>Feature sequence01 1204 899 gene locus_tag LOCUS_00010 1204 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1364 1439 gene locus_tag LOCUS_t00010 1364 1439 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1464 2021 gene locus_tag LOCUS_00020 1464 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2018 3130 gene locus_tag LOCUS_00030 2018 3130 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5S2 protein_id gnl|my_center|LOCUS_00030 3227 4630 gene locus_tag LOCUS_00040 3227 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4641 5567 gene locus_tag LOCUS_00050 4641 5567 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_00050 6614 6144 gene locus_tag LOCUS_00060 6614 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7123 6608 gene locus_tag LOCUS_00070 7123 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7662 7180 gene locus_tag LOCUS_00080 7662 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7798 8841 gene locus_tag LOCUS_00090 7798 8841 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_00090 8925 10421 gene locus_tag LOCUS_00100 gene ahcY 8925 10421 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_00100 11721 10513 gene locus_tag LOCUS_00110 11721 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12078 11869 gene locus_tag LOCUS_00120 12078 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11974 14376 gene locus_tag LOCUS_00130 11974 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16940 14373 gene locus_tag LOCUS_00140 16940 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17123 18691 gene locus_tag LOCUS_00150 17123 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19181 20134 gene locus_tag LOCUS_00160 19181 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23002 20159 gene locus_tag LOCUS_00170 23002 20159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23413 23063 gene locus_tag LOCUS_00180 23413 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23294 24541 gene locus_tag LOCUS_00190 23294 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24565 26289 gene locus_tag LOCUS_00200 24565 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26306 28057 gene locus_tag LOCUS_00210 26306 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 28026 29690 gene locus_tag LOCUS_00220 28026 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29700 29942 gene locus_tag LOCUS_00230 29700 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29939 30796 gene locus_tag LOCUS_00240 29939 30796 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 30864 33803 gene locus_tag LOCUS_00250 30864 33803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34243 33806 gene locus_tag LOCUS_00260 34243 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971067.1 protein_id gnl|my_center|LOCUS_00260 36015 34504 gene locus_tag LOCUS_00270 36015 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37748 36270 gene locus_tag LOCUS_00280 gene guaB 37748 36270 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEU7 protein_id gnl|my_center|LOCUS_00280 37883 38485 gene locus_tag LOCUS_00290 37883 38485 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_00290 38507 39043 gene locus_tag LOCUS_00300 38507 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40292 39048 gene locus_tag LOCUS_00310 40292 39048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_00310 40393 42627 gene locus_tag LOCUS_00320 40393 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 44030 42804 gene locus_tag LOCUS_00330 44030 42804 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_00330 44627 44034 gene locus_tag LOCUS_00340 44627 44034 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_00340 44729 45727 gene locus_tag LOCUS_00350 gene thrB 44729 45727 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_00350 45731 47068 gene locus_tag LOCUS_00360 45731 47068 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_00360 47130 48767 gene locus_tag LOCUS_00370 47130 48767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 50359 48728 gene locus_tag LOCUS_00380 50359 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 51237 50383 gene locus_tag LOCUS_00390 51237 50383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 51353 51952 gene locus_tag LOCUS_00400 gene pdxH 51353 51952 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_00400 52679 52909 gene locus_tag LOCUS_00410 52679 52909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53685 54266 gene locus_tag LOCUS_00420 53685 54266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 55350 54385 gene locus_tag LOCUS_00430 55350 54385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 59355 55378 gene locus_tag LOCUS_00440 59355 55378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 61729 59609 gene locus_tag LOCUS_00450 61729 59609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 63277 61784 gene locus_tag LOCUS_00460 63277 61784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 63694 63281 gene locus_tag LOCUS_00470 63694 63281 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_00470 64872 63790 gene locus_tag LOCUS_00480 64872 63790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 65837 64893 gene locus_tag LOCUS_00490 65837 64893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 65885 66154 gene locus_tag LOCUS_00500 65885 66154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 66154 69537 gene locus_tag LOCUS_00510 66154 69537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 69550 70596 gene locus_tag LOCUS_00520 69550 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 72847 70640 gene locus_tag LOCUS_00530 72847 70640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 75685 72935 gene locus_tag LOCUS_00540 75685 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00540 75877 76806 gene locus_tag LOCUS_00550 gene pepL 75877 76806 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FHS3 protein_id gnl|my_center|LOCUS_00550 79249 76826 gene locus_tag LOCUS_00560 79249 76826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00560 79441 80034 gene locus_tag LOCUS_00570 79441 80034 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_00570 80027 83170 gene locus_tag LOCUS_00580 80027 83170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 84168 83167 gene locus_tag LOCUS_00590 gene argF 84168 83167 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF9 protein_id gnl|my_center|LOCUS_00590 84274 86775 gene locus_tag LOCUS_00600 84274 86775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 86928 87452 gene locus_tag LOCUS_00610 86928 87452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 87557 88600 gene locus_tag LOCUS_00620 87557 88600 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118844.1 protein_id gnl|my_center|LOCUS_00620 88641 89852 gene locus_tag LOCUS_00630 88641 89852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224220.1 protein_id gnl|my_center|LOCUS_00630 91411 89864 gene locus_tag LOCUS_00640 91411 89864 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_00640 91349 91507 gene locus_tag LOCUS_00650 91349 91507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 91901 92926 gene locus_tag LOCUS_00660 91901 92926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 93845 93279 gene locus_tag LOCUS_00670 93845 93279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 protein_id gnl|my_center|LOCUS_00670 94913 93849 gene locus_tag LOCUS_00680 gene rnz 94913 93849 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXP0 protein_id gnl|my_center|LOCUS_00680 95603 94926 gene locus_tag LOCUS_00690 95603 94926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 104818 95600 gene locus_tag LOCUS_00700 104818 95600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 111846 104815 gene locus_tag LOCUS_00710 111846 104815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 113555 111903 gene locus_tag LOCUS_00720 113555 111903 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_00720 113883 115934 gene locus_tag LOCUS_00730 113883 115934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 115939 116958 gene locus_tag LOCUS_00740 115939 116958 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_00740 116961 117875 gene locus_tag LOCUS_00750 gene psuG 116961 117875 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_00750 118136 117942 gene locus_tag LOCUS_00760 118136 117942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 121184 118638 gene locus_tag LOCUS_00770 gene lon 121184 118638 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJA3 protein_id gnl|my_center|LOCUS_00770 122349 121363 gene locus_tag LOCUS_00780 122349 121363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 123414 122473 gene locus_tag LOCUS_00790 123414 122473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 124836 123451 gene locus_tag LOCUS_00800 124836 123451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 124909 127584 gene locus_tag LOCUS_00810 124909 127584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 127609 128628 gene locus_tag LOCUS_00820 127609 128628 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972787.1 protein_id gnl|my_center|LOCUS_00820 128629 130254 gene locus_tag LOCUS_00830 128629 130254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 130261 132678 gene locus_tag LOCUS_00840 130261 132678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 133147 135609 gene locus_tag LOCUS_00850 133147 135609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00850 135904 136191 gene locus_tag LOCUS_00860 135904 136191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 136212 137558 gene locus_tag LOCUS_00870 gene hemN 136212 137558 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_00870 137573 138277 gene locus_tag LOCUS_00880 137573 138277 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_00880 138340 139131 gene locus_tag LOCUS_00890 138340 139131 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_00890 139151 139819 gene locus_tag LOCUS_00900 139151 139819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227186.1 protein_id gnl|my_center|LOCUS_00900 139829 140887 gene locus_tag LOCUS_00910 139829 140887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886851.1 protein_id gnl|my_center|LOCUS_00910 140884 141702 gene locus_tag LOCUS_00920 140884 141702 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774940.1 protein_id gnl|my_center|LOCUS_00920 141704 142510 gene locus_tag LOCUS_00930 141704 142510 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760712.1 protein_id gnl|my_center|LOCUS_00930 142530 143849 gene locus_tag LOCUS_00940 gene lysA 142530 143849 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_00940 143846 145282 gene locus_tag LOCUS_00950 143846 145282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 145300 145545 gene locus_tag LOCUS_00960 145300 145545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 145561 146682 gene locus_tag LOCUS_00970 145561 146682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 146675 147469 gene locus_tag LOCUS_00980 146675 147469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106510.1 protein_id gnl|my_center|LOCUS_00980 147498 150212 gene locus_tag LOCUS_00990 147498 150212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 151383 154628 gene locus_tag LOCUS_01000 151383 154628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 154625 156031 gene locus_tag LOCUS_01010 154625 156031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 157389 156703 gene locus_tag LOCUS_01020 157389 156703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 159301 157409 gene locus_tag LOCUS_01030 159301 157409 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_01030 160270 159377 gene locus_tag LOCUS_01040 160270 159377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_01040 162082 160295 gene locus_tag LOCUS_01050 162082 160295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 163047 162148 gene locus_tag LOCUS_01060 163047 162148 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_01060 163231 164445 gene locus_tag LOCUS_01070 163231 164445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01070 164468 165103 gene locus_tag LOCUS_01080 164468 165103 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_01080 165903 165163 gene locus_tag LOCUS_01090 165903 165163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 167380 166058 gene locus_tag LOCUS_01100 gene purA 167380 166058 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_01100 167545 168192 gene locus_tag LOCUS_01110 gene thiE 167545 168192 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL8 protein_id gnl|my_center|LOCUS_01110 168189 169655 gene locus_tag LOCUS_01120 168189 169655 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_01120 169779 172871 gene locus_tag LOCUS_01130 169779 172871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 174572 172875 gene locus_tag LOCUS_01140 174572 172875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 174691 177537 gene locus_tag LOCUS_01150 174691 177537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 178307 177552 gene locus_tag LOCUS_01160 gene tipA 178307 177552 CDS product HTH-type transcriptional activator TipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4T8 protein_id gnl|my_center|LOCUS_01160 179746 178532 gene locus_tag LOCUS_01170 179746 178532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 180168 179743 gene locus_tag LOCUS_01180 180168 179743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 180294 182273 gene locus_tag LOCUS_01190 180294 182273 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_01190 182273 184450 gene locus_tag LOCUS_01200 182273 184450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 184603 185544 gene locus_tag LOCUS_01210 184603 185544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 187142 186129 gene locus_tag LOCUS_01220 187142 186129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 189472 187673 gene locus_tag LOCUS_01230 189472 187673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 192831 189469 gene locus_tag LOCUS_01240 192831 189469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 194372 192828 gene locus_tag LOCUS_01250 194372 192828 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_01250 195797 194442 gene locus_tag LOCUS_01260 195797 194442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 197125 195851 gene locus_tag LOCUS_01270 197125 195851 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_01270 198662 197154 gene locus_tag LOCUS_01280 198662 197154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 198856 200460 gene locus_tag LOCUS_01290 198856 200460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 200457 201704 gene locus_tag LOCUS_01300 200457 201704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 202975 201701 gene locus_tag LOCUS_01310 202975 201701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 204071 203181 gene locus_tag LOCUS_01320 204071 203181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 204537 205442 gene locus_tag LOCUS_01330 204537 205442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 206429 205488 gene locus_tag LOCUS_01340 206429 205488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 207210 206809 gene locus_tag LOCUS_01350 207210 206809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 208101 207328 gene locus_tag LOCUS_01360 208101 207328 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_01360 209328 208216 gene locus_tag LOCUS_01370 gene leu 209328 208216 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 protein_id gnl|my_center|LOCUS_01370 209931 209470 gene locus_tag LOCUS_01380 209931 209470 CDS product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 protein_id gnl|my_center|LOCUS_01380 211710 209968 gene locus_tag LOCUS_01390 211710 209968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 211847 212653 gene locus_tag LOCUS_01400 211847 212653 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_01400 212666 218377 gene locus_tag LOCUS_01410 212666 218377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 219067 218390 gene locus_tag LOCUS_01420 219067 218390 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_01420 220128 219061 gene locus_tag LOCUS_01430 gene cheB2 220128 219061 CDS product chemotaxis response regulator protein-glutamate methylesterase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUI8 protein_id gnl|my_center|LOCUS_01430 221702 220143 gene locus_tag LOCUS_01440 gene paaZ 221702 220143 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_01440 223435 221711 gene locus_tag LOCUS_01450 223435 221711 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_01450 225172 223523 gene locus_tag LOCUS_01460 225172 223523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 226248 225223 gene locus_tag LOCUS_01470 226248 225223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 226351 227058 gene locus_tag LOCUS_01480 226351 227058 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_01480 229360 227066 gene locus_tag LOCUS_01490 229360 227066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 229906 229370 gene locus_tag LOCUS_01500 229906 229370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 230066 231583 gene locus_tag LOCUS_01510 230066 231583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 233402 231597 gene locus_tag LOCUS_01520 233402 231597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 235586 233427 gene locus_tag LOCUS_01530 gene ptrB 235586 233427 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_01530 235743 236354 gene locus_tag LOCUS_01540 235743 236354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 236375 236881 gene locus_tag LOCUS_01550 236375 236881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 239178 236878 gene locus_tag LOCUS_01560 239178 236878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 239301 239576 gene locus_tag LOCUS_01570 239301 239576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 239573 239989 gene locus_tag LOCUS_01580 239573 239989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 240006 242102 gene locus_tag LOCUS_01590 240006 242102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_01590 242080 243267 gene locus_tag LOCUS_01600 242080 243267 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_01600 243277 244389 gene locus_tag LOCUS_01610 243277 244389 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_01610 245038 244466 gene locus_tag LOCUS_01620 245038 244466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 245559 245035 gene locus_tag LOCUS_01630 245559 245035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 247402 245678 gene locus_tag LOCUS_01640 247402 245678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 247550 249295 gene locus_tag LOCUS_01650 247550 249295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 249420 250604 gene locus_tag LOCUS_01660 249420 250604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 250765 251076 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctgaaagagcggtctttccgg 252833 251103 gene locus_tag LOCUS_01670 252833 251103 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_01670 252895 253365 gene locus_tag LOCUS_01680 252895 253365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 253465 255162 gene locus_tag LOCUS_01690 253465 255162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 255207 258926 gene locus_tag LOCUS_01700 255207 258926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 258923 260302 gene locus_tag LOCUS_01710 gene argH 258923 260302 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34858 protein_id gnl|my_center|LOCUS_01710 261279 260260 gene locus_tag LOCUS_01720 261279 260260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 263461 261470 gene locus_tag LOCUS_01730 263461 261470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 264003 264167 gene locus_tag LOCUS_01740 264003 264167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 264164 266167 gene locus_tag LOCUS_01750 gene feoB 264164 266167 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_01750 266403 267497 gene locus_tag LOCUS_01760 266403 267497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 268692 267541 gene locus_tag LOCUS_01770 gene mauG 268692 267541 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_01770 269220 268729 gene locus_tag LOCUS_01780 269220 268729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 269359 269886 gene locus_tag LOCUS_01790 269359 269886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 270607 271842 gene locus_tag LOCUS_01800 270607 271842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 272945 273322 gene locus_tag LOCUS_01810 272945 273322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 275173 274493 gene locus_tag LOCUS_01820 275173 274493 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923472.1 protein_id gnl|my_center|LOCUS_01820 275656 275192 gene locus_tag LOCUS_01830 275656 275192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 278409 275698 gene locus_tag LOCUS_01840 278409 275698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 279409 278492 gene locus_tag LOCUS_01850 279409 278492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 280616 279684 gene locus_tag LOCUS_01860 280616 279684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 281352 280657 gene locus_tag LOCUS_01870 281352 280657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 283784 281349 gene locus_tag LOCUS_01880 283784 281349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 284266 283781 gene locus_tag LOCUS_01890 284266 283781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 284309 285688 gene locus_tag LOCUS_01900 284309 285688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_01900 285688 287400 gene locus_tag LOCUS_01910 285688 287400 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635613.2 protein_id gnl|my_center|LOCUS_01910 287423 287902 gene locus_tag LOCUS_01920 287423 287902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 287899 288519 gene locus_tag LOCUS_01930 287899 288519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 290679 288565 gene locus_tag LOCUS_01940 290679 288565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 290889 293201 gene locus_tag LOCUS_01950 290889 293201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 293869 293498 gene locus_tag LOCUS_01960 293869 293498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 295890 294736 gene locus_tag LOCUS_01970 295890 294736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 296433 295948 gene locus_tag LOCUS_01980 296433 295948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 297348 296491 gene locus_tag LOCUS_01990 297348 296491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 297720 298052 gene locus_tag LOCUS_02000 297720 298052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 299091 298081 gene locus_tag LOCUS_02010 299091 298081 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_02010 299192 300904 gene locus_tag LOCUS_02020 299192 300904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_02020 303269 300948 gene locus_tag LOCUS_02030 303269 300948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 303810 304532 gene locus_tag LOCUS_02040 303810 304532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 305893 304586 gene locus_tag LOCUS_02050 305893 304586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 305944 306303 gene locus_tag LOCUS_02060 305944 306303 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_02060 306371 306961 gene locus_tag LOCUS_02070 306371 306961 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085670.1 protein_id gnl|my_center|LOCUS_02070 307844 307296 gene locus_tag LOCUS_02080 307844 307296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 307959 310061 gene locus_tag LOCUS_02090 307959 310061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 310071 310721 gene locus_tag LOCUS_02100 gene udk 310071 310721 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_02100 310817 311458 gene locus_tag LOCUS_02110 310817 311458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 311704 312339 gene locus_tag LOCUS_02120 311704 312339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 312384 312851 gene locus_tag LOCUS_02130 312384 312851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 313071 314516 gene locus_tag LOCUS_02140 313071 314516 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405396.1 protein_id gnl|my_center|LOCUS_02140 314644 315633 gene locus_tag LOCUS_02150 314644 315633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 315637 316989 gene locus_tag LOCUS_02160 315637 316989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 319350 317305 gene locus_tag LOCUS_02170 319350 317305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 322004 319347 gene locus_tag LOCUS_02180 322004 319347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 322033 322602 gene locus_tag LOCUS_02190 322033 322602 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_02190 322623 323597 gene locus_tag LOCUS_02200 322623 323597 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_02200 323594 324349 gene locus_tag LOCUS_02210 323594 324349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_02210 324428 325711 gene locus_tag LOCUS_02220 324428 325711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 325708 326190 gene locus_tag LOCUS_02230 325708 326190 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_02230 327201 326191 gene locus_tag LOCUS_02240 gene trpD 327201 326191 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_02240 327226 329040 gene locus_tag LOCUS_02250 327226 329040 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_02250 329048 329881 gene locus_tag LOCUS_02260 329048 329881 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_02260 329903 331810 gene locus_tag LOCUS_02270 329903 331810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941908.1 protein_id gnl|my_center|LOCUS_02270 332822 331887 gene locus_tag LOCUS_02280 332822 331887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 339242 333618 gene locus_tag LOCUS_02290 339242 333618 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941907.1 protein_id gnl|my_center|LOCUS_02290 339342 340124 gene locus_tag LOCUS_02300 339342 340124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 341161 340085 gene locus_tag LOCUS_02310 341161 340085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 341236 341913 gene locus_tag LOCUS_02320 341236 341913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 342210 342560 gene locus_tag LOCUS_02330 342210 342560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 343365 342577 gene locus_tag LOCUS_02340 343365 342577 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_02340 344435 343362 gene locus_tag LOCUS_02350 344435 343362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 345949 344435 gene locus_tag LOCUS_02360 345949 344435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_02360 347113 346205 gene locus_tag LOCUS_02370 347113 346205 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887407.1 protein_id gnl|my_center|LOCUS_02370 347156 347830 gene locus_tag LOCUS_02380 347156 347830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 349166 347865 gene locus_tag LOCUS_02390 349166 347865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 349254 349538 gene locus_tag LOCUS_02400 349254 349538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 352033 349580 gene locus_tag LOCUS_02410 352033 349580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_02410 353941 352139 gene locus_tag LOCUS_02420 353941 352139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_02420 355808 353910 gene locus_tag LOCUS_02430 355808 353910 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_02430 358551 355816 gene locus_tag LOCUS_02440 358551 355816 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031100.1 protein_id gnl|my_center|LOCUS_02440 360736 360008 gene locus_tag LOCUS_02450 360736 360008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 361891 360890 gene locus_tag LOCUS_02460 361891 360890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 364504 362006 gene locus_tag LOCUS_02470 364504 362006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 366844 364568 gene locus_tag LOCUS_02480 366844 364568 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937680.1 protein_id gnl|my_center|LOCUS_02480 366987 369413 gene locus_tag LOCUS_02490 366987 369413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_02490 370210 369467 gene locus_tag LOCUS_02500 370210 369467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 372466 370877 gene locus_tag LOCUS_02510 372466 370877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 373444 372512 gene locus_tag LOCUS_02520 373444 372512 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974920.1 protein_id gnl|my_center|LOCUS_02520 374310 373441 gene locus_tag LOCUS_02530 374310 373441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_02530 375125 374331 gene locus_tag LOCUS_02540 375125 374331 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_02540 375284 377107 gene locus_tag LOCUS_02550 375284 377107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 377249 378211 gene locus_tag LOCUS_02560 377249 378211 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_02560 378235 379218 gene locus_tag LOCUS_02570 378235 379218 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_02570 379412 379984 gene locus_tag LOCUS_02580 379412 379984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 380007 380732 gene locus_tag LOCUS_02590 380007 380732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 380867 382123 gene locus_tag LOCUS_02600 380867 382123 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_02600 382289 385270 gene locus_tag LOCUS_02610 382289 385270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 385775 385960 gene locus_tag LOCUS_02620 385775 385960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 385948 386265 gene locus_tag LOCUS_02630 385948 386265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 389736 386368 gene locus_tag LOCUS_02640 389736 386368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 390708 389755 gene locus_tag LOCUS_02650 390708 389755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 390818 391111 gene locus_tag LOCUS_02660 390818 391111 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_02660 393504 391108 gene locus_tag LOCUS_02670 393504 391108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 394772 393570 gene locus_tag LOCUS_02680 394772 393570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 395133 394795 gene locus_tag LOCUS_02690 395133 394795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 395218 396342 gene locus_tag LOCUS_02700 395218 396342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 396339 397295 gene locus_tag LOCUS_02710 396339 397295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 397292 397855 gene locus_tag LOCUS_02720 397292 397855 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_02720 398383 397826 gene locus_tag LOCUS_02730 398383 397826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 402468 399085 gene locus_tag LOCUS_02740 402468 399085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 402661 402476 gene locus_tag LOCUS_02750 402661 402476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 405645 402667 gene locus_tag LOCUS_02760 405645 402667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_02760 406503 407144 gene locus_tag LOCUS_02770 406503 407144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 408933 407155 gene locus_tag LOCUS_02780 408933 407155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 409086 410810 gene locus_tag LOCUS_02790 409086 410810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 416453 411693 gene locus_tag LOCUS_02800 416453 411693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 419182 416720 gene locus_tag LOCUS_02810 419182 416720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_02810 420279 419227 gene locus_tag LOCUS_02820 420279 419227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 422414 420309 gene locus_tag LOCUS_02830 422414 420309 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_02830 424103 422427 gene locus_tag LOCUS_02840 424103 422427 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_02840 424779 424171 gene locus_tag LOCUS_02850 424779 424171 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_02850 424958 427411 gene locus_tag LOCUS_02860 424958 427411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 427477 428418 gene locus_tag LOCUS_02870 gene xerD 427477 428418 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 protein_id gnl|my_center|LOCUS_02870 429879 431759 gene locus_tag LOCUS_02880 429879 431759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 431811 432479 gene locus_tag LOCUS_02890 431811 432479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 432752 432480 gene locus_tag LOCUS_02900 432752 432480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 433632 433009 gene locus_tag LOCUS_02910 433632 433009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 435704 433638 gene locus_tag LOCUS_02920 435704 433638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 435985 439278 gene locus_tag LOCUS_02930 435985 439278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_02930 439281 440690 gene locus_tag LOCUS_02940 439281 440690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 442010 440748 gene locus_tag LOCUS_02950 442010 440748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 443410 442346 gene locus_tag LOCUS_02960 443410 442346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 446378 443439 gene locus_tag LOCUS_02970 446378 443439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 449329 446396 gene locus_tag LOCUS_02980 449329 446396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 449883 449326 gene locus_tag LOCUS_02990 449883 449326 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_02990 450164 450940 gene locus_tag LOCUS_03000 gene coaX 450164 450940 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX22 protein_id gnl|my_center|LOCUS_03000 451032 454079 gene locus_tag LOCUS_03010 451032 454079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 455455 454562 gene locus_tag LOCUS_03020 455455 454562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 456366 455455 gene locus_tag LOCUS_03030 456366 455455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 459766 456437 gene locus_tag LOCUS_03040 459766 456437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_03040 460128 459805 gene locus_tag LOCUS_03050 460128 459805 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_03050 460404 460132 gene locus_tag LOCUS_03060 460404 460132 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DQ1 protein_id gnl|my_center|LOCUS_03060 460750 465093 gene locus_tag LOCUS_03070 460750 465093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 465213 466466 gene locus_tag LOCUS_03080 465213 466466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 466463 467296 gene locus_tag LOCUS_03090 466463 467296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 467331 468299 gene locus_tag LOCUS_03100 467331 468299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 469728 468832 gene locus_tag LOCUS_03110 469728 468832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 479015 469815 gene locus_tag LOCUS_03120 479015 469815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 479759 479208 gene locus_tag LOCUS_03130 479759 479208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 481501 479756 gene locus_tag LOCUS_03140 481501 479756 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03140 483354 481498 gene locus_tag LOCUS_03150 gene hutH 483354 481498 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73Q56 protein_id gnl|my_center|LOCUS_03150 484817 483351 gene locus_tag LOCUS_03160 gene hisS 484817 483351 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAL6 protein_id gnl|my_center|LOCUS_03160 484978 487911 gene locus_tag LOCUS_03170 484978 487911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 488353 487988 gene locus_tag LOCUS_03180 488353 487988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 488640 489362 gene locus_tag LOCUS_03190 488640 489362 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_03190 491223 489379 gene locus_tag LOCUS_03200 gene menD 491223 489379 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB45 protein_id gnl|my_center|LOCUS_03200 492643 491231 gene locus_tag LOCUS_03210 492643 491231 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_03210 493425 492640 gene locus_tag LOCUS_03220 gene ubiE 493425 492640 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_03220 494567 493440 gene locus_tag LOCUS_03230 494567 493440 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974661.1 protein_id gnl|my_center|LOCUS_03230 495139 494564 gene locus_tag LOCUS_03240 495139 494564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 495771 495211 gene locus_tag LOCUS_03250 495771 495211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 496309 495839 gene locus_tag LOCUS_03260 496309 495839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_03260 498696 496360 gene locus_tag LOCUS_03270 498696 496360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 501306 498748 gene locus_tag LOCUS_03280 501306 498748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 501588 502106 gene locus_tag LOCUS_03290 501588 502106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 503238 502108 gene locus_tag LOCUS_03300 gene mvaS 503238 502108 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_03300 505820 503616 gene locus_tag LOCUS_03310 505820 503616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 506285 509404 gene locus_tag LOCUS_03320 506285 509404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 510682 509999 gene locus_tag LOCUS_03330 510682 509999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 511698 512267 gene locus_tag LOCUS_03340 511698 512267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 514054 512501 gene locus_tag LOCUS_03350 514054 512501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 515508 514051 gene locus_tag LOCUS_03360 gene pleD 515508 514051 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 protein_id gnl|my_center|LOCUS_03360 516563 515505 gene locus_tag LOCUS_03370 gene cheB 516563 515505 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBT0 protein_id gnl|my_center|LOCUS_03370 518554 516560 gene locus_tag LOCUS_03380 518554 516560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 520202 518565 gene locus_tag LOCUS_03390 520202 518565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 520521 520186 gene locus_tag LOCUS_03400 520521 520186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 520964 520518 gene locus_tag LOCUS_03410 520964 520518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 521076 521897 gene locus_tag LOCUS_03420 521076 521897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 521926 523341 gene locus_tag LOCUS_03430 521926 523341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228357.1 protein_id gnl|my_center|LOCUS_03430 523387 524793 gene locus_tag LOCUS_03440 523387 524793 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_03440 524801 525703 gene locus_tag LOCUS_03450 524801 525703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 525828 528542 gene locus_tag LOCUS_03460 525828 528542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 528798 530108 gene locus_tag LOCUS_03470 gene ampG 528798 530108 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 protein_id gnl|my_center|LOCUS_03470 530195 530404 gene locus_tag LOCUS_03480 530195 530404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 530523 530894 gene locus_tag LOCUS_03490 530523 530894 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_03490 530891 533575 gene locus_tag LOCUS_03500 530891 533575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_03500 534007 533594 gene locus_tag LOCUS_03510 534007 533594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 539124 534211 gene locus_tag LOCUS_03520 539124 534211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 539359 540867 gene locus_tag LOCUS_03530 539359 540867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 540848 542902 gene locus_tag LOCUS_03540 540848 542902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 542921 543943 gene locus_tag LOCUS_03550 542921 543943 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969676.1 protein_id gnl|my_center|LOCUS_03550 544701 544030 gene locus_tag LOCUS_03560 gene pcm 544701 544030 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_03560 545022 546740 gene locus_tag LOCUS_03570 545022 546740 CDS product ubiquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405397.1 protein_id gnl|my_center|LOCUS_03570 546792 549344 gene locus_tag LOCUS_03580 546792 549344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 552088 549341 gene locus_tag LOCUS_03590 552088 549341 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405361.1 protein_id gnl|my_center|LOCUS_03590 557271 552223 gene locus_tag LOCUS_03600 557271 552223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 561999 557554 gene locus_tag LOCUS_03610 561999 557554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 564725 561996 gene locus_tag LOCUS_03620 564725 561996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 566591 564759 gene locus_tag LOCUS_03630 566591 564759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 567595 569949 gene locus_tag LOCUS_03640 567595 569949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 570332 570132 gene locus_tag LOCUS_03650 570332 570132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 570965 570399 gene locus_tag LOCUS_03660 570965 570399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 571062 572273 gene locus_tag LOCUS_03670 571062 572273 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_03670 575218 572210 gene locus_tag LOCUS_03680 575218 572210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 575217 577304 gene locus_tag LOCUS_03690 575217 577304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 583578 577363 gene locus_tag LOCUS_03700 583578 577363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 589971 583765 gene locus_tag LOCUS_03710 589971 583765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 590265 593525 gene locus_tag LOCUS_03720 590265 593525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 593522 595072 gene locus_tag LOCUS_03730 593522 595072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 597685 595082 gene locus_tag LOCUS_03740 gene pepN 597685 595082 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_03740 598900 597767 gene locus_tag LOCUS_03750 598900 597767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 600663 598876 gene locus_tag LOCUS_03760 600663 598876 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03760 600657 602714 gene locus_tag LOCUS_03770 600657 602714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 603281 605167 gene locus_tag LOCUS_03780 603281 605167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 605164 605799 gene locus_tag LOCUS_03790 605164 605799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_03790 607743 605761 gene locus_tag LOCUS_03800 607743 605761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 607885 608703 gene locus_tag LOCUS_03810 gene trpC 607885 608703 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_03810 610322 608727 gene locus_tag LOCUS_03820 610322 608727 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103517.1 protein_id gnl|my_center|LOCUS_03820 611775 610369 gene locus_tag LOCUS_03830 611775 610369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 612572 611772 gene locus_tag LOCUS_03840 612572 611772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140506.1 protein_id gnl|my_center|LOCUS_03840 613979 612588 gene locus_tag LOCUS_03850 613979 612588 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_03850 615456 613984 gene locus_tag LOCUS_03860 615456 613984 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_03860 615491 616141 gene locus_tag LOCUS_03870 615491 616141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352341.1 protein_id gnl|my_center|LOCUS_03870 616138 617367 gene locus_tag LOCUS_03880 616138 617367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_03880 617535 619019 gene locus_tag LOCUS_03890 617535 619019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 620880 619120 gene locus_tag LOCUS_03900 620880 619120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 622671 620971 gene locus_tag LOCUS_03910 622671 620971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 623009 624337 gene locus_tag LOCUS_03920 623009 624337 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_03920 624334 625581 gene locus_tag LOCUS_03930 624334 625581 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403884.1 protein_id gnl|my_center|LOCUS_03930 625760 627865 gene locus_tag LOCUS_03940 625760 627865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 627944 628492 gene locus_tag LOCUS_03950 627944 628492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 628562 629443 gene locus_tag LOCUS_03960 628562 629443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 629591 630736 gene locus_tag LOCUS_03970 629591 630736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 631674 630820 gene locus_tag LOCUS_03980 631674 630820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 631756 632886 gene locus_tag LOCUS_03990 gene wecE 631756 632886 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_03990 633412 632915 gene locus_tag LOCUS_04000 633412 632915 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070579.1 protein_id gnl|my_center|LOCUS_04000 633452 634174 gene locus_tag LOCUS_04010 633452 634174 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_04010 634171 635991 gene locus_tag LOCUS_04020 634171 635991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765190.1 protein_id gnl|my_center|LOCUS_04020 638147 636534 gene locus_tag LOCUS_04030 gene agpS 638147 636534 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_04030 638213 639361 gene locus_tag LOCUS_04040 638213 639361 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_04040 639514 639840 gene locus_tag LOCUS_04050 639514 639840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 641406 639862 gene locus_tag LOCUS_04060 641406 639862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 641514 642638 gene locus_tag LOCUS_04070 641514 642638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 642635 644047 gene locus_tag LOCUS_04080 642635 644047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 644095 644844 gene locus_tag LOCUS_04090 644095 644844 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_04090 645623 644865 gene locus_tag LOCUS_04100 645623 644865 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LH9 protein_id gnl|my_center|LOCUS_04100 645710 646561 gene locus_tag LOCUS_04110 645710 646561 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W0 protein_id gnl|my_center|LOCUS_04110 