_tag LOCUS_15400 1045 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1753 1055 gene locus_tag LOCUS_15410 1753 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0720 <1 561 gene locus_tag LOCUS_15420 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:TonB-dependent receptor >Feature sequence0721 >Feature sequence0722 810 115 gene locus_tag LOCUS_15430 810 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532133.1 protein_id gnl|my_center|LOCUS_15430 <1766 1093 gene locus_tag LOCUS_15440 <1766 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337624.1:sodium:calcium antiporter >Feature sequence0723 >Feature sequence0724 931 62 gene locus_tag LOCUS_15450 931 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1040 1273 gene locus_tag LOCUS_15460 1040 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1273 1584 gene locus_tag LOCUS_15470 1273 1584 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence0725 1041 1538 gene locus_tag LOCUS_15480 1041 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0726 >Feature sequence0727 294 112 gene locus_tag LOCUS_15490 294 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1158 412 gene locus_tag LOCUS_15500 1158 412 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_15500 1715 1224 gene locus_tag LOCUS_15510 1715 1224 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0728 1149 403 gene locus_tag LOCUS_15520 1149 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1595 1221 gene locus_tag LOCUS_15530 1595 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence0729 1499 1008 gene locus_tag LOCUS_15540 1499 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1744 1502 gene locus_tag LOCUS_15550 1744 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0730 1748 678 gene locus_tag LOCUS_15560 1748 678 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_15560 >Feature sequence0731 241 495 gene locus_tag LOCUS_15570 241 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 505 1401 gene locus_tag LOCUS_15580 505 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0732 >Feature sequence0733 249 1349 gene locus_tag LOCUS_15590 249 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence0734 <1 1197 gene locus_tag LOCUS_15600 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403563.1:amidohydrolase >Feature sequence0735 >Feature sequence0736 >Feature sequence0737 68 592 gene locus_tag LOCUS_15610 68 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 <1743 651 gene locus_tag LOCUS_15620 <1743 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963881.1:aspartate aminotransferase family protein >Feature sequence0738 1601 576 gene locus_tag LOCUS_15630 gene aroB 1601 576 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence0739 113 745 gene locus_tag LOCUS_15640 113 745 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0740 226 53 gene locus_tag LOCUS_15650 226 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_15650 343 1014 gene locus_tag LOCUS_15660 343 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence0741 >Feature sequence0742 1714 527 gene locus_tag LOCUS_15670 1714 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0743 1706 948 gene locus_tag LOCUS_15680 1706 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0744 1698 1405 gene locus_tag LOCUS_15690 1698 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence0745 >Feature sequence0746 1567 11 gene locus_tag LOCUS_15700 1567 11 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence0747 714 70 gene locus_tag LOCUS_15710 714 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0748 803 42 gene locus_tag LOCUS_15720 gene panC 803 42 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0749 >Feature sequence0750 <1 1682 gene locus_tag LOCUS_15730 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140483.1:fused response regulator/thioredoxin-disulfide reductase >Feature sequence0751 >Feature sequence0752 >Feature sequence0753 <1 1259 gene locus_tag LOCUS_15740 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence0754 772 107 gene locus_tag LOCUS_15750 772 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence0755 1223 411 gene locus_tag LOCUS_15760 1223 411 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0756 <1712 238 gene locus_tag LOCUS_15770 <1712 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962273.1:succinate dehydrogenase >Feature sequence0757 >Feature sequence0758 >Feature sequence0759 <1 1405 gene locus_tag LOCUS_15780 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P05656:levanase >Feature sequence0760 1196 831 gene locus_tag LOCUS_15790 1196 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0761 <1711 64 gene locus_tag LOCUS_15800 <1711 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459131.1:histidine kinase >Feature sequence0762 1 354 gene locus_tag LOCUS_15810 1 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 344 1120 gene locus_tag LOCUS_15820 344 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence0763 <1709 361 gene locus_tag LOCUS_15830 <1709 361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEB3:NADH-quinone oxidoreductase subunit N >Feature sequence0764 >Feature sequence0765 >Feature sequence0766 8 1351 gene locus_tag LOCUS_15840 8 1351 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence0767 <1700 789 gene locus_tag LOCUS_15850 <1700 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121855.1:manganese transporter >Feature sequence0768 >Feature sequence0769 1421 924 gene locus_tag LOCUS_15860 1421 924 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence0770 <1697 1059 gene locus_tag LOCUS_15870 <1697 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0771 <1697 1186 gene locus_tag LOCUS_15880 <1697 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MG9:prolipoprotein diacylglyceryl transferase >Feature sequence0772 >Feature sequence0773 <1 570 gene locus_tag LOCUS_15890 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962589.1:transporter >Feature sequence0774 1692 943 gene locus_tag LOCUS_15900 1692 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0775 491 820 gene locus_tag LOCUS_15910 491 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0776 1606 1046 gene locus_tag LOCUS_15920 1606 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence0777 <1687 755 gene locus_tag LOCUS_15930 <1687 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence0778 1438 623 gene locus_tag LOCUS_15940 1438 623 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0779 <1 869 gene locus_tag LOCUS_15950 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:membrane protein >Feature sequence0780 522 151 gene locus_tag LOCUS_15960 522 151 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_15960 1134 562 gene locus_tag LOCUS_15970 1134 562 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence0781 >Feature sequence0782 <1 1080 gene locus_tag LOCUS_15980 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZG0:ribonuclease Y >Feature sequence0783 >Feature sequence0784 330 581 gene locus_tag LOCUS_15990 gene rpsR 330 581 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_15990 604 1047 gene locus_tag LOCUS_16000 gene rplI 604 1047 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_16000 >Feature sequence0785 >Feature sequence0786 >Feature sequence0787 1356 688 gene locus_tag LOCUS_16010 1356 688 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_16010 1676 1353 gene locus_tag LOCUS_16020 1676 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence0788 877 305 gene locus_tag LOCUS_16030 877 305 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_16030 <1678 849 gene locus_tag LOCUS_16040 <1678 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887074.1:ATPase >Feature sequence0789 <1677 432 gene locus_tag LOCUS_16050 <1677 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963860.1:antirepressor >Feature sequence0790 656 249 gene locus_tag LOCUS_16060 gene ygcM 656 249 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0791 854 366 gene locus_tag LOCUS_16070 854 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1338 985 gene locus_tag LOCUS_16080 1338 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence0792 1218 79 gene locus_tag LOCUS_16090 1218 79 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence0793 <1670 201 gene locus_tag LOCUS_16100 <1670 201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase >Feature sequence0794 >Feature sequence0795 470 234 gene locus_tag LOCUS_16110 470 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1044 445 gene locus_tag LOCUS_16120 1044 445 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0796 868 374 gene locus_tag LOCUS_16130 868 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1330 887 gene locus_tag LOCUS_16140 1330 887 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence0797 273 1544 gene locus_tag LOCUS_16150 gene fahA 273 1544 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence0798 >Feature sequence0799 <1665 624 gene locus_tag LOCUS_16160 <1665 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964304.1:agmatinase >Feature sequence0800 >Feature sequence0801 >Feature sequence0802 166 1173 gene locus_tag LOCUS_16170 166 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0803 215 655 gene locus_tag LOCUS_16180 215 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence0804 1 147 gene locus_tag LOCUS_16190 1 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 206 1018 gene locus_tag LOCUS_16200 206 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1015 1626 gene locus_tag LOCUS_16210 gene ubiE 1015 1626 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence0805 <1 809 gene locus_tag LOCUS_16220 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZS0:CRISPR-associated endonuclease Cas1 806 1144 gene locus_tag LOCUS_16230 gene cas2 806 1144 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_16230 1286 1651 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcttctaagatacaatttgaaagctagtcacaac >Feature sequence0806 212 1243 gene locus_tag LOCUS_16240 212 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0807 54 440 gene locus_tag LOCUS_16250 54 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 534 1037 gene locus_tag LOCUS_16260 534 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence0808 44 283 gene locus_tag LOCUS_16270 gene acpP 44 283 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_16270 305 1555 gene locus_tag LOCUS_16280 gene fabF 305 1555 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_16280 >Feature sequence0809 >Feature sequence0810 577 741 gene locus_tag LOCUS_16290 577 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0811 >Feature sequence0812 >Feature sequence0813 1212 763 gene locus_tag LOCUS_16300 1212 763 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_16300 1647 1216 gene locus_tag LOCUS_16310 1647 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence0814 2 754 gene locus_tag LOCUS_16320 2 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1419 1063 gene locus_tag LOCUS_16330 1419 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence0815 1076 1492 gene locus_tag LOCUS_16340 1076 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0816 1071 250 gene locus_tag LOCUS_16350 1071 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 protein_id gnl|my_center|LOCUS_16350 <1627 1074 gene locus_tag LOCUS_16360 <1627 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142702.1:RNA polymerase >Feature sequence0817 <1 1114 gene locus_tag LOCUS_16370 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0818 124 924 gene locus_tag LOCUS_16380 124 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 <1621 921 gene locus_tag LOCUS_16390 <1621 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098476.1:transcriptional regulator FhlA >Feature sequence0819 964 215 gene locus_tag LOCUS_16400 964 215 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence0820 1034 1432 gene locus_tag LOCUS_16410 1034 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence0821 <1 1180 gene locus_tag LOCUS_16420 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66766:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence0822 259 1041 gene locus_tag LOCUS_16430 259 1041 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence0823 >Feature sequence0824 <1617 694 gene locus_tag LOCUS_16440 <1617 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787151.1:TonB-dependent receptor >Feature sequence0825 1293 595 gene locus_tag LOCUS_16450 1293 595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence0826 263 1351 gene locus_tag LOCUS_16460 263 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence0827 1473 199 gene locus_tag LOCUS_16470 1473 199 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0828 461 237 gene locus_tag LOCUS_16480 461 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 <1606 473 gene locus_tag LOCUS_16490 <1606 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A4T0:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) >Feature sequence0829 >Feature sequence0830 954 169 gene locus_tag LOCUS_16500 954 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence0831 >Feature sequence0832 >Feature sequence0833 >Feature sequence0834 >Feature sequence0835 >Feature sequence0836 >Feature sequence0837 >Feature sequence0838 525 136 gene locus_tag LOCUS_16510 525 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1160 531 gene locus_tag LOCUS_16520 1160 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0839 91 1008 gene locus_tag LOCUS_16530 gene cobW 91 1008 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044933.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence0840 <1594 394 gene locus_tag LOCUS_16540 <1594 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203505.1:LruC domain-containing protein >Feature sequence0841 337 1329 gene locus_tag LOCUS_16550 337 1329 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence0842 1419 67 gene locus_tag LOCUS_16560 1419 67 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_16560 1542 1460 gene locus_tag LOCUS_t00150 1542 1460 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0843 >Feature sequence0844 >Feature sequence0845 1336 500 gene locus_tag LOCUS_16570 1336 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0846 909 283 gene locus_tag LOCUS_16580 909 283 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_16580 1448 906 gene locus_tag LOCUS_16590 gene ftnA 1448 906 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0847 >Feature sequence0848 >Feature sequence0849 486 698 gene locus_tag LOCUS_16600 486 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 691 1503 gene locus_tag LOCUS_16610 691 1503 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_16610 >Feature sequence0850 >Feature sequence0851 759 559 gene locus_tag LOCUS_16620 759 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0852 759 406 gene locus_tag LOCUS_16630 759 406 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_16630 <1576 863 gene locus_tag LOCUS_16640 <1576 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962636.1:universal stress protein UspA >Feature sequence0853 <1575 486 gene