646669 648627 gene locus_tag LOCUS_04120 646669 648627 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_04120 648721 650037 gene locus_tag LOCUS_04130 648721 650037 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_04130 650794 650069 gene locus_tag LOCUS_04140 650794 650069 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_04140 651040 651408 gene locus_tag LOCUS_04150 651040 651408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_04150 651464 651838 gene locus_tag LOCUS_04160 651464 651838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 651847 652410 gene locus_tag LOCUS_04170 651847 652410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 652455 652937 gene locus_tag LOCUS_04180 652455 652937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 654462 652927 gene locus_tag LOCUS_04190 654462 652927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 654635 655048 gene locus_tag LOCUS_04200 654635 655048 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057828.1 protein_id gnl|my_center|LOCUS_04200 655474 655049 gene locus_tag LOCUS_04210 655474 655049 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228709.1 protein_id gnl|my_center|LOCUS_04210 655877 656929 gene locus_tag LOCUS_04220 655877 656929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_04220 657420 656977 gene locus_tag LOCUS_04230 657420 656977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 658291 659028 gene locus_tag LOCUS_04240 658291 659028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 659049 659975 gene locus_tag LOCUS_04250 659049 659975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 659972 660811 gene locus_tag LOCUS_04260 659972 660811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 660808 661368 gene locus_tag LOCUS_04270 660808 661368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 664125 661537 gene locus_tag LOCUS_04280 664125 661537 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_04280 664678 664127 gene locus_tag LOCUS_04290 664678 664127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 664856 665218 gene locus_tag LOCUS_04300 gene ytxJ 664856 665218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39914 protein_id gnl|my_center|LOCUS_04300 665460 668258 gene locus_tag LOCUS_04310 gene fecA 665460 668258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_04310 668443 670164 gene locus_tag LOCUS_04320 668443 670164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 670205 670993 gene locus_tag LOCUS_04330 670205 670993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 671478 671101 gene locus_tag LOCUS_04340 671478 671101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 672073 671660 gene locus_tag LOCUS_04350 672073 671660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 672821 672024 gene locus_tag LOCUS_04360 672821 672024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 673463 675346 gene locus_tag LOCUS_04370 673463 675346 CDS product receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933414.1 protein_id gnl|my_center|LOCUS_04370 675353 676258 gene locus_tag LOCUS_04380 675353 676258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 677042 678550 gene locus_tag LOCUS_04390 677042 678550 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110040.1 protein_id gnl|my_center|LOCUS_04390 678894 679325 gene locus_tag LOCUS_04400 678894 679325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 679442 679930 gene locus_tag LOCUS_04410 679442 679930 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7K7 protein_id gnl|my_center|LOCUS_04410 679970 680326 gene locus_tag LOCUS_04420 679970 680326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 680539 681273 gene locus_tag LOCUS_04430 680539 681273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 681760 681284 gene locus_tag LOCUS_04440 681760 681284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 682317 681757 gene locus_tag LOCUS_04450 gene algU 682317 681757 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_04450 682657 682319 gene locus_tag LOCUS_04460 682657 682319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 682948 683889 gene locus_tag LOCUS_04470 682948 683889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 684216 685154 gene locus_tag LOCUS_04480 684216 685154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 685765 685181 gene locus_tag LOCUS_04490 685765 685181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 685903 686442 gene locus_tag LOCUS_04500 685903 686442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 686579 688033 gene locus_tag LOCUS_04510 686579 688033 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_04510 688033 688371 gene locus_tag LOCUS_04520 688033 688371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 689015 688368 gene locus_tag LOCUS_04530 689015 688368 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_04530 690792 689125 gene locus_tag LOCUS_04540 690792 689125 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_04540 692680 690803 gene locus_tag LOCUS_04550 692680 690803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 692597 692806 gene locus_tag LOCUS_04560 692597 692806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 692819 694711 gene locus_tag LOCUS_04570 692819 694711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 697238 694683 gene locus_tag LOCUS_04580 697238 694683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 698557 697271 gene locus_tag LOCUS_04590 698557 697271 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_04590 699449 698490 gene locus_tag LOCUS_04600 gene dmt 699449 698490 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_04600 700215 699460 gene locus_tag LOCUS_04610 700215 699460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 700873 700217 gene locus_tag LOCUS_04620 700873 700217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 702102 700870 gene locus_tag LOCUS_04630 gene dfp 702102 700870 CDS product bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_04630 702385 702131 gene locus_tag LOCUS_04640 702385 702131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 702581 704146 gene locus_tag LOCUS_04650 702581 704146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 704157 705473 gene locus_tag LOCUS_04660 704157 705473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 705470 706738 gene locus_tag LOCUS_04670 gene ndh 705470 706738 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_04670 708079 707696 gene locus_tag LOCUS_04680 708079 707696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 709309 708422 gene locus_tag LOCUS_04690 709309 708422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_04690 709407 710300 gene locus_tag LOCUS_04700 709407 710300 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04700 710320 711216 gene locus_tag LOCUS_04710 710320 711216 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04710 711216 711797 gene locus_tag LOCUS_04720 711216 711797 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_04720 711879 712202 gene locus_tag LOCUS_04730 711879 712202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 712391 712870 gene locus_tag LOCUS_04740 712391 712870 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_04740 714480 712858 gene locus_tag LOCUS_04750 714480 712858 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026859.1 protein_id gnl|my_center|LOCUS_04750 717104 714504 gene locus_tag LOCUS_04760 717104 714504 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_04760 717103 718023 gene locus_tag LOCUS_04770 717103 718023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 719381 718044 gene locus_tag LOCUS_04780 719381 718044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 719517 721010 gene locus_tag LOCUS_04790 719517 721010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 721036 721812 gene locus_tag LOCUS_04800 721036 721812 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_04800 721902 722243 gene locus_tag LOCUS_04810 gene hypA 721902 722243 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF96 protein_id gnl|my_center|LOCUS_04810 722243 722944 gene locus_tag LOCUS_04820 gene hypB 722243 722944 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_04820 722944 723588 gene locus_tag LOCUS_04830 722944 723588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 723591 724784 gene locus_tag LOCUS_04840 723591 724784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 724797 725051 gene locus_tag LOCUS_04850 724797 725051 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_04850 725048 726169 gene locus_tag LOCUS_04860 725048 726169 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_04860 726166 727215 gene locus_tag LOCUS_04870 gene hypE 726166 727215 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_04870 727678 727217 gene locus_tag LOCUS_04880 727678 727217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 728982 727675 gene locus_tag LOCUS_04890 728982 727675 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_04890 729754 728966 gene locus_tag LOCUS_04900 729754 728966 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_04900 730664 729771 gene locus_tag LOCUS_04910 730664 729771 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729413.1 protein_id gnl|my_center|LOCUS_04910 731130 730657 gene locus_tag LOCUS_04920 731130 730657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_04920 732242 731127 gene locus_tag LOCUS_04930 732242 731127 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895386.1 protein_id gnl|my_center|LOCUS_04930 733025 732417 gene locus_tag LOCUS_04940 733025 732417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 734335 733154 gene locus_tag LOCUS_04950 734335 733154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 734861 734307 gene locus_tag LOCUS_04960 734861 734307 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_04960 735156 736097 gene locus_tag LOCUS_04970 735156 736097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 736399 736887 gene locus_tag LOCUS_04980 736399 736887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 739736 737439 gene locus_tag LOCUS_04990 739736 737439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 740647 739811 gene locus_tag LOCUS_05000 740647 739811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 740784 743006 gene locus_tag LOCUS_05010 740784 743006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 744187 743009 gene locus_tag LOCUS_05020 744187 743009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 744317 744401 gene locus_tag LOCUS_t00020 744317 744401 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 744417 744506 gene locus_tag LOCUS_t00030 744417 744506 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 744657 747254 gene locus_tag LOCUS_05030 744657 747254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 748143 747196 gene locus_tag LOCUS_05040 748143 747196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 750354 748147 gene locus_tag LOCUS_05050 gene clpA 750354 748147 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_05050 750750 750427 gene locus_tag LOCUS_05060 gene clpS 750750 750427 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_05060 751825 750800 gene locus_tag LOCUS_05070 751825 750800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 751952 753145 gene locus_tag LOCUS_05080 751952 753145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 753699 753166 gene locus_tag LOCUS_05090 753699 753166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_05090 756686 754245 gene locus_tag LOCUS_05100 756686 754245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_05100 756850 757614 gene locus_tag LOCUS_05110 gene paaG 756850 757614 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_05110 757617 758891 gene locus_tag LOCUS_05120 757617 758891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_05120 759101 758916 gene locus_tag LOCUS_05130 759101 758916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 759292 759101 gene locus_tag LOCUS_05140 759292 759101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 760611 759289 gene locus_tag LOCUS_05150 760611 759289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 761095 760760 gene locus_tag LOCUS_05160 761095 760760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 763618 761123 gene locus_tag LOCUS_05170 763618 761123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 767275 763874 gene locus_tag LOCUS_05180 767275 763874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 767772 767533 gene locus_tag LOCUS_05190 767772 767533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 767850 768792 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggccgatccccgcgtgcgcggggaagac 769337 768843 gene locus_tag LOCUS_05200 769337 768843 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_05200 770541 769660 gene locus_tag LOCUS_05210 gene cas1 770541 769660 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXJ3 protein_id gnl|my_center|LOCUS_05210 771323 770544 gene locus_tag LOCUS_05220 771323 770544 CDS product CRISPR-associated protein Cse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_05220 772062 771313 gene locus_tag LOCUS_05230 772062 771313 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_05230 773270 772059 gene locus_tag LOCUS_05240 773270 772059 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_05240 773794 773297 gene locus_tag LOCUS_05250 773794 773297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 775326 773791 gene locus_tag LOCUS_05260 775326 773791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 776835 775825 gene locus_tag LOCUS_05270 776835 775825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 777233 776970 gene locus_tag LOCUS_05280 777233 776970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 777699 777343 gene locus_tag LOCUS_05290 777699 777343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 777934 779181 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggccgatccccgcgtgcgcggggaagac 781609 779240 gene locus_tag LOCUS_05300 781609 779240 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 781631 781867 gene locus_tag LOCUS_05310 781631 781867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 782001 784493 gene locus_tag LOCUS_05320 782001 784493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_05320 784689 785618 gene locus_tag LOCUS_05330 784689 785618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 786770 785685 gene locus_tag LOCUS_05340 786770 785685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 788708 786906 gene locus_tag LOCUS_05350 788708 786906 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_05350 790271 788736 gene locus_tag LOCUS_05360 790271 788736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 791713 790268 gene locus_tag LOCUS_05370 791713 790268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 793298 791706 gene locus_tag LOCUS_05380 793298 791706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 795169 793334 gene locus_tag LOCUS_05390 795169 793334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 795226 796014 gene locus_tag LOCUS_05400 795226 796014 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_05400 796064 796822 gene locus_tag LOCUS_05410 gene olsA 796064 796822 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527683.1 protein_id gnl|my_center|LOCUS_05410 797366 796872 gene locus_tag LOCUS_05420 797366 796872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 800133 797866 gene locus_tag LOCUS_05430 800133 797866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 800320 801642 gene locus_tag LOCUS_05440 800320 801642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 801790 801866 gene locus_tag LOCUS_t00040 801790 801866 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 803097 801997 gene locus_tag LOCUS_05450 803097 801997 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940498.1 protein_id gnl|my_center|LOCUS_05450 804031 803180 gene locus_tag LOCUS_05460 gene suhB 804031 803180 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_05460 805362 804064 gene locus_tag LOCUS_05470 gene pyrC 805362 804064 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_05470 806324 805359 gene locus_tag LOCUS_05480 gene pyrB 806324 805359 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_05480 806922 806332 gene locus_tag LOCUS_05490 gene pyrR 806922 806332 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK65 protein_id gnl|my_center|LOCUS_05490 807173 808006 gene locus_tag LOCUS_05500 807173 808006 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_05500 808041 808574 gene locus_tag LOCUS_05510 808041 808574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 808562 809344 gene locus_tag LOCUS_05520 808562 809344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337320.1 protein_id gnl|my_center|LOCUS_05520 809325 811946 gene locus_tag LOCUS_05530 809325 811946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence02 109 2379 gene locus_tag LOCUS_05540 109 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2541 3503 gene locus_tag LOCUS_05550 2541 3503 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_05550 4926 4105 gene locus_tag LOCUS_05560 4926 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948253.1 protein_id gnl|my_center|LOCUS_05560 5065 6690 gene locus_tag LOCUS_05570 5065 6690 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_05570 6800 14509 gene locus_tag LOCUS_05580 6800 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14575 21348 gene locus_tag LOCUS_05590 14575 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21345 22613 gene locus_tag LOCUS_05600 21345 22613 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_05600 24667 22793 gene locus_tag LOCUS_05610 24667 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 26462 24636 gene locus_tag LOCUS_05620 26462 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 28169 26466 gene locus_tag LOCUS_05630 28169 26466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 28266 29477 gene locus_tag LOCUS_05640 28266 29477 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_05640 31050 30010 gene locus_tag LOCUS_05650 31050 30010 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_05650 31097 31522 gene locus_tag LOCUS_05660 31097 31522 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_05660 37511 31830 gene locus_tag LOCUS_05670 37511 31830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 38798 37578 gene locus_tag LOCUS_05680 38798 37578 CDS product DUF4785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946691.1 protein_id gnl|my_center|LOCUS_05680 39670 38816 gene locus_tag LOCUS_05690 39670 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_05690 44055 39895 gene locus_tag LOCUS_05700 44055 39895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117982.1 protein_id gnl|my_center|LOCUS_05700 44527 44766 gene locus_tag LOCUS_05710 44527 44766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 45779 44769 gene locus_tag LOCUS_05720 gene gap 45779 44769 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67161 protein_id gnl|my_center|LOCUS_05720 46798 45779 gene locus_tag LOCUS_05730 gene gap 46798 45779 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_05730 46884 47714 gene locus_tag LOCUS_05740 46884 47714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 47721 49520 gene locus_tag LOCUS_05750 47721 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 49633 53808 gene locus_tag LOCUS_05760 49633 53808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 53801 54208 gene locus_tag LOCUS_05770 53801 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 54205 55707 gene locus_tag LOCUS_05780 54205 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 57730 55712 gene locus_tag LOCUS_05790 57730 55712 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188387.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05790 61049 57891 gene locus_tag LOCUS_05800 61049 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 61093 61830 gene locus_tag LOCUS_05810 61093 61830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 62179 61961 gene locus_tag LOCUS_05820 62179 61961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 62331 63191 gene locus_tag LOCUS_05830 62331 63191 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_05830 63489 63941 gene locus_tag LOCUS_05840 63489 63941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 64597 65802 gene locus_tag LOCUS_05850 64597 65802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 65844 67238 gene locus_tag LOCUS_05860 65844 67238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 67226 68557 gene locus_tag LOCUS_05870 67226 68557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 68580 69224 gene locus_tag LOCUS_05880 68580 69224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 69261 70001 gene locus_tag LOCUS_05890 69261 70001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 70998 70030 gene locus_tag LOCUS_05900 70998 70030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 71753 70995 gene locus_tag LOCUS_05910 71753 70995 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_05910 72802 71750 gene locus_tag LOCUS_05920 72802 71750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_05920 72782 73963 gene locus_tag LOCUS_05930 72782 73963 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331462.1 protein_id gnl|my_center|LOCUS_05930 73960 74757 gene locus_tag LOCUS_05940 73960 74757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 74887 76896 gene locus_tag LOCUS_05950 74887 76896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 76907 77503 gene locus_tag LOCUS_05960 76907 77503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 77616 78761 gene locus_tag LOCUS_05970 77616 78761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 78752 79765 gene locus_tag LOCUS_05980 78752 79765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 79793 82267 gene locus_tag LOCUS_05990 79793 82267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 82304 83998 gene locus_tag LOCUS_06000 82304 83998 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_06000 84147 85619 gene locus_tag LOCUS_06010 84147 85619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 85616 86842 gene locus_tag LOCUS_06020 85616 86842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 86839 87495 gene locus_tag LOCUS_06030 86839 87495 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_06030 87753 87849 gene locus_tag LOCUS_t00050 87753 87849 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 88123 89433 gene locus_tag LOCUS_06040 88123 89433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 90073 89411 gene locus_tag LOCUS_06050 90073 89411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 91890 90076 gene locus_tag LOCUS_06060 91890 90076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 94857 91936 gene locus_tag LOCUS_06070 94857 91936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 96238 94844 gene locus_tag LOCUS_06080 gene cca 96238 94844 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ELM1 protein_id gnl|my_center|LOCUS_06080 98197 96248 gene locus_tag LOCUS_06090 98197 96248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 98577 98194 gene locus_tag LOCUS_06100 98577 98194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 98893 98597 gene locus_tag LOCUS_06110 98893 98597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 98923 99876 gene locus_tag LOCUS_06120 98923 99876 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616206.1 protein_id gnl|my_center|LOCUS_06120 99876 100886 gene locus_tag LOCUS_06130 99876 100886 CDS product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_06130 100883 102088 gene locus_tag LOCUS_06140 100883 102088 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071851.1 protein_id gnl|my_center|LOCUS_06140 104304 102175 gene locus_tag LOCUS_06150 104304 102175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 106852 104375 gene locus_tag LOCUS_06160 106852 104375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 106851 108287 gene locus_tag LOCUS_06170 106851 108287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_06170 110560 108284 gene locus_tag LOCUS_06180 110560 108284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 110864 111640 gene locus_tag LOCUS_06190 110864 111640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 113166 112420 gene locus_tag LOCUS_06200 113166 112420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 113851 113306 gene locus_tag LOCUS_06210 113851 113306 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 protein_id gnl|my_center|LOCUS_06210 114319 113882 gene locus_tag LOCUS_06220 114319 113882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 114644 114309 gene locus_tag LOCUS_06230 114644 114309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 115124 114702 gene locus_tag LOCUS_06240 115124 114702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 116376 115237 gene locus_tag LOCUS_06250 116376 115237 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_06250 116577 117956 gene locus_tag LOCUS_06260 116577 117956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 117953 118309 gene locus_tag LOCUS_06270 117953 118309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 118306 118932 gene locus_tag LOCUS_06280 118306 118932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 120390 118990 gene locus_tag LOCUS_06290 120390 118990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 121686 120406 gene locus_tag LOCUS_06300 121686 120406 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_06300 123110 121674 gene locus_tag LOCUS_06310 123110 121674 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_06310 123281 125665 gene locus_tag LOCUS_06320 123281 125665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_06320 126943 125672 gene locus_tag LOCUS_06330 126943 125672 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206548.1 protein_id gnl|my_center|LOCUS_06330 126977 128383 gene locus_tag LOCUS_06340 gene rtcB 126977 128383 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_06340 128757 128380 gene locus_tag LOCUS_06350 128757 128380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_06350 128848 129978 gene locus_tag LOCUS_06360 128848 129978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_06360 130098 130937 gene locus_tag LOCUS_06370 130098 130937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 131021 132310 gene locus_tag LOCUS_06380 131021 132310 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_06380 136555 132359 gene locus_tag LOCUS_06390 136555 132359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 138412 136562 gene locus_tag LOCUS_06400 138412 136562 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_06400 139407 138409 gene locus_tag LOCUS_06410 139407 138409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 139493 142069 gene locus_tag LOCUS_06420 139493 142069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 142066 143208 gene locus_tag LOCUS_06430 142066 143208 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MWH8 protein_id gnl|my_center|LOCUS_06430 144936 143509 gene locus_tag LOCUS_06440 144936 143509 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227167.1 protein_id gnl|my_center|LOCUS_06440 149552 144933 gene locus_tag LOCUS_06450 149552 144933 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_06450 149859 151703 gene locus_tag LOCUS_06460 149859 151703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 153080 151728 gene locus_tag LOCUS_06470 153080 151728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 153820 153266 gene locus_tag LOCUS_06480 153820 153266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_06480 155539 153866 gene locus_tag LOCUS_06490 155539 153866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 156644 155556 gene locus_tag LOCUS_06500 gene pilT-3 156644 155556 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_06500 158576 156678 gene locus_tag LOCUS_06510 158576 156678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 160162 158654 gene locus_tag LOCUS_06520 160162 158654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120502.1 protein_id gnl|my_center|LOCUS_06520 160857 160159 gene locus_tag LOCUS_06530 160857 160159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 161639 160878 gene locus_tag LOCUS_06540 161639 160878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 162696 161629 gene locus_tag LOCUS_06550 162696 161629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 163241 162693 gene locus_tag LOCUS_06560 163241 162693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 163498 163238 gene locus_tag LOCUS_06570 163498 163238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 163734 165167 gene locus_tag LOCUS_06580 163734 165167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 165173 166924 gene locus_tag LOCUS_06590 165173 166924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 166921 167718 gene locus_tag LOCUS_06600 166921 167718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_06600 170800 167729 gene locus_tag LOCUS_06610 170800 167729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 173872 170816 gene locus_tag LOCUS_06620 173872 170816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_06620 176929 173891 gene locus_tag LOCUS_06630 176929 173891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_06630 177159 179045 gene locus_tag LOCUS_06640 177159 179045 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 protein_id gnl|my_center|LOCUS_06640 179087 179677 gene locus_tag LOCUS_06650 179087 179677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 179766 181916 gene locus_tag LOCUS_06660 179766 181916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 182202 182741 gene locus_tag LOCUS_06670 182202 182741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 182756 184210 gene locus_tag LOCUS_06680 182756 184210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 184873 184214 gene locus_tag LOCUS_06690 184873 184214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 186690 184876 gene locus_tag LOCUS_06700 186690 184876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 188291 186720 gene locus_tag LOCUS_06710 188291 186720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 189386 188292 gene locus_tag LOCUS_06720 189386 188292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 189465 191879 gene locus_tag LOCUS_06730 189465 191879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 193322 191898 gene locus_tag LOCUS_06740 193322 191898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 193458 194210 gene locus_tag LOCUS_06750 193458 194210 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_06750 194207 194914 gene locus_tag LOCUS_06760 194207 194914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 194911 195252 gene locus_tag LOCUS_06770 194911 195252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 197521 195233 gene locus_tag LOCUS_06780 197521 195233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 199869 197572 gene locus_tag LOCUS_06790 199869 197572 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_06790 200259 200333 gene locus_tag LOCUS_t00060 200259 200333 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 200353 200440 gene locus_tag LOCUS_t00070 200353 200440 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 202301 200457 gene locus_tag LOCUS_06800 202301 200457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 202566 203462 gene locus_tag LOCUS_06810 202566 203462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_06810 204862 203465 gene locus_tag LOCUS_06820 204862 203465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 206375 204864 gene locus_tag LOCUS_06830 206375 204864 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_06830 206693 207286 gene locus_tag LOCUS_06840 206693 207286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 207763 208062 gene locus_tag LOCUS_06850 207763 208062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 209412 210038 gene locus_tag LOCUS_06860 209412 210038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 210673 210452 gene locus_tag LOCUS_06870 210673 210452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 210685 211143 gene locus_tag LOCUS_06880 210685 211143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 211140 213044 gene locus_tag LOCUS_06890 211140 213044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 213063 215609 gene locus_tag LOCUS_06900 213063 215609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 215826 216560 gene locus_tag LOCUS_06910 215826 216560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 216688 217341 gene locus_tag LOCUS_06920 216688 217341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 217350 218759 gene locus_tag LOCUS_06930 217350 218759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 218756 219385 gene locus_tag LOCUS_06940 218756 219385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 219407 224227 gene locus_tag LOCUS_06950 219407 224227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 224227 224961 gene locus_tag LOCUS_06960 224227 224961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 225265 224912 gene locus_tag LOCUS_06970 225265 224912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 225173 226927 gene locus_tag LOCUS_06980 225173 226927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 226940 228310 gene locus_tag LOCUS_06990 226940 228310 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_06990 229502 228315 gene locus_tag LOCUS_07000 229502 228315 CDS product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_07000 230810 229593 gene locus_tag LOCUS_07010 230810 229593 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_07010 231254 232120 gene locus_tag LOCUS_07020 gene paaH 231254 232120 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_07020 232210 232455 gene locus_tag LOCUS_07030 232210 232455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 232462 233640 gene locus_tag LOCUS_07040 232462 233640 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_07040 233727 234761 gene locus_tag LOCUS_07050 233727 234761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226588.1 protein_id gnl|my_center|LOCUS_07050 234786 245678 gene locus_tag LOCUS_07060 234786 245678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 245675 250294 gene locus_tag LOCUS_07070 245675 250294 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973237.1 protein_id gnl|my_center|LOCUS_07070 250304 251281 gene locus_tag LOCUS_07080 250304 251281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103869.1 protein_id gnl|my_center|LOCUS_07080 251297 260680 gene locus_tag LOCUS_07090 251297 260680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 260705 263137 gene locus_tag LOCUS_07100 260705 263137 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_07100 263134 269625 gene locus_tag LOCUS_07110 263134 269625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 269622 280217 gene locus_tag LOCUS_07120 269622 280217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 282666 280234 gene locus_tag LOCUS_07130 282666 280234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_07130 284044 282764 gene locus_tag LOCUS_07140 284044 282764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 286424 284061 gene locus_tag LOCUS_07150 286424 284061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_07150 286467 289349 gene locus_tag LOCUS_07160 286467 289349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 289861 291168 gene locus_tag LOCUS_07170 289861 291168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 292490 291180 gene locus_tag LOCUS_07180 292490 291180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 295534 292487 gene locus_tag LOCUS_07190 295534 292487 CDS product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974633.1 protein_id gnl|my_center|LOCUS_07190 296652 295531 gene locus_tag LOCUS_07200 296652 295531 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_07200 296850 297314 gene locus_tag LOCUS_07210 296850 297314 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709384.1 protein_id gnl|my_center|LOCUS_07210 298786 297311 gene locus_tag LOCUS_07220 298786 297311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 299818 298802 gene locus_tag LOCUS_07230 299818 298802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 303075 299872 gene locus_tag LOCUS_07240 303075 299872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 303331 303068 gene locus_tag LOCUS_07250 303331 303068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 303819 303583 gene locus_tag LOCUS_07260 303819 303583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 303776 304027 gene locus_tag LOCUS_07270 303776 304027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 304141 304869 gene locus_tag LOCUS_07280 304141 304869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 304892 306763 gene locus_tag LOCUS_07290 304892 306763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 306774 309188 gene locus_tag LOCUS_07300 306774 309188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 309175 310050 gene locus_tag LOCUS_07310 309175 310050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 310064 311206 gene locus_tag LOCUS_07320 310064 311206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 311245 312834 gene locus_tag LOCUS_07330 311245 312834 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_07330 313682 313230 gene locus_tag LOCUS_07340 313682 313230 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393869.1 protein_id gnl|my_center|LOCUS_07340 313578 313775 gene locus_tag LOCUS_07350 313578 313775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 314943 313777 gene locus_tag LOCUS_07360 314943 313777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 315012 315959 gene locus_tag LOCUS_07370 315012 315959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 315980 318841 gene locus_tag LOCUS_07380 315980 318841 CDS product ABC-ATPase UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_07380 319064 318855 gene locus_tag LOCUS_07390 319064 318855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 320413 319190 gene locus_tag LOCUS_07400 320413 319190 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGZ5 protein_id gnl|my_center|LOCUS_07400 321399 320416 gene locus_tag LOCUS_07410 321399 320416 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_07410 322616 321396 gene locus_tag LOCUS_07420 322616 321396 CDS product selenium metabolism hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869177.1 protein_id gnl|my_center|LOCUS_07420 324132 322603 gene locus_tag LOCUS_07430 324132 322603 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_07430 325500 324136 gene locus_tag LOCUS_07440 325500 324136 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869175.1 protein_id gnl|my_center|LOCUS_07440 327252 325576 gene locus_tag LOCUS_07450 327252 325576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 328154 327585 gene locus_tag LOCUS_07460 328154 327585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225405.1 protein_id gnl|my_center|LOCUS_07460 328660 328989 gene locus_tag LOCUS_07470 328660 328989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 329082 329618 gene locus_tag LOCUS_07480 329082 329618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 331157 329655 gene locus_tag LOCUS_07490 331157 329655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 331900 331613 gene locus_tag LOCUS_07500 331900 331613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 331954 337089 gene locus_tag LOCUS_07510 331954 337089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 340384 338420 gene locus_tag LOCUS_07520 340384 338420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 360620 340440 gene locus_tag LOCUS_07530 360620 340440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 360921 361283 gene locus_tag LOCUS_07540 360921 361283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 362295 362444 gene locus_tag LOCUS_07550 362295 362444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 365070 365366 gene locus_tag LOCUS_07560 365070 365366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 367357 369438 gene locus_tag LOCUS_07570 367357 369438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 369491 370822 gene locus_tag LOCUS_07580 369491 370822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 370841 372721 gene locus_tag LOCUS_07590 370841 372721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 372849 373082 gene locus_tag LOCUS_07600 372849 373082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 373329 376592 gene locus_tag LOCUS_07610 373329 376592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07610 377186 376623 gene locus_tag LOCUS_07620 377186 376623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 378778 377165 gene locus_tag LOCUS_07630 378778 377165 CDS product fatty aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_07630 379695 378790 gene locus_tag LOCUS_07640 gene dapA 379695 378790 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_07640 381035 379719 gene locus_tag LOCUS_07650 381035 379719 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205391.1 protein_id gnl|my_center|LOCUS_07650 381297 381028 gene locus_tag LOCUS_07660 381297 381028 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368424.1 protein_id gnl|my_center|LOCUS_07660 382517 381333 gene locus_tag LOCUS_07670 382517 381333 CDS product D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637768.2 protein_id gnl|my_center|LOCUS_07670 383467 382514 gene locus_tag LOCUS_07680 383467 382514 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NG7 protein_id gnl|my_center|LOCUS_07680 383707 383988 gene locus_tag LOCUS_07690 383707 383988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 383993 387805 gene locus_tag LOCUS_07700 383993 387805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 387889 388575 gene locus_tag LOCUS_07710 387889 388575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 389628 388600 gene locus_tag LOCUS_07720 gene fabH 389628 388600 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5P1 protein_id gnl|my_center|LOCUS_07720 389868 390557 gene locus_tag LOCUS_07730 gene yqjF 389868 390557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_07730 390777 393713 gene locus_tag LOCUS_07740 390777 393713 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030528.1 protein_id gnl|my_center|LOCUS_07740 393852 396053 gene locus_tag LOCUS_07750 393852 396053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 396091 396969 gene locus_tag LOCUS_07760 396091 396969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 396962 399127 gene locus_tag LOCUS_07770 396962 399127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 400214 399144 gene locus_tag LOCUS_07780 400214 399144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_07780 400419 402380 gene locus_tag LOCUS_07790 400419 402380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 402406 403137 gene locus_tag LOCUS_07800 402406 403137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 403734 404483 gene locus_tag LOCUS_07810 403734 404483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 406037 404799 gene locus_tag LOCUS_07820 406037 404799 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_07820 407524 406049 gene locus_tag LOCUS_07830 407524 406049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 409119 407521 gene locus_tag LOCUS_07840 409119 407521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 409287 410417 gene locus_tag LOCUS_07850 409287 410417 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_07850 410414 412207 gene locus_tag LOCUS_07860 410414 412207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 412243 414069 gene locus_tag LOCUS_07870 412243 414069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 415258 414428 gene locus_tag LOCUS_07880 415258 414428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 415343 416098 gene locus_tag LOCUS_07890 gene sfsA 415343 416098 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_07890 416253 418976 gene locus_tag LOCUS_07900 416253 418976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 419010 422321 gene locus_tag LOCUS_07910 419010 422321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 423392 422520 gene locus_tag LOCUS_07920 423392 422520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 424362 423406 gene locus_tag LOCUS_07930 424362 423406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 426200 424359 gene locus_tag LOCUS_07940 426200 424359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 428134 426197 gene locus_tag LOCUS_07950 428134 426197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 428140 430719 gene locus_tag LOCUS_07960 428140 430719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 432019 431120 gene locus_tag LOCUS_07970 432019 431120 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_07970 434265 432133 gene locus_tag LOCUS_07980 434265 432133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 437377 434636 gene locus_tag LOCUS_07990 437377 434636 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920434.1 protein_id gnl|my_center|LOCUS_07990 438238 437519 gene locus_tag LOCUS_08000 438238 437519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 439267 438476 gene locus_tag LOCUS_08010 439267 438476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 439672 439343 gene locus_tag LOCUS_08020 439672 439343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 439874 440347 gene locus_tag LOCUS_08030 439874 440347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 440990 440568 gene locus_tag LOCUS_08040 gene vapc5 440990 440568 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P4M9 protein_id gnl|my_center|LOCUS_08040 441238 440987 gene locus_tag LOCUS_08050 441238 440987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 441350 443311 gene locus_tag LOCUS_08060 441350 443311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 443298 444491 gene locus_tag LOCUS_08070 gene galK 443298 444491 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M60 protein_id gnl|my_center|LOCUS_08070 448435 444494 gene locus_tag LOCUS_08080 448435 444494 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_08080 448518 449996 gene locus_tag LOCUS_08090 448518 449996 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_08090 450932 449970 gene locus_tag LOCUS_08100 450932 449970 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_08100 452481 450943 gene locus_tag LOCUS_08110 452481 450943 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_08110 453815 452481 gene locus_tag LOCUS_08120 453815 452481 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_08120 455587 453890 gene locus_tag LOCUS_08130 455587 453890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 455730 457910 gene locus_tag LOCUS_08140 455730 457910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 457926 459803 gene locus_tag LOCUS_08150 457926 459803 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088443.1 protein_id gnl|my_center|LOCUS_08150 459794 462262 gene locus_tag LOCUS_08160 gene pepN 459794 462262 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_08160 462335 464593 gene locus_tag LOCUS_08170 462335 464593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 466340 464625 gene locus_tag LOCUS_08180 466340 464625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 467231 466350 gene locus_tag LOCUS_08190 467231 466350 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_08190 467617 467228 gene locus_tag LOCUS_08200 gene gntR 467617 467228 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_08200 468114 472250 gene locus_tag LOCUS_08210 468114 472250 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_08210 472338 472514 gene locus_tag LOCUS_08220 472338 472514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 474851 472551 gene locus_tag LOCUS_08230 474851 472551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 474944 476497 gene locus_tag LOCUS_08240 474944 476497 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_08240 475060 475139 gene locus_tag LOCUS_t00080 475060 475139 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 476488 476988 gene locus_tag LOCUS_08250 476488 476988 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_08250 477061 478422 gene locus_tag LOCUS_08260 477061 478422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 478940 478458 gene locus_tag LOCUS_08270 478940 478458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 480157 478937 gene locus_tag LOCUS_08280 480157 478937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 481692 480154 gene locus_tag LOCUS_08290 gene lysS 481692 480154 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_08290 483214 481766 gene locus_tag LOCUS_08300 gene abfD 483214 481766 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_08300 486129 483403 gene locus_tag LOCUS_08310 gene ppc 486129 483403 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_08310 486200 488062 gene locus_tag LOCUS_08320 486200 488062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_08320 488566 489276 gene locus_tag LOCUS_08330 488566 489276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 494391 489346 gene locus_tag LOCUS_08340 494391 489346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 495740 494388 gene locus_tag LOCUS_08350 495740 494388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 497036 495801 gene locus_tag LOCUS_08360 497036 495801 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_08360 498084 497134 gene locus_tag LOCUS_08370 498084 497134 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_08370 499724 498201 gene locus_tag LOCUS_08380 499724 498201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 500527 499763 gene locus_tag LOCUS_08390 500527 499763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 500963 502414 gene locus_tag LOCUS_08400 500963 502414 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_08400 502398 502601 gene locus_tag LOCUS_08410 502398 502601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 504137 503136 gene locus_tag LOCUS_08420 504137 503136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 504521 504150 gene locus_tag LOCUS_08430 504521 504150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706237.1 protein_id gnl|my_center|LOCUS_08430 505648 504518 gene locus_tag LOCUS_08440 gene pyrD 505648 504518 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_08440 505752 507113 gene locus_tag LOCUS_08450 505752 507113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 507110 509353 gene locus_tag LOCUS_08460 507110 509353 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_08460 509357 512356 gene locus_tag LOCUS_08470 509357 512356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 512377 512919 gene locus_tag LOCUS_08480 512377 512919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 513011 513472 gene locus_tag LOCUS_08490 513011 513472 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_08490 513488 514996 gene locus_tag LOCUS_08500 513488 514996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 514993 515895 gene locus_tag LOCUS_08510 514993 515895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 515892 516443 gene locus_tag LOCUS_08520 515892 516443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 518986 516473 gene locus_tag LOCUS_08530 518986 516473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_08530 519158 519940 gene locus_tag LOCUS_08540 519158 519940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 519967 523980 gene locus_tag LOCUS_08550 519967 523980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 524077 525786 gene locus_tag LOCUS_08560 gene mphR 524077 525786 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_08560 527539 525794 gene locus_tag LOCUS_08570 527539 525794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 527504 527716 gene locus_tag LOCUS_08580 527504 527716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 530311 527858 gene locus_tag LOCUS_08590 gene dinG 530311 527858 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_08590 530455 531150 gene locus_tag LOCUS_08600 530455 531150 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_08600 531153 533066 gene locus_tag LOCUS_08610 gene sdhA 531153 533066 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_08610 533066 533827 gene locus_tag LOCUS_08620 533066 533827 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_08620 534770 534402 gene locus_tag LOCUS_08630 534770 534402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 535401 534901 gene locus_tag LOCUS_08640 535401 534901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 535538 535614 gene locus_tag LOCUS_t00090 535538 535614 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 535703 535779 gene locus_tag LOCUS_t00100 535703 535779 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 535864 537783 gene locus_tag LOCUS_08650 gene thrS 535864 537783 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L8 protein_id gnl|my_center|LOCUS_08650 537836 538030 gene locus_tag LOCUS_08660 537836 538030 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_08660 538162 538521 gene locus_tag LOCUS_08670 gene rplT 538162 538521 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_08670 538700 538936 gene locus_tag LOCUS_08680 538700 538936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 539057 539377 gene locus_tag LOCUS_08690 539057 539377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 539692 541281 gene locus_tag LOCUS_08700 539692 541281 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_08700 541301 542140 gene locus_tag LOCUS_08710 541301 542140 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_08710 542137 543336 gene locus_tag LOCUS_08720 542137 543336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_08720 543869 543333 gene locus_tag LOCUS_08730 543869 543333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532976.1 protein_id gnl|my_center|LOCUS_08730 543906 544199 gene locus_tag LOCUS_08740 543906 544199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 544209 544586 gene locus_tag LOCUS_08750 544209 544586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121790.1 protein_id gnl|my_center|LOCUS_08750 544641 546035 gene locus_tag LOCUS_08760 544641 546035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_08760 547278 545944 gene locus_tag LOCUS_08770 547278 545944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 547605 547357 gene locus_tag LOCUS_08780 547605 547357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 548426 547665 gene locus_tag LOCUS_08790 548426 547665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 550146 548665 gene locus_tag LOCUS_08800 550146 548665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 550121 550951 gene locus_tag LOCUS_08810 550121 550951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_08810 550948 552831 gene locus_tag LOCUS_08820 550948 552831 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_08820 554979 552853 gene locus_tag LOCUS_08830 554979 552853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 555398 554979 gene locus_tag LOCUS_08840 555398 554979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 556593 556366 gene locus_tag LOCUS_08850 556593 556366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 558643 556838 gene locus_tag LOCUS_08860 558643 556838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765190.1 protein_id gnl|my_center|LOCUS_08860 559849 558689 gene locus_tag LOCUS_08870 gene dinB 559849 558689 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_08870 560139 560549 gene locus_tag LOCUS_08880 560139 560549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence03 338 1684 gene locus_tag LOCUS_08890 338 1684 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_08890 1952 3103 gene locus_tag LOCUS_08900 1952 3103 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_08900 3100 3543 gene locus_tag LOCUS_08910 3100 3543 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_08910 3540 3863 gene locus_tag LOCUS_08920 3540 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5173 4253 gene locus_tag LOCUS_08930 5173 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5320 5715 gene locus_tag LOCUS_08940 5320 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5755 6039 gene locus_tag LOCUS_08950 5755 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6221 7408 gene locus_tag LOCUS_08960 6221 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7968 7462 gene locus_tag LOCUS_08970 7968 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9909 7990 gene locus_tag LOCUS_08980 9909 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119331.1 protein_id gnl|my_center|LOCUS_08980 10003 11328 gene locus_tag LOCUS_08990 10003 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13070 11331 gene locus_tag LOCUS_09000 13070 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 13129 13353 gene locus_tag LOCUS_09010 13129 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13761 13324 gene locus_tag LOCUS_09020 13761 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 15476 13758 gene locus_tag LOCUS_09030 15476 13758 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09030 18028 15491 gene locus_tag LOCUS_09040 18028 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 19661 18051 gene locus_tag LOCUS_09050 19661 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 21362 19758 gene locus_tag LOCUS_09060 21362 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 21966 23750 gene locus_tag LOCUS_09070 21966 23750 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_09070 27184 24707 gene locus_tag LOCUS_09080 27184 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 28607 27258 gene locus_tag LOCUS_09090 28607 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 28882 31137 gene locus_tag LOCUS_09100 28882 31137 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_09100 32608 31151 gene locus_tag LOCUS_09110 32608 31151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 32920 32732 gene locus_tag LOCUS_09120 32920 32732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 33287 32913 gene locus_tag LOCUS_09130 33287 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 34066 33290 gene locus_tag LOCUS_09140 34066 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 35510 34053 gene locus_tag LOCUS_09150 35510 34053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_09150 36582 35527 gene locus_tag LOCUS_09160 36582 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 37193 36579 gene locus_tag LOCUS_09170 37193 36579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 40765 37388 gene locus_tag LOCUS_09180 40765 37388 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_09180 42115 40775 gene locus_tag LOCUS_09190 42115 40775 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_09190 43950 42136 gene locus_tag LOCUS_09200 43950 42136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 44123 45112 gene locus_tag LOCUS_09210 44123 45112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 45148 46176 gene locus_tag LOCUS_09220 45148 46176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 46198 48078 gene locus_tag LOCUS_09230 46198 48078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 48093 52010 gene locus_tag LOCUS_09240 48093 52010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 52032 52403 gene locus_tag LOCUS_09250 52032 52403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 52412 53629 gene locus_tag LOCUS_09260 52412 53629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708720.1 protein_id gnl|my_center|LOCUS_09260 53647 55011 gene locus_tag LOCUS_09270 53647 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 55991 54978 gene locus_tag LOCUS_09280 55991 54978 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_09280 56603 57199 gene locus_tag LOCUS_09290 56603 57199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_09290 57209 58858 gene locus_tag LOCUS_09300 57209 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 61294 58868 gene locus_tag LOCUS_09310 61294 58868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_09310 61529 62308 gene locus_tag LOCUS_09320 61529 62308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 62477 65548 gene locus_tag LOCUS_09330 62477 65548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 65583 65936 gene locus_tag LOCUS_09340 65583 65936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 65923 66324 gene locus_tag LOCUS_09350 65923 66324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 66403 67836 gene locus_tag LOCUS_09360 66403 67836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 69029 67863 gene locus_tag LOCUS_09370 69029 67863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 71512 69062 gene locus_tag LOCUS_09380 71512 69062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_09380 71609 72820 gene locus_tag LOCUS_09390 71609 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 72929 73378 gene locus_tag LOCUS_09400 72929 73378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 73924 73397 gene locus_tag LOCUS_09410 73924 73397 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_09410 76840 73979 gene locus_tag LOCUS_09420 76840 73979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 77480 76842 gene locus_tag LOCUS_09430 77480 76842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479123.1 protein_id gnl|my_center|LOCUS_09430 77586 79598 gene locus_tag LOCUS_09440 gene ligA 77586 79598 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HP94 protein_id gnl|my_center|LOCUS_09440 79595 80032 gene locus_tag LOCUS_09450 79595 80032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 81276 79933 gene locus_tag LOCUS_09460 81276 79933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_09460 83022 81292 gene locus_tag LOCUS_09470 83022 81292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_09470 83575 84396 gene locus_tag LOCUS_09480 83575 84396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 84397 85404 gene locus_tag LOCUS_09490 gene oruR 84397 85404 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_09490 85522 86370 gene locus_tag LOCUS_09500 85522 86370 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_09500 86367 86861 gene locus_tag LOCUS_09510 86367 86861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_09510 87033 87893 gene locus_tag LOCUS_09520 87033 87893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 87998 88723 gene locus_tag LOCUS_09530 87998 88723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 90100 88739 gene locus_tag LOCUS_09540 90100 88739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 90594 90385 gene locus_tag LOCUS_09550 90594 90385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 90520 92715 gene locus_tag LOCUS_09560 90520 92715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_09560 92727 93707 gene locus_tag LOCUS_09570 92727 93707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 93704 94699 gene locus_tag LOCUS_09580 93704 94699 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_09580 95825 94710 gene locus_tag LOCUS_09590 95825 94710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 96900 95905 gene locus_tag LOCUS_09600 96900 95905 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_09600 99800 96966 gene locus_tag LOCUS_09610 gene nrdA 99800 96966 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D561 protein_id gnl|my_center|LOCUS_09610 100172 101527 gene locus_tag LOCUS_09620 100172 101527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_09620 101535 103922 gene locus_tag LOCUS_09630 101535 103922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 104436 106085 gene locus_tag LOCUS_09640 104436 106085 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX68 protein_id gnl|my_center|LOCUS_09640 106085 107719 gene locus_tag LOCUS_09650 106085 107719 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037204.1 protein_id gnl|my_center|LOCUS_09650 107776 109560 gene locus_tag LOCUS_09660 107776 109560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_09660 109734 110225 gene locus_tag LOCUS_09670 109734 110225 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_09670 110446 110991 gene locus_tag LOCUS_09680 110446 110991 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_09680 110988 111875 gene locus_tag LOCUS_09690 110988 111875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 111882 113768 gene locus_tag LOCUS_09700 111882 113768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 113849 116530 gene locus_tag LOCUS_09710 113849 116530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 118388 116514 gene locus_tag LOCUS_09720 118388 116514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_09720 119396 118392 gene locus_tag LOCUS_09730 119396 118392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 119527 120591 gene locus_tag LOCUS_09740 119527 120591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_09740 120597 122126 gene locus_tag LOCUS_09750 gene rumA 120597 122126 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_09750 122520 123146 gene locus_tag LOCUS_09760 gene folE 122520 123146 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJV0 protein_id gnl|my_center|LOCUS_09760 123154 123741 gene locus_tag LOCUS_09770 123154 123741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 123766 124851 gene locus_tag LOCUS_09780 gene fabH2 123766 124851 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_09780 124990 125430 gene locus_tag LOCUS_09790 124990 125430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 125522 126136 gene locus_tag LOCUS_09800 125522 126136 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_09800 126137 127447 gene locus_tag LOCUS_09810 126137 127447 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946024.1 protein_id gnl|my_center|LOCUS_09810 127777 129000 gene locus_tag LOCUS_09820 127777 129000 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_09820 129450 129001 gene locus_tag LOCUS_09830 129450 129001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 130298 129477 gene locus_tag LOCUS_09840 130298 129477 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_09840 130777 130295 gene locus_tag LOCUS_09850 130777 130295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 134521 131201 gene locus_tag LOCUS_09860 134521 131201 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_09860 135677 134514 gene locus_tag LOCUS_09870 135677 134514 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403253.1 protein_id gnl|my_center|LOCUS_09870 137137 135677 gene locus_tag LOCUS_09880 137137 135677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038813.1 protein_id gnl|my_center|LOCUS_09880 137829 137134 gene locus_tag LOCUS_09890 137829 137134 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_09890 137968 138426 gene locus_tag LOCUS_09900 137968 138426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 138423 139829 gene locus_tag LOCUS_09910 138423 139829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 139826 141193 gene locus_tag LOCUS_09920 139826 141193 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_09920 141290 141829 gene locus_tag LOCUS_09930 141290 141829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 141819 142436 gene locus_tag LOCUS_09940 gene msrA 141819 142436 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_09940 143548 142622 gene locus_tag LOCUS_09950 gene gnnA 143548 142622 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_09950 144380 143565 gene locus_tag LOCUS_09960 gene lpxA 144380 143565 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHD2 protein_id gnl|my_center|LOCUS_09960 144840 144391 gene locus_tag LOCUS_09970 gene fabZ 144840 144391 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25928 protein_id gnl|my_center|LOCUS_09970 145907 144837 gene locus_tag LOCUS_09980 gene lpxD 145907 144837 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR8 protein_id gnl|my_center|LOCUS_09980 146428 145907 gene locus_tag LOCUS_09990 146428 145907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 149070 146476 gene locus_tag LOCUS_10000 149070 146476 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_10000 149381 149587 gene locus_tag LOCUS_10010 149381 149587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_10010 149857 149639 gene locus_tag LOCUS_10020 149857 149639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 151895 149889 gene locus_tag LOCUS_10030 151895 149889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 155401 151874 gene locus_tag LOCUS_10040 155401 151874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 159255 155455 gene locus_tag LOCUS_10050 159255 155455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 159485 161029 gene locus_tag LOCUS_10060 159485 161029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 161050 163194 gene locus_tag LOCUS_10070 161050 163194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 163237 163464 gene locus_tag LOCUS_10080 163237 163464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 165437 164346 gene locus_tag LOCUS_10090 165437 164346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 165706 167616 gene locus_tag LOCUS_10100 165706 167616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 168506 167595 gene locus_tag LOCUS_10110 168506 167595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 169850 168747 gene locus_tag LOCUS_10120 169850 168747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_10120 170366 170296 gene locus_tag LOCUS_t00110 170366 170296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 170795 171940 gene locus_tag LOCUS_10130 170795 171940 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_10130 172013 173116 gene locus_tag LOCUS_10140 172013 173116 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_10140 173749 173189 gene locus_tag LOCUS_10150 173749 173189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 177015 173911 gene locus_tag LOCUS_10160 177015 173911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 177347 177940 gene locus_tag LOCUS_10170 177347 177940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 179388 177958 gene locus_tag LOCUS_10180 179388 177958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 179573 181753 gene locus_tag LOCUS_10190 179573 181753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 183668 182187 gene locus_tag LOCUS_10200 183668 182187 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256316.1 protein_id gnl|my_center|LOCUS_10200 184288 183746 gene locus_tag LOCUS_10210 gene kdsC 184288 183746 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_10210 185247 184285 gene locus_tag LOCUS_10220 gene kdsD 185247 184285 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_10220 185336 186928 gene locus_tag LOCUS_10230 185336 186928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_10230 188205 186925 gene locus_tag LOCUS_10240 188205 186925 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 protein_id gnl|my_center|LOCUS_10240 188277 188660 gene locus_tag LOCUS_10250 188277 188660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 188657 189082 gene locus_tag LOCUS_10260 188657 189082 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_10260 190657 189167 gene locus_tag LOCUS_10270 190657 189167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 192932 190647 gene locus_tag LOCUS_10280 192932 190647 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_10280 193180 194850 gene locus_tag LOCUS_10290 193180 194850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 194990 195364 gene locus_tag LOCUS_10300 194990 195364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 195440 196237 gene locus_tag LOCUS_10310 195440 196237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_10310 196269 196535 gene locus_tag LOCUS_10320 196269 196535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 197691 196561 gene locus_tag LOCUS_10330 197691 196561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_10330 198887 197733 gene locus_tag LOCUS_10340 gene czcB 198887 197733 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_10340 199395 199048 gene locus_tag LOCUS_10350 199395 199048 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888442.1 protein_id gnl|my_center|LOCUS_10350 199696 199385 gene locus_tag LOCUS_10360 199696 199385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_10360 201676 199754 gene locus_tag LOCUS_10370 201676 199754 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_10370 202458 201673 gene locus_tag LOCUS_10380 202458 201673 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_10380 203968 202484 gene locus_tag LOCUS_10390 203968 202484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 204072 204770 gene locus_tag LOCUS_10400 gene deoD 204072 204770 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81FV5 protein_id gnl|my_center|LOCUS_10400 205184 204819 gene locus_tag LOCUS_10410 205184 204819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_10410 207982 205190 gene locus_tag LOCUS_10420 207982 205190 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_10420 209528 208008 gene locus_tag LOCUS_10430 209528 208008 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_10430 210148 209660 gene locus_tag LOCUS_10440 210148 209660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 211742 210294 gene locus_tag LOCUS_10450 211742 210294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_10450 211836 213593 gene locus_tag LOCUS_10460 gene sglT 211836 213593 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_10460 213685 215475 gene locus_tag LOCUS_10470 213685 215475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 215504 216697 gene locus_tag LOCUS_10480 215504 216697 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_10480 216694 217716 gene locus_tag LOCUS_10490 216694 217716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 220362 218449 gene locus_tag LOCUS_10500 220362 218449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 218511 218601 gene locus_tag LOCUS_t00120 218511 218601 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 222484 220571 gene locus_tag LOCUS_10510 222484 220571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 223482 222520 gene locus_tag LOCUS_10520 223482 222520 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_10520 222869 222785 gene locus_tag LOCUS_t00130 222869 222785 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 223888 223472 gene locus_tag LOCUS_10530 223888 223472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 223996 225771 gene locus_tag LOCUS_10540 223996 225771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 225794 226453 gene locus_tag LOCUS_10550 gene tmk 225794 226453 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_10550 226450 227274 gene locus_tag LOCUS_10560 226450 227274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 227493 228545 gene locus_tag LOCUS_10570 gene dsbG 227493 228545 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_10570 229798 228578 gene locus_tag LOCUS_10580 229798 228578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 229950 230606 gene locus_tag LOCUS_10590 229950 230606 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_10590 230623 231426 gene locus_tag LOCUS_10600 gene thiG 230623 231426 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_10600 231632 233557 gene locus_tag LOCUS_10610 231632 233557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_10610 233689 234591 gene locus_tag LOCUS_10620 233689 234591 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_10620 234603 238217 gene locus_tag LOCUS_10630 234603 238217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_10630 238995 238204 gene locus_tag LOCUS_10640 238995 238204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 239068 240036 gene locus_tag LOCUS_10650 gene glk 239068 240036 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64254 protein_id gnl|my_center|LOCUS_10650 240055 241266 gene locus_tag LOCUS_10660 240055 241266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 241326 242381 gene locus_tag LOCUS_10670 241326 242381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 242386 243255 gene locus_tag LOCUS_10680 242386 243255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 243233 244405 gene locus_tag LOCUS_10690 243233 244405 CDS product putative mannose-6-phosphate isomerase ManA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704330.1 protein_id gnl|my_center|LOCUS_10690 246891 245101 gene locus_tag LOCUS_10700 246891 245101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 247009 252642 gene locus_tag LOCUS_10710 247009 252642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_10710 252713 253099 gene locus_tag LOCUS_10720 252713 253099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 253096 253545 gene locus_tag LOCUS_10730 253096 253545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 253562 254140 gene locus_tag LOCUS_10740 253562 254140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 254118 254480 gene locus_tag LOCUS_10750 254118 254480 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_10750 254483 255094 gene locus_tag LOCUS_10760 254483 255094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 255101 255442 gene locus_tag LOCUS_10770 255101 255442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 255463 256800 gene locus_tag LOCUS_10780 255463 256800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 256885 256810 gene locus_tag LOCUS_t00140 256885 256810 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 256986 256909 gene locus_tag LOCUS_t00150 256986 256909 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 257084 257009 gene locus_tag LOCUS_t00160 257084 257009 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 257167 257091 gene locus_tag LOCUS_t00170 257167 257091 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 257275 257200 gene locus_tag LOCUS_t00180 257275 257200 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 257374 257298 gene locus_tag LOCUS_t00190 257374 257298 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 257476 257402 gene locus_tag LOCUS_t00200 257476 257402 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 257561 257485 gene locus_tag LOCUS_t00210 257561 257485 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 259143 258148 gene locus_tag LOCUS_10790 259143 258148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 259335 260783 gene locus_tag LOCUS_10800 259335 260783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 260793 261479 gene locus_tag LOCUS_10810 260793 261479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 261974 261534 gene locus_tag LOCUS_10820 261974 261534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 262417 261998 gene locus_tag LOCUS_10830 262417 261998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 263231 262482 gene locus_tag LOCUS_10840 gene trmJ 263231 262482 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G5 protein_id gnl|my_center|LOCUS_10840 263845 263231 gene locus_tag LOCUS_10850 263845 263231 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_10850 266439 263842 gene locus_tag LOCUS_10860 266439 263842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 267352 266468 gene locus_tag LOCUS_10870 267352 266468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 268153 267404 gene locus_tag LOCUS_10880 268153 267404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 268082 271387 gene locus_tag LOCUS_10890 268082 271387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 272214 271921 gene locus_tag LOCUS_10900 272214 271921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 272442 272218 gene locus_tag LOCUS_10910 272442 272218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 272788 273279 gene locus_tag LOCUS_10920 272788 273279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 273450 274448 gene locus_tag LOCUS_10930 273450 274448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 275811 274465 gene locus_tag LOCUS_10940 275811 274465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 275912 277195 gene locus_tag LOCUS_10950 275912 277195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 277189 278034 gene locus_tag LOCUS_10960 277189 278034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 278034 280370 gene locus_tag LOCUS_10970 278034 280370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 280381 281121 gene locus_tag LOCUS_10980 280381 281121 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 protein_id gnl|my_center|LOCUS_10980 281121 281546 gene locus_tag LOCUS_10990 281121 281546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 282887 281556 gene locus_tag LOCUS_11000 gene pyrC 282887 281556 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_11000 282956 285400 gene locus_tag LOCUS_11010 282956 285400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 286789 285413 gene locus_tag LOCUS_11020 286789 285413 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_11020 287899 286799 gene locus_tag LOCUS_11030 287899 286799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 287970 288710 gene locus_tag LOCUS_11040 gene ate 287970 288710 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_11040 289708 288776 gene locus_tag LOCUS_11050 289708 288776 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_11050 290510 289776 gene locus_tag LOCUS_11060 290510 289776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 290509 291312 gene locus_tag LOCUS_11070 290509 291312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_11070 291323 292714 gene locus_tag LOCUS_11080 291323 292714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 292774 293409 gene locus_tag LOCUS_11090 292774 293409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 293402 294850 gene locus_tag LOCUS_11100 293402 294850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 295209 294871 gene locus_tag LOCUS_11110 295209 294871 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_11110 295430 295206 gene locus_tag LOCUS_11120 295430 295206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 295562 298000 gene locus_tag LOCUS_11130 295562 298000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_11130 301116 298486 gene locus_tag LOCUS_11140 301116 298486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 302430 301171 gene locus_tag LOCUS_11150 302430 301171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 302579 303355 gene locus_tag LOCUS_11160 302579 303355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 304824 303352 gene locus_tag LOCUS_11170 304824 303352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 305147 306781 gene locus_tag LOCUS_11180 305147 306781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 306873 308219 gene locus_tag LOCUS_11190 306873 308219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 309230 308235 gene locus_tag LOCUS_11200 309230 308235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 310042 309227 gene locus_tag LOCUS_11210 310042 309227 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_11210 311118 310051 gene locus_tag LOCUS_11220 311118 310051 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723775.1 protein_id gnl|my_center|LOCUS_11220 312675 311242 gene locus_tag LOCUS_11230 312675 311242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 313301 312690 gene locus_tag LOCUS_11240 313301 312690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 316362 313459 gene locus_tag LOCUS_11250 316362 313459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143648.1 protein_id gnl|my_center|LOCUS_11250 316945 316364 gene locus_tag LOCUS_11260 316945 316364 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972148.1 protein_id gnl|my_center|LOCUS_11260 318695 316965 gene locus_tag LOCUS_11270 gene oppA 318695 316965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_11270 319566 318712 gene locus_tag LOCUS_11280 319566 318712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 320531 319566 gene locus_tag LOCUS_11290 320531 319566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_11290 320641 320565 gene locus_tag LOCUS_t00220 320641 320565 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 320782 320706 gene locus_tag LOCUS_t00230 320782 320706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 320894 320818 gene locus_tag LOCUS_t00240 320894 320818 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 321114 321749 gene locus_tag LOCUS_11300 321114 321749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 321746 323143 gene locus_tag LOCUS_11310 gene rsaFb 321746 323143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_11310 323140 323973 gene locus_tag LOCUS_11320 323140 323973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 323977 327135 gene locus_tag LOCUS_11330 323977 327135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 327413 327985 gene locus_tag LOCUS_11340 327413 327985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 327978 328298 gene locus_tag LOCUS_11350 327978 328298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 328529 329497 gene locus_tag LOCUS_11360 328529 329497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 329656 331476 gene locus_tag LOCUS_11370 329656 331476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 332940 331540 gene locus_tag LOCUS_11380 332940 331540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 335023 333068 gene locus_tag LOCUS_11390 335023 333068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 336993 335023 gene locus_tag LOCUS_11400 336993 335023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 337937 337026 gene locus_tag LOCUS_11410 337937 337026 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_11410 338370 337930 gene locus_tag LOCUS_11420 338370 337930 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_11420 338514 341813 gene locus_tag LOCUS_11430 338514 341813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_11430 341823 342653 gene locus_tag LOCUS_11440 341823 342653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 342669 343541 gene locus_tag LOCUS_11450 342669 343541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 343541 345289 gene locus_tag LOCUS_11460 343541 345289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 345902 345312 gene locus_tag LOCUS_11470 345902 345312 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_11470 345973 346299 gene locus_tag LOCUS_11480 345973 346299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 347866 346493 gene locus_tag LOCUS_11490 347866 346493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 347980 348231 gene locus_tag LOCUS_11500 347980 348231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 348228 348482 gene locus_tag LOCUS_11510 348228 348482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 349855 348527 gene locus_tag LOCUS_11520 gene folC 349855 348527 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_11520 353607 349852 gene locus_tag LOCUS_11530 353607 349852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 353666 354367 gene locus_tag LOCUS_11540 353666 354367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 354395 355024 gene locus_tag LOCUS_11550 gene upp 354395 355024 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXY9 protein_id gnl|my_center|LOCUS_11550 355401 359081 gene locus_tag LOCUS_11560 gene metH 355401 359081 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_11560 360403 359489 gene locus_tag LOCUS_11570 360403 359489 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 protein_id gnl|my_center|LOCUS_11570 361349 360411 gene locus_tag LOCUS_11580 gene fpr 361349 360411 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_11580 365174 361707 gene locus_tag LOCUS_11590 365174 361707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 365611 367371 gene locus_tag LOCUS_11600 365611 367371 CDS product acetolactate synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_11600 368859 367531 gene locus_tag LOCUS_11610 368859 367531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_11610 370787 368880 gene locus_tag LOCUS_11620 gene uup 370787 368880 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_11620 371525 370809 gene locus_tag LOCUS_11630 371525 370809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 371630 372538 gene locus_tag LOCUS_11640 gene rfbB 371630 372538 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5T6 protein_id gnl|my_center|LOCUS_11640 374686 372542 gene locus_tag LOCUS_11650 374686 372542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 374794 376467 gene locus_tag LOCUS_11660 374794 376467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142453.1 protein_id gnl|my_center|LOCUS_11660 377265 376513 gene locus_tag LOCUS_11670 gene ppiA 377265 376513 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E8 protein_id gnl|my_center|LOCUS_11670 377430 380528 gene locus_tag LOCUS_11680 377430 380528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 380763 381497 gene locus_tag LOCUS_11690 380763 381497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 382547 381564 gene locus_tag LOCUS_11700 gene thiL 382547 381564 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_11700 384955 382544 gene locus_tag LOCUS_11710 gene lon 384955 382544 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_11710 385489 384986 gene locus_tag LOCUS_11720 gene nrdR 385489 384986 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33661 protein_id gnl|my_center|LOCUS_11720 387664 385496 gene locus_tag LOCUS_11730 387664 385496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 387920 389014 gene locus_tag LOCUS_11740 gene hrcA 387920 389014 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_11740 389071 390012 gene locus_tag LOCUS_11750 389071 390012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 390035 391858 gene locus_tag LOCUS_11760 gene dnaK 390035 391858 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_11760 391858 392961 gene locus_tag LOCUS_11770 gene dnaJ 391858 392961 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_11770 395060 392958 gene locus_tag LOCUS_11780 395060 392958 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_11780 395127 396272 gene locus_tag LOCUS_11790 395127 396272 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406228.1 protein_id gnl|my_center|LOCUS_11790 396851 397753 gene locus_tag LOCUS_11800 396851 397753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 397785 398126 gene locus_tag LOCUS_11810 397785 398126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 398210 399571 gene locus_tag LOCUS_11820 398210 399571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 399568 401052 gene locus_tag LOCUS_11830 gene cusB 399568 401052 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263308.1 protein_id gnl|my_center|LOCUS_11830 401055 404192 gene locus_tag LOCUS_11840 gene cusA 401055 404192 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_11840 404189 404704 gene locus_tag LOCUS_11850 404189 404704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 404820 412235 gene locus_tag LOCUS_11860 404820 412235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 412244 412597 gene locus_tag LOCUS_11870 412244 412597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 412896 415214 gene locus_tag LOCUS_11880 412896 415214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 416811 415189 gene locus_tag LOCUS_11890 416811 415189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 419627 416808 gene locus_tag LOCUS_11900 gene topA 419627 416808 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV5 protein_id gnl|my_center|LOCUS_11900 416845 416969 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttggccttcgtcgtcttggc 419957 419848 gene locus_tag LOCUS_r00010 419957 419848 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence04 1472 183 gene locus_tag LOCUS_11910 1472 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2167 1604 gene locus_tag LOCUS_11920 2167 1604 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_11920 3181 2210 gene locus_tag LOCUS_11930 3181 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3545 6634 gene locus_tag LOCUS_11940 3545 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6665 7243 gene locus_tag LOCUS_11950 6665 7243 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_11950 7255 8004 gene locus_tag LOCUS_11960 7255 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_11960 8976 8569 gene locus_tag LOCUS_11970 8976 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10004 9471 gene locus_tag LOCUS_11980 10004 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 10613 10377 gene locus_tag LOCUS_11990 10613 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 13503 12982 gene locus_tag LOCUS_12000 13503 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 14990 14676 gene locus_tag LOCUS_12010 14990 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 15208 15651 gene locus_tag LOCUS_12020 15208 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15648 16973 gene locus_tag LOCUS_12030 15648 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_12030 16976 18661 gene locus_tag LOCUS_12040 gene kstD 16976 18661 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71864 protein_id gnl|my_center|LOCUS_12040 18661 20148 gene locus_tag LOCUS_12050 18661 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22496 20145 gene locus_tag LOCUS_12060 22496 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 22688 23590 gene locus_tag LOCUS_12070 22688 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 24496 23603 gene locus_tag LOCUS_12080 gene purC 24496 23603 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_12080 26532 24526 gene locus_tag LOCUS_12090 26532 24526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 26595 27662 gene locus_tag LOCUS_12100 26595 27662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459200.1 protein_id gnl|my_center|LOCUS_12100 27659 28678 gene locus_tag LOCUS_12110 27659 28678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531723.1 protein_id gnl|my_center|LOCUS_12110 28782 30437 gene locus_tag LOCUS_12120 28782 30437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 31687 30467 gene locus_tag LOCUS_12130 31687 30467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 