locus_tag LOCUS_16650 <1575 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403494.1:multidrug resistance protein >Feature sequence0854 >Feature sequence0855 >Feature sequence0856 >Feature sequence0857 86 1159 gene locus_tag LOCUS_16660 gene prfA 86 1159 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_16660 >Feature sequence0858 1389 1544 gene locus_tag LOCUS_16670 1389 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence0859 >Feature sequence0860 1190 252 gene locus_tag LOCUS_16680 1190 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0861 3 1229 gene locus_tag LOCUS_16690 3 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence0862 >Feature sequence0863 >Feature sequence0864 >Feature sequence0865 309 133 gene locus_tag LOCUS_16700 309 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1548 409 gene locus_tag LOCUS_16710 1548 409 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence0866 181 651 gene locus_tag LOCUS_16720 gene rimP 181 651 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_16720 >Feature sequence0867 652 14 gene locus_tag LOCUS_16730 652 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1461 673 gene locus_tag LOCUS_16740 1461 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0868 >Feature sequence0869 766 107 gene locus_tag LOCUS_16750 766 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 765 1364 gene locus_tag LOCUS_16760 765 1364 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 >Feature sequence0873 184 594 gene locus_tag LOCUS_16770 184 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 784 1212 gene locus_tag LOCUS_16780 784 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence0874 462 1472 gene locus_tag LOCUS_16790 462 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence0875 <1 1077 gene locus_tag LOCUS_16800 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54354:3-isopropylmalate dehydrogenase >Feature sequence0876 >Feature sequence0877 1542 700 gene locus_tag LOCUS_16810 1542 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence0878 <1 1025 gene locus_tag LOCUS_16820 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEP3:chaperone protein DnaK >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 >Feature sequence0882 1 939 gene locus_tag LOCUS_16830 gene pdhB 1 939 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_16830 993 1490 gene locus_tag LOCUS_16840 993 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence0883 >Feature sequence0884 <1534 899 gene locus_tag LOCUS_16850 <1534 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964438.1:two-component sensor histidine kinase >Feature sequence0885 284 1522 gene locus_tag LOCUS_16860 284 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence0886 >Feature sequence0887 2 337 gene locus_tag LOCUS_16870 2 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 327 812 gene locus_tag LOCUS_16880 327 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0888 >Feature sequence0889 >Feature sequence0890 >Feature sequence0891 >Feature sequence0892 227 1255 gene locus_tag LOCUS_16890 227 1255 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence0893 331 1296 gene locus_tag LOCUS_16900 331 1296 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence0894 1237 1165 gene locus_tag LOCUS_t00160 1237 1165 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0895 417 1082 gene locus_tag LOCUS_16910 417 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence0896 <1 998 gene locus_tag LOCUS_16920 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931920.1:UDP-glucose/GDP-mannose dehydrogenase >Feature sequence0897 555 1472 gene locus_tag LOCUS_16930 gene miaA1 555 1472 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_16930 >Feature sequence0898 >Feature sequence0899 953 165 gene locus_tag LOCUS_16940 953 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence0900 336 1448 gene locus_tag LOCUS_16950 336 1448 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence0901 <1 962 gene locus_tag LOCUS_16960 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962525.1:cystathionine beta-lyase >Feature sequence0902 >Feature sequence0903 1099 467 gene locus_tag LOCUS_16970 gene sodA 1099 467 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_16970 >Feature sequence0904 339 202 gene locus_tag LOCUS_16980 339 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 <1511 401 gene locus_tag LOCUS_16990 <1511 401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963925.1:DEAD/DEAH box helicase >Feature sequence0905 <1509 270 gene locus_tag LOCUS_17000 <1509 270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor >Feature sequence0906 >Feature sequence0907 727 248 gene locus_tag LOCUS_17010 727 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1322 777 gene locus_tag LOCUS_17020 1322 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence0908 <1 1034 gene locus_tag LOCUS_17030 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211395.1:4-hydroxybutyrate CoA-transferase >Feature sequence0909 208 918 gene locus_tag LOCUS_17040 208 918 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0910 <1 1171 gene locus_tag LOCUS_17050 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785125.1:phosphohydrolase >Feature sequence0911 >Feature sequence0912 <1 542 gene locus_tag LOCUS_17060 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase 539 976 gene locus_tag LOCUS_17070 539 976 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence0913 >Feature sequence0914 <1 666 gene locus_tag LOCUS_17080 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480118.1:oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB 672 1049 gene locus_tag LOCUS_17090 672 1049 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence0915 282 524 gene locus_tag LOCUS_17100 282 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0916 >Feature sequence0917 <1 1029 gene locus_tag LOCUS_17110 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H128:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1029 1286 gene locus_tag LOCUS_17120 1029 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence0918 <1 1319 gene locus_tag LOCUS_17130 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791956.1:GTP-binding protein >Feature sequence0919 267 707 gene locus_tag LOCUS_17140 267 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 <1497 916 gene locus_tag LOCUS_17150 <1497 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0920 3 722 gene locus_tag LOCUS_17160 3 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1255 734 gene locus_tag LOCUS_17170 gene aroK 1255 734 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_17170 >Feature sequence0921 358 1491 gene locus_tag LOCUS_17180 358 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0922 >Feature sequence0923 412 1293 gene locus_tag LOCUS_17190 412 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1439 1290 gene locus_tag LOCUS_17200 1439 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0924 >Feature sequence0925 <1 1081 gene locus_tag LOCUS_17210 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H195:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase >Feature sequence0926 >Feature sequence0927 408 728 gene locus_tag LOCUS_17220 408 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1482 1018 gene locus_tag LOCUS_17230 1482 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0928 <1481 839 gene locus_tag LOCUS_17240 <1481 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SC0:UPF0246 protein >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 1305 364 gene locus_tag LOCUS_17250 1305 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence0932 >Feature sequence0933 1 372 gene locus_tag LOCUS_17260 1 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0934 892 128 gene locus_tag LOCUS_17270 gene mapB 892 128 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0935 >Feature sequence0936 1312 581 gene locus_tag LOCUS_17280 1312 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0937 1 909 gene locus_tag LOCUS_17290 1 909 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence0938 1345 833 gene locus_tag LOCUS_17300 1345 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence0939 102 800 gene locus_tag LOCUS_17310 102 800 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_17310 846 1418 gene locus_tag LOCUS_17320 846 1418 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence0940 <1 1442 gene locus_tag LOCUS_17330 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease >Feature sequence0941 >Feature sequence0942 847 659 gene locus_tag LOCUS_17340 847 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 >Feature sequence0946 <1 899 gene locus_tag LOCUS_17350 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H296:bifunctional purine biosynthesis protein PurH >Feature sequence0947 >Feature sequence0948 710 240 gene locus_tag LOCUS_17360 gene smpB 710 240 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_17360 1104 700 gene locus_tag LOCUS_17370 1104 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0949 >Feature sequence0950 524 1045 gene locus_tag LOCUS_17380 524 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0951 <1 1282 gene locus_tag LOCUS_17390 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB2:tRNA modification GTPase MnmE >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 <1 608 gene locus_tag LOCUS_17400 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962235.1:haloacid dehalogenase 616 1086 gene locus_tag LOCUS_17410 616 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0955 1176 592 gene locus_tag LOCUS_17420 1176 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0956 405 764 gene locus_tag LOCUS_17430 405 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0957 525 331 gene locus_tag LOCUS_17440 525 331 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_17440 <1444 547 gene locus_tag LOCUS_17450 <1444 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963288.1:endonuclease >Feature sequence0958 >Feature sequence0959 <1 648 gene locus_tag LOCUS_17460 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964122.1:ABC transporter permease 716 1099 gene locus_tag LOCUS_17470 716 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0960 >Feature sequence0961 894 472 gene locus_tag LOCUS_17480 894 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence0962 421 1221 gene locus_tag LOCUS_17490 421 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0963 >Feature sequence0964 532 1062 gene locus_tag LOCUS_17500 gene haaO 532 1062 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_17500 >Feature sequence0965 <1 741 gene locus_tag LOCUS_17510 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918774.1:peptidase M28 <1437 774 gene locus_tag LOCUS_17520 <1437 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932675.1:3-beta hydroxysteroid dehydrogenase >Feature sequence0966 486 1268 gene locus_tag LOCUS_17530 486 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0967 1186 551 gene locus_tag LOCUS_17540 gene sdhC 1186 551 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence0968 >Feature sequence0969 245 991 gene locus_tag LOCUS_17550 245 991 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0970 226 702 gene locus_tag LOCUS_17560 gene ispF 226 702 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y7 protein_id gnl|my_center|LOCUS_17560 703 1383 gene locus_tag LOCUS_17570 703 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence0971 >Feature sequence0972 1088 105 gene locus_tag LOCUS_17580 1088 105 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0973 <1428 286 gene locus_tag LOCUS_17590 <1428 286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769220.1:penicillin-binding protein >Feature sequence0974 1266 571 gene locus_tag LOCUS_17600 1266 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence0975 70 366 gene locus_tag LOCUS_17610 70 366 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_17610 1143 367 gene locus_tag LOCUS_17620 1143 367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0976 1235 456 gene locus_tag LOCUS_17630 gene nqrC 1235 456 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_17630 >Feature sequence0977 80 319 gene locus_tag LOCUS_17640 80 319 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0978 <1 884 gene locus_tag LOCUS_17650 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000671775.1:alkaline phosphatase >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 318 641 gene locus_tag LOCUS_17660 318 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44075 protein_id gnl|my_center|LOCUS_17660 >Feature sequence0982 >Feature sequence0983 196 723 gene locus_tag LOCUS_17670 196 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence0984 <1410 804 gene locus_tag LOCUS_17680 <1410 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963350.1:peptidoglycan endopeptidase >Feature sequence0985 126 1031 gene locus_tag LOCUS_17690 126 1031 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence0986 674 90 gene locus_tag LOCUS_17700 674 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence0987 <1 804 gene locus_tag LOCUS_17710 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760507.1:membrane protein >Feature sequence0988 <1 705 gene locus_tag LOCUS_17720 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203499.1:histidine kinase >Feature sequence0989 1281 670 gene locus_tag LOCUS_17730 1281 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0990 <1 1147 gene locus_tag LOCUS_17740 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence0991 >Feature sequence0992 <1 1092 gene locus_tag LOCUS_17750 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:two-component system response regulator >Feature sequence0993 >Feature sequence0994 <1 1362 gene locus_tag LOCUS_17760 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963148.1:peptidase S41 >Feature sequence0995 >Feature sequence0996 <1 1179 gene locus_tag LOCUS_17770 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PY9:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence0997 857 1078 gene locus_tag LOCUS_17780 857 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 >Feature sequence1001 511 1140 gene locus_tag LOCUS_17790 511 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence1002 >Feature sequence1003 958 422 gene locus_tag LOCUS_17800 958 422 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence1004 >Feature sequence1005 244 1011 gene locus_tag LOCUS_17810 244 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence1006 196 1098 gene locus_tag LOCUS_17820 196 1098 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence1007 <1 935 gene locus_tag LOCUS_17830 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786936.1:membrane protein >Feature sequence1008 >Feature sequence1009 >Feature sequence1010 127 585 gene locus_tag LOCUS_17840 127 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17840 862 1155 gene locus_tag LOCUS_17850 862 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17850 >Feature sequence1011 991 242 gene locus_tag LOCUS_17860 991 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence1012 >Feature