31747 32658 gene locus_tag LOCUS_12140 gene lipZ 31747 32658 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_12140 33569 32589 gene locus_tag LOCUS_12150 33569 32589 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_12150 34140 33598 gene locus_tag LOCUS_12160 gene lspA 34140 33598 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGD1 protein_id gnl|my_center|LOCUS_12160 34778 34137 gene locus_tag LOCUS_12170 34778 34137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 35004 34768 gene locus_tag LOCUS_12180 35004 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 35190 36077 gene locus_tag LOCUS_12190 35190 36077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 36081 36602 gene locus_tag LOCUS_12200 gene def-1 36081 36602 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW5 protein_id gnl|my_center|LOCUS_12200 36636 38069 gene locus_tag LOCUS_12210 gene cysS 36636 38069 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_12210 38074 38466 gene locus_tag LOCUS_12220 38074 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 38564 38638 gene locus_tag LOCUS_t00250 38564 38638 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38691 38765 gene locus_tag LOCUS_t00260 38691 38765 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 38813 38896 gene locus_tag LOCUS_t00270 38813 38896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42021 39340 gene locus_tag LOCUS_12230 42021 39340 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_12230 48986 42009 gene locus_tag LOCUS_12240 48986 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 53350 57288 gene locus_tag LOCUS_12250 53350 57288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 57309 59081 gene locus_tag LOCUS_12260 57309 59081 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_12260 59099 62386 gene locus_tag LOCUS_12270 59099 62386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 62383 63393 gene locus_tag LOCUS_12280 gene ltaA 62383 63393 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_12280 65763 63949 gene locus_tag LOCUS_12290 65763 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_12290 69015 65773 gene locus_tag LOCUS_12300 69015 65773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_12300 70870 69077 gene locus_tag LOCUS_12310 70870 69077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_12310 72133 70892 gene locus_tag LOCUS_12320 72133 70892 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_12320 72704 72147 gene locus_tag LOCUS_12330 72704 72147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 74856 72715 gene locus_tag LOCUS_12340 gene ppk 74856 72715 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B706 protein_id gnl|my_center|LOCUS_12340 74901 75410 gene locus_tag LOCUS_12350 74901 75410 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_12350 75407 76618 gene locus_tag LOCUS_12360 75407 76618 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_12360 77580 76633 gene locus_tag LOCUS_12370 gene cysK 77580 76633 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_12370 77692 82467 gene locus_tag LOCUS_12380 77692 82467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 82464 83420 gene locus_tag LOCUS_12390 gene hpnA 82464 83420 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_12390 83514 86690 gene locus_tag LOCUS_12400 83514 86690 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_12400 86690 87958 gene locus_tag LOCUS_12410 gene aspB 86690 87958 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53001 protein_id gnl|my_center|LOCUS_12410 88095 88661 gene locus_tag LOCUS_12420 gene efp 88095 88661 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_12420 88661 89617 gene locus_tag LOCUS_12430 gene poxA 88661 89617 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B8 protein_id gnl|my_center|LOCUS_12430 89619 91598 gene locus_tag LOCUS_12440 89619 91598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 91669 93018 gene locus_tag LOCUS_12450 91669 93018 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_12450 93015 93998 gene locus_tag LOCUS_12460 93015 93998 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118476.1 protein_id gnl|my_center|LOCUS_12460 94005 95606 gene locus_tag LOCUS_12470 94005 95606 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977556.1 protein_id gnl|my_center|LOCUS_12470 96092 96490 gene locus_tag LOCUS_12480 96092 96490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 97856 96405 gene locus_tag LOCUS_12490 97856 96405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 99113 97869 gene locus_tag LOCUS_12500 gene metB 99113 97869 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_12500 100959 99412 gene locus_tag LOCUS_12510 gene purH 100959 99412 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9N7 protein_id gnl|my_center|LOCUS_12510 101772 101014 gene locus_tag LOCUS_12520 101772 101014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 101879 101953 gene locus_tag LOCUS_t00280 101879 101953 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 102028 102471 gene locus_tag LOCUS_12530 102028 102471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 103877 102483 gene locus_tag LOCUS_12540 103877 102483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 104437 103874 gene locus_tag LOCUS_12550 gene kptA 104437 103874 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_12550 104508 108890 gene locus_tag LOCUS_12560 104508 108890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 109992 108910 gene locus_tag LOCUS_12570 109992 108910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 110741 109989 gene locus_tag LOCUS_12580 110741 109989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 111199 110813 gene locus_tag LOCUS_12590 111199 110813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 111412 112458 gene locus_tag LOCUS_12600 gene aspG 111412 112458 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405364.1 protein_id gnl|my_center|LOCUS_12600 112468 114459 gene locus_tag LOCUS_12610 gene uvrB 112468 114459 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV3 protein_id gnl|my_center|LOCUS_12610 116189 114474 gene locus_tag LOCUS_12620 116189 114474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 117180 116194 gene locus_tag LOCUS_12630 117180 116194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 117215 118345 gene locus_tag LOCUS_12640 117215 118345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_12640 118410 122033 gene locus_tag LOCUS_12650 118410 122033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 126110 122040 gene locus_tag LOCUS_12660 126110 122040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 126281 127357 gene locus_tag LOCUS_12670 126281 127357 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_12670 127354 130464 gene locus_tag LOCUS_12680 127354 130464 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_12680 131023 131958 gene locus_tag LOCUS_12690 gene murK 131023 131958 CDS product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 protein_id gnl|my_center|LOCUS_12690 131962 133623 gene locus_tag LOCUS_12700 131962 133623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 133624 135060 gene locus_tag LOCUS_12710 133624 135060 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 protein_id gnl|my_center|LOCUS_12710 135097 136275 gene locus_tag LOCUS_12720 135097 136275 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_12720 136430 137620 gene locus_tag LOCUS_12730 136430 137620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 140046 137716 gene locus_tag LOCUS_12740 140046 137716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 140206 144231 gene locus_tag LOCUS_12750 140206 144231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 146020 144248 gene locus_tag LOCUS_12760 146020 144248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_12760 146934 146017 gene locus_tag LOCUS_12770 146934 146017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121246.1 protein_id gnl|my_center|LOCUS_12770 147930 146947 gene locus_tag LOCUS_12780 147930 146947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_12780 148524 147934 gene locus_tag LOCUS_12790 148524 147934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 149749 148604 gene locus_tag LOCUS_12800 149749 148604 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_12800 150448 149780 gene locus_tag LOCUS_12810 gene nth 150448 149780 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_12810 151370 150459 gene locus_tag LOCUS_12820 151370 150459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 151463 152158 gene locus_tag LOCUS_12830 151463 152158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 152169 153368 gene locus_tag LOCUS_12840 152169 153368 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_12840 153461 156022 gene locus_tag LOCUS_12850 153461 156022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 156082 156564 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acctccatgttcgttgtacatg 156621 159164 gene locus_tag LOCUS_12860 156621 159164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 159905 159168 gene locus_tag LOCUS_12870 159905 159168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 160288 160112 gene locus_tag LOCUS_12880 160288 160112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 162294 160396 gene locus_tag LOCUS_12890 162294 160396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 163931 162348 gene locus_tag LOCUS_12900 163931 162348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 164731 163949 gene locus_tag LOCUS_12910 164731 163949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_12910 167365 164780 gene locus_tag LOCUS_12920 167365 164780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 168441 167362 gene locus_tag LOCUS_12930 168441 167362 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_12930 168830 168495 gene locus_tag LOCUS_12940 168830 168495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 168927 169880 gene locus_tag LOCUS_12950 gene accA 168927 169880 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_12950 169891 171579 gene locus_tag LOCUS_12960 gene recJ 169891 171579 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_12960 171583 173700 gene locus_tag LOCUS_12970 171583 173700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 173701 174480 gene locus_tag LOCUS_12980 173701 174480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_12980 174517 176016 gene locus_tag LOCUS_12990 gene rpoN 174517 176016 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_12990 176027 176578 gene locus_tag LOCUS_13000 gene raiA 176027 176578 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_13000 176584 177039 gene locus_tag LOCUS_13010 gene ptsN 176584 177039 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30335 protein_id gnl|my_center|LOCUS_13010 177084 177932 gene locus_tag LOCUS_13020 177084 177932 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7A2 protein_id gnl|my_center|LOCUS_13020 177947 178216 gene locus_tag LOCUS_13030 177947 178216 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_13030 178225 179964 gene locus_tag LOCUS_13040 gene ptsI 178225 179964 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_13040 180128 180952 gene locus_tag LOCUS_13050 180128 180952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 180949 182274 gene locus_tag LOCUS_13060 gene miaB 180949 182274 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X63 protein_id gnl|my_center|LOCUS_13060 182384 182884 gene locus_tag LOCUS_13070 182384 182884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_13070 183073 183834 gene locus_tag LOCUS_13080 183073 183834 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_13080 183824 184708 gene locus_tag LOCUS_13090 183824 184708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 184841 187204 gene locus_tag LOCUS_13100 184841 187204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 188615 187464 gene locus_tag LOCUS_13110 gene metK 188615 187464 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_13110 188785 189576 gene locus_tag LOCUS_13120 188785 189576 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356757.1 protein_id gnl|my_center|LOCUS_13120 190376 189549 gene locus_tag LOCUS_13130 190376 189549 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256748.1 protein_id gnl|my_center|LOCUS_13130 190391 193669 gene locus_tag LOCUS_13140 190391 193669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 193721 196180 gene locus_tag LOCUS_13150 193721 196180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 196500 197039 gene locus_tag LOCUS_13160 196500 197039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 197070 198092 gene locus_tag LOCUS_13170 197070 198092 CDS product geranylgeranyl diphosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 protein_id gnl|my_center|LOCUS_13170 198131 201481 gene locus_tag LOCUS_13180 198131 201481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 201496 203640 gene locus_tag LOCUS_13190 201496 203640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 203670 204710 gene locus_tag LOCUS_13200 203670 204710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 204707 205837 gene locus_tag LOCUS_13210 204707 205837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 205834 206688 gene locus_tag LOCUS_13220 205834 206688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 208681 206699 gene locus_tag LOCUS_13230 208681 206699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_13230 210643 208694 gene locus_tag LOCUS_13240 210643 208694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 211686 210694 gene locus_tag LOCUS_13250 gene ocd 211686 210694 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226628.1 protein_id gnl|my_center|LOCUS_13250 212653 211676 gene locus_tag LOCUS_13260 212653 211676 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_13260 212830 213402 gene locus_tag LOCUS_13270 212830 213402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 214885 213320 gene locus_tag LOCUS_13280 214885 213320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_13280 218226 215668 gene locus_tag LOCUS_13290 218226 215668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 219605 218274 gene locus_tag LOCUS_13300 gene fadL 219605 218274 CDS product long-chain fatty acid outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347691.1 protein_id gnl|my_center|LOCUS_13300 220981 219767 gene locus_tag LOCUS_13310 gene mntH 220981 219767 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_13310 222522 220978 gene locus_tag LOCUS_13320 222522 220978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 223757 222519 gene locus_tag LOCUS_13330 223757 222519 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110125.1 protein_id gnl|my_center|LOCUS_13330 224254 227730 gene locus_tag LOCUS_13340 224254 227730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 233448 227734 gene locus_tag LOCUS_13350 233448 227734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 239124 233473 gene locus_tag LOCUS_13360 239124 233473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 239186 240154 gene locus_tag LOCUS_13370 gene ybgG 239186 240154 CDS product homocysteine S-methyltransferase YbgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31463 protein_id gnl|my_center|LOCUS_13370 240660 240094 gene locus_tag LOCUS_13380 240660 240094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 242372 241113 gene locus_tag LOCUS_13390 242372 241113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 244294 242360 gene locus_tag LOCUS_13400 244294 242360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 244972 244400 gene locus_tag LOCUS_13410 244972 244400 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_13410 245103 246317 gene locus_tag LOCUS_13420 245103 246317 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_13420 246321 247139 gene locus_tag LOCUS_13430 246321 247139 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_13430 247143 248372 gene locus_tag LOCUS_13440 247143 248372 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_13440 248487 250241 gene locus_tag LOCUS_13450 248487 250241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 250253 252895 gene locus_tag LOCUS_13460 250253 252895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 254328 252865 gene locus_tag LOCUS_13470 254328 252865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 254463 255362 gene locus_tag LOCUS_13480 254463 255362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_13480 256716 255577 gene locus_tag LOCUS_13490 gene mmgC 256716 255577 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_13490 257871 256726 gene locus_tag LOCUS_13500 257871 256726 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_13500 259233 257893 gene locus_tag LOCUS_13510 gene dctD 259233 257893 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_13510 259340 260014 gene locus_tag LOCUS_13520 259340 260014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 260011 261717 gene locus_tag LOCUS_13530 260011 261717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 261746 263443 gene locus_tag LOCUS_13540 261746 263443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 264754 263681 gene locus_tag LOCUS_13550 264754 263681 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_13550 265141 264755 gene locus_tag LOCUS_13560 265141 264755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 265352 266452 gene locus_tag LOCUS_13570 265352 266452 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_13570 267567 266449 gene locus_tag LOCUS_13580 267567 266449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 269591 267609 gene locus_tag LOCUS_13590 269591 267609 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_13590 269743 271080 gene locus_tag LOCUS_13600 269743 271080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 272707 271103 gene locus_tag LOCUS_13610 272707 271103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 272813 273775 gene locus_tag LOCUS_13620 272813 273775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 273782 274876 gene locus_tag LOCUS_13630 273782 274876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_13630 276357 274873 gene locus_tag LOCUS_13640 276357 274873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 277066 276482 gene locus_tag LOCUS_13650 gene nfuA 277066 276482 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 protein_id gnl|my_center|LOCUS_13650 277802 277050 gene locus_tag LOCUS_13660 277802 277050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 279371 277827 gene locus_tag LOCUS_13670 279371 277827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 283411 279392 gene locus_tag LOCUS_13680 283411 279392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 284382 283480 gene locus_tag LOCUS_13690 gene wbbL 284382 283480 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMY3 protein_id gnl|my_center|LOCUS_13690 285533 284379 gene locus_tag LOCUS_13700 285533 284379 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_13700 288913 285530 gene locus_tag LOCUS_13710 288913 285530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 289471 288923 gene locus_tag LOCUS_13720 289471 288923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 290796 289621 gene locus_tag LOCUS_13730 290796 289621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 291755 290817 gene locus_tag LOCUS_13740 291755 290817 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_13740 292742 291768 gene locus_tag LOCUS_13750 292742 291768 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_13750 292837 293265 gene locus_tag LOCUS_13760 gene msrB 292837 293265 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLB3 protein_id gnl|my_center|LOCUS_13760 293265 294473 gene locus_tag LOCUS_13770 293265 294473 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_13770 294574 296265 gene locus_tag LOCUS_13780 294574 296265 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_13780 296299 297156 gene locus_tag LOCUS_13790 296299 297156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_13790 299696 297192 gene locus_tag LOCUS_13800 299696 297192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 300222 299809 gene locus_tag LOCUS_13810 300222 299809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_13810 301670 300222 gene locus_tag LOCUS_13820 301670 300222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 301982 303448 gene locus_tag LOCUS_13830 301982 303448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 303474 305774 gene locus_tag LOCUS_13840 303474 305774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 305785 306216 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgaaaagtccgttgaacgac 307829 306231 gene locus_tag LOCUS_13850 307829 306231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_13850 309851 307905 gene locus_tag LOCUS_13860 309851 307905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 312178 309884 gene locus_tag LOCUS_13870 312178 309884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 312402 315866 gene locus_tag LOCUS_13880 312402 315866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 315888 319469 gene locus_tag LOCUS_13890 315888 319469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 323033 319665 gene locus_tag LOCUS_13900 323033 319665 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_13900 323116 324405 gene locus_tag LOCUS_13910 323116 324405 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121707.1 protein_id gnl|my_center|LOCUS_13910 324523 330351 gene locus_tag LOCUS_13920 324523 330351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 330390 331181 gene locus_tag LOCUS_13930 330390 331181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 331985 331260 gene locus_tag LOCUS_13940 331985 331260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 333158 332079 gene locus_tag LOCUS_13950 333158 332079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 334421 333225 gene locus_tag LOCUS_13960 334421 333225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 335899 334472 gene locus_tag LOCUS_13970 335899 334472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 336771 335896 gene locus_tag LOCUS_13980 336771 335896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_13980 337808 336774 gene locus_tag LOCUS_13990 337808 336774 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_13990 339150 337810 gene locus_tag LOCUS_14000 339150 337810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 339245 340660 gene locus_tag LOCUS_14010 gene fumC 339245 340660 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L0 protein_id gnl|my_center|LOCUS_14010 342899 340635 gene locus_tag LOCUS_14020 342899 340635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 343260 342922 gene locus_tag LOCUS_14030 343260 342922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 343540 344406 gene locus_tag LOCUS_14040 343540 344406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 345150 344326 gene locus_tag LOCUS_14050 345150 344326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 345784 345353 gene locus_tag LOCUS_14060 345784 345353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 347725 345947 gene locus_tag LOCUS_14070 347725 345947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_14070 349726 347753 gene locus_tag LOCUS_14080 349726 347753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 349883 351772 gene locus_tag LOCUS_14090 gene korA 349883 351772 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_14090 351772 352794 gene locus_tag LOCUS_14100 gene korB 351772 352794 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_14100 352915 353751 gene locus_tag LOCUS_14110 352915 353751 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_14110 353795 355507 gene locus_tag LOCUS_14120 353795 355507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 355547 358903 gene locus_tag LOCUS_14130 355547 358903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 359000 361486 gene locus_tag LOCUS_14140 359000 361486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence05 965 186 gene locus_tag LOCUS_14150 965 186 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_14150 3281 993 gene locus_tag LOCUS_14160 gene fadE 3281 993 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_14160 5084 3354 gene locus_tag LOCUS_14170 5084 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7177 5081 gene locus_tag LOCUS_14180 7177 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7947 7174 gene locus_tag LOCUS_14190 7947 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8186 9832 gene locus_tag LOCUS_14200 8186 9832 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_14200 9829 11010 gene locus_tag LOCUS_14210 9829 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13678 11051 gene locus_tag LOCUS_14220 gene glgX 13678 11051 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880M4 protein_id gnl|my_center|LOCUS_14220 14411 13722 gene locus_tag LOCUS_14230 14411 13722 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_14230 15317 14433 gene locus_tag LOCUS_14240 15317 14433 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_14240 17247 15322 gene locus_tag LOCUS_14250 17247 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18519 17305 gene locus_tag LOCUS_14260 18519 17305 CDS product cyclodextrin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_14260 19622 18537 gene locus_tag LOCUS_14270 19622 18537 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_14270 21234 19657 gene locus_tag LOCUS_14280 21234 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21495 24269 gene locus_tag LOCUS_14290 21495 24269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 24718 24224 gene locus_tag LOCUS_14300 24718 24224 CDS product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028081.1 protein_id gnl|my_center|LOCUS_14300 26168 25152 gene locus_tag LOCUS_14310 26168 25152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 26775 26146 gene locus_tag LOCUS_14320 26775 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 30800 26844 gene locus_tag LOCUS_14330 30800 26844 CDS product alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257197.1 protein_id gnl|my_center|LOCUS_14330 31174 31524 gene locus_tag LOCUS_14340 31174 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 31521 32288 gene locus_tag LOCUS_14350 31521 32288 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_14350 32308 33078 gene locus_tag LOCUS_14360 32308 33078 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583046.1 protein_id gnl|my_center|LOCUS_14360 33106 35313 gene locus_tag LOCUS_14370 33106 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 35422 36480 gene locus_tag LOCUS_14380 35422 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 36601 37428 gene locus_tag LOCUS_14390 36601 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_14390 37425 39107 gene locus_tag LOCUS_14400 37425 39107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 40491 39121 gene locus_tag LOCUS_14410 40491 39121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 40647 41684 gene locus_tag LOCUS_14420 40647 41684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 42196 41681 gene locus_tag LOCUS_14430 42196 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 43999 42230 gene locus_tag LOCUS_14440 43999 42230 CDS product 4-cresol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_14440 44200 46785 gene locus_tag LOCUS_14450 44200 46785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 46924 47046 gene locus_tag LOCUS_14460 46924 47046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 47134 48285 gene locus_tag LOCUS_14470 47134 48285 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971388.1 protein_id gnl|my_center|LOCUS_14470 48298 51000 gene locus_tag LOCUS_14480 48298 51000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 50997 53099 gene locus_tag LOCUS_14490 50997 53099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 54300 53107 gene locus_tag LOCUS_14500 54300 53107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 56173 54323 gene locus_tag LOCUS_14510 56173 54323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 56096 56317 gene locus_tag LOCUS_14520 56096 56317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 56554 56372 gene locus_tag LOCUS_14530 56554 56372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 56664 58355 gene locus_tag LOCUS_14540 gene cspC 56664 58355 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433821.1 protein_id gnl|my_center|LOCUS_14540 59426 58827 gene locus_tag LOCUS_14550 59426 58827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 63949 59438 gene locus_tag LOCUS_14560 63949 59438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 66034 63974 gene locus_tag LOCUS_14570 66034 63974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_14570 68715 66031 gene locus_tag LOCUS_14580 68715 66031 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258038.1 protein_id gnl|my_center|LOCUS_14580 71249 68712 gene locus_tag LOCUS_14590 71249 68712 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_14590 71611 71246 gene locus_tag LOCUS_14600 71611 71246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_14600 71945 71622 gene locus_tag LOCUS_14610 71945 71622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_14610 72495 71968 gene locus_tag LOCUS_14620 72495 71968 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_14620 73616 72492 gene locus_tag LOCUS_14630 73616 72492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_14630 73979 73617 gene locus_tag LOCUS_14640 73979 73617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_14640 74595 73990 gene locus_tag LOCUS_14650 74595 73990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_14650 75841 74657 gene locus_tag LOCUS_14660 75841 74657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 77150 75885 gene locus_tag LOCUS_14670 77150 75885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 77733 77482 gene locus_tag LOCUS_14680 77733 77482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 79715 77730 gene locus_tag LOCUS_14690 79715 77730 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_14690 81016 79712 gene locus_tag LOCUS_14700 81016 79712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_14700 81870 81013 gene locus_tag LOCUS_14710 81870 81013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 82595 81870 gene locus_tag LOCUS_14720 82595 81870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_14720 83139 82615 gene locus_tag LOCUS_14730 83139 82615 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_14730 85120 83150 gene locus_tag LOCUS_14740 85120 83150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 85606 85178 gene locus_tag LOCUS_14750 85606 85178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 86235 87119 gene locus_tag LOCUS_14760 86235 87119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 87817 96696 gene locus_tag LOCUS_14770 87817 96696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 101605 96710 gene locus_tag LOCUS_14780 101605 96710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 101713 102555 gene locus_tag LOCUS_14790 101713 102555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 104997 102586 gene locus_tag LOCUS_14800 104997 102586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14800 105430 105083 gene locus_tag LOCUS_14810 gene phaG 105430 105083 CDS product putative K(+)/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q3 protein_id gnl|my_center|LOCUS_14810 105689 105423 gene locus_tag LOCUS_14820 gene mrpF 105689 105423 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_14820 106051 105689 gene locus_tag LOCUS_14830 106051 105689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 107544 106048 gene locus_tag LOCUS_14840 gene mrpD 107544 106048 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_14840 107969 107541 gene locus_tag LOCUS_14850 107969 107541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 110602 107966 gene locus_tag LOCUS_14860 110602 107966 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 protein_id gnl|my_center|LOCUS_14860 111374 112738 gene locus_tag LOCUS_14870 111374 112738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 113123 112743 gene locus_tag LOCUS_14880 113123 112743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 113446 113120 gene locus_tag LOCUS_14890 113446 113120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 113662 113447 gene locus_tag LOCUS_14900 113662 113447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 114231 113659 gene locus_tag LOCUS_14910 114231 113659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 115242 114490 gene locus_tag LOCUS_14920 115242 114490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 115792 115391 gene locus_tag LOCUS_14930 115792 115391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 117199 115913 gene locus_tag LOCUS_14940 117199 115913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 117998 117282 gene locus_tag LOCUS_14950 117998 117282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 118822 118271 gene locus_tag LOCUS_14960 118822 118271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 120983 119013 gene locus_tag LOCUS_14970 120983 119013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 121999 122742 gene locus_tag LOCUS_14980 121999 122742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 125472 125140 gene locus_tag LOCUS_14990 125472 125140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039495.1 protein_id gnl|my_center|LOCUS_14990 126488 126276 gene locus_tag LOCUS_15000 126488 126276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 126568 126804 gene locus_tag LOCUS_15010 126568 126804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 126869 127942 gene locus_tag LOCUS_15020 126869 127942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 128889 128053 gene locus_tag LOCUS_15030 128889 128053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 131376 128932 gene locus_tag LOCUS_15040 131376 128932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 131585 131511 gene locus_tag LOCUS_t00290 131585 131511 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 131830 132045 gene locus_tag LOCUS_15050 gene rpmE 131830 132045 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D39 protein_id gnl|my_center|LOCUS_15050 132199 133284 gene locus_tag LOCUS_15060 gene prfA 132199 133284 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIQ7 protein_id gnl|my_center|LOCUS_15060 136337 133866 gene locus_tag LOCUS_15070 136337 133866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 136548 137921 gene locus_tag LOCUS_15080 136548 137921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 137952 139274 gene locus_tag LOCUS_15090 137952 139274 CDS product interphotoreceptor retinoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_15090 139350 139637 gene locus_tag LOCUS_15100 139350 139637 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAS4 protein_id gnl|my_center|LOCUS_15100 141943 139679 gene locus_tag LOCUS_15110 141943 139679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 143234 142203 gene locus_tag LOCUS_15120 143234 142203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 143818 146118 gene locus_tag LOCUS_15130 143818 146118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 147312 146197 gene locus_tag LOCUS_15140 147312 146197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 148460 147357 gene locus_tag LOCUS_15150 148460 147357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 148813 151218 gene locus_tag LOCUS_15160 148813 151218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 153051 151249 gene locus_tag LOCUS_15170 153051 151249 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_15170 154576 153173 gene locus_tag LOCUS_15180 154576 153173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_15180 154718 154945 gene locus_tag LOCUS_15190 154718 154945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 155021 155275 gene locus_tag LOCUS_15200 155021 155275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 156628 155261 gene locus_tag LOCUS_15210 156628 155261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_15210 156896 160681 gene locus_tag LOCUS_15220 gene smc 156896 160681 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G5EBD4 protein_id gnl|my_center|LOCUS_15220 160693 161451 gene locus_tag LOCUS_15230 gene paaG 160693 161451 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_15230 161448 162023 gene locus_tag LOCUS_15240 161448 162023 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_15240 162911 162402 gene locus_tag LOCUS_15250 162911 162402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_15250 163824 162931 gene locus_tag LOCUS_15260 163824 162931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_15260 166398 163825 gene locus_tag LOCUS_15270 166398 163825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 166607 167398 gene locus_tag LOCUS_15280 166607 167398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 167395 168114 gene locus_tag LOCUS_15290 167395 168114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15290 168248 168865 gene locus_tag LOCUS_15300 168248 168865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_15300 168878 169369 gene locus_tag LOCUS_15310 168878 169369 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 protein_id gnl|my_center|LOCUS_15310 169356 171518 gene locus_tag LOCUS_15320 169356 171518 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_15320 171683 173242 gene locus_tag LOCUS_15330 171683 173242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 175706 173253 gene locus_tag LOCUS_15340 175706 173253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 175880 176725 gene locus_tag LOCUS_15350 175880 176725 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 protein_id gnl|my_center|LOCUS_15350 176722 177777 gene locus_tag LOCUS_15360 gene cpdP 176722 177777 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261870.1 protein_id gnl|my_center|LOCUS_15360 177903 179840 gene locus_tag LOCUS_15370 177903 179840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 179857 181680 gene locus_tag LOCUS_15380 179857 181680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 182773 181733 gene locus_tag LOCUS_15390 182773 181733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 182989 184191 gene locus_tag LOCUS_15400 182989 184191 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_15400 186213 184210 gene locus_tag LOCUS_15410 186213 184210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 186403 186227 gene locus_tag LOCUS_15420 186403 186227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 186390 188789 gene locus_tag LOCUS_15430 186390 188789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_15430 188903 189832 gene locus_tag LOCUS_15440 188903 189832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 190340 193456 gene locus_tag LOCUS_15450 190340 193456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 193664 193464 gene locus_tag LOCUS_15460 193664 193464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 193770 195002 gene locus_tag LOCUS_15470 193770 195002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 195026 195487 gene locus_tag LOCUS_15480 195026 195487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 195647 197425 gene locus_tag LOCUS_15490 195647 197425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 197418 199577 gene locus_tag LOCUS_15500 197418 199577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_15500 199598 203563 gene locus_tag LOCUS_15510 199598 203563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_15510 203560 208797 gene locus_tag LOCUS_15520 203560 208797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 209478 210641 gene locus_tag LOCUS_15530 209478 210641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 210638 211636 gene locus_tag LOCUS_15540 210638 211636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 211629 211811 gene locus_tag LOCUS_15550 211629 211811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 213547 211994 gene locus_tag LOCUS_15560 213547 211994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946629.1 protein_id gnl|my_center|LOCUS_15560 213805 214356 gene locus_tag LOCUS_15570 213805 214356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15570 214510 216924 gene locus_tag LOCUS_15580 214510 216924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_15580 218331 217009 gene locus_tag LOCUS_15590 218331 217009 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_15590 219679 218378 gene locus_tag LOCUS_15600 219679 218378 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_15600 219951 222236 gene locus_tag LOCUS_15610 219951 222236 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_15610 222289 224391 gene locus_tag LOCUS_15620 gene nicT 222289 224391 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_15620 224792 224412 gene locus_tag LOCUS_15630 224792 224412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 225876 224806 gene locus_tag LOCUS_15640 gene cheB2 225876 224806 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62637 protein_id gnl|my_center|LOCUS_15640 226691 225873 gene locus_tag LOCUS_15650 gene cheR40H 226691 225873 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AY4 protein_id gnl|my_center|LOCUS_15650 228632 226728 gene locus_tag LOCUS_15660 228632 226728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 230822 228717 gene locus_tag LOCUS_15670 230822 228717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 231400 230918 gene locus_tag LOCUS_15680 231400 230918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 232122 231397 gene locus_tag LOCUS_15690 232122 231397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 233836 232214 gene locus_tag LOCUS_15700 gene cheA 233836 232214 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405314.1 protein_id gnl|my_center|LOCUS_15700 234102 234461 gene locus_tag LOCUS_15710 gene cheY-2 234102 234461 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_15710 234467 235225 gene locus_tag LOCUS_15720 234467 235225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942853.1 protein_id gnl|my_center|LOCUS_15720 235306 236913 gene locus_tag LOCUS_15730 235306 236913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 236938 237771 gene locus_tag LOCUS_15740 236938 237771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 237788 238675 gene locus_tag LOCUS_15750 237788 238675 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_15750 239496 238660 gene locus_tag LOCUS_15760 239496 238660 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_15760 242093 239493 gene locus_tag LOCUS_15770 242093 239493 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_15770 242200 243096 gene locus_tag LOCUS_15780 gene dhmA1 242200 243096 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_15780 247054 243596 gene locus_tag LOCUS_15790 247054 243596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 247382 248806 gene locus_tag LOCUS_15800 247382 248806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 248803 249597 gene locus_tag LOCUS_15810 248803 249597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 250155 249616 gene locus_tag LOCUS_15820 250155 249616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 251399 250449 gene locus_tag LOCUS_15830 251399 250449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_15830 252007 251441 gene locus_tag LOCUS_15840 252007 251441 CDS product UPF0215 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYY6 protein_id gnl|my_center|LOCUS_15840 253504 252008 gene locus_tag LOCUS_15850 gene phr 253504 252008 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_15850 254224 253532 gene locus_tag LOCUS_15860 254224 253532 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_15860 254354 254430 gene locus_tag LOCUS_t00300 254354 254430 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 254470 255186 gene locus_tag LOCUS_15870 254470 255186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 255210 256541 gene locus_tag LOCUS_15880 255210 256541 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_15880 259030 256559 gene locus_tag LOCUS_15890 259030 256559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_15890 259164 259952 gene locus_tag LOCUS_15900 259164 259952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_15900 262890 259963 gene locus_tag LOCUS_15910 262890 259963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 266307 262915 gene locus_tag LOCUS_15920 266307 262915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 267021 266329 gene locus_tag LOCUS_15930 267021 266329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 268922 267129 gene locus_tag LOCUS_15940 268922 267129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 269780 268926 gene locus_tag LOCUS_15950 269780 268926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921552.1 protein_id gnl|my_center|LOCUS_15950 269667 269924 gene locus_tag LOCUS_15960 269667 269924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 269973 272513 gene locus_tag LOCUS_15970 269973 272513 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_15970 272737 273192 gene locus_tag LOCUS_15980 272737 273192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 274747 273380 gene locus_tag LOCUS_15990 274747 273380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 276194 274764 gene locus_tag LOCUS_16000 276194 274764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 277175 276207 gene locus_tag LOCUS_16010 277175 276207 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_16010 278521 277172 gene locus_tag LOCUS_16020 278521 277172 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_16020 278708 279388 gene locus_tag LOCUS_16030 278708 279388 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_16030 279369 280613 gene locus_tag LOCUS_16040 279369 280613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 280684 281766 gene locus_tag LOCUS_16050 280684 281766 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_16050 284829 282046 gene locus_tag LOCUS_16060 284829 282046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 287593 285152 gene locus_tag LOCUS_16070 287593 285152 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_16070 288513 288031 gene locus_tag LOCUS_16080 gene coaD 288513 288031 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5K7 protein_id gnl|my_center|LOCUS_16080 290752 288548 gene locus_tag LOCUS_16090 290752 288548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 292727 290844 gene locus_tag LOCUS_16100 292727 290844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_16100 293392 292790 gene locus_tag LOCUS_16110 293392 292790 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938551.1 protein_id gnl|my_center|LOCUS_16110 295113 293392 gene locus_tag LOCUS_16120 gene recN 295113 293392 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_16120 296616 295138 gene locus_tag LOCUS_16130 296616 295138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 296903 296613 gene locus_tag LOCUS_16140 296903 296613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 297095 296904 gene locus_tag LOCUS_16150 297095 296904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 298859 297129 gene locus_tag LOCUS_16160 gene ilvB 298859 297129 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_16160 300518 298887 gene locus_tag LOCUS_16170 gene pruA 300518 298887 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_16170 301007 300636 gene locus_tag LOCUS_16180 301007 300636 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_16180 301311 301039 gene locus_tag LOCUS_16190 301311 301039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 301730 301311 gene locus_tag LOCUS_16200 301730 301311 CDS product UPF0403 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G5 protein_id gnl|my_center|LOCUS_16200 302099 304783 gene locus_tag LOCUS_16210 302099 304783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 304802 306649 gene locus_tag LOCUS_16220 304802 306649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 306649 307659 gene locus_tag LOCUS_16230 306649 307659 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_16230 307690 309942 gene locus_tag LOCUS_16240 307690 309942 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887341.1 protein_id gnl|my_center|LOCUS_16240 312359 309948 gene locus_tag LOCUS_16250 312359 309948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16250 313927 312440 gene locus_tag LOCUS_16260 313927 312440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 314866 313970 gene locus_tag LOCUS_16270 314866 313970 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_16270 316037 314883 gene locus_tag LOCUS_16280 316037 314883 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_16280 318577 316049 gene locus_tag LOCUS_16290 318577 316049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_16290 319302 318580 gene locus_tag LOCUS_16300 319302 318580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_16300 319912 319331 gene locus_tag LOCUS_16310 319912 319331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 320336 319953 gene locus_tag LOCUS_16320 320336 319953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_16320 321637 320333 gene locus_tag LOCUS_16330 321637 320333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 321742 322860 gene locus_tag LOCUS_16340 gene agxT 321742 322860 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_16340 322998 323951 gene locus_tag LOCUS_16350 322998 323951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 324303 325049 gene locus_tag LOCUS_16360 324303 325049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence06 186 2549 gene locus_tag LOCUS_16370 gene polB 186 2549 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4C3 protein_id gnl|my_center|LOCUS_16370 2654 3010 gene locus_tag LOCUS_16380 2654 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3198 2986 gene locus_tag LOCUS_16390 3198 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5759 3345 gene locus_tag LOCUS_16400 5759 3345 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 protein_id gnl|my_center|LOCUS_16400 6250 5873 gene locus_tag LOCUS_16410 6250 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 7366 6380 gene locus_tag LOCUS_16420 7366 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7604 9844 gene locus_tag LOCUS_16430 7604 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 12560 9858 gene locus_tag LOCUS_16440 12560 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 13077 12670 gene locus_tag LOCUS_16450 13077 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 13380 13132 gene locus_tag LOCUS_16460 13380 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 13408 14439 gene locus_tag LOCUS_16470 13408 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 15334 14441 gene locus_tag LOCUS_16480 15334 14441 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_16480 15392 15796 gene locus_tag LOCUS_16490 15392 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16956 15709 gene locus_tag LOCUS_16500 16956 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 18332 16932 gene locus_tag LOCUS_16510 gene lysA 18332 16932 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P709 protein_id gnl|my_center|LOCUS_16510 18448 18777 gene locus_tag LOCUS_16520 18448 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 18796 19473 gene locus_tag LOCUS_16530 gene fabG 18796 19473 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2D0 protein_id gnl|my_center|LOCUS_16530 21413 19470 gene locus_tag LOCUS_16540 21413 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 21792 21406 gene locus_tag LOCUS_16550 21792 21406 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921336.1 protein_id gnl|my_center|LOCUS_16550 22183 21872 gene locus_tag LOCUS_16560 22183 21872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 22668 22183 gene locus_tag LOCUS_16570 22668 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 24605 22677 gene locus_tag LOCUS_16580 24605 22677 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_16580 24720 27770 gene locus_tag LOCUS_16590 24720 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 29563 27767 gene locus_tag LOCUS_16600 29563 27767 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_16600 32767 29576 gene locus_tag LOCUS_16610 32767 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 36438 32764 gene locus_tag LOCUS_16620 36438 32764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 39746 36531 gene locus_tag LOCUS_16630 39746 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_16630 40105 40196 gene locus_tag LOCUS_t00310 40105 40196 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40241 42244 gene locus_tag LOCUS_16640 40241 42244 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_16640 42605 43009 gene locus_tag LOCUS_16650 42605 43009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 43099 43737 gene locus_tag LOCUS_16660 43099 43737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 43739 45238 gene locus_tag LOCUS_16670 43739 45238 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_16670 47170 45209 gene locus_tag LOCUS_16680 47170 45209 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228865.1 protein_id gnl|my_center|LOCUS_16680 47362 49326 gene locus_tag LOCUS_16690 47362 49326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 49708 49340 gene locus_tag LOCUS_16700 49708 49340 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_16700 51543 49705 gene locus_tag LOCUS_16710 51543 49705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 53081 51543 gene locus_tag LOCUS_16720 53081 51543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 53132 55111 gene locus_tag LOCUS_16730 53132 55111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 57058 55178 gene locus_tag LOCUS_16740 57058 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 58049 57084 gene locus_tag LOCUS_16750 gene asd 58049 57084 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIS1 protein_id gnl|my_center|LOCUS_16750 58900 58046 gene locus_tag LOCUS_16760 gene pssA 58900 58046 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_16760 59553 58897 gene locus_tag LOCUS_16770 59553 58897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 59914 59693 gene locus_tag LOCUS_16780 59914 59693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 60193 61929 gene locus_tag LOCUS_16790 60193 61929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 63312 62497 gene locus_tag LOCUS_16800 63312 62497 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_16800 64250 63333 gene locus_tag LOCUS_16810 gene ilvE2 64250 63333 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_16810 64434 66173 gene locus_tag LOCUS_16820 64434 66173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 67109 66177 gene locus_tag LOCUS_16830 67109 66177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 68194 67151 gene locus_tag LOCUS_16840 68194 67151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 69192 68461 gene locus_tag LOCUS_16850 69192 68461 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_16850 70200 69214 gene locus_tag LOCUS_16860 70200 69214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 70580 72394 gene locus_tag LOCUS_16870 70580 72394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 73945 72641 gene locus_tag LOCUS_16880 73945 72641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 77503 74354 gene locus_tag LOCUS_16890 77503 74354 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_16890 78601 77591 gene locus_tag LOCUS_16900 78601 77591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 78989 79171 gene locus_tag LOCUS_16910 78989 79171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 79989 79558 gene locus_tag LOCUS_16920 79989 79558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 82541 80256 gene locus_tag LOCUS_16930 82541 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 84261 82792 gene locus_tag LOCUS_16940 84261 82792 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_16940 86815 84479 gene locus_tag LOCUS_16950 86815 84479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 87537 86809 gene locus_tag LOCUS_16960 87537 86809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_16960 88942 87581 gene locus_tag LOCUS_16970 88942 87581 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_16970 91165 88955 gene locus_tag LOCUS_16980 gene glgB 91165 88955 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 protein_id gnl|my_center|LOCUS_16980 92336 91722 gene locus_tag LOCUS_16990 92336 91722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 92437 92916 gene locus_tag LOCUS_17000 92437 92916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_17000 93100 96369 gene locus_tag LOCUS_17010 93100 96369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 98973 96982 gene locus_tag LOCUS_17020 98973 96982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 99764 99576 gene locus_tag LOCUS_17030 99764 99576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 102128 100326 gene locus_tag LOCUS_17040 102128 100326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 103374 102232 gene locus_tag LOCUS_17050 103374 102232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 103434 104549 gene locus_tag LOCUS_17060 103434 104549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 105350 104556 gene locus_tag LOCUS_17070 105350 104556 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_17070 107446 105431 gene locus_tag LOCUS_17080 107446 105431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 109307 107673 gene locus_tag LOCUS_17090 109307 107673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 109409 110728 gene locus_tag LOCUS_17100 gene rhtX 109409 110728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968200.1 protein_id gnl|my_center|LOCUS_17100 110789 111187 gene locus_tag LOCUS_17110 110789 111187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 111330 113453 gene locus_tag LOCUS_17120 111330 113453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17120 113478 113759 gene locus_tag LOCUS_17130 113478 113759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17130 113785 114201 gene locus_tag LOCUS_17140 113785 114201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 114952 114215 gene locus_tag LOCUS_17150 114952 114215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_17150 115800 115108 gene locus_tag LOCUS_17160 115800 115108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_17160 117175 115919 gene locus_tag LOCUS_17170 117175 115919 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_17170 117397 118227 gene locus_tag LOCUS_17180 117397 118227 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_17180 118196 118837 gene locus_tag LOCUS_17190 118196 118837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 118834 119418 gene locus_tag LOCUS_17200 118834 119418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 119433 120692 gene locus_tag LOCUS_17210 119433 120692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_17210 120695 121018 gene locus_tag LOCUS_17220 120695 121018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 121015 122280 gene locus_tag LOCUS_17230 121015 122280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 123097 124038 gene locus_tag LOCUS_17240 123097 124038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 124451 126070 gene locus_tag LOCUS_17250 124451 126070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 126182 127930 gene locus_tag LOCUS_17260 126182 127930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 129419 127938 gene locus_tag LOCUS_17270 129419 127938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 129552 132239 gene locus_tag LOCUS_17280 129552 132239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 132650 132246 gene locus_tag LOCUS_17290 132650 132246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 133877 132762 gene locus_tag LOCUS_17300 133877 132762 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_17300 134711 133887 gene locus_tag LOCUS_17310 134711 133887 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_17310 135592 134708 gene locus_tag LOCUS_17320 135592 134708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_17320 136874 135621 gene locus_tag LOCUS_17330 136874 135621 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_17330 138373 136871 gene locus_tag LOCUS_17340 138373 136871 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_17340 139845 138370 gene locus_tag LOCUS_17350 139845 138370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 142556 139872 gene locus_tag LOCUS_17360 142556 139872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 143773 142763 gene locus_tag LOCUS_17370 143773 142763 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_17370 144783 143818 gene locus_tag LOCUS_17380 144783 143818 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404767.1 protein_id gnl|my_center|LOCUS_17380 146244 144793 gene locus_tag LOCUS_17390 146244 144793 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_17390 146779 146255 gene locus_tag LOCUS_17400 146779 146255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 150622 147026 gene locus_tag LOCUS_17410 150622 147026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 150767 151153 gene locus_tag LOCUS_17420 150767 151153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 152255 151155 gene locus_tag LOCUS_17430 gene modC 152255 151155 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_17430 152910 152242 gene locus_tag LOCUS_17440 gene modB 152910 152242 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022260.1 protein_id gnl|my_center|LOCUS_17440 153276 152923 gene locus_tag LOCUS_17450 153276 152923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 155422 153305 gene locus_tag LOCUS_17460 155422 153305 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU0 protein_id gnl|my_center|LOCUS_17460 155415 157397 gene locus_tag LOCUS_17470 155415 157397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 157384 159252 gene locus_tag LOCUS_17480 157384 159252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 159278 160384 gene locus_tag LOCUS_17490 gene carA 159278 160384 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK41 protein_id gnl|my_center|LOCUS_17490 160381 161334 gene locus_tag LOCUS_17500 gene fcl 160381 161334 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_17500 162715 161408 gene locus_tag LOCUS_17510 162715 161408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_17510 165389 162747 gene locus_tag LOCUS_17520 165389 162747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 167292 165457 gene locus_tag LOCUS_17530 167292 165457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 167999 167289 gene locus_tag LOCUS_17540 167999 167289 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_17540 169654 167996 gene locus_tag LOCUS_17550 169654 167996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 171057 169654 gene locus_tag LOCUS_17560 171057 169654 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_17560 171895 171068 gene locus_tag LOCUS_17570 171895 171068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 172887 171862 gene locus_tag LOCUS_17580 172887 171862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 174254 175294 gene locus_tag LOCUS_17590 174254 175294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 175543 175818 gene locus_tag LOCUS_17600 175543 175818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 175772 176239 gene locus_tag LOCUS_17610 gene ntrR1 175772 176239 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7APC4 protein_id gnl|my_center|LOCUS_17610 178482 176236 gene locus_tag LOCUS_17620 178482 176236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 179426 178482 gene locus_tag LOCUS_17630 179426 178482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 181078 179423 gene locus_tag LOCUS_17640 181078 179423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 181091 182503 gene locus_tag LOCUS_17650 181091 182503 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_17650 182562 183590 gene locus_tag LOCUS_17660 182562 183590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 183603 183908 gene locus_tag LOCUS_17670 183603 183908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 183941 187003 gene locus_tag LOCUS_17680 183941 187003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 187848 187045 gene locus_tag LOCUS_17690 187848 187045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_17690 189023 187878 gene locus_tag LOCUS_17700 gene dprA 189023 187878 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_17700 189359 189799 gene locus_tag LOCUS_17710 189359 189799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 189871 190608 gene locus_tag LOCUS_17720 189871 190608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 190633 193554 gene locus_tag LOCUS_17730 190633 193554 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405100.1 protein_id gnl|my_center|LOCUS_17730 194654 193641 gene locus_tag LOCUS_17740 gene trpS 194654 193641 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA78 protein_id gnl|my_center|LOCUS_17740 194801 195454 gene locus_tag LOCUS_17750 194801 195454 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143625.1 protein_id gnl|my_center|LOCUS_17750 195712 196812 gene locus_tag LOCUS_17760 195712 196812 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_17760 196812 201158 gene locus_tag LOCUS_17770 196812 201158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 201311 201384 gene locus_tag LOCUS_t00320 201311 201384 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 201488 202105 gene locus_tag LOCUS_17780 201488 202105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 202686 208082 gene locus_tag LOCUS_17790 202686 208082 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_17790 208082 211039 gene locus_tag LOCUS_17800 208082 211039 CDS product ATP-dependent helicase HepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_17800 211044 215033 gene locus_tag LOCUS_17810 211044 215033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_17810 215036 216262 gene locus_tag LOCUS_17820 215036 216262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_17820 216263 217027 gene locus_tag LOCUS_17830 216263 217027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 217351 217097 gene locus_tag LOCUS_17840 217351 217097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 217445 218731 gene locus_tag LOCUS_17850 217445 218731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 218731 219411 gene locus_tag LOCUS_17860 218731 219411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 219408 223814 gene locus_tag LOCUS_17870 gene mukB 219408 223814 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7Z5 protein_id gnl|my_center|LOCUS_17870 223811 224848 gene locus_tag LOCUS_17880 223811 224848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 226454 224808 gene locus_tag LOCUS_17890 226454 224808 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_17890 228713 226536 gene locus_tag LOCUS_17900 228713 226536 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067382.1 protein_id gnl|my_center|LOCUS_17900 232326 228718 gene locus_tag LOCUS_17910 232326 228718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 232422 233306 gene locus_tag LOCUS_17920 232422 233306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 233303 233947 gene locus_tag LOCUS_17930 233303 233947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 238249 234431 gene locus_tag LOCUS_17940 238249 234431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 241814 238458 gene locus_tag LOCUS_17950 241814 238458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 242556 241879 gene locus_tag LOCUS_17960 242556 241879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 243424 242651 gene locus_tag LOCUS_17970 243424 242651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 243936 243421 gene locus_tag LOCUS_17980 243936 243421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 244078 245613 gene locus_tag LOCUS_17990 244078 245613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 247500 245635 gene locus_tag LOCUS_18000 247500 245635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 248306 247497 gene locus_tag LOCUS_18010 248306 247497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 248829 249071 gene locus_tag LOCUS_18020 248829 249071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 250111 249317 gene locus_tag LOCUS_18030 250111 249317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_18030 255282 250114 gene locus_tag LOCUS_18040 255282 250114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 255971 258466 gene locus_tag LOCUS_18050 255971 258466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 258476 258907 gene locus_tag LOCUS_18060 258476 258907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_18060 258961 260337 gene locus_tag LOCUS_18070 258961 260337 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_18070 264405 260317 gene locus_tag LOCUS_18080 264405 260317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 264599 267907 gene locus_tag LOCUS_18090 264599 267907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_18090 267928 270396 gene locus_tag LOCUS_18100 267928 270396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143648.1 protein_id gnl|my_center|LOCUS_18100 271036 270473 gene locus_tag LOCUS_18110 271036 270473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 272074 271115 gene locus_tag LOCUS_18120 272074 271115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 272285 273592 gene locus_tag LOCUS_18130 272285 273592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 273589 274788 gene locus_tag LOCUS_18140 273589 274788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 274785 275477 gene locus_tag LOCUS_18150 274785 275477 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_18150 275461 278016 gene locus_tag LOCUS_18160 275461 278016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 279419 278040 gene locus_tag LOCUS_18170 gene dhs1 279419 278040 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_18170 279530 280021 gene locus_tag LOCUS_18180 279530 280021 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_18180 280315 280037 gene locus_tag LOCUS_18190 280315 280037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 282197 280458 gene locus_tag LOCUS_18200 282197 280458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 283925 282246 gene locus_tag LOCUS_18210 283925 282246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 284257 286308 gene locus_tag LOCUS_18220 284257 286308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 287211 286480 gene locus_tag LOCUS_18230 287211 286480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_18230 288197 287211 gene locus_tag LOCUS_18240 288197 287211 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_18240 288278 288877 gene locus_tag LOCUS_18250 288278 288877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 289637 290551 gene locus_tag LOCUS_18260 289637 290551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 291503 290688 gene locus_tag LOCUS_18270 291503 290688 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_18270 292003 291656 gene locus_tag LOCUS_18280 292003 291656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 291995 292558 gene locus_tag LOCUS_18290 291995 292558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 293465 292599 gene locus_tag LOCUS_18300 293465 292599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 295733 293562 gene locus_tag LOCUS_18310 295733 293562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 295915 297600 gene locus_tag LOCUS_18320 295915 297600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_18320 297609 299234 gene locus_tag LOCUS_18330 297609 299234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 299645 299244 gene locus_tag LOCUS_18340 gene fxsA 299645 299244 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_18340 300764 299658 gene locus_tag LOCUS_18350 300764 299658 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_18350 301035 301916 gene locus_tag LOCUS_18360 gene uppS 301035 301916 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_18360 301978 302838 gene locus_tag LOCUS_18370 301978 302838 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_18370 302935 303702 gene locus_tag LOCUS_18380 302935 303702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 303699 304925 gene locus_tag LOCUS_18390 303699 304925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 304922 305578 gene locus_tag LOCUS_18400 304922 305578 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_18400 306825 305614 gene locus_tag LOCUS_18410 306825 305614 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_18410 307308 313868 gene locus_tag LOCUS_18420 307308 313868 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence07 1187 54 gene locus_tag LOCUS_18430 1187 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2916 1228 gene locus_tag LOCUS_18440 gene mviN 2916 1228 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_18440 4688 2913 gene locus_tag LOCUS_18450 4688 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6822 4666 gene locus_tag LOCUS_18460 6822 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7691 6882 gene locus_tag LOCUS_18470 7691 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 7910 7695 gene locus_tag LOCUS_18480 7910 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8967 7960 gene locus_tag LOCUS_18490 8967 7960 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_18490 10213 8972 gene locus_tag LOCUS_18500 10213 8972 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_18500 12093 10213 gene locus_tag LOCUS_18510 12093 10213 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337464.1 protein_id gnl|my_center|LOCUS_18510 13978 12356 gene locus_tag LOCUS_18520 13978 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 15804 13975 gene locus_tag LOCUS_18530 15804 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 16614 15847 gene locus_tag LOCUS_18540 16614 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 19626 16831 gene locus_tag LOCUS_18550 19626 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 19748 20389 gene locus_tag LOCUS_18560 19748 20389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 20499 20924 gene locus_tag LOCUS_18570 20499 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 21048 23300 gene locus_tag LOCUS_18580 21048 23300 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_18580 23971 23315 gene locus_tag LOCUS_18590 23971 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 25783 24074 gene locus_tag LOCUS_18600 25783 24074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 25896 28814 gene locus_tag LOCUS_18610 25896 28814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 28874 30496 gene locus_tag LOCUS_18620 28874 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 30914 30537 gene locus_tag LOCUS_18630 30914 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 31007 32500 gene locus_tag LOCUS_18640 31007 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_18640 32519 33778 gene locus_tag LOCUS_18650 32519 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_18650 33792 34334 gene locus_tag LOCUS_18660 33792 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 36293 35025 gene locus_tag LOCUS_18670 36293 35025 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_18670 36647 36294 gene locus_tag LOCUS_18680 36647 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_18680 38171 36780 gene locus_tag LOCUS_18690 gene mgtE 38171 36780 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 protein_id gnl|my_center|LOCUS_18690 38321 39532 gene locus_tag LOCUS_18700 gene add 38321 39532 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224867.1 protein_id gnl|my_center|LOCUS_18700 39525 41537 gene locus_tag LOCUS_18710 39525 41537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 41537 42928 gene locus_tag LOCUS_18720 gene allB 41537 42928 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKU5 protein_id gnl|my_center|LOCUS_18720 43293 54236 gene locus_tag LOCUS_18730 43293 54236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 54255 60302 gene locus_tag LOCUS_18740 54255 60302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 60389 60937 gene locus_tag LOCUS_18750 60389 60937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 60981 61958 gene locus_tag LOCUS_18760 60981 61958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 62266 63162 gene locus_tag LOCUS_18770 gene murQ 62266 63162 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 protein_id gnl|my_center|LOCUS_18770 64392 63166 gene locus_tag LOCUS_18780 64392 63166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 64542 66269 gene locus_tag LOCUS_18790 64542 66269 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_18790 67577 66306 gene locus_tag LOCUS_18800 67577 66306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 68478 67570 gene locus_tag LOCUS_18810 68478 67570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 68879 68481 gene locus_tag LOCUS_18820 68879 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 69143 72271 gene locus_tag LOCUS_18830 69143 72271 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_18830 75565 72275 gene locus_tag LOCUS_18840 75565 72275 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT8 protein_id gnl|my_center|LOCUS_18840 75707 80284 gene locus_tag LOCUS_18850 75707 80284 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_18850 82861 80294 gene locus_tag LOCUS_18860 82861 80294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_18860 82945 84102 gene locus_tag LOCUS_18870 82945 84102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_18870 87029 84180 gene locus_tag LOCUS_18880 87029 84180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 87482 87033 gene locus_tag LOCUS_18890 87482 87033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 88147 89124 gene locus_tag LOCUS_18900 88147 89124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 91673 89316 gene locus_tag LOCUS_18910 91673 89316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 93513 91690 gene locus_tag LOCUS_18920 93513 91690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 95554 93506 gene locus_tag LOCUS_18930 95554 93506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 95656 96738 gene locus_tag LOCUS_18940 95656 96738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 96738 97760 gene locus_tag LOCUS_18950 96738 97760 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_18950 97773 98897 gene locus_tag LOCUS_18960 gene tyrA 97773 98897 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QH8 protein_id gnl|my_center|LOCUS_18960 98922 99755 gene locus_tag LOCUS_18970 gene cobB 98922 99755 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIH7 protein_id gnl|my_center|LOCUS_18970 100869 99739 gene locus_tag LOCUS_18980 gene rp630 100869 99739 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_18980 100967 101668 gene locus_tag LOCUS_18990 100967 101668 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_18990 101966 102280 gene locus_tag LOCUS_19000 101966 102280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19000 103388 102264 gene locus_tag LOCUS_19010 103388 102264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 103561 104076 gene locus_tag LOCUS_19020 103561 104076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_19020 104083 104562 gene locus_tag LOCUS_19030 104083 104562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 104575 106641 gene locus_tag LOCUS_19040 104575 106641 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_19040 106680 107921 gene locus_tag LOCUS_19050 gene alaS 106680 107921 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181813.1 protein_id gnl|my_center|LOCUS_19050 107947 108870 gene locus_tag LOCUS_19060 107947 108870 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_19060 109645 108929 gene locus_tag LOCUS_19070 109645 108929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 111952 109781 gene locus_tag LOCUS_19080 111952 109781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 111906 113024 gene locus_tag LOCUS_19090 111906 113024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 113039 113929 gene locus_tag LOCUS_19100 113039 113929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403785.1 protein_id gnl|my_center|LOCUS_19100 113910 114734 gene locus_tag LOCUS_19110 113910 114734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 114872 115312 gene locus_tag LOCUS_19120 114872 115312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 116808 115357 gene locus_tag LOCUS_19130 116808 115357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 117019 116930 gene locus_tag LOCUS_t00330 117019 116930 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117144 117067 gene locus_tag LOCUS_t00340 117144 117067 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 117254 117169 gene locus_tag LOCUS_t00350 117254 117169 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117356 117268 gene locus_tag LOCUS_t00360 117356 117268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117490 117401 gene locus_tag LOCUS_t00370 117490 117401 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117817 118326 gene locus_tag LOCUS_19140 117817 118326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 120922 118331 gene locus_tag LOCUS_19150 120922 118331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_19150 121009 122835 gene locus_tag LOCUS_19160 121009 122835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 122848 123972 gene locus_tag LOCUS_19170 122848 123972 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_19170 124057 124305 gene locus_tag LOCUS_19180 124057 124305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 124435 124704 gene locus_tag LOCUS_19190 124435 124704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 124790 127486 gene locus_tag LOCUS_19200 124790 127486 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_19200 127492 127932 gene locus_tag LOCUS_19210 127492 127932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 129190 127961 gene locus_tag LOCUS_19220 129190 127961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_19220 129651 129193 gene locus_tag LOCUS_19230 gene rplI 129651 129193 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DH1 protein_id gnl|my_center|LOCUS_19230 129892 129662 gene locus_tag LOCUS_19240 gene rpsR 129892 129662 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQP6 protein_id gnl|my_center|LOCUS_19240 130296 129904 gene locus_tag LOCUS_19250 gene rpsF 130296 129904 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC2 protein_id gnl|my_center|LOCUS_19250 132477 130417 gene locus_tag LOCUS_19260 gene hppA1 132477 130417 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_19260 133146 132520 gene locus_tag LOCUS_19270 gene pth 133146 132520 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRW3 protein_id gnl|my_center|LOCUS_19270 133797 133150 gene locus_tag LOCUS_19280 gene rplY 133797 133150 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG55 protein_id gnl|my_center|LOCUS_19280 134824 133883 gene locus_tag LOCUS_19290 gene prsA 134824 133883 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_19290 135491 135096 gene locus_tag LOCUS_19300 135491 135096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 136054 135710 gene locus_tag LOCUS_19310 136054 135710 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C35 protein_id gnl|my_center|LOCUS_19310 136224 137939 gene locus_tag LOCUS_19320 136224 137939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 138421 137987 gene locus_tag LOCUS_19330 138421 137987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 139955 138432 gene locus_tag LOCUS_19340 139955 138432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 139973 140521 gene locus_tag LOCUS_19350 gene hpt 139973 140521 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_19350 140550 140930 gene locus_tag LOCUS_19360 140550 140930 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_19360 141884 140931 gene locus_tag LOCUS_19370 141884 140931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 142522 141908 gene locus_tag LOCUS_19380 gene ribE 142522 141908 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_19380 143628 142486 gene locus_tag LOCUS_19390 143628 142486 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_19390 144647 143628 gene locus_tag LOCUS_19400 gene ftsY 144647 143628 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_19400 145073 144696 gene locus_tag LOCUS_19410 145073 144696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 146935 145076 gene locus_tag LOCUS_19420 146935 145076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 148129 147011 gene locus_tag LOCUS_19430 gene aroB 148129 147011 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_19430 149896 148139 gene locus_tag LOCUS_19440 gene aspS 149896 148139 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_19440 150762 149926 gene locus_tag LOCUS_19450 150762 149926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 151582 150794 gene locus_tag LOCUS_19460 151582 150794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 152703 151618 gene locus_tag LOCUS_19470 152703 151618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 153280 152753 gene locus_tag LOCUS_19480 153280 152753 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889777.1 protein_id gnl|my_center|LOCUS_19480 156966 153664 gene locus_tag LOCUS_19490 gene acrD 156966 153664 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_19490 158511 156970 gene locus_tag LOCUS_19500 158511 156970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 158785 159396 gene locus_tag LOCUS_19510 158785 159396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 163790 159393 gene locus_tag LOCUS_19520 163790 159393 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 protein_id gnl|my_center|LOCUS_19520 164588 163794 gene locus_tag LOCUS_19530 164588 163794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 165340 164627 gene locus_tag LOCUS_19540 165340 164627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 165566 168046 gene locus_tag LOCUS_19550 165566 168046 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_19550 170990 168057 gene locus_tag LOCUS_19560 170990 168057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 173583 171094 gene locus_tag LOCUS_19570 173583 171094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_19570 173690 175429 gene locus_tag LOCUS_19580 173690 175429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 175426 177135 gene locus_tag LOCUS_19590 175426 177135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 180247 177176 gene locus_tag LOCUS_19600 180247 177176 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_19600 183364 180320 gene locus_tag LOCUS_19610 183364 180320 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_19610 184485 183415 gene locus_tag LOCUS_19620 184485 183415 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_19620 185012 184494 gene locus_tag LOCUS_19630 185012 184494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 188078 185112 gene locus_tag LOCUS_19640 188078 185112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 188126 191491 gene locus_tag LOCUS_19650 188126 191491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_19650 192537 191536 gene locus_tag LOCUS_19660 192537 191536 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_19660 192781 193290 gene locus_tag LOCUS_19670 192781 193290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 194353 193412 gene locus_tag LOCUS_19680 194353 193412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 195287 194544 gene locus_tag LOCUS_19690 195287 194544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 196197 195277 gene locus_tag LOCUS_19700 gene hemC 196197 195277 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP73 protein_id gnl|my_center|LOCUS_19700 197453 196194 gene locus_tag LOCUS_19710 gene hemA 197453 196194 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I2 protein_id gnl|my_center|LOCUS_19710 198329 197505 gene locus_tag LOCUS_19720 198329 197505 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_19720 199231 198377 gene locus_tag LOCUS_19730 199231 198377 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_19730 200834 199302 gene locus_tag LOCUS_19740 200834 199302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 201217 200930 gene locus_tag LOCUS_19750 201217 200930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 201128 201817 gene locus_tag LOCUS_19760 201128 201817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 201814 204525 gene locus_tag LOCUS_19770 201814 204525 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405034.1 protein_id gnl|my_center|LOCUS_19770 204570 206546 gene locus_tag LOCUS_19780 204570 206546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 207559 206657 gene locus_tag LOCUS_19790 207559 206657 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023628.1 protein_id gnl|my_center|LOCUS_19790 207632 208174 gene locus_tag LOCUS_19800 207632 208174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 208369 208950 gene locus_tag LOCUS_19810 208369 208950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 209093 209782 gene locus_tag LOCUS_19820 209093 209782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 210020 212800 gene locus_tag LOCUS_19830 210020 212800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 215300 212808 gene locus_tag LOCUS_19840 215300 212808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_19840 216003 215404 gene locus_tag LOCUS_19850 216003 215404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 217978 216113 gene locus_tag LOCUS_19860 gene gaa 217978 216113 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_19860 218247 218660 gene locus_tag LOCUS_19870 218247 218660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 218672 229309 gene locus_tag LOCUS_19880 218672 229309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 230833 229328 gene locus_tag LOCUS_19890 230833 229328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 233105 230817 gene locus_tag LOCUS_19900 233105 230817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_19900 234648 233125 gene locus_tag LOCUS_19910 234648 233125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680701.1 protein_id gnl|my_center|LOCUS_19910 239326 234716 gene locus_tag LOCUS_19920 239326 234716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 245922 239347 gene locus_tag LOCUS_19930 gene pvdD 245922 239347 CDS product pyoverdine synthetase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895611.1 protein_id gnl|my_center|LOCUS_19930 252593 245919 gene locus_tag LOCUS_19940 252593 245919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 262562 252624 gene locus_tag LOCUS_19950 262562 252624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 275158 262559 gene locus_tag LOCUS_19960 275158 262559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 275342 275662 gene locus_tag LOCUS_19970 275342 275662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 288375 276703 gene locus_tag LOCUS_19980 288375 276703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 288961 289800 gene locus_tag LOCUS_19990 288961 289800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 289975 291717 gene locus_tag LOCUS_20000 289975 291717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 292186 292836 gene locus_tag LOCUS_20010 292186 292836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 292846 293574 gene locus_tag LOCUS_20020 292846 293574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 293845 295347 gene locus_tag LOCUS_20030 293845 295347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 295663 295914 gene locus_tag LOCUS_20040 295663 295914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 303023 296196 gene locus_tag LOCUS_20050 303023 296196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 303963 304529 gene locus_tag LOCUS_20060 303963 304529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 304602 304913 gene locus_tag LOCUS_20070 304602 304913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 305106 307067 gene locus_tag LOCUS_20080 305106 307067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 307227 307967 gene locus_tag LOCUS_20090 307227 307967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 310050 310769 gene locus_tag LOCUS_20100 310050 310769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 310805 311029 gene locus_tag LOCUS_20110 310805 311029 CDS product antibiotic synthesis protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304661.1 protein_id gnl|my_center|LOCUS_20110 311094 312269 gene locus_tag LOCUS_20120 gene proB 311094 312269 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDJ9 protein_id gnl|my_center|LOCUS_20120 312266 313555 gene locus_tag LOCUS_20130 gene proA 312266 313555 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_20130 313630 314013 gene locus_tag LOCUS_20140 313630 314013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 314078 315127 gene locus_tag LOCUS_20150 314078 315127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 315120 316238 gene locus_tag LOCUS_20160 315120 316238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 316378 318321 gene locus_tag LOCUS_20170 gene cmfA 316378 318321 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_20170 323215 318593 gene locus_tag LOCUS_20180 323215 318593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence08 308 616 gene locus_tag LOCUS_20190 gene rpsJ 308 616 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J83 protein_id gnl|my_center|LOCUS_20190 630 1259 gene locus_tag LOCUS_20200 gene rplC 630 1259 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60454 protein_id gnl|my_center|LOCUS_20200 1291 1914 gene locus_tag LOCUS_20210 gene rplD 1291 1914 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPQ7 protein_id gnl|my_center|LOCUS_20210 1911 2195 gene locus_tag LOCUS_20220 gene rplW 1911 2195 