sequence1013 624 1223 gene locus_tag LOCUS_17870 624 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence1014 >Feature sequence1015 982 335 gene locus_tag LOCUS_17880 982 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence1016 761 129 gene locus_tag LOCUS_17890 761 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence1017 743 240 gene locus_tag LOCUS_17900 743 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 <1368 789 gene locus_tag LOCUS_17910 <1368 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861584.1:AraC family transcriptional regulator >Feature sequence1018 >Feature sequence1019 <1368 320 gene locus_tag LOCUS_17920 <1368 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease >Feature sequence1020 492 1070 gene locus_tag LOCUS_17930 492 1070 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence1021 691 1218 gene locus_tag LOCUS_17940 691 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence1022 <1 1218 gene locus_tag LOCUS_17950 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404072.1:peptidase S9 >Feature sequence1023 1073 501 gene locus_tag LOCUS_17960 1073 501 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence1024 <1 584 gene locus_tag LOCUS_17970 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814856.1:membrane protein 1182 568 gene locus_tag LOCUS_17980 1182 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence1025 1357 137 gene locus_tag LOCUS_17990 1357 137 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence1026 >Feature sequence1027 <1361 98 gene locus_tag LOCUS_18000 <1361 98 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814920.1:sugar transporter >Feature sequence1028 >Feature sequence1029 >Feature sequence1030 >Feature sequence1031 739 335 gene locus_tag LOCUS_18010 739 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 <1 628 gene locus_tag LOCUS_18020 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence1035 >Feature sequence1036 92 778 gene locus_tag LOCUS_18030 gene phoP 92 778 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence1037 438 1193 gene locus_tag LOCUS_18040 438 1193 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence1038 <1 527 gene locus_tag LOCUS_18050 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962590.1:biotin attachment protein >Feature sequence1039 160 978 gene locus_tag LOCUS_18060 160 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence1040 >Feature sequence1041 <1338 229 gene locus_tag LOCUS_18070 <1338 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964498.1:tetracycline resistance MFS efflux pump >Feature sequence1042 >Feature sequence1043 691 1107 gene locus_tag LOCUS_18080 691 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence1044 >Feature sequence1045 390 998 gene locus_tag LOCUS_18090 gene sigW 390 998 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_18090 >Feature sequence1046 >Feature sequence1047 <1 906 gene locus_tag LOCUS_18100 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038867.1:N-acyl-L-amino acid amidohydrolase >Feature sequence1048 >Feature sequence1049 >Feature sequence1050 >Feature sequence1051 >Feature sequence1052 <1 523 gene locus_tag LOCUS_18110 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403194.1:DNA-binding response regulator 523 1110 gene locus_tag LOCUS_18120 523 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence1053 493 951 gene locus_tag LOCUS_18130 493 951 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence1054 394 873 gene locus_tag LOCUS_18140 394 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence1055 >Feature sequence1056 468 749 gene locus_tag LOCUS_18150 468 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_18150 <1317 782 gene locus_tag LOCUS_18160 <1317 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404038.1:amino acid transporter >Feature sequence1057 330 193 gene locus_tag LOCUS_18170 330 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1004 330 gene locus_tag LOCUS_18180 1004 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence1058 576 4 gene locus_tag LOCUS_18190 576 4 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence1059 1248 772 gene locus_tag LOCUS_18200 1248 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence1060 1166 282 gene locus_tag LOCUS_18210 1166 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence1061 >Feature sequence1062 <1 583 gene locus_tag LOCUS_18220 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase 630 1205 gene locus_tag LOCUS_18230 630 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence1063 257 853 gene locus_tag LOCUS_18240 257 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1311 850 gene locus_tag LOCUS_18250 1311 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence1064 775 11 gene locus_tag LOCUS_18260 775 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence1065 <1 835 gene locus_tag LOCUS_18270 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence1066 74 373 gene locus_tag LOCUS_18280 74 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence1067 >Feature sequence1068 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 483 926 gene locus_tag LOCUS_18290 483 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence1072 <1301 355 gene locus_tag LOCUS_18300 <1301 355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW3:aminomethyltransferase >Feature sequence1073 <1301 346 gene locus_tag LOCUS_18310 <1301 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920401.1:aminopeptidase >Feature sequence1074 >Feature sequence1075 1205 657 gene locus_tag LOCUS_18320 1205 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence1076 1086 640 gene locus_tag LOCUS_18330 1086 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence1077 >Feature sequence1078 1217 342 gene locus_tag LOCUS_18340 1217 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence1079 3 692 gene locus_tag LOCUS_18350 gene radC 3 692 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence1080 >Feature sequence1081 462 950 gene locus_tag LOCUS_18360 462 950 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767822.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 >Feature sequence1085 <1 799 gene locus_tag LOCUS_18370 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108354.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1086 >Feature sequence1087 513 1094 gene locus_tag LOCUS_18380 gene hisH 513 1094 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_18380 >Feature sequence1088 >Feature sequence1089 148 279 gene locus_tag LOCUS_18390 148 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 929 327 gene locus_tag LOCUS_18400 929 327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence1090 <1 843 gene locus_tag LOCUS_18410 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769257.