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_20220 2198 3031 gene locus_tag LOCUS_20230 gene rplB 2198 3031 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_20230 3043 3327 gene locus_tag LOCUS_20240 gene rpsS 3043 3327 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH45 protein_id gnl|my_center|LOCUS_20240 3349 3705 gene locus_tag LOCUS_20250 gene rplV 3349 3705 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PY5 protein_id gnl|my_center|LOCUS_20250 3755 4405 gene locus_tag LOCUS_20260 gene rpsC 3755 4405 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_20260 4443 4859 gene locus_tag LOCUS_20270 gene rplP 4443 4859 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_20270 4874 5062 gene locus_tag LOCUS_20280 gene rpmC 4874 5062 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W7 protein_id gnl|my_center|LOCUS_20280 5087 5389 gene locus_tag LOCUS_20290 gene rpsQ 5087 5389 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG8 protein_id gnl|my_center|LOCUS_20290 5402 5770 gene locus_tag LOCUS_20300 gene rplN 5402 5770 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z8 protein_id gnl|my_center|LOCUS_20300 5781 6104 gene locus_tag LOCUS_20310 gene rplX 5781 6104 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG36 protein_id gnl|my_center|LOCUS_20310 6131 6697 gene locus_tag LOCUS_20320 gene rplE 6131 6697 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG8 protein_id gnl|my_center|LOCUS_20320 6707 6892 gene locus_tag LOCUS_20330 6707 6892 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_20330 6913 7311 gene locus_tag LOCUS_20340 gene rpsH 6913 7311 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66623 protein_id gnl|my_center|LOCUS_20340 7322 7861 gene locus_tag LOCUS_20350 gene rplF 7322 7861 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_20350 7876 8262 gene locus_tag LOCUS_20360 gene rplR 7876 8262 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG8 protein_id gnl|my_center|LOCUS_20360 8272 8805 gene locus_tag LOCUS_20370 gene rpsE 8272 8805 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_20370 8839 9024 gene locus_tag LOCUS_20380 gene rpmD 8839 9024 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM3 protein_id gnl|my_center|LOCUS_20380 9028 9465 gene locus_tag LOCUS_20390 gene rplO 9028 9465 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J23 protein_id gnl|my_center|LOCUS_20390 9462 10841 gene locus_tag LOCUS_20400 gene secY 9462 10841 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_20400 10872 11438 gene locus_tag LOCUS_20410 gene adk 10872 11438 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY1 protein_id gnl|my_center|LOCUS_20410 11435 12328 gene locus_tag LOCUS_20420 11435 12328 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_20420 12303 12581 gene locus_tag LOCUS_20430 gene infA1 12303 12581 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_20430 12769 13149 gene locus_tag LOCUS_20440 gene rpsM 12769 13149 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_20440 13161 13556 gene locus_tag LOCUS_20450 gene rpsK 13161 13556 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B1 protein_id gnl|my_center|LOCUS_20450 13581 14210 gene locus_tag LOCUS_20460 13581 14210 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_20460 14333 15325 gene locus_tag LOCUS_20470 gene rpoA 14333 15325 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_20470 15346 15738 gene locus_tag LOCUS_20480 gene rplQ 15346 15738 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY5 protein_id gnl|my_center|LOCUS_20480 17409 15790 gene locus_tag LOCUS_20490 17409 15790 CDS product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_20490 18107 17430 gene locus_tag LOCUS_20500 18107 17430 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_20500 19281 18133 gene locus_tag LOCUS_20510 19281 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 19311 20462 gene locus_tag LOCUS_20520 19311 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 20446 21144 gene locus_tag LOCUS_20530 20446 21144 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_20530 21232 21897 gene locus_tag LOCUS_20540 gene sigW 21232 21897 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_20540 21894 22526 gene locus_tag LOCUS_20550 21894 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 24721 23135 gene locus_tag LOCUS_20560 24721 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 26189 24783 gene locus_tag LOCUS_20570 26189 24783 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_20570 26550 27137 gene locus_tag LOCUS_20580 26550 27137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 27229 27672 gene locus_tag LOCUS_20590 27229 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 28387 27701 gene locus_tag LOCUS_20600 gene moaX 28387 27701 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MWY3 protein_id gnl|my_center|LOCUS_20600 28268 28492 gene locus_tag LOCUS_20610 28268 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 28489 30192 gene locus_tag LOCUS_20620 28489 30192 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_20620 30204 31571 gene locus_tag LOCUS_20630 30204 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 31582 32949 gene locus_tag LOCUS_20640 31582 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 34674 33301 gene locus_tag LOCUS_20650 34674 33301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 35962 34658 gene locus_tag LOCUS_20660 35962 34658 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_20660 36175 37245 gene locus_tag LOCUS_20670 36175 37245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 37291 38445 gene locus_tag LOCUS_20680 37291 38445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 38601 40001 gene locus_tag LOCUS_20690 38601 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 40573 39998 gene locus_tag LOCUS_20700 40573 39998 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710981.1 protein_id gnl|my_center|LOCUS_20700 42528 40570 gene locus_tag LOCUS_20710 42528 40570 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_20710 43835 42696 gene locus_tag LOCUS_20720 43835 42696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 46109 43878 gene locus_tag LOCUS_20730 46109 43878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 46202 46432 gene locus_tag LOCUS_20740 46202 46432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 46644 48899 gene locus_tag LOCUS_20750 gene phuR 46644 48899 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_20750 48909 50018 gene locus_tag LOCUS_20760 48909 50018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 50082 50609 gene locus_tag LOCUS_20770 50082 50609 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404452.1 protein_id gnl|my_center|LOCUS_20770 50593 51228 gene locus_tag LOCUS_20780 50593 51228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 51215 51805 gene locus_tag LOCUS_20790 51215 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 51980 53005 gene locus_tag LOCUS_20800 gene fabH 51980 53005 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_20800 53002 53907 gene locus_tag LOCUS_20810 gene oleB 53002 53907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_20810 54349 53963 gene locus_tag LOCUS_20820 54349 53963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 55272 54472 gene locus_tag LOCUS_20830 gene xth 55272 54472 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_20830 67845 55354 gene locus_tag LOCUS_20840 67845 55354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 68299 68625 gene locus_tag LOCUS_20850 68299 68625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 68947 69861 gene locus_tag LOCUS_20860 68947 69861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 69868 71682 gene locus_tag LOCUS_20870 69868 71682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 72866 72288 gene locus_tag LOCUS_20880 72866 72288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 72892 73842 gene locus_tag LOCUS_20890 72892 73842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 73860 75389 gene locus_tag LOCUS_20900 73860 75389 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974857.1 protein_id gnl|my_center|LOCUS_20900 75768 75367 gene locus_tag LOCUS_20910 75768 75367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 76628 75765 gene locus_tag LOCUS_20920 76628 75765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20920 79298 76638 gene locus_tag LOCUS_20930 gene valS 79298 76638 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL27 protein_id gnl|my_center|LOCUS_20930 80284 79349 gene locus_tag LOCUS_20940 80284 79349 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 protein_id gnl|my_center|LOCUS_20940 80574 80299 gene locus_tag LOCUS_20950 80574 80299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 80939 80571 gene locus_tag LOCUS_20960 80939 80571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 82769 81465 gene locus_tag LOCUS_20970 gene eno 82769 81465 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR6 protein_id gnl|my_center|LOCUS_20970 83358 82828 gene locus_tag LOCUS_20980 83358 82828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 84489 83371 gene locus_tag LOCUS_20990 84489 83371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 84633 85133 gene locus_tag LOCUS_21000 gene tpx 84633 85133 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 protein_id gnl|my_center|LOCUS_21000 85193 87196 gene locus_tag LOCUS_21010 85193 87196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 87776 87159 gene locus_tag LOCUS_21020 87776 87159 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808853.1 protein_id gnl|my_center|LOCUS_21020 89223 87850 gene locus_tag LOCUS_21030 89223 87850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_21030 89290 90057 gene locus_tag LOCUS_21040 89290 90057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 90060 90425 gene locus_tag LOCUS_21050 90060 90425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 90737 90429 gene locus_tag LOCUS_21060 90737 90429 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_21060 91071 93152 gene locus_tag LOCUS_21070 91071 93152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 93205 93810 gene locus_tag LOCUS_21080 93205 93810 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_21080 94238 93849 gene locus_tag LOCUS_21090 94238 93849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 96571 94331 gene locus_tag LOCUS_21100 96571 94331 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_21100 99630 96715 gene locus_tag LOCUS_21110 99630 96715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 100716 99691 gene locus_tag LOCUS_21120 100716 99691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 100812 101435 gene locus_tag LOCUS_21130 100812 101435 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_21130 101448 102215 gene locus_tag LOCUS_21140 101448 102215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 102290 105280 gene locus_tag LOCUS_21150 102290 105280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142889.1 protein_id gnl|my_center|LOCUS_21150 105364 106107 gene locus_tag LOCUS_21160 105364 106107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 106130 107407 gene locus_tag LOCUS_21170 106130 107407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 109598 107499 gene locus_tag LOCUS_21180 109598 107499 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143962.1 protein_id gnl|my_center|LOCUS_21180 110500 109703 gene locus_tag LOCUS_21190 110500 109703 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_21190 112762 110516 gene locus_tag LOCUS_21200 gene pmm 112762 110516 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_21200 113812 112793 gene locus_tag LOCUS_21210 113812 112793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_21210 113859 114410 gene locus_tag LOCUS_21220 gene def 113859 114410 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_21220 114359 114901 gene locus_tag LOCUS_21230 gene rlmH 114359 114901 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB0 protein_id gnl|my_center|LOCUS_21230 114999 115388 gene locus_tag LOCUS_21240 114999 115388 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125527.1 protein_id gnl|my_center|LOCUS_21240 115407 116798 gene locus_tag LOCUS_21250 115407 116798 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_21250 116840 117256 gene locus_tag LOCUS_21260 gene hit 116840 117256 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_21260 118447 117530 gene locus_tag LOCUS_21270 118447 117530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_21270 119784 118444 gene locus_tag LOCUS_21280 gene moxR 119784 118444 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_21280 122453 119760 gene locus_tag LOCUS_21290 122453 119760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 124672 122474 gene locus_tag LOCUS_21300 124672 122474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 125992 124760 gene locus_tag LOCUS_21310 125992 124760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 127348 126479 gene locus_tag LOCUS_21320 127348 126479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771225.1 protein_id gnl|my_center|LOCUS_21320 129063 127348 gene locus_tag LOCUS_21330 129063 127348 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_21330 129999 129145 gene locus_tag LOCUS_21340 129999 129145 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_21340 130967 130026 gene locus_tag LOCUS_21350 130967 130026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 133290 131044 gene locus_tag LOCUS_21360 gene mrcB 133290 131044 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ35 protein_id gnl|my_center|LOCUS_21360 134921 133797 gene locus_tag LOCUS_21370 gene hemH2 134921 133797 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_21370 135141 137378 gene locus_tag LOCUS_21380 135141 137378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 137480 138859 gene locus_tag LOCUS_21390 gene ffh 137480 138859 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV8 protein_id gnl|my_center|LOCUS_21390 139047 139484 gene locus_tag LOCUS_21400 139047 139484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 139481 139738 gene locus_tag LOCUS_21410 139481 139738 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK95 protein_id gnl|my_center|LOCUS_21410 139767 140324 gene locus_tag LOCUS_21420 gene rimM 139767 140324 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDI4 protein_id gnl|my_center|LOCUS_21420 140306 141055 gene locus_tag LOCUS_21430 gene trmD 140306 141055 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_21430 141257 141601 gene locus_tag LOCUS_21440 gene rplS 141257 141601 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNZ0 protein_id gnl|my_center|LOCUS_21440 141686 142366 gene locus_tag LOCUS_21450 gene rnhB 141686 142366 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIH1 protein_id gnl|my_center|LOCUS_21450 142366 145833 gene locus_tag LOCUS_21460 142366 145833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 145886 146953 gene locus_tag LOCUS_21470 145886 146953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 147017 148033 gene locus_tag LOCUS_21480 147017 148033 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_21480 148062 148922 gene locus_tag LOCUS_21490 148062 148922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_21490 148932 149957 gene locus_tag LOCUS_21500 148932 149957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_21500 151760 149964 gene locus_tag LOCUS_21510 151760 149964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_21510 152807 151764 gene locus_tag LOCUS_21520 152807 151764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 152925 153155 gene locus_tag LOCUS_21530 152925 153155 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_21530 153694 153233 gene locus_tag LOCUS_21540 153694 153233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 154566 153802 gene locus_tag LOCUS_21550 154566 153802 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226595.1 protein_id gnl|my_center|LOCUS_21550 154746 157193 gene locus_tag LOCUS_21560 154746 157193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_21560 158674 157214 gene locus_tag LOCUS_21570 158674 157214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 158860 160413 gene locus_tag LOCUS_21580 158860 160413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 160425 161171 gene locus_tag LOCUS_21590 160425 161171 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_21590 161128 162789 gene locus_tag LOCUS_21600 gene bshC 161128 162789 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI14 protein_id gnl|my_center|LOCUS_21600 162786 163526 gene locus_tag LOCUS_21610 162786 163526 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_21610 163510 164436 gene locus_tag LOCUS_21620 163510 164436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 166123 164759 gene locus_tag LOCUS_21630 166123 164759 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_21630 168206 166152 gene locus_tag LOCUS_21640 168206 166152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 168328 168516 gene locus_tag LOCUS_21650 168328 168516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 168513 169304 gene locus_tag LOCUS_21660 168513 169304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 170999 169863 gene locus_tag LOCUS_21670 170999 169863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 170998 172272 gene locus_tag LOCUS_21680 gene kynU 170998 172272 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 protein_id gnl|my_center|LOCUS_21680 173711 172284 gene locus_tag LOCUS_21690 173711 172284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 174976 173714 gene locus_tag LOCUS_21700 174976 173714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 177016 174977 gene locus_tag LOCUS_21710 177016 174977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 177049 178425 gene locus_tag LOCUS_21720 177049 178425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 178867 178430 gene locus_tag LOCUS_21730 178867 178430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 180777 178864 gene locus_tag LOCUS_21740 180777 178864 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_21740 180882 181706 gene locus_tag LOCUS_21750 gene cobB 180882 181706 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM9 protein_id gnl|my_center|LOCUS_21750 181719 183308 gene locus_tag LOCUS_21760 gene prfC 181719 183308 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_21760 184534 183347 gene locus_tag LOCUS_21770 184534 183347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 184859 185725 gene locus_tag LOCUS_21780 184859 185725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 185809 188532 gene locus_tag LOCUS_21790 185809 188532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 188575 189882 gene locus_tag LOCUS_21800 188575 189882 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_21800 189884 191518 gene locus_tag LOCUS_21810 189884 191518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 192298 191528 gene locus_tag LOCUS_21820 192298 191528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 194198 192414 gene locus_tag LOCUS_21830 194198 192414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 197797 194681 gene locus_tag LOCUS_21840 197797 194681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_21840 197835 198797 gene locus_tag LOCUS_21850 197835 198797 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_21850 199742 198798 gene locus_tag LOCUS_21860 199742 198798 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_21860 199874 200401 gene locus_tag LOCUS_21870 199874 200401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 200417 201631 gene locus_tag LOCUS_21880 200417 201631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 201628 202473 gene locus_tag LOCUS_21890 201628 202473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 202451 203623 gene locus_tag LOCUS_21900 202451 203623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 203620 204648 gene locus_tag LOCUS_21910 203620 204648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 204742 207180 gene locus_tag LOCUS_21920 gene clpC 204742 207180 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880827.1 protein_id gnl|my_center|LOCUS_21920 209564 207198 gene locus_tag LOCUS_21930 209564 207198 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_21930 211090 209600 gene locus_tag LOCUS_21940 211090 209600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 212172 211093 gene locus_tag LOCUS_21950 212172 211093 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS91 protein_id gnl|my_center|LOCUS_21950 213280 212240 gene locus_tag LOCUS_21960 gene moaA 213280 212240 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39757 protein_id gnl|my_center|LOCUS_21960 213468 215156 gene locus_tag LOCUS_21970 213468 215156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 215662 215165 gene locus_tag LOCUS_21980 215662 215165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 216905 215982 gene locus_tag LOCUS_21990 216905 215982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 217029 217514 gene locus_tag LOCUS_22000 217029 217514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 217642 220005 gene locus_tag LOCUS_22010 217642 220005 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030698.1 protein_id gnl|my_center|LOCUS_22010 220482 222377 gene locus_tag LOCUS_22020 220482 222377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 222450 222947 gene locus_tag LOCUS_22030 222450 222947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 222940 224721 gene locus_tag LOCUS_22040 222940 224721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 224734 225339 gene locus_tag LOCUS_22050 224734 225339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 225352 226497 gene locus_tag LOCUS_22060 225352 226497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 226506 227921 gene locus_tag LOCUS_22070 226506 227921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 227936 228445 gene locus_tag LOCUS_22080 227936 228445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 228538 229701 gene locus_tag LOCUS_22090 228538 229701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 229691 231358 gene locus_tag LOCUS_22100 229691 231358 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_22100 231351 231824 gene locus_tag LOCUS_22110 231351 231824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 231826 232638 gene locus_tag LOCUS_22120 231826 232638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 232692 233612 gene locus_tag LOCUS_22130 232692 233612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 233609 235867 gene locus_tag LOCUS_22140 233609 235867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 235864 237063 gene locus_tag LOCUS_22150 235864 237063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 237060 238223 gene locus_tag LOCUS_22160 237060 238223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 238256 240451 gene locus_tag LOCUS_22170 238256 240451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 240448 242697 gene locus_tag LOCUS_22180 240448 242697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 242681 243301 gene locus_tag LOCUS_22190 242681 243301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 243313 245088 gene locus_tag LOCUS_22200 243313 245088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 249141 245095 gene locus_tag LOCUS_22210 gene cyaI3 249141 245095 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967832.1 protein_id gnl|my_center|LOCUS_22210 251738 249198 gene locus_tag LOCUS_22220 251738 249198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 252751 251780 gene locus_tag LOCUS_22230 252751 251780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 252924 254288 gene locus_tag LOCUS_22240 252924 254288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 254388 255110 gene locus_tag LOCUS_22250 254388 255110 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_22250 255364 255143 gene locus_tag LOCUS_22260 255364 255143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 255661 255386 gene locus_tag LOCUS_22270 255661 255386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 257121 255694 gene locus_tag LOCUS_22280 257121 255694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 257816 257127 gene locus_tag LOCUS_22290 257816 257127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 257950 259389 gene locus_tag LOCUS_22300 gene purB 257950 259389 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_22300 259434 260087 gene locus_tag LOCUS_22310 259434 260087 CDS product lipoprotein, RlpA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546239.1 protein_id gnl|my_center|LOCUS_22310 260700 260993 gene locus_tag LOCUS_22320 260700 260993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 260980 262410 gene locus_tag LOCUS_22330 gene gatA 260980 262410 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY4 protein_id gnl|my_center|LOCUS_22330 262420 263976 gene locus_tag LOCUS_22340 262420 263976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 263980 265566 gene locus_tag LOCUS_22350 263980 265566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 265573 267003 gene locus_tag LOCUS_22360 gene gatB 265573 267003 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2U6 protein_id gnl|my_center|LOCUS_22360 267056 267742 gene locus_tag LOCUS_22370 267056 267742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 271926 268384 gene locus_tag LOCUS_22380 271926 268384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 273755 272283 gene locus_tag LOCUS_22390 273755 272283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 273909 274331 gene locus_tag LOCUS_22400 273909 274331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 274453 277641 gene locus_tag LOCUS_22410 gene lacZ 274453 277641 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_22410 277649 277996 gene locus_tag LOCUS_22420 277649 277996 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_22420 279318 277999 gene locus_tag LOCUS_22430 279318 277999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 282620 279387 gene locus_tag LOCUS_22440 282620 279387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 283988 282741 gene locus_tag LOCUS_22450 283988 282741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_22450 285925 283988 gene locus_tag LOCUS_22460 285925 283988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 285999 286601 gene locus_tag LOCUS_22470 gene pdxH 285999 286601 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_22470 286598 287557 gene locus_tag LOCUS_22480 286598 287557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_22480 287575 289656 gene locus_tag LOCUS_22490 287575 289656 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_22490 291287 289725 gene locus_tag LOCUS_22500 291287 289725 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_22500 292078 291347 gene locus_tag LOCUS_22510 292078 291347 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 protein_id gnl|my_center|LOCUS_22510 292186 292734 gene locus_tag LOCUS_22520 gene rpoE 292186 292734 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_22520 292731 293657 gene locus_tag LOCUS_22530 292731 293657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 293695 294567 gene locus_tag LOCUS_22540 293695 294567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 294675 296132 gene locus_tag LOCUS_22550 294675 296132 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence09 234 584 gene locus_tag LOCUS_22560 234 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 830 639 gene locus_tag LOCUS_22570 830 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1441 1998 gene locus_tag LOCUS_22580 1441 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2017 2562 gene locus_tag LOCUS_22590 2017 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2572 3882 gene locus_tag LOCUS_22600 2572 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3900 4460 gene locus_tag LOCUS_22610 3900 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4471 8358 gene locus_tag LOCUS_22620 4471 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 9699 8452 gene locus_tag LOCUS_22630 9699 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 11248 9722 gene locus_tag LOCUS_22640 11248 9722 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_22640 12158 11274 gene locus_tag LOCUS_22650 12158 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 12471 14279 gene locus_tag LOCUS_22660 12471 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14282 14944 gene locus_tag LOCUS_22670 14282 14944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 17869 15470 gene locus_tag LOCUS_22680 17869 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22680 19636 18179 gene locus_tag LOCUS_22690 gene leuB 19636 18179 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_22690 19767 22094 gene locus_tag LOCUS_22700 19767 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 22066 23259 gene locus_tag LOCUS_22710 22066 23259 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973328.1 protein_id gnl|my_center|LOCUS_22710 23256 26408 gene locus_tag LOCUS_22720 23256 26408 CDS product drug-resistance cell envelope-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531375.1 protein_id gnl|my_center|LOCUS_22720 29520 26512 gene locus_tag LOCUS_22730 29520 26512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 31993 29627 gene locus_tag LOCUS_22740 31993 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 32195 33658 gene locus_tag LOCUS_22750 32195 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 34132 33683 gene locus_tag LOCUS_22760 34132 33683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_22760 35270 34338 gene locus_tag LOCUS_22770 gene catE 35270 34338 CDS product catechol-2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54721 protein_id gnl|my_center|LOCUS_22770 35923 36915 gene locus_tag LOCUS_22780 35923 36915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 37065 39206 gene locus_tag LOCUS_22790 37065 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 39288 39752 gene locus_tag LOCUS_22800 39288 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 40414 39749 gene locus_tag LOCUS_22810 40414 39749 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226486.1 protein_id gnl|my_center|LOCUS_22810 40447 40767 gene locus_tag LOCUS_22820 40447 40767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 40760 40945 gene locus_tag LOCUS_22830 40760 40945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 41857 41000 gene locus_tag LOCUS_22840 41857 41000 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_22840 42405 41872 gene locus_tag LOCUS_22850 42405 41872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 42456 42986 gene locus_tag LOCUS_22860 42456 42986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 44131 43103 gene locus_tag LOCUS_22870 44131 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 44472 44822 gene locus_tag LOCUS_22880 44472 44822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 49651 45272 gene locus_tag LOCUS_22890 49651 45272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 50996 49641 gene locus_tag LOCUS_22900 50996 49641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 52465 51026 gene locus_tag LOCUS_22910 gene selA 52465 51026 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61736 protein_id gnl|my_center|LOCUS_22910 52529 53791 gene locus_tag LOCUS_22920 52529 53791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 53788 54447 gene locus_tag LOCUS_22930 53788 54447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 56946 54454 gene locus_tag LOCUS_22940 56946 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22940 59460 57064 gene locus_tag LOCUS_22950 59460 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 61013 59457 gene locus_tag LOCUS_22960 61013 59457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 61101 62369 gene locus_tag LOCUS_22970 61101 62369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 62523 63401 gene locus_tag LOCUS_22980 62523 63401 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_22980 63448 64344 gene locus_tag LOCUS_22990 63448 64344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 65620 64910 gene locus_tag LOCUS_23000 65620 64910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 65941 69018 gene locus_tag LOCUS_23010 65941 69018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_23010 69421 69020 gene locus_tag LOCUS_23020 69421 69020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 70980 69421 gene locus_tag LOCUS_23030 gene pulE 70980 69421 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_23030 73775 71010 gene locus_tag LOCUS_23040 73775 71010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 74750 73800 gene locus_tag LOCUS_23050 74750 73800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 75986 74769 gene locus_tag LOCUS_23060 75986 74769 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986415.1 protein_id gnl|my_center|LOCUS_23060 77402 75990 gene locus_tag LOCUS_23070 77402 75990 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_23070 79378 77699 gene locus_tag LOCUS_23080 79378 77699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_23080 81654 79375 gene locus_tag LOCUS_23090 81654 79375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 83379 82081 gene locus_tag LOCUS_23100 83379 82081 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_23100 84052 83405 gene locus_tag LOCUS_23110 84052 83405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 84424 84158 gene locus_tag LOCUS_23120 84424 84158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 84638 85204 gene locus_tag LOCUS_23130 84638 85204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 85215 87329 gene locus_tag LOCUS_23140 85215 87329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 87326 89671 gene locus_tag LOCUS_23150 87326 89671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 90541 89984 gene locus_tag LOCUS_23160 90541 89984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 93096 90700 gene locus_tag LOCUS_23170 93096 90700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_23170 93579 93169 gene locus_tag LOCUS_23180 93579 93169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 95045 93768 gene locus_tag LOCUS_23190 95045 93768 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_23190 95109 95792 gene locus_tag LOCUS_23200 95109 95792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 95815 96366 gene locus_tag LOCUS_23210 95815 96366 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_23210 97220 96558 gene locus_tag LOCUS_23220 97220 96558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 97174 98442 gene locus_tag LOCUS_23230 97174 98442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 98476 100599 gene locus_tag LOCUS_23240 gene cat5 98476 100599 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_23240 100640 103150 gene locus_tag LOCUS_23250 100640 103150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_23250 103161 104276 gene locus_tag LOCUS_23260 gene rnd 103161 104276 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_23260 104280 106298 gene locus_tag LOCUS_23270 104280 106298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 108422 106317 gene locus_tag LOCUS_23280 108422 106317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 108646 108570 gene locus_tag LOCUS_t00380 108646 108570 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 108872 110002 gene locus_tag LOCUS_23290 108872 110002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 110776 110006 gene locus_tag LOCUS_23300 110776 110006 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_23300 111438 110773 gene locus_tag LOCUS_23310 111438 110773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 112511 111480 gene locus_tag LOCUS_23320 112511 111480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 113715 112525 gene locus_tag LOCUS_23330 113715 112525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 114566 113745 gene locus_tag LOCUS_23340 114566 113745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 114447 116666 gene locus_tag LOCUS_23350 gene greA 114447 116666 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7G4 protein_id gnl|my_center|LOCUS_23350 116669 117592 gene locus_tag LOCUS_23360 116669 117592 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708509.1 protein_id gnl|my_center|LOCUS_23360 118852 117593 gene locus_tag LOCUS_23370 118852 117593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_23370 121220 118857 gene locus_tag LOCUS_23380 121220 118857 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_23380 121981 121241 gene locus_tag LOCUS_23390 121981 121241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_23390 122068 123417 gene locus_tag LOCUS_23400 122068 123417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 123423 124961 gene locus_tag LOCUS_23410 123423 124961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 125058 127442 gene locus_tag LOCUS_23420 125058 127442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 127458 128720 gene locus_tag LOCUS_23430 127458 128720 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN6 protein_id gnl|my_center|LOCUS_23430 130340 129498 gene locus_tag LOCUS_23440 130340 129498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_23440 131647 130337 gene locus_tag LOCUS_23450 131647 130337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 132640 133056 gene locus_tag LOCUS_23460 132640 133056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 133164 134906 gene locus_tag LOCUS_23470 133164 134906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 137337 134920 gene locus_tag LOCUS_23480 137337 134920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_23480 137416 141210 gene locus_tag LOCUS_23490 137416 141210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 141842 141207 gene locus_tag LOCUS_23500 141842 141207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 142729 141863 gene locus_tag LOCUS_23510 142729 141863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 142853 144100 gene locus_tag LOCUS_23520 gene adh 142853 144100 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_23520 144112 144849 gene locus_tag LOCUS_23530 144112 144849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 145491 144946 gene locus_tag LOCUS_23540 145491 144946 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_23540 146112 145516 gene locus_tag LOCUS_23550 146112 145516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_23550 146219 147013 gene locus_tag LOCUS_23560 gene thyA 146219 147013 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_23560 147029 150334 gene locus_tag LOCUS_23570 147029 150334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 152433 150337 gene locus_tag LOCUS_23580 152433 150337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 153071 153307 gene locus_tag LOCUS_23590 153071 153307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 153321 154004 gene locus_tag LOCUS_23600 153321 154004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 155647 153989 gene locus_tag LOCUS_23610 155647 153989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 155783 157333 gene locus_tag LOCUS_23620 155783 157333 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_23620 157358 157855 gene locus_tag LOCUS_23630 157358 157855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_23630 157903 158871 gene locus_tag LOCUS_23640 157903 158871 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_23640 158887 159504 gene locus_tag LOCUS_23650 158887 159504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 159551 160237 gene locus_tag LOCUS_23660 159551 160237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 160234 161940 gene locus_tag LOCUS_23670 160234 161940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 164583 161947 gene locus_tag LOCUS_23680 gene polA 164583 161947 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_23680 167022 164617 gene locus_tag LOCUS_23690 167022 164617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_23690 167868 167131 gene locus_tag LOCUS_23700 167868 167131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 168601 167846 gene locus_tag LOCUS_23710 168601 167846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 169200 168598 gene locus_tag LOCUS_23720 gene sigW 169200 168598 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_23720 169465 173886 gene locus_tag LOCUS_23730 169465 173886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 173896 174798 gene locus_tag LOCUS_23740 173896 174798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 176276 174768 gene locus_tag LOCUS_23750 176276 174768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 177233 176286 gene locus_tag LOCUS_23760 gene wxcM 177233 176286 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035858.1 protein_id gnl|my_center|LOCUS_23760 178165 177230 gene locus_tag LOCUS_23770 gene wxcL 178165 177230 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035859.1 protein_id gnl|my_center|LOCUS_23770 179298 178165 gene locus_tag LOCUS_23780 179298 178165 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056557.1 protein_id gnl|my_center|LOCUS_23780 179356 180186 gene locus_tag LOCUS_23790 179356 180186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 180248 182011 gene locus_tag LOCUS_23800 180248 182011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 182034 185330 gene locus_tag LOCUS_23810 182034 185330 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_23810 185346 185873 gene locus_tag LOCUS_23820 185346 185873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_23820 186476 186075 gene locus_tag LOCUS_23830 186476 186075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 186655 187971 gene locus_tag LOCUS_23840 186655 187971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 187976 189274 gene locus_tag LOCUS_23850 187976 189274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601952.1 protein_id gnl|my_center|LOCUS_23850 191374 189707 gene locus_tag LOCUS_23860 191374 189707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 192888 191374 gene locus_tag LOCUS_23870 192888 191374 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23870 192805 193041 gene locus_tag LOCUS_23880 192805 193041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 193989 193309 gene locus_tag LOCUS_23890 193989 193309 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933742.1 protein_id gnl|my_center|LOCUS_23890 195477 194008 gene locus_tag LOCUS_23900 195477 194008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 197135 195474 gene locus_tag LOCUS_23910 197135 195474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 198768 197140 gene locus_tag LOCUS_23920 198768 197140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 199427 198825 gene locus_tag LOCUS_23930 199427 198825 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040681.1 protein_id gnl|my_center|LOCUS_23930 200175 199507 gene locus_tag LOCUS_23940 200175 199507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 200647 200294 gene locus_tag LOCUS_23950 200647 200294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 200792 202744 gene locus_tag LOCUS_23960 200792 202744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 204225 203104 gene locus_tag LOCUS_23970 204225 203104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 204364 205071 gene locus_tag LOCUS_23980 204364 205071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 205105 205461 gene locus_tag LOCUS_23990 205105 205461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_23990 206189 205446 gene locus_tag LOCUS_24000 206189 205446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 207121 206186 gene locus_tag LOCUS_24010 207121 206186 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_24010 208784 207126 gene locus_tag LOCUS_24020 208784 207126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 208998 210416 gene locus_tag LOCUS_24030 208998 210416 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_24030 210413 211123 gene locus_tag LOCUS_24040 gene pcaI 210413 211123 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 protein_id gnl|my_center|LOCUS_24040 211120 211788 gene locus_tag LOCUS_24050 211120 211788 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 protein_id gnl|my_center|LOCUS_24050 211788 213092 gene locus_tag LOCUS_24060 gene atrB 211788 213092 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887159.1 protein_id gnl|my_center|LOCUS_24060 213575 213916 gene locus_tag LOCUS_24070 213575 213916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 214307 214786 gene locus_tag LOCUS_24080 214307 214786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 215230 214790 gene locus_tag LOCUS_24090 215230 214790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 215320 216453 gene locus_tag LOCUS_24100 215320 216453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 216460 218199 gene locus_tag LOCUS_24110 216460 218199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_24110 218306 218563 gene locus_tag LOCUS_24120 218306 218563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 221118 218797 gene locus_tag LOCUS_24130 221118 218797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 222339 221122 gene locus_tag LOCUS_24140 222339 221122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020137.1 protein_id gnl|my_center|LOCUS_24140 226641 222520 gene locus_tag LOCUS_24150 226641 222520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 226873 226619 gene locus_tag LOCUS_24160 226873 226619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 228438 226873 gene locus_tag LOCUS_24170 228438 226873 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_24170 229676 228471 gene locus_tag LOCUS_24180 229676 228471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_24180 230832 229690 gene locus_tag LOCUS_24190 230832 229690 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_24190 233566 230975 gene locus_tag LOCUS_24200 233566 230975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_24200 234267 233590 gene locus_tag LOCUS_24210 234267 233590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 234288 236858 gene locus_tag LOCUS_24220 234288 236858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 237532 236879 gene locus_tag LOCUS_24230 237532 236879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 237630 238784 gene locus_tag LOCUS_24240 237630 238784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 239774 239169 gene locus_tag LOCUS_24250 239774 239169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 239869 241278 gene locus_tag LOCUS_24260 239869 241278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 241367 241882 gene locus_tag LOCUS_24270 241367 241882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 241988 242635 gene locus_tag LOCUS_24280 241988 242635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 242996 243886 gene locus_tag LOCUS_24290 242996 243886 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_24290 245500 243860 gene locus_tag LOCUS_24300 245500 243860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 245588 247666 gene locus_tag LOCUS_24310 245588 247666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 247659 249209 gene locus_tag LOCUS_24320 247659 249209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_24320 250492 249257 gene locus_tag LOCUS_24330 250492 249257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 251020 250574 gene locus_tag LOCUS_24340 251020 250574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 251848 253845 gene locus_tag LOCUS_24350 251848 253845 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_24350 253945 254709 gene locus_tag LOCUS_24360 253945 254709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 255635 254730 gene locus_tag LOCUS_24370 255635 254730 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 protein_id gnl|my_center|LOCUS_24370 257018 255654 gene locus_tag LOCUS_24380 257018 255654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 257492 257040 gene locus_tag LOCUS_24390 257492 257040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 257658 261461 gene locus_tag LOCUS_24400 257658 261461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 261612 262157 gene locus_tag LOCUS_24410 261612 262157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 262138 262884 gene locus_tag LOCUS_24420 262138 262884 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_24420 262881 263924 gene locus_tag LOCUS_24430 262881 263924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 264455 265051 gene locus_tag LOCUS_24440 264455 265051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 266352 265069 gene locus_tag LOCUS_24450 266352 265069 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_24450 266454 269750 gene locus_tag LOCUS_24460 266454 269750 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_24460 271619 269802 gene locus_tag LOCUS_24470 gene edd 271619 269802 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_24470 272945 271635 gene locus_tag LOCUS_24480 272945 271635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 274329 273076 gene locus_tag LOCUS_24490 274329 273076 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_24490 277716 274339 gene locus_tag LOCUS_24500 277716 274339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 279572 277770 gene locus_tag LOCUS_24510 279572 277770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 281716 279569 gene locus_tag LOCUS_24520 281716 279569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 284249 281733 gene locus_tag LOCUS_24530 284249 281733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 285546 284254 gene locus_tag LOCUS_24540 285546 284254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 286011 285550 gene locus_tag LOCUS_24550 286011 285550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 286001 287419 gene locus_tag LOCUS_24560 286001 287419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 288955 288425 gene locus_tag LOCUS_24570 288955 288425 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_24570 289484 288966 gene locus_tag LOCUS_24580 289484 288966 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_24580 290022 289510 gene locus_tag LOCUS_24590 290022 289510 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_24590 290257 290649 gene locus_tag LOCUS_24600 290257 290649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 290750 291262 gene locus_tag LOCUS_24610 290750 291262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 291268 291597 gene locus_tag LOCUS_24620 291268 291597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 292293 291691 gene locus_tag LOCUS_24630 292293 291691 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729910.1 protein_id gnl|my_center|LOCUS_24630 294438 292678 gene locus_tag LOCUS_24640 294438 292678 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_24640 294916 294452 gene locus_tag LOCUS_24650 294916 294452 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence10 111 1607 gene locus_tag LOCUS_24660 111 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2395 1898 gene locus_tag LOCUS_24670 2395 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2285 2821 gene locus_tag LOCUS_24680 2285 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3951 2995 gene locus_tag LOCUS_24690 gene tal 3951 2995 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL7 protein_id gnl|my_center|LOCUS_24690 4114 4947 gene locus_tag LOCUS_24700 4114 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 6296 4971 gene locus_tag LOCUS_24710 6296 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_24710 6915 8822 gene locus_tag LOCUS_24720 6915 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 8825 10252 gene locus_tag LOCUS_24730 8825 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 10254 11618 gene locus_tag LOCUS_24740 10254 11618 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_24740 11646 12851 gene locus_tag LOCUS_24750 11646 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 14256 12841 gene locus_tag LOCUS_24760 14256 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 15110 14286 gene locus_tag LOCUS_24770 15110 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 16472 15225 gene locus_tag LOCUS_24780 16472 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 19116 16486 gene locus_tag LOCUS_24790 19116 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 19470 20612 gene locus_tag LOCUS_24800 19470 20612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964036.1 protein_id gnl|my_center|LOCUS_24800 20675 21895 gene locus_tag LOCUS_24810 20675 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 22693 21899 gene locus_tag LOCUS_24820 22693 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 23327 23665 gene locus_tag LOCUS_24830 23327 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 24562 24350 gene locus_tag LOCUS_24840 24562 24350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 27676 24629 gene locus_tag LOCUS_24850 27676 24629 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_24850 28501 27701 gene locus_tag LOCUS_24860 28501 27701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 29190 28501 gene locus_tag LOCUS_24870 29190 28501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_24870 35654 29343 gene locus_tag LOCUS_24880 35654 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 39562 35819 gene locus_tag LOCUS_24890 39562 35819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 42580 41846 gene locus_tag LOCUS_24900 42580 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 44065 42614 gene locus_tag LOCUS_24910 44065 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 45028 44078 gene locus_tag LOCUS_24920 45028 44078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 45029 45346 gene locus_tag LOCUS_24930 45029 45346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 47762 45705 gene locus_tag LOCUS_24940 47762 45705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 49658 47775 gene locus_tag LOCUS_24950 49658 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 50008 50601 gene locus_tag LOCUS_24960 50008 50601 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_24960 50611 54318 gene locus_tag LOCUS_24970 50611 54318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 54363 54581 gene locus_tag LOCUS_24980 54363 54581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 54571 56019 gene locus_tag LOCUS_24990 54571 56019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 56689 58110 gene locus_tag LOCUS_25000 56689 58110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 59754 58579 gene locus_tag LOCUS_25010 59754 58579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 61586 59751 gene locus_tag LOCUS_25020 gene pepF 61586 59751 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_25020 63421 61643 gene locus_tag LOCUS_25030 63421 61643 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_25030 64754 63414 gene locus_tag LOCUS_25040 64754 63414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 65014 64751 gene locus_tag LOCUS_25050 65014 64751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 65176 65373 gene locus_tag LOCUS_25060 65176 65373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 65361 65657 gene locus_tag LOCUS_25070 65361 65657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 65623 66387 gene locus_tag LOCUS_25080 65623 66387 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947243.1 protein_id gnl|my_center|LOCUS_25080 66387 66971 gene locus_tag LOCUS_25090 gene ppiB 66387 66971 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D70 protein_id gnl|my_center|LOCUS_25090 70422 66985 gene locus_tag LOCUS_25100 70422 66985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 70640 70425 gene locus_tag LOCUS_25110 70640 70425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 71387 70641 gene locus_tag LOCUS_25120 71387 70641 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_25120 72044 71403 gene locus_tag LOCUS_25130 72044 71403 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ52 protein_id gnl|my_center|LOCUS_25130 72203 74902 gene locus_tag LOCUS_25140 72203 74902 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_25140 74988 75440 gene locus_tag LOCUS_25150 gene queD 74988 75440 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941336.1 protein_id gnl|my_center|LOCUS_25150 75437 76288 gene locus_tag LOCUS_25160 75437 76288 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_25160 76295 77311 gene locus_tag LOCUS_25170 gene galM 76295 77311 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_25170 77777 78103 gene locus_tag LOCUS_25180 77777 78103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 78190 78792 gene locus_tag LOCUS_25190 78190 78792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 78903 80120 gene locus_tag LOCUS_25200 78903 80120 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_25200 83667 81922 gene locus_tag LOCUS_25210 83667 81922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 84045 83677 gene locus_tag LOCUS_25220 gene pemK 84045 83677 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E882 protein_id gnl|my_center|LOCUS_25220 85234 84020 gene locus_tag LOCUS_25230 85234 84020 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229083.1 protein_id gnl|my_center|LOCUS_25230 85469 87895 gene locus_tag LOCUS_25240 85469 87895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_25240 88516 89727 gene locus_tag LOCUS_25250 88516 89727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_25250 89727 92111 gene locus_tag LOCUS_25260 89727 92111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 92135 93028 gene locus_tag LOCUS_25270 92135 93028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 93303 93085 gene locus_tag LOCUS_25280 93303 93085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 96281 93471 gene locus_tag LOCUS_25290 96281 93471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 97522 96458 gene locus_tag LOCUS_25300 97522 96458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 98619 97519 gene locus_tag LOCUS_25310 98619 97519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_25310 101393 98667 gene locus_tag LOCUS_25320 101393 98667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 103076 101820 gene locus_tag LOCUS_25330 103076 101820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 105124 103475 gene locus_tag LOCUS_25340 105124 103475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 105716 105336 gene locus_tag LOCUS_25350 105716 105336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 107511 105853 gene locus_tag LOCUS_25360 107511 105853 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_25360 108725 107517 gene locus_tag LOCUS_25370 108725 107517 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259423.1 protein_id gnl|my_center|LOCUS_25370 109754 108735 gene locus_tag LOCUS_25380 109754 108735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 110689 109751 gene locus_tag LOCUS_25390 110689 109751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 111845 110664 gene locus_tag LOCUS_25400 111845 110664 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_25400 112686 111940 gene locus_tag LOCUS_25410 112686 111940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_25410 113445 112723 gene locus_tag LOCUS_25420 113445 112723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 114187 113522 gene locus_tag LOCUS_25430 114187 113522 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_25430 115193 114240 gene locus_tag LOCUS_25440 gene yrbG 115193 114240 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_25440 116350 115217 gene locus_tag LOCUS_25450 116350 115217 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_25450 117813 116440 gene locus_tag LOCUS_25460 117813 116440 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B646 protein_id gnl|my_center|LOCUS_25460 118257 117841 gene locus_tag LOCUS_25470 118257 117841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 119153 118278 gene locus_tag LOCUS_25480 gene pilD 119153 118278 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_25480 119110 119292 gene locus_tag LOCUS_25490 119110 119292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 119271 119720 gene locus_tag LOCUS_25500 119271 119720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 120734 119733 gene locus_tag LOCUS_25510 120734 119733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 121896 120856 gene locus_tag LOCUS_25520 121896 120856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_25520 123395 122778 gene locus_tag LOCUS_25530 123395 122778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 124769 125107 gene locus_tag LOCUS_25540 124769 125107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 126324 125122 gene locus_tag LOCUS_25550 126324 125122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 126454 127977 gene locus_tag LOCUS_25560 126454 127977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347929.1 protein_id gnl|my_center|LOCUS_25560 128787 128017 gene locus_tag LOCUS_25570 128787 128017 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_25570 128927 129256 gene locus_tag LOCUS_25580 128927 129256 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947851.1 protein_id gnl|my_center|LOCUS_25580 130144 129317 gene locus_tag LOCUS_25590 130144 129317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 131184 130141 gene locus_tag LOCUS_25600 131184 130141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 132401 131283 gene locus_tag LOCUS_25610 132401 131283 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AC4 protein_id gnl|my_center|LOCUS_25610 133285 132398 gene locus_tag LOCUS_25620 133285 132398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 136803 133282 gene locus_tag LOCUS_25630 gene mfd 136803 133282 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_25630 137076 139388 gene locus_tag LOCUS_25640 gene mrcB 137076 139388 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_25640 139937 139401 gene locus_tag LOCUS_25650 139937 139401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 142262 139977 gene locus_tag LOCUS_25660 142262 139977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 145465 142262 gene locus_tag LOCUS_25670 145465 142262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 145675 145601 gene locus_tag LOCUS_t00390 145675 145601 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 146464 145736 gene locus_tag LOCUS_25680 146464 145736 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267698.1 protein_id gnl|my_center|LOCUS_25680 146518 149658 gene locus_tag LOCUS_25690 146518 149658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 151813 149684 gene locus_tag LOCUS_25700 151813 149684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 153029 153976 gene locus_tag LOCUS_25710 153029 153976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 154629 154054 gene locus_tag LOCUS_25720 154629 154054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 155010 155972 gene locus_tag LOCUS_25730 155010 155972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 156006 157166 gene locus_tag LOCUS_25740 156006 157166 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089883.1 protein_id gnl|my_center|LOCUS_25740 157211 157681 gene locus_tag LOCUS_25750 157211 157681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 157686 157859 gene locus_tag LOCUS_25760 157686 157859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 159242 157872 gene locus_tag LOCUS_25770 159242 157872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 159362 160849 gene locus_tag LOCUS_25780 gene gpuP 159362 160849 CDS product 3-guanidinopropionate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_25780 160914 161618 gene locus_tag LOCUS_25790 160914 161618 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_25790 161646 163472 gene locus_tag LOCUS_25800 161646 163472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 163601 164968 gene locus_tag LOCUS_25810 gene pilT-1 163601 164968 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_25810 165016 165447 gene locus_tag LOCUS_25820 gene recX 165016 165447 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_25820 169714 165458 gene locus_tag LOCUS_25830 169714 165458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 170886 169714 gene locus_tag LOCUS_25840 170886 169714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_25840 173075 170883 gene locus_tag LOCUS_25850 173075 170883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_25850 173241 173600 gene locus_tag LOCUS_25860 173241 173600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 173653 175098 gene locus_tag LOCUS_25870 gene hemY 173653 175098 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_25870 175148 176554 gene locus_tag LOCUS_25880 175148 176554 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_25880 176551 177102 gene locus_tag LOCUS_25890 176551 177102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_25890 177120 178343 gene locus_tag LOCUS_25900 177120 178343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_25900 178343 178999 gene locus_tag LOCUS_25910 178343 178999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 179873 179052 gene locus_tag LOCUS_25920 179873 179052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 180871 180047 gene locus_tag LOCUS_25930 180871 180047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 181012 181992 gene locus_tag LOCUS_25940 gene mdh 181012 181992 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_25940 182938 183765 gene locus_tag LOCUS_25950 gene rsgA 182938 183765 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK24 protein_id gnl|my_center|LOCUS_25950 183827 184255 gene locus_tag LOCUS_25960 183827 184255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 184291 185388 gene locus_tag LOCUS_25970 184291 185388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 185405 187567 gene locus_tag LOCUS_25980 185405 187567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 189189 187519 gene locus_tag LOCUS_25990 gene hflX 189189 187519 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_25990 189294 189797 gene locus_tag LOCUS_26000 gene purE 189294 189797 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_26000 192548 189870 gene locus_tag LOCUS_26010 192548 189870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 193095 192550 gene locus_tag LOCUS_26020 gene rpoE 193095 192550 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_26020 193560 193192 gene locus_tag LOCUS_26030 193560 193192 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_26030 193669 194361 gene locus_tag LOCUS_26040 193669 194361 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_26040 194464 195063 gene locus_tag LOCUS_26050 194464 195063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 195079 196311 gene locus_tag LOCUS_26060 195079 196311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 196777 196352 gene locus_tag LOCUS_26070 196777 196352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 198244 196790 gene locus_tag LOCUS_26080 198244 196790 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_26080 198327 199631 gene locus_tag LOCUS_26090 gene cat2 198327 199631 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_26090 199728 200297 gene locus_tag LOCUS_26100 199728 200297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 200298 200900 gene locus_tag LOCUS_26110 200298 200900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 201595 200924 gene locus_tag LOCUS_26120 201595 200924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_26120 201707 204049 gene locus_tag LOCUS_26130 201707 204049 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338477.1 protein_id gnl|my_center|LOCUS_26130 205569 204271 gene locus_tag LOCUS_26140 gene ahbD 205569 204271 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_26140 207344 205599 gene locus_tag LOCUS_26150 207344 205599 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_26150 207424 208503 gene locus_tag LOCUS_26160 207424 208503 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_26160 208667 208927 gene locus_tag LOCUS_26170 208667 208927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 208911 209507 gene locus_tag LOCUS_26180 208911 209507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 209521 209799 gene locus_tag LOCUS_26190 209521 209799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 210198 209806 gene locus_tag LOCUS_26200 210198 209806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 210538 210179 gene locus_tag LOCUS_26210 210538 210179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 210658 210918 gene locus_tag LOCUS_26220 210658 210918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 211006 213042 gene locus_tag LOCUS_26230 211006 213042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26230 213557 213333 gene locus_tag LOCUS_26240 213557 213333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 215293 214262 gene locus_tag LOCUS_26250 215293 214262 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_26250 219257 215307 gene locus_tag LOCUS_26260 219257 215307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 219613 219362 gene locus_tag LOCUS_26270 219613 219362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 221613 220147 gene locus_tag LOCUS_26280 221613 220147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 222226 221753 gene locus_tag LOCUS_26290 222226 221753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 222645 222217 gene locus_tag LOCUS_26300 222645 222217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 225397 222740 gene locus_tag LOCUS_26310 225397 222740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 226569 225481 gene locus_tag LOCUS_26320 gene recA 226569 225481 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_26320 226724 227449 gene locus_tag LOCUS_26330 226724 227449 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_26330 227486 228121 gene locus_tag LOCUS_26340 227486 228121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 228167 229141 gene locus_tag LOCUS_26350 gene yeaC 228167 229141 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_26350 229148 230164 gene locus_tag LOCUS_26360 229148 230164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 230161 232377 gene locus_tag LOCUS_26370 230161 232377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 232408 234468 gene locus_tag LOCUS_26380 232408 234468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 235618 234461 gene locus_tag LOCUS_26390 gene degP 235618 234461 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_26390 238678 235628 gene locus_tag LOCUS_26400 238678 235628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 239010 238831 gene locus_tag LOCUS_26410 239010 238831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 239016 240401 gene locus_tag LOCUS_26420 gene betC 239016 240401 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69787 protein_id gnl|my_center|LOCUS_26420 240458 241057 gene locus_tag LOCUS_26430 240458 241057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 241054 242769 gene locus_tag LOCUS_26440 241054 242769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 242880 243767 gene locus_tag LOCUS_26450 gene pdxS 242880 243767 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_26450 243771 244367 gene locus_tag LOCUS_26460 gene pdxT 243771 244367 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUL8 protein_id gnl|my_center|LOCUS_26460 244423 245931 gene locus_tag LOCUS_26470 244423 245931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256570.1 protein_id gnl|my_center|LOCUS_26470 245928 247184 gene locus_tag LOCUS_26480 245928 247184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256571.1 protein_id gnl|my_center|LOCUS_26480 247222 248316 gene locus_tag LOCUS_26490 247222 248316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_26490 248459 248360 gene locus_tag LOCUS_t00400 248459 248360 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 248559 250847 gene locus_tag LOCUS_26500 248559 250847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 250868 251536 gene locus_tag LOCUS_26510 250868 251536 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_26510 252329 253360 gene locus_tag LOCUS_26520 252329 253360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_26520 254308 253376 gene locus_tag LOCUS_26530 gene ftsX 254308 253376 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA0 protein_id gnl|my_center|LOCUS_26530 255075 254305 gene locus_tag LOCUS_26540 gene ftsE 255075 254305 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_26540 257409 255094 gene locus_tag LOCUS_26550 257409 255094 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870229.1 protein_id gnl|my_center|LOCUS_26550 257731 260574 gene locus_tag LOCUS_26560 257731 260574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 261568 260576 gene locus_tag LOCUS_26570 261568 260576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 262055 261831 gene locus_tag LOCUS_26580 262055 261831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 262856 262227 gene locus_tag LOCUS_26590 262856 262227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 263909 262869 gene locus_tag LOCUS_26600 263909 262869 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_26600 265800 263929 gene locus_tag LOCUS_26610 gene fadE10 265800 263929 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQF7 protein_id gnl|my_center|LOCUS_26610 266488 265835 gene locus_tag LOCUS_26620 266488 265835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 266969 266655 gene locus_tag LOCUS_26630 266969 266655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 267549 267076 gene locus_tag LOCUS_26640 267549 267076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 267943 270399 gene locus_tag LOCUS_26650 267943 270399 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_26650 270400 271434 gene locus_tag LOCUS_26660 270400 271434 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_26660 272681 271515 gene locus_tag LOCUS_26670 272681 271515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 273544 272726 gene locus_tag LOCUS_26680 273544 272726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 274267 273548 gene locus_tag LOCUS_26690 274267 273548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 274829 274296 gene locus_tag LOCUS_26700 274829 274296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 275260 274826 gene locus_tag LOCUS_26710 gene exbD 275260 274826 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_26710 275964 275284 gene locus_tag LOCUS_26720 275964 275284 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_26720 276651 276145 gene locus_tag LOCUS_26730 gene ruvC 276651 276145 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QX7 protein_id gnl|my_center|LOCUS_26730 277397 276651 gene locus_tag LOCUS_26740 277397 276651 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_26740 >Feature sequence11 4298 1431 gene locus_tag LOCUS_26750 4298 1431 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121420.1 protein_id gnl|my_center|LOCUS_26750 6172 4295 gene locus_tag LOCUS_26760 6172 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 6200 7657 gene locus_tag LOCUS_26770 6200 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 7871 8404 gene locus_tag LOCUS_26780 7871 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 10991 8529 gene locus_tag LOCUS_26790 10991 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 11020 11949 gene locus_tag LOCUS_26800 11020 11949 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_26800 14171 11946 gene locus_tag LOCUS_26810 14171 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 15986 14397 gene locus_tag LOCUS_26820 15986 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 16038 18095 gene locus_tag LOCUS_26830 gene glgX 16038 18095 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDC6 protein_id gnl|my_center|LOCUS_26830 18781 18092 gene locus_tag LOCUS_26840 18781 18092 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063755.1 protein_id gnl|my_center|LOCUS_26840 20145 18796 gene locus_tag LOCUS_26850 20145 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 20418 20149 gene locus_tag LOCUS_26860 20418 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 20299 22125 gene locus_tag LOCUS_26870 20299 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 22122 24677 gene locus_tag LOCUS_26880 22122 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 25028 24729 gene locus_tag LOCUS_26890 25028 24729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 28029 25798 gene locus_tag LOCUS_26900 28029 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 30229 30543 gene locus_tag LOCUS_26910 30229 30543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 33067 31136 gene locus_tag LOCUS_26920 33067 31136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 33367 33822 gene locus_tag LOCUS_26930 33367 33822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 33819 36161 gene locus_tag LOCUS_26940 33819 36161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 37977 36169 gene locus_tag LOCUS_26950 37977 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 39295 38030 gene locus_tag LOCUS_26960 gene murA 39295 38030 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHW9 protein_id gnl|my_center|LOCUS_26960 40393 39512 gene locus_tag LOCUS_26970 40393 39512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 40504 43056 gene locus_tag LOCUS_26980 40504 43056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 43109 43690 gene locus_tag LOCUS_26990 43109 43690 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26990 43687 47007 gene locus_tag LOCUS_27000 43687 47007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 48355 47027 gene locus_tag LOCUS_27010 48355 47027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 49767 48370 gene locus_tag LOCUS_27020 49767 48370 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_27020 49887 51644 gene locus_tag LOCUS_27030 49887 51644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_27030 52795 51665 gene locus_tag LOCUS_27040 gene menC 52795 51665 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_27040 53959 53015 gene locus_tag LOCUS_27050 53959 53015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_27050 54939 54031 gene locus_tag LOCUS_27060 54939 54031 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140901.1 protein_id gnl|my_center|LOCUS_27060 55189 57594 gene locus_tag LOCUS_27070 55189 57594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_27070 58271 59236 gene locus_tag LOCUS_27080 58271 59236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680773.1 protein_id gnl|my_center|LOCUS_27080 59286 59909 gene locus_tag LOCUS_27090 59286 59909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_27090 62553 60013 gene locus_tag LOCUS_27100 62553 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 63160 62624 gene locus_tag LOCUS_27110 63160 62624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 63963 63157 gene locus_tag LOCUS_27120 63963 63157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 66401 64161 gene locus_tag LOCUS_27130 66401 64161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 68179 66500 gene locus_tag LOCUS_27140 68179 66500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 68417 70966 gene locus_tag LOCUS_27150 68417 70966 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_27150 73456 71045 gene locus_tag LOCUS_27160 73456 71045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_27160 73607 74623 gene locus_tag LOCUS_27170 73607 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 74870 74640 gene locus_tag LOCUS_27180 74870 74640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 75453 74884 gene locus_tag LOCUS_27190 75453 74884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 77315 75627 gene locus_tag LOCUS_27200 77315 75627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 79222 77312 gene locus_tag LOCUS_27210 79222 77312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 80731 79262 gene locus_tag LOCUS_27220 80731 79262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 80764 84657 gene locus_tag LOCUS_27230 gene lacZ 80764 84657 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_27230 85687 84734 gene locus_tag LOCUS_27240 85687 84734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 85997 85704 gene locus_tag LOCUS_27250 85997 85704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_27250 87388 86018 gene locus_tag LOCUS_27260 87388 86018 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_27260 88188 87385 gene locus_tag LOCUS_27270 88188 87385 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0G0 protein_id gnl|my_center|LOCUS_27270 89487 88270 gene locus_tag LOCUS_27280 89487 88270 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_27280 89580 89984 gene locus_tag LOCUS_27290 89580 89984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 90021 90566 gene locus_tag LOCUS_27300 90021 90566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 90578 91792 gene locus_tag LOCUS_27310 90578 91792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 91948 92307 gene locus_tag LOCUS_27320 91948 92307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008992036.1 protein_id gnl|my_center|LOCUS_27320 92530 93978 gene locus_tag LOCUS_27330 92530 93978 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_27330 93984 95201 gene locus_tag LOCUS_27340 93984 95201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 95295 97037 gene locus_tag LOCUS_27350 95295 97037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 97122 98201 gene locus_tag LOCUS_27360 97122 98201 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDV6 protein_id gnl|my_center|LOCUS_27360 98213 99871 gene locus_tag LOCUS_27370 98213 99871 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_27370 99872 101068 gene locus_tag LOCUS_27380 99872 101068 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_27380 104252 101043 gene locus_tag LOCUS_27390 gene acrD 104252 101043 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_27390 104805 104374 gene locus_tag LOCUS_27400 104805 104374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 105244 104819 gene locus_tag LOCUS_27410 105244 104819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 106620 105436 gene locus_tag LOCUS_27420 gene tuf2 106620 105436 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_094359.1 protein_id gnl|my_center|LOCUS_27420 106966 107952 gene locus_tag LOCUS_27430 106966 107952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 109067 108714 gene locus_tag LOCUS_27440 109067 108714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 109542 109108 gene locus_tag LOCUS_27450 109542 109108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 110914 109673 gene locus_tag LOCUS_27460 gene galK 110914 109673 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB97 protein_id gnl|my_center|LOCUS_27460 111077 112084 gene locus_tag LOCUS_27470 gene phoL 111077 112084 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_27470 112216 114645 gene locus_tag LOCUS_27480 112216 114645 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_27480 114744 115148 gene locus_tag LOCUS_27490 gene ybeY 114744 115148 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ51 protein_id gnl|my_center|LOCUS_27490 115138 116412 gene locus_tag LOCUS_27500 115138 116412 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_27500 116409 117374 gene locus_tag LOCUS_27510 116409 117374 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_27510 118043 120448 gene locus_tag LOCUS_27520 118043 120448 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010691.2 protein_id gnl|my_center|LOCUS_27520 122403 120445 gene locus_tag LOCUS_27530 gene htpG 122403 120445 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4W3 protein_id gnl|my_center|LOCUS_27530 123916 122528 gene locus_tag LOCUS_27540 gene mtaD 123916 122528 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLB7 protein_id gnl|my_center|LOCUS_27540 125479 123926 gene locus_tag LOCUS_27550 gene merA 125479 123926 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_27550 126230 125469 gene locus_tag LOCUS_27560 126230 125469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 126538 127866 gene locus_tag LOCUS_27570 126538 127866 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_27570 129764 127995 gene locus_tag LOCUS_27580 129764 127995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_27580 130774 129806 gene locus_tag LOCUS_27590 130774 129806 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085337.1 protein_id gnl|my_center|LOCUS_27590 131712 131047 gene locus_tag LOCUS_27600 gene lipB 131712 131047 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ3 protein_id gnl|my_center|LOCUS_27600 132518 131712 gene locus_tag LOCUS_27610 132518 131712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 132587 133168 gene locus_tag LOCUS_27620 132587 133168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 133185 134903 gene locus_tag LOCUS_27630 133185 134903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 136073 134919 gene locus_tag LOCUS_27640 136073 134919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 137308 136082 gene locus_tag LOCUS_27650 gene rocD 137308 136082 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9P3 protein_id gnl|my_center|LOCUS_27650 137383 138207 gene locus_tag LOCUS_27660 137383 138207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_27660 138956 138204 gene locus_tag LOCUS_27670 138956 138204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 139803 138994 gene locus_tag LOCUS_27680 139803 138994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 140329 139787 gene locus_tag LOCUS_27690 140329 139787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 140819 140319 gene locus_tag LOCUS_27700 140819 140319 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 protein_id gnl|my_center|LOCUS_27700 140992 140816 gene locus_tag LOCUS_27710 140992 140816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 143143 141032 gene locus_tag LOCUS_27720 gene ptrB 143143 141032 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_27720 144004 143183 gene locus_tag LOCUS_27730 144004 143183 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_27730 144832 144035 gene locus_tag LOCUS_27740 gene trpA 144832 144035 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_27740 146260 144866 gene locus_tag LOCUS_27750 gene trpB1 146260 144866 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_27750 146906 146253 gene locus_tag LOCUS_27760 gene trpF 146906 146253 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_27760 147108 147860 gene locus_tag LOCUS_27770 147108 147860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 148690 147899 gene locus_tag LOCUS_27780 148690 147899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_27780 149936 148695 gene locus_tag LOCUS_27790 149936 148695 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_27790 149991 150686 gene locus_tag LOCUS_27800 149991 150686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 150683 151462 gene locus_tag LOCUS_27810 150683 151462 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_27810 151437 152738 gene locus_tag LOCUS_27820 gene aroA2 151437 152738 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L213 protein_id gnl|my_center|LOCUS_27820 152760 154670 gene locus_tag LOCUS_27830 152760 154670 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_27830 154777 155694 gene locus_tag LOCUS_27840 154777 155694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_27840 157734 155704 gene locus_tag LOCUS_27850 157734 155704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 158372 157995 gene locus_tag LOCUS_27860 158372 157995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 159579 158902 gene locus_tag LOCUS_27870 159579 158902 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_27870 160817 159579 gene locus_tag LOCUS_27880 160817 159579 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_27880 162064 160835 gene locus_tag LOCUS_27890 162064 160835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 163777 162230 gene locus_tag LOCUS_27900 163777 162230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 164401 164039 gene locus_tag LOCUS_27910 gene spoIIAA 164401 164039 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_27910 167197 164501 gene locus_tag LOCUS_27920 gene ppdK 167197 164501 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_27920 168245 167349 gene locus_tag LOCUS_27930 168245 167349 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141662.1 protein_id gnl|my_center|LOCUS_27930 169838 168378 gene locus_tag LOCUS_27940 169838 168378 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_27940 170799 170026 gene locus_tag LOCUS_27950 170799 170026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 170973 172142 gene locus_tag LOCUS_27960 170973 172142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_27960 172518 172769 gene locus_tag LOCUS_27970 172518 172769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 174012 172756 gene locus_tag LOCUS_27980 174012 172756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 174182 174859 gene locus_tag LOCUS_27990 174182 174859 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_27990 174852 176123 gene locus_tag LOCUS_28000 174852 176123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 176177 177430 gene locus_tag LOCUS_28010 176177 177430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 177430 179925 gene locus_tag LOCUS_28020 177430 179925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 180170 180000 gene locus_tag LOCUS_28030 180170 180000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 180353 181228 gene locus_tag LOCUS_28040 180353 181228 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729M0 protein_id gnl|my_center|LOCUS_28040 181225 181650 gene locus_tag LOCUS_28050 181225 181650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 181684 182982 gene locus_tag LOCUS_28060 181684 182982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 183259 183795 gene locus_tag LOCUS_28070 183259 183795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 184524 183700 gene locus_tag LOCUS_28080 184524 183700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 185433 184549 gene locus_tag LOCUS_28090 185433 184549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 186328 185465 gene locus_tag LOCUS_28100 186328 185465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 188837 186339 gene locus_tag LOCUS_28110 188837 186339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 189015 189185 gene locus_tag LOCUS_28120 189015 189185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 190115 189678 gene locus_tag LOCUS_28130 190115 189678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 190352 190699 gene locus_tag LOCUS_28140 190352 190699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 190696 191196 gene locus_tag LOCUS_28150 190696 191196 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_28150 199904 191193 gene locus_tag LOCUS_28160 199904 191193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 201505 200087 gene locus_tag LOCUS_28170 201505 200087 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_28170 205133 201513 gene locus_tag LOCUS_28180 205133 201513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 206319 205174 gene locus_tag LOCUS_28190 206319 205174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_28190 206854 206474 gene locus_tag LOCUS_28200 gene merR 206854 206474 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_28200 208887 206935 gene locus_tag LOCUS_28210 gene dnaK 208887 206935 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_28210 210534 209122 gene locus_tag LOCUS_28220 210534 209122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 212293 210578 gene locus_tag LOCUS_28230 212293 210578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 212751 212305 gene locus_tag LOCUS_28240 212751 212305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 212952 213794 gene locus_tag LOCUS_28250 212952 213794 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_28250 213784 217086 gene locus_tag LOCUS_28260 213784 217086 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_28260 217135 218133 gene locus_tag LOCUS_28270 217135 218133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_28270 219875 218154 gene locus_tag LOCUS_28280 219875 218154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 219989 222154 gene locus_tag LOCUS_28290 219989 222154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_28290 222157 222981 gene locus_tag LOCUS_28300 gene blaA 222157 222981 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_28300 225080 223056 gene locus_tag LOCUS_28310 225080 223056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 225571 225840 gene locus_tag LOCUS_28320 225571 225840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 226570 227247 gene locus_tag LOCUS_28330 226570 227247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 227335 228189 gene locus_tag LOCUS_28340 227335 228189 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_28340 228577 228365 gene locus_tag LOCUS_28350 228577 228365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 230377 228620 gene locus_tag LOCUS_28360 230377 228620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 231593 230349 gene locus_tag LOCUS_28370 231593 230349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 232365 231691 gene locus_tag LOCUS_28380 232365 231691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 232509 233426 gene locus_tag LOCUS_28390 gene prmA 232509 233426 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DNP4 protein_id gnl|my_center|LOCUS_28390 233423 234130 gene locus_tag LOCUS_28400 233423 234130 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX2 protein_id gnl|my_center|LOCUS_28400 234230 235927 gene locus_tag LOCUS_28410 234230 235927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 237667 235928 gene locus_tag LOCUS_28420 237667 