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1091 >Feature sequence1092 799 209 gene locus_tag LOCUS_18420 gene engB 799 209 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_18420 >Feature sequence1093 >Feature sequence1094 <1 1021 gene locus_tag LOCUS_18430 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964480.1:Fe-S cluster assembly protein SufD >Feature sequence1095 >Feature sequence1096 380 766 gene locus_tag LOCUS_18440 380 766 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence1097 606 241 gene locus_tag LOCUS_18450 606 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 protein_id gnl|my_center|LOCUS_18450 <1264 609 gene locus_tag LOCUS_18460 <1264 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047983.1:glycerophosphoryl diester phosphodiesterase >Feature sequence1098 206 382 gene locus_tag LOCUS_18470 206 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence1099 239 460 gene locus_tag LOCUS_18480 239 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence1100 1060 383 gene locus_tag LOCUS_18490 1060 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence1101 944 417 gene locus_tag LOCUS_18500 944 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence1102 >Feature sequence1103 >Feature sequence1104 >Feature sequence1105 >Feature sequence1106 1024 239 gene locus_tag LOCUS_18510 1024 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence1107 1094 438 gene locus_tag LOCUS_18520 1094 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence1108 551 838 gene locus_tag LOCUS_18530 551 838 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence1109 >Feature sequence1110 323 982 gene locus_tag LOCUS_18540 323 982 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence1111 257 940 gene locus_tag LOCUS_18550 257 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence1112 675 121 gene locus_tag LOCUS_18560 675 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence1113 >Feature sequence1114 >Feature sequence1115 >Feature sequence1116 457 155 gene locus_tag LOCUS_18570 457 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence1117 >Feature sequence1118 >Feature sequence1119 >Feature sequence1120 >Feature sequence1121 >Feature sequence1122 976 281 gene locus_tag LOCUS_18580 976 281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence1123 <1 701 gene locus_tag LOCUS_18590 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RE9:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence1124 >Feature sequence1125 >Feature sequence1126 <1233 626 gene locus_tag LOCUS_18600 <1233 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence1127 136 1164 gene locus_tag LOCUS_18610 136 1164 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence1128 <1 715 gene locus_tag LOCUS_18620 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGW0:hemin import ATP-binding protein HmuV >Feature sequence1129 >Feature sequence1130 <1 839 gene locus_tag LOCUS_18630 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ5:DNA helicase >Feature sequence1131 <1227 692 gene locus_tag LOCUS_18640 <1227 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104643.1:alanine racemase >Feature sequence1132 >Feature sequence1133 486 815 gene locus_tag LOCUS_18650 486 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence1134 354 16 gene locus_tag LOCUS_18660 354 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 978 526 gene locus_tag LOCUS_18670 978 526 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186556.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 88 666 gene locus_tag LOCUS_18680 88 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence1138 109 1020 gene locus_tag LOCUS_18690 gene mntA 109 1020 CDS product manganese-binding lipoprotein MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34385 protein_id gnl|my_center|LOCUS_18690 >Feature sequence1139 <1220 65 gene locus_tag LOCUS_18700 <1220 65 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884049.1:ABC transporter permease >Feature sequence1140 >Feature sequence1141 >Feature sequence1142 >Feature sequence1143 <1 728 gene locus_tag LOCUS_18710 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272562.1:radical SAM/Cys-rich domain protein >Feature sequence1144 <1217 491 gene locus_tag LOCUS_18720 <1217 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001012068.1:2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase >Feature sequence1145 >Feature sequence1146 1215 1054 gene locus_tag LOCUS_18730 1215 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence1147 644 249 gene locus_tag LOCUS_18740 644 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18740 >Feature sequence1148 262 915 gene locus_tag LOCUS_18750 262 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence1149 203 538 gene locus_tag LOCUS_18760 203 538 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence1150 <1210 514 gene locus_tag LOCUS_18770 <1210 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107418.1:DNA-binding response regulator >Feature sequence1151 >Feature sequence1152 >Feature sequence1153 >Feature sequence1154 3 314 gene locus_tag LOCUS_18780 3 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence1155 >Feature sequence1156 >Feature sequence1157 >Feature sequence1158 >Feature sequence1159 >Feature sequence1160 >Feature sequence1161 679 134 gene locus_tag LOCUS_18790 679 134 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence1162 <1 796 gene locus_tag LOCUS_18800 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036051.1:glucose-fructose oxidoreductase >Feature sequence1163 >Feature sequence1164 701 892 gene locus_tag LOCUS_18810 gene yjbJ 701 892 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence1165 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 346 125 gene locus_tag LOCUS_18820 346 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 493 1146 gene locus_tag LOCUS_18830 493 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence1169 <1 1083 gene locus_tag LOCUS_18840 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783728.1:membrane protein >Feature sequence1170 1065 373 gene locus_tag LOCUS_18850 1065 373 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence1171 763 8 gene locus_tag LOCUS_18860 763 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence1172 999 742 gene locus_tag LOCUS_18870 999 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence1173 >Feature sequence1174 275 904 gene locus_tag LOCUS_18880 275 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence1175 <1187 196 gene locus_tag LOCUS_18890 <1187 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence1176 >Feature sequence1177 320 859 gene locus_tag LOCUS_18900 320 859 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence1178 >Feature sequence1179 <1 581 gene locus_tag LOCUS_18910 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125869.1:C-3',4' desaturase CrtD 622 1161 gene locus_tag LOCUS_18920 622 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence1180 401 871 gene locus_tag LOCUS_18930 401 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence1181 >Feature sequence1182 >Feature sequence1183 >Feature sequence1184 >Feature sequence1185 584 510 gene locus_tag LOCUS_t00170 584 510 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1064 666 gene locus_tag LOCUS_18940 1064 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence1186 <1178 547 gene locus_tag LOCUS_18950 <1178 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0T6:GMP synthase [glutamine-hydrolyzing] >Feature sequence1187 <1 744 gene locus_tag LOCUS_18960 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784757.1:magnesium chelatase subunit I >Feature sequence1188 >Feature sequence1189 665 162 gene locus_tag LOCUS_18970 gene cobU 665 162 CDS product cobinamide kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 protein_id gnl|my_center|LOCUS_18970 1052 669 gene locus_tag LOCUS_18980 1052 669 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence1190 >Feature sequence1191 447 148 gene locus_tag LOCUS_18990 447 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 <1173 590 gene locus_tag LOCUS_19000 <1173 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZI3:signal recognition particle receptor FtsY >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 <1 528 gene locus_tag LOCUS_19010 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261712.1:TetR family transcriptional regulator 586 1152 gene locus_tag LOCUS_19020 586 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence1195 >Feature sequence1196 <1172 388 gene locus_tag LOCUS_19030 <1172 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW00:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence1197 >Feature sequence1198 <1171 310 gene locus_tag LOCUS_19040 <1171 310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057204.1:molybdopterin molybdenumtransferase MoeA >Feature sequence1199 <1 675 gene locus_tag LOCUS_19050 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105061.1:flavodoxin 1169 825 gene locus_tag LOCUS_19060 1169 825 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence1200 <1170 301 gene locus_tag LOCUS_19070 <1170 301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784844.1:lytic transglycosylase >Feature sequence1201 <1170 356 gene locus_tag LOCUS_19080 <1170 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762561.1:LacI family transcriptional regulator >Feature sequence1202 234 563 gene locus_tag LOCUS_19090 234 563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence1203 <1169 370 gene locus_tag LOCUS_19100 <1169 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6Z2:phosphoribosylformylglycinamidine synthase >Feature sequence1204 <1 1012 gene locus_tag LOCUS_19110 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q99YJ8:gamma-glutamyl phosphate reductase >Feature sequence1205 606 1028 gene locus_tag LOCUS_19120 606 1028 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918964.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence1206 <1167 237 gene locus_tag LOCUS_19130 <1167 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118661.1:D-aminoacylase >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 610 38 gene locus_tag LOCUS_19140 610 38 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence1210 >Feature sequence1211 <1163 361 gene locus_tag LOCUS_19150 <1163 361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203288.1:membrane protein >Feature sequence1212 >Feature sequence1213 <1162 81 gene locus_tag LOCUS_19160 <1162 81 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766132.1:solute:sodium symporter family transporter >Feature sequence1214 2 622 gene locus_tag LOCUS_19170 2 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence1215 697 458 gene locus_tag LOCUS_19180 gene rpmB 697 458 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_19180 >Feature sequence1216 <1 883 gene locus_tag LOCUS_19190 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG >Feature sequence1217 >Feature sequence1218 1 372 gene locus_tag LOCUS_19200 1 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 <1157 473 gene locus_tag LOCUS_19210 <1157 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962664.1:membrane protein >Feature sequence1219 >Feature sequence1220 <1 941 gene locus_tag LOCUS_19220 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000427574.1:carboxylate transporter >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 860 399 gene locus_tag LOCUS_19230 860 399 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence1224 <1 1023 gene locus_tag LOCUS_19240 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXJ7:transcription termination factor Rho >Feature sequence1225 288 1055 gene locus_tag LOCUS_19250 288 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence1226 478 44 gene locus_tag LOCUS_19260 478 44 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_19260 784 578 gene locus_tag LOCUS_19270 784 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence1227 1 315 gene locus_tag LOCUS_19280 1 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence1228 >Feature sequence1229 >Feature sequence1230 <1 801 gene locus_tag LOCUS_19290 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943387.1:potassium transporter >Feature sequence1231 >Feature sequence1232 <1148 453 gene locus_tag LOCUS_19300 <1148 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZ68:citrate synthase >Feature sequence1233 836 498 gene locus_tag LOCUS_19310 836 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence1234 >Feature sequence1235 >Feature sequence1236 >Feature sequence1237 <1 525 gene locus_tag LOCUS_19320 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYZ5:Sec-independent protein translocase protein TatC 522 956 gene locus_tag LOCUS_19330 522 956 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence1238 >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 <1 855 gene locus_tag LOCUS_19340 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962544.1:quinol:cytochrome C oxidoreductase >Feature sequence1242 962 435 gene locus_tag LOCUS_19350 962 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence1243 >Feature sequence1244 >Feature sequence1245 >Feature sequence1246 454 1086 gene locus_tag LOCUS_19360 454 1086 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence1247 >Feature sequence1248 >Feature sequence1249 256 837 gene locus_tag LOCUS_19370 256 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence1250 >Feature sequence1251 >Feature sequence1252 >Feature sequence1253 <1 886 gene locus_tag LOCUS_19380 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021346.1:amino acid permease >Feature sequence1254 <1122 196 gene locus_tag LOCUS_19390 <1122 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence1255 >Feature sequence1256 <1 548 gene locus_tag LOCUS_19400 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964527.1:peptidase M23 679 879 gene locus_tag LOCUS_19410 679 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence1257 557 309 gene locus_tag LOCUS_19420 557 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence1258 138 800 gene locus_tag LOCUS_19430 gene atoA 138 800 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence1259 671 183 gene locus_tag LOCUS_19440 671 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119897.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence1260 >Feature sequence1261 >Feature sequence1262 186 998 gene locus_tag LOCUS_19450 186 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence1263 >Feature sequence1264 56 484 gene locus_tag LOCUS_19460 56 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence1265 760 266 gene locus_tag LOCUS_19470 760 266 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124116.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence1266 >Feature sequence1267 >Feature sequence1268 >Feature sequence1269 <1107 147 gene locus_tag LOCUS_19480 <1107 147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H141:DNA replication and repair protein RecF >Feature sequence1270 308 568 gene locus_tag LOCUS_19490 308 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 806 576 gene locus_tag LOCUS_19500 806 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence1271 1064 693 gene locus_tag LOCUS_19510 1064 693 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence1272 >Feature sequence1273 316 1032 gene locus_tag LOCUS_19520 316 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence1274 >Feature sequence1275 74 850 gene locus_tag LOCUS_19530 gene surE 74 850 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_19530 >Feature sequence1276 >Feature sequence1277 1096 305 gene locus_tag LOCUS_19540 gene argB 1096 305 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_19540 >Feature sequence1278 341 688 gene locus_tag LOCUS_19550 341 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence1279 >Feature sequence1280 924 505 gene locus_tag LOCUS_19560 924 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence1281 >Feature sequence1282 >Feature sequence1283 242 805 gene locus_tag LOCUS_19570 gene efp 242 805 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_19570 >Feature sequence1284 >Feature sequence1285 <1094 53 gene locus_tag LOCUS_19580 <1094 53 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481540.1:LruC domain-containing protein >Feature sequence1286 <1 1079 gene locus_tag LOCUS_19590 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein >Feature sequence1287 >Feature sequence1288 >Feature sequence1289 >Feature sequence1290 >Feature sequence1291 >Feature sequence1292 >Feature sequence1293 <1 675 gene locus_tag LOCUS_19600 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2E8:ribonuclease 3 >Feature sequence1294 >Feature sequence1295 692 99 gene locus_tag LOCUS_19610 692 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence1296 >Feature sequence1297 <1086 196 gene locus_tag LOCUS_19620 <1086 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073980.1:membrane protein >Feature sequence1298 >Feature sequence1299 >Feature sequence1300 >Feature sequence1301 1058 180 gene locus_tag LOCUS_19630 1058 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_19630 >Feature sequence1302 >Feature sequence1303 >Feature sequence1304 >Feature sequence1305 >Feature sequence1306 >Feature sequence1307 1017 406 gene locus_tag LOCUS_19640 1017 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence1308 >Feature sequence1309 614 270 gene locus_tag LOCUS_19650 614 270 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_19650 >Feature sequence1310 1006 371 gene locus_tag LOCUS_19660 1006 371 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870298.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence1311 >Feature sequence1312 890 357 gene locus_tag LOCUS_19670 gene actD 890 357 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 >Feature sequence1316 >Feature sequence1317 >Feature sequence1318 >Feature sequence1319 1074 649 gene locus_tag LOCUS_19680 1074 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence1320 >Feature sequence1321 <1 691 gene locus_tag LOCUS_19690 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933114.1:serine protease >Feature sequence1322 >Feature sequence1323 255 785 gene locus_tag LOCUS_19700 255 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence1324 >Feature sequence1325 <1 565 gene locus_tag LOCUS_19710 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963562.1:SAM-dependent methyltransferase >Feature sequence1326 <1 671 gene locus_tag LOCUS_19720 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1L7:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence1327 >Feature sequence1328 787 335 gene locus_tag LOCUS_19730 787 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 >Feature sequence1333 <1062 142 gene locus_tag LOCUS_19740 <1062 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227156.1:membrane protein >Feature sequence1334 <1 634 gene locus_tag LOCUS_19750 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UX42:glutamine--tRNA ligase >Feature sequence1335 1024 602 gene locus_tag LOCUS_19760 1024 602 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence1336 1059 295 gene locus_tag LOCUS_19770 1059 295 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence1337 >Feature sequence1338 287 505 gene locus_tag LOCUS_19780 287 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 563 1021 gene locus_tag LOCUS_19790 563 1021 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence1339 >Feature sequence1340 153 536 gene locus_tag LOCUS_19800 153 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence1341 >Feature sequence1342 >Feature sequence1343 >Feature sequence1344 528 456 gene locus_tag LOCUS_t00180 528 456 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1345 >Feature sequence1346 >Feature sequence1347 2 640 gene locus_tag LOCUS_19810 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence1348 904 65 gene locus_tag LOCUS_19820 904 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence1349 >Feature sequence1350 >Feature sequence1351 946 533 gene locus_tag LOCUS_19830 946 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 >Feature sequence1355 >Feature sequence1356 >Feature sequence1357 <1 1028 gene locus_tag LOCUS_19840 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H070:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence1358 <1 894 gene locus_tag LOCUS_19850 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:ATPase >Feature sequence1359 <1037 311 gene locus_tag LOCUS_19860 <1037 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257690.1:lycopene cyclase >Feature sequence1360 <1037 428 gene locus_tag LOCUS_19870 <1037 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793798.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1361 >Feature sequence1362 <1 1030 gene locus_tag LOCUS_19880 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963276.1:phosphoglucomutase >Feature sequence1363 >Feature sequence1364 <1 1013 gene locus_tag LOCUS_19890 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:RNA-binding transcriptional accessory protein >Feature sequence1365 1030 194 gene locus_tag LOCUS_19900 1030 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence1366 >Feature sequence1367 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 >Feature sequence1371 >Feature sequence1372 606 148 gene locus_tag LOCUS_19910 gene rnhA 606 148 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_19910 >Feature sequence1373 <1 600 gene locus_tag LOCUS_19920 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence1374 <1 765 gene locus_tag LOCUS_19930 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FU73:periplasmic trehalase >Feature sequence1375 >Feature sequence1376 >Feature sequence1377 15 899 gene locus_tag LOCUS_19940 15 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence1378 >Feature sequence1379 >Feature sequence1380 271 981 gene locus_tag LOCUS_19950 271 981 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence1381 120 452 gene locus_tag LOCUS_19960 120 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence1382 >Feature sequence1383 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 108 506 gene locus_tag LOCUS_19970 108 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence1387 <1 708 gene locus_tag LOCUS_19980 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase >Feature sequence1388 <1 545 gene locus_tag LOCUS_19990 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582960.1:group 1 glycosyl transferase >Feature sequence1389 <1011 364 gene locus_tag LOCUS_20000 <1011 364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258015.1:low molecular weight phosphatase family protein >Feature sequence1390 >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 >Feature sequence1394 <1 653 gene locus_tag LOCUS_20010 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168038.1:nicotinamide riboside transporter PnuC >Feature sequence1395 1003 224 gene locus_tag LOCUS_20020 1003 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence1396 >Feature sequence1397 892 167 gene locus_tag LOCUS_20030 gene rsmA 892 167 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_20030 >Feature sequence1398 1003 767 gene locus_tag LOCUS_20040 1003 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence1399 >Feature sequence1400 >Feature sequence1401 184 777 gene locus_tag LOCUS_20050 gene piuC 184 777 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM60 protein_id gnl|my_center|LOCUS_20050