235928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 238602 237688 gene locus_tag LOCUS_28430 238602 237688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 protein_id gnl|my_center|LOCUS_28430 239411 238599 gene locus_tag LOCUS_28440 239411 238599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_28440 240485 239412 gene locus_tag LOCUS_28450 240485 239412 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706453.1 protein_id gnl|my_center|LOCUS_28450 241341 240517 gene locus_tag LOCUS_28460 241341 240517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 242281 241364 gene locus_tag LOCUS_28470 242281 241364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 243886 242336 gene locus_tag LOCUS_28480 243886 242336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 244704 243892 gene locus_tag LOCUS_28490 244704 243892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 246427 244718 gene locus_tag LOCUS_28500 246427 244718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 246603 247103 gene locus_tag LOCUS_28510 246603 247103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 247682 247119 gene locus_tag LOCUS_28520 247682 247119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 249988 247694 gene locus_tag LOCUS_28530 249988 247694 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_28530 250803 249985 gene locus_tag LOCUS_28540 250803 249985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 251435 250800 gene locus_tag LOCUS_28550 251435 250800 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_28550 252166 251435 gene locus_tag LOCUS_28560 252166 251435 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_28560 252677 255346 gene locus_tag LOCUS_28570 252677 255346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 255462 256175 gene locus_tag LOCUS_28580 255462 256175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 256281 257756 gene locus_tag LOCUS_28590 gene glpK 256281 257756 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N7 protein_id gnl|my_center|LOCUS_28590 258431 261574 gene locus_tag LOCUS_28600 258431 261574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 264813 261589 gene locus_tag LOCUS_28610 264813 261589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 264890 265699 gene locus_tag LOCUS_28620 264890 265699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 266919 265696 gene locus_tag LOCUS_28630 266919 265696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 269128 266954 gene locus_tag LOCUS_28640 269128 266954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 270411 269125 gene locus_tag LOCUS_28650 270411 269125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 272011 270536 gene locus_tag LOCUS_28660 272011 270536 CDS product putative Na(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57007 protein_id gnl|my_center|LOCUS_28660 >Feature sequence12 1377 3812 gene locus_tag LOCUS_28670 1377 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28670 4266 3883 gene locus_tag LOCUS_28680 4266 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 5609 4329 gene locus_tag LOCUS_28690 5609 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089905.1 protein_id gnl|my_center|LOCUS_28690 6016 5606 gene locus_tag LOCUS_28700 6016 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089906.1 protein_id gnl|my_center|LOCUS_28700 6053 6292 gene locus_tag LOCUS_28710 6053 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 7008 6316 gene locus_tag LOCUS_28720 7008 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970038.1 protein_id gnl|my_center|LOCUS_28720 7495 7064 gene locus_tag LOCUS_28730 7495 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 8210 7566 gene locus_tag LOCUS_28740 8210 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 8274 9176 gene locus_tag LOCUS_28750 8274 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 9163 9792 gene locus_tag LOCUS_28760 9163 9792 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_28760 9845 10141 gene locus_tag LOCUS_28770 gene eutM 9845 10141 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABF4 protein_id gnl|my_center|LOCUS_28770 10148 10462 gene locus_tag LOCUS_28780 gene eutN 10148 10462 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_28780 10450 11940 gene locus_tag LOCUS_28790 10450 11940 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_28790 11959 12561 gene locus_tag LOCUS_28800 gene pduT 11959 12561 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 protein_id gnl|my_center|LOCUS_28800 12561 12848 gene locus_tag LOCUS_28810 12561 12848 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_28810 12845 13117 gene locus_tag LOCUS_28820 12845 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 13217 14824 gene locus_tag LOCUS_28830 13217 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 14915 18898 gene locus_tag LOCUS_28840 14915 18898 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108517.1 protein_id gnl|my_center|LOCUS_28840 18895 20580 gene locus_tag LOCUS_28850 18895 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 21361 20612 gene locus_tag LOCUS_28860 21361 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 22259 21486 gene locus_tag LOCUS_28870 22259 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 22395 23684 gene locus_tag LOCUS_28880 22395 23684 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_28880 23805 26702 gene locus_tag LOCUS_28890 23805 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 28367 26727 gene locus_tag LOCUS_28900 28367 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 28475 29272 gene locus_tag LOCUS_28910 28475 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 29549 30550 gene locus_tag LOCUS_28920 29549 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 30749 33439 gene locus_tag LOCUS_28930 gene secA 30749 33439 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ1 protein_id gnl|my_center|LOCUS_28930 33467 34570 gene locus_tag LOCUS_28940 33467 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 34609 35619 gene locus_tag LOCUS_28950 gene adhP 34609 35619 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_28950 35823 37451 gene locus_tag LOCUS_28960 35823 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 37543 38352 gene locus_tag LOCUS_28970 37543 38352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 38517 38858 gene locus_tag LOCUS_28980 38517 38858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 38946 41042 gene locus_tag LOCUS_28990 38946 41042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 41058 43754 gene locus_tag LOCUS_29000 41058 43754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 43948 49182 gene locus_tag LOCUS_29010 43948 49182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 49481 49768 gene locus_tag LOCUS_29020 gene groS 49481 49768 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_29020 49791 51446 gene locus_tag LOCUS_29030 gene groL 49791 51446 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_29030 51537 53495 gene locus_tag LOCUS_29040 51537 53495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 53498 54031 gene locus_tag LOCUS_29050 53498 54031 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_29050 54276 54028 gene locus_tag LOCUS_29060 54276 54028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 54303 55199 gene locus_tag LOCUS_29070 gene dnaC 54303 55199 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_29070 55394 57406 gene locus_tag LOCUS_29080 55394 57406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 58950 57745 gene locus_tag LOCUS_29090 58950 57745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 61733 58947 gene locus_tag LOCUS_29100 61733 58947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 63619 61751 gene locus_tag LOCUS_29110 63619 61751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 64848 63631 gene locus_tag LOCUS_29120 64848 63631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 65280 66845 gene locus_tag LOCUS_29130 65280 66845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 69889 66842 gene locus_tag LOCUS_29140 69889 66842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 72185 69882 gene locus_tag LOCUS_29150 72185 69882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 74556 72190 gene locus_tag LOCUS_29160 74556 72190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 75932 74520 gene locus_tag LOCUS_29170 75932 74520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 78199 76013 gene locus_tag LOCUS_29180 78199 76013 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_29180 80040 78196 gene locus_tag LOCUS_29190 gene mcm2 80040 78196 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013245.1 protein_id gnl|my_center|LOCUS_29190 80384 80049 gene locus_tag LOCUS_29200 80384 80049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 80776 80483 gene locus_tag LOCUS_29210 80776 80483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_29210 81740 80799 gene locus_tag LOCUS_29220 81740 80799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 83886 81754 gene locus_tag LOCUS_29230 83886 81754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 83993 85021 gene locus_tag LOCUS_29240 gene gluQ 83993 85021 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_29240 87884 84975 gene locus_tag LOCUS_29250 87884 84975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 88024 88962 gene locus_tag LOCUS_29260 88024 88962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 89287 88853 gene locus_tag LOCUS_29270 89287 88853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 91128 89359 gene locus_tag LOCUS_29280 91128 89359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 91305 92063 gene locus_tag LOCUS_29290 91305 92063 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709510.1 protein_id gnl|my_center|LOCUS_29290 92105 92515 gene locus_tag LOCUS_29300 92105 92515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 92549 93157 gene locus_tag LOCUS_29310 92549 93157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 93154 94524 gene locus_tag LOCUS_29320 93154 94524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 94521 95099 gene locus_tag LOCUS_29330 94521 95099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 95096 96625 gene locus_tag LOCUS_29340 95096 96625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 96642 98861 gene locus_tag LOCUS_29350 96642 98861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 98895 99929 gene locus_tag LOCUS_29360 gene cheB 98895 99929 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBT0 protein_id gnl|my_center|LOCUS_29360 101311 99926 gene locus_tag LOCUS_29370 101311 99926 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_29370 104212 101513 gene locus_tag LOCUS_29380 104212 101513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 104283 105599 gene locus_tag LOCUS_29390 104283 105599 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_29390 106717 105932 gene locus_tag LOCUS_29400 106717 105932 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_29400 107699 106746 gene locus_tag LOCUS_29410 107699 106746 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 protein_id gnl|my_center|LOCUS_29410 109252 107738 gene locus_tag LOCUS_29420 109252 107738 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_29420 110530 109265 gene locus_tag LOCUS_29430 110530 109265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 111330 110758 gene locus_tag LOCUS_29440 111330 110758 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_29440 112406 111339 gene locus_tag LOCUS_29450 112406 111339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 113829 112396 gene locus_tag LOCUS_29460 gene hslU 113829 112396 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_29460 114341 113826 gene locus_tag LOCUS_29470 gene hslV 114341 113826 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ1 protein_id gnl|my_center|LOCUS_29470 115548 114433 gene locus_tag LOCUS_29480 115548 114433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 115734 119081 gene locus_tag LOCUS_29490 115734 119081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_29490 120027 119491 gene locus_tag LOCUS_29500 120027 119491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 120923 120123 gene locus_tag LOCUS_29510 120923 120123 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528404.1 protein_id gnl|my_center|LOCUS_29510 120998 122695 gene locus_tag LOCUS_29520 120998 122695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 123481 122699 gene locus_tag LOCUS_29530 gene phnE 123481 122699 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301998.1 protein_id gnl|my_center|LOCUS_29530 124256 123411 gene locus_tag LOCUS_29540 gene phnC 124256 123411 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AQ6 protein_id gnl|my_center|LOCUS_29540 125155 124265 gene locus_tag LOCUS_29550 125155 124265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 127071 125152 gene locus_tag LOCUS_29560 127071 125152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 131374 127175 gene locus_tag LOCUS_29570 131374 127175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 132583 131429 gene locus_tag LOCUS_29580 132583 131429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119245.1 protein_id gnl|my_center|LOCUS_29580 133515 132715 gene locus_tag LOCUS_29590 133515 132715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 133560 134804 gene locus_tag LOCUS_29600 133560 134804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 134797 136458 gene locus_tag LOCUS_29610 134797 136458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 138391 136682 gene locus_tag LOCUS_29620 138391 136682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 139114 138407 gene locus_tag LOCUS_29630 139114 138407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 139217 139468 gene locus_tag LOCUS_29640 139217 139468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 139492 140451 gene locus_tag LOCUS_29650 139492 140451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_29650 141938 140862 gene locus_tag LOCUS_29660 141938 140862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 143209 141935 gene locus_tag LOCUS_29670 gene xapH 143209 141935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_29670 144045 143209 gene locus_tag LOCUS_29680 gene xapG 144045 143209 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_29680 145179 144064 gene locus_tag LOCUS_29690 145179 144064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 146054 145179 gene locus_tag LOCUS_29700 146054 145179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 146222 147457 gene locus_tag LOCUS_29710 146222 147457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404073.1 protein_id gnl|my_center|LOCUS_29710 147466 148647 gene locus_tag LOCUS_29720 147466 148647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 148644 149639 gene locus_tag LOCUS_29730 148644 149639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 151192 149726 gene locus_tag LOCUS_29740 151192 149726 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_29740 151901 151203 gene locus_tag LOCUS_29750 gene drrA 151901 151203 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_29750 152755 152081 gene locus_tag LOCUS_29760 152755 152081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_29760 152945 153712 gene locus_tag LOCUS_29770 152945 153712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 154442 155425 gene locus_tag LOCUS_29780 154442 155425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 155431 157296 gene locus_tag LOCUS_29790 155431 157296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 157305 165998 gene locus_tag LOCUS_29800 157305 165998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 166010 169840 gene locus_tag LOCUS_29810 166010 169840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 170407 169817 gene locus_tag LOCUS_29820 gene ppiB 170407 169817 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_29820 171264 170428 gene locus_tag LOCUS_29830 171264 170428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 172115 171261 gene locus_tag LOCUS_29840 172115 171261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_29840 173554 172133 gene locus_tag LOCUS_29850 gene nfeD 173554 172133 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_29850 173619 174665 gene locus_tag LOCUS_29860 gene ansA 173619 174665 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404454.1 protein_id gnl|my_center|LOCUS_29860 175070 177886 gene locus_tag LOCUS_29870 175070 177886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 178643 177906 gene locus_tag LOCUS_29880 178643 177906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 178690 179161 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctagaaatccgttgaccgact 179409 181208 gene locus_tag LOCUS_29890 gene lepA2 179409 181208 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_29890 181334 182350 gene locus_tag LOCUS_29900 gene hemN 181334 182350 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_29900 183658 182402 gene locus_tag LOCUS_29910 183658 182402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 183800 184267 gene locus_tag LOCUS_29920 183800 184267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 184891 184271 gene locus_tag LOCUS_29930 184891 184271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 184992 187343 gene locus_tag LOCUS_29940 184992 187343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 187340 189373 gene locus_tag LOCUS_29950 187340 189373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 189391 189585 gene locus_tag LOCUS_29960 189391 189585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 189643 190488 gene locus_tag LOCUS_29970 189643 190488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 191529 190495 gene locus_tag LOCUS_29980 191529 190495 CDS product peptidase S58 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_29980 191742 193325 gene locus_tag LOCUS_29990 191742 193325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 193367 194293 gene locus_tag LOCUS_30000 193367 194293 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_30000 194750 194283 gene locus_tag LOCUS_30010 194750 194283 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882L6 protein_id gnl|my_center|LOCUS_30010 195024 199547 gene locus_tag LOCUS_30020 195024 199547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 200561 199644 gene locus_tag LOCUS_30030 200561 199644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 203485 200558 gene locus_tag LOCUS_30040 203485 200558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 205659 203494 gene locus_tag LOCUS_30050 gene pilJ 205659 203494 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_30050 206039 205674 gene locus_tag LOCUS_30060 206039 205674 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_30060 206220 206065 gene locus_tag LOCUS_30070 206220 206065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 207546 206239 gene locus_tag LOCUS_30080 207546 206239 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_30080 208133 207543 gene locus_tag LOCUS_30090 208133 207543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 209038 208130 gene locus_tag LOCUS_30100 209038 208130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 210062 209208 gene locus_tag LOCUS_30110 210062 209208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 210323 212203 gene locus_tag LOCUS_30120 210323 212203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 212235 213122 gene locus_tag LOCUS_30130 212235 213122 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_30130 217286 213885 gene locus_tag LOCUS_30140 217286 213885 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_30140 219012 217321 gene locus_tag LOCUS_30150 219012 217321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 219161 220774 gene locus_tag LOCUS_30160 219161 220774 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_30160 220793 222088 gene locus_tag LOCUS_30170 220793 222088 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331299.1 protein_id gnl|my_center|LOCUS_30170 222111 222647 gene locus_tag LOCUS_30180 222111 222647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 223388 222651 gene locus_tag LOCUS_30190 223388 222651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 223836 224525 gene locus_tag LOCUS_30200 223836 224525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 224522 225661 gene locus_tag LOCUS_30210 224522 225661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 225658 226629 gene locus_tag LOCUS_30220 225658 226629 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_30220 226631 227923 gene locus_tag LOCUS_30230 226631 227923 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 protein_id gnl|my_center|LOCUS_30230 227985 228632 gene locus_tag LOCUS_30240 227985 228632 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_30240 228629 231154 gene locus_tag LOCUS_30250 228629 231154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 233557 231161 gene locus_tag LOCUS_30260 233557 231161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 235022 233622 gene locus_tag LOCUS_30270 235022 233622 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_30270 235093 236286 gene locus_tag LOCUS_30280 235093 236286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 236879 236253 gene locus_tag LOCUS_30290 236879 236253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 237725 236892 gene locus_tag LOCUS_30300 237725 236892 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_30300 238474 237722 gene locus_tag LOCUS_30310 238474 237722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 239863 238508 gene locus_tag LOCUS_30320 gene pepQ 239863 238508 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_30320 239989 240555 gene locus_tag LOCUS_30330 gene crp 239989 240555 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_30330 240559 241845 gene locus_tag LOCUS_30340 240559 241845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 245039 242445 gene locus_tag LOCUS_30350 245039 242445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 247076 245067 gene locus_tag LOCUS_30360 247076 245067 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_30360 248390 247227 gene locus_tag LOCUS_30370 248390 247227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 249658 248387 gene locus_tag LOCUS_30380 249658 248387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 249800 250297 gene locus_tag LOCUS_30390 249800 250297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_30390 252645 250309 gene locus_tag LOCUS_30400 gene glnS 252645 250309 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_30400 254403 252661 gene locus_tag LOCUS_30410 254403 252661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 257585 254400 gene locus_tag LOCUS_30420 257585 254400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 259000 257603 gene locus_tag LOCUS_30430 259000 257603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 259141 260046 gene locus_tag LOCUS_30440 259141 260046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 261127 260396 gene locus_tag LOCUS_30450 261127 260396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 261218 261607 gene locus_tag LOCUS_30460 261218 261607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 261689 262555 gene locus_tag LOCUS_30470 261689 262555 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399938.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence13 3600 220 gene locus_tag LOCUS_30480 3600 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4854 3604 gene locus_tag LOCUS_30490 4854 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 5317 4841 gene locus_tag LOCUS_30500 5317 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 7092 5350 gene locus_tag LOCUS_30510 7092 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 7994 7089 gene locus_tag LOCUS_30520 7994 7089 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 protein_id gnl|my_center|LOCUS_30520 8125 10515 gene locus_tag LOCUS_30530 8125 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_30530 11668 10544 gene locus_tag LOCUS_30540 11668 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 12315 11668 gene locus_tag LOCUS_30550 12315 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 13427 12324 gene locus_tag LOCUS_30560 13427 12324 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_30560 13668 15038 gene locus_tag LOCUS_30570 13668 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 16218 15031 gene locus_tag LOCUS_30580 16218 15031 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 protein_id gnl|my_center|LOCUS_30580 18057 16228 gene locus_tag LOCUS_30590 18057 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 18238 20142 gene locus_tag LOCUS_30600 18238 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 20175 23582 gene locus_tag LOCUS_30610 gene dnaE2 20175 23582 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT5 protein_id gnl|my_center|LOCUS_30610 23585 25747 gene locus_tag LOCUS_30620 gene rlmL 23585 25747 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_30620 25962 25813 gene locus_tag LOCUS_30630 25962 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 26384 26019 gene locus_tag LOCUS_30640 26384 26019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_30640 28873 26387 gene locus_tag LOCUS_30650 28873 26387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 30321 28870 gene locus_tag LOCUS_30660 30321 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 32019 30379 gene locus_tag LOCUS_30670 32019 30379 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_30670 32982 32089 gene locus_tag LOCUS_30680 32982 32089 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_30680 33958 32987 gene locus_tag LOCUS_30690 33958 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 35240 33966 gene locus_tag LOCUS_30700 35240 33966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 36329 35280 gene locus_tag LOCUS_30710 36329 35280 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_30710 36924 36313 gene locus_tag LOCUS_30720 36924 36313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 38346 36934 gene locus_tag LOCUS_30730 38346 36934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_30730 39028 38432 gene locus_tag LOCUS_30740 39028 38432 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228239.1 protein_id gnl|my_center|LOCUS_30740 41568 39037 gene locus_tag LOCUS_30750 gene gyrA 41568 39037 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_30750 43701 41689 gene locus_tag LOCUS_30760 gene uvrD 43701 41689 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_30760 44000 43698 gene locus_tag LOCUS_30770 44000 43698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 44158 44736 gene locus_tag LOCUS_30780 44158 44736 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_30780 44833 46137 gene locus_tag LOCUS_30790 gene fahA 44833 46137 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_30790 46598 47047 gene locus_tag LOCUS_30800 46598 47047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 protein_id gnl|my_center|LOCUS_30800 47055 48965 gene locus_tag LOCUS_30810 gene selB 47055 48965 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_30810 48998 49372 gene locus_tag LOCUS_30820 48998 49372 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_30820 49393 50190 gene locus_tag LOCUS_30830 49393 50190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 50225 51127 gene locus_tag LOCUS_30840 50225 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 52127 51141 gene locus_tag LOCUS_30850 52127 51141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 53167 52136 gene locus_tag LOCUS_30860 53167 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 56226 53185 gene locus_tag LOCUS_30870 56226 53185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 59337 56425 gene locus_tag LOCUS_30880 59337 56425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 60531 59347 gene locus_tag LOCUS_30890 60531 59347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 60646 61230 gene locus_tag LOCUS_30900 60646 61230 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_30900 61437 63773 gene locus_tag LOCUS_30910 61437 63773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 64799 63849 gene locus_tag LOCUS_30920 64799 63849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 65816 65478 gene locus_tag LOCUS_30930 65816 65478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 66664 65891 gene locus_tag LOCUS_30940 66664 65891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 66707 67951 gene locus_tag LOCUS_30950 gene moeA 66707 67951 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_30950 69158 67983 gene locus_tag LOCUS_30960 69158 67983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 69261 71102 gene locus_tag LOCUS_30970 69261 71102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 71404 72741 gene locus_tag LOCUS_30980 71404 72741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 73027 74412 gene locus_tag LOCUS_30990 73027 74412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 74486 74971 gene locus_tag LOCUS_31000 74486 74971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 74961 75986 gene locus_tag LOCUS_31010 74961 75986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 76720 75992 gene locus_tag LOCUS_31020 76720 75992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 77928 76762 gene locus_tag LOCUS_31030 77928 76762 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_31030 78251 77976 gene locus_tag LOCUS_31040 78251 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 78355 80778 gene locus_tag LOCUS_31050 78355 80778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31050 84827 80775 gene locus_tag LOCUS_31060 84827 80775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 86567 85125 gene locus_tag LOCUS_31070 86567 85125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 87513 86647 gene locus_tag LOCUS_31080 87513 86647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 87726 88151 gene locus_tag LOCUS_31090 87726 88151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 88148 89008 gene locus_tag LOCUS_31100 88148 89008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 90831 89581 gene locus_tag LOCUS_31110 90831 89581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 94738 90911 gene locus_tag LOCUS_31120 94738 90911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 95753 94752 gene locus_tag LOCUS_31130 95753 94752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 98297 95865 gene locus_tag LOCUS_31140 98297 95865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 98503 99858 gene locus_tag LOCUS_31150 98503 99858 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_31150 99862 101310 gene locus_tag LOCUS_31160 99862 101310 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_31160 102111 101314 gene locus_tag LOCUS_31170 102111 101314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 104309 102108 gene locus_tag LOCUS_31180 104309 102108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 104478 105074 gene locus_tag LOCUS_31190 104478 105074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 108733 105110 gene locus_tag LOCUS_31200 108733 105110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 109309 108737 gene locus_tag LOCUS_31210 109309 108737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 110379 109309 gene locus_tag LOCUS_31220 110379 109309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 110859 110383 gene locus_tag LOCUS_31230 110859 110383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 111760 111167 gene locus_tag LOCUS_31240 111760 111167 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8C7 protein_id gnl|my_center|LOCUS_31240 112941 111757 gene locus_tag LOCUS_31250 112941 111757 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_31250 113141 114868 gene locus_tag LOCUS_31260 gene sopT 113141 114868 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_31260 115088 115300 gene locus_tag LOCUS_31270 115088 115300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 116749 115313 gene locus_tag LOCUS_31280 116749 115313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 117061 117417 gene locus_tag LOCUS_31290 117061 117417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 117506 121885 gene locus_tag LOCUS_31300 117506 121885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 122726 121833 gene locus_tag LOCUS_31310 122726 121833 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_31310 122791 124941 gene locus_tag LOCUS_31320 122791 124941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 126508 125306 gene locus_tag LOCUS_31330 126508 125306 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_31330 129742 126539 gene locus_tag LOCUS_31340 129742 126539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 129819 131738 gene locus_tag LOCUS_31350 129819 131738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 131795 133189 gene locus_tag LOCUS_31360 131795 133189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 134622 133234 gene locus_tag LOCUS_31370 134622 133234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 134689 135153 gene locus_tag LOCUS_31380 134689 135153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_31380 136275 135142 gene locus_tag LOCUS_31390 136275 135142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 136350 138806 gene locus_tag LOCUS_31400 136350 138806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 141240 138841 gene locus_tag LOCUS_31410 141240 138841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 141369 143453 gene locus_tag LOCUS_31420 gene fusA-1 141369 143453 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_31420 143480 144694 gene locus_tag LOCUS_31430 143480 144694 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064899.1 protein_id gnl|my_center|LOCUS_31430 144720 147686 gene locus_tag LOCUS_31440 gene chb 144720 147686 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_31440 149182 147683 gene locus_tag LOCUS_31450 149182 147683 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_31450 149162 151612 gene locus_tag LOCUS_31460 149162 151612 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_31460 152373 151798 gene locus_tag LOCUS_31470 152373 151798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 152267 152470 gene locus_tag LOCUS_31480 152267 152470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 152473 153594 gene locus_tag LOCUS_31490 152473 153594 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528974.1 protein_id gnl|my_center|LOCUS_31490 153725 155302 gene locus_tag LOCUS_31500 gene glyQS 153725 155302 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_31500 155325 156254 gene locus_tag LOCUS_31510 gene lipA 155325 156254 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201875.1 protein_id gnl|my_center|LOCUS_31510 156289 157407 gene locus_tag LOCUS_31520 156289 157407 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_31520 158463 157675 gene locus_tag LOCUS_31530 158463 157675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 159995 158487 gene locus_tag LOCUS_31540 159995 158487 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_31540 160046 161356 gene locus_tag LOCUS_31550 160046 161356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_31550 161341 162120 gene locus_tag LOCUS_31560 gene truA 161341 162120 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_31560 162168 163202 gene locus_tag LOCUS_31570 162168 163202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181149.1 protein_id gnl|my_center|LOCUS_31570 166115 163227 gene locus_tag LOCUS_31580 166115 163227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 172580 166176 gene locus_tag LOCUS_31590 172580 166176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 172691 173824 gene locus_tag LOCUS_31600 172691 173824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 173836 174600 gene locus_tag LOCUS_31610 173836 174600 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_31610 175584 174601 gene locus_tag LOCUS_31620 175584 174601 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_31620 175749 177668 gene locus_tag LOCUS_31630 gene speA 175749 177668 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_31630 177672 178895 gene locus_tag LOCUS_31640 177672 178895 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_31640 179033 179743 gene locus_tag LOCUS_31650 179033 179743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 180775 180542 gene locus_tag LOCUS_31660 180775 180542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 181310 180768 gene locus_tag LOCUS_31670 181310 180768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 182131 182757 gene locus_tag LOCUS_31680 182131 182757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 182878 185292 gene locus_tag LOCUS_31690 182878 185292 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_31690 185304 186422 gene locus_tag LOCUS_31700 185304 186422 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_31700 186419 189493 gene locus_tag LOCUS_31710 186419 189493 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_31710 191432 189615 gene locus_tag LOCUS_31720 191432 189615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 191673 192548 gene locus_tag LOCUS_31730 191673 192548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 192568 195264 gene locus_tag LOCUS_31740 192568 195264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 195339 196181 gene locus_tag LOCUS_31750 195339 196181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 196182 197588 gene locus_tag LOCUS_31760 196182 197588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 197585 198049 gene locus_tag LOCUS_31770 197585 198049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 198085 200022 gene locus_tag LOCUS_31780 198085 200022 CDS product capsular polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_31780 201690 200032 gene locus_tag LOCUS_31790 201690 200032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 202911 201901 gene locus_tag LOCUS_31800 202911 201901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 204485 203067 gene locus_tag LOCUS_31810 204485 203067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_31810 205906 204497 gene locus_tag LOCUS_31820 205906 204497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_31820 206620 205916 gene locus_tag LOCUS_31830 206620 205916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_31830 207185 206883 gene locus_tag LOCUS_31840 207185 206883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 207417 208352 gene locus_tag LOCUS_31850 207417 208352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 209407 208394 gene locus_tag LOCUS_31860 209407 208394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 209639 211063 gene locus_tag LOCUS_31870 gene mpl 209639 211063 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_31870 211094 211333 gene locus_tag LOCUS_31880 211094 211333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 211439 212104 gene locus_tag LOCUS_31890 211439 212104 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202426.1 protein_id gnl|my_center|LOCUS_31890 212468 214960 gene locus_tag LOCUS_31900 212468 214960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31900 215109 215786 gene locus_tag LOCUS_31910 215109 215786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 215803 216681 gene locus_tag LOCUS_31920 215803 216681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 216740 217549 gene locus_tag LOCUS_31930 216740 217549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 218022 217567 gene locus_tag LOCUS_31940 218022 217567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 218567 218022 gene locus_tag LOCUS_31950 218567 218022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 219773 218958 gene locus_tag LOCUS_31960 gene rph 219773 218958 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEW9 protein_id gnl|my_center|LOCUS_31960 220470 219796 gene locus_tag LOCUS_31970 220470 219796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 222125 220467 gene locus_tag LOCUS_31980 222125 220467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 222137 222212 gene locus_tag LOCUS_t00410 222137 222212 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 223533 222937 gene locus_tag LOCUS_31990 223533 222937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 224173 223595 gene locus_tag LOCUS_32000 224173 223595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_32000 226337 224184 gene locus_tag LOCUS_32010 226337 224184 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_32010 226797 226339 gene locus_tag LOCUS_32020 226797 226339 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_32020 227037 226961 gene locus_tag LOCUS_t00420 227037 226961 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 228689 227151 gene locus_tag LOCUS_32030 228689 227151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 230196 228730 gene locus_tag LOCUS_32040 gene glgA1 230196 228730 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_32040 231461 230193 gene locus_tag LOCUS_32050 gene glgC 231461 230193 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_32050 233875 231524 gene locus_tag LOCUS_32060 233875 231524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 235974 233938 gene locus_tag LOCUS_32070 235974 233938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 236155 237930 gene locus_tag LOCUS_32080 236155 237930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 241006 237914 gene locus_tag LOCUS_32090 241006 237914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_32090 241226 242083 gene locus_tag LOCUS_32100 241226 242083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 242080 242847 gene locus_tag LOCUS_32110 242080 242847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32110 242859 244928 gene locus_tag LOCUS_32120 242859 244928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 244925 245995 gene locus_tag LOCUS_32130 244925 245995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 248167 246398 gene locus_tag LOCUS_32140 248167 246398 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_32140 249225 248206 gene locus_tag LOCUS_32150 249225 248206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 250001 249300 gene locus_tag LOCUS_32160 250001 249300 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_32160 251536 250037 gene locus_tag LOCUS_32170 gene trpE 251536 250037 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_32170 252183 251536 gene locus_tag LOCUS_32180 gene hisI 252183 251536 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC9 protein_id gnl|my_center|LOCUS_32180 253010 252180 gene locus_tag LOCUS_32190 gene hisF 253010 252180 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S295 protein_id gnl|my_center|LOCUS_32190 253735 253007 gene locus_tag LOCUS_32200 gene hisA 253735 253007 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60581 protein_id gnl|my_center|LOCUS_32200 254360 253713 gene locus_tag LOCUS_32210 gene hisH 254360 253713 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_32210 254968 254357 gene locus_tag LOCUS_32220 gene hisB 254968 254357 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039B2 protein_id gnl|my_center|LOCUS_32220 256071 254965 gene locus_tag LOCUS_32230 gene hisC 256071 254965 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2C4 protein_id gnl|my_center|LOCUS_32230 >Feature sequence14 3069 331 gene locus_tag LOCUS_32240 3069 331 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073743.1 protein_id gnl|my_center|LOCUS_32240 5552 3063 gene locus_tag LOCUS_32250 5552 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 6119 5634 gene locus_tag LOCUS_32260 6119 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 6940 6119 gene locus_tag LOCUS_32270 6940 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 7110 9122 gene locus_tag LOCUS_32280 7110 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 9126 11078 gene locus_tag LOCUS_32290 9126 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 11084 12250 gene locus_tag LOCUS_32300 11084 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 12427 12750 gene locus_tag LOCUS_32310 12427 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 12772 15627 gene locus_tag LOCUS_32320 12772 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 15617 16576 gene locus_tag LOCUS_32330 15617 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 16592 18538 gene locus_tag LOCUS_32340 16592 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 18580 19731 gene locus_tag LOCUS_32350 18580 19731 CDS product NHLP bacteriocin system secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814912.1 protein_id gnl|my_center|LOCUS_32350 19734 21956 gene locus_tag LOCUS_32360 19734 21956 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_32360 21963 25736 gene locus_tag LOCUS_32370 21963 25736 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_32370 25736 26794 gene locus_tag LOCUS_32380 25736 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 27403 26801 gene locus_tag LOCUS_32390 27403 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 27528 28250 gene locus_tag LOCUS_32400 27528 28250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 28259 30373 gene locus_tag LOCUS_32410 28259 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_32410 30370 34203 gene locus_tag LOCUS_32420 30370 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_32420 34839 36335 gene locus_tag LOCUS_32430 34839 36335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 36533 37624 gene locus_tag LOCUS_32440 36533 37624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_32440 38084 37614 gene locus_tag LOCUS_32450 38084 37614 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056590.1 protein_id gnl|my_center|LOCUS_32450 39062 38088 gene locus_tag LOCUS_32460 39062 38088 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_32460 40334 39156 gene locus_tag LOCUS_32470 40334 39156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 40370 40882 gene locus_tag LOCUS_32480 40370 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 41135 43084 gene locus_tag LOCUS_32490 41135 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 43227 45215 gene locus_tag LOCUS_32500 43227 45215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 45233 46963 gene locus_tag LOCUS_32510 45233 46963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 48525 46960 gene locus_tag LOCUS_32520 48525 46960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 50099 48543 gene locus_tag LOCUS_32530 50099 48543 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228459.1 protein_id gnl|my_center|LOCUS_32530 50807 50148 gene locus_tag LOCUS_32540 50807 50148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 52156 50900 gene locus_tag LOCUS_32550 gene pgaC 52156 50900 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_32550 53935 52232 gene locus_tag LOCUS_32560 gene hmsF 53935 52232 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_32560 56505 53932 gene locus_tag LOCUS_32570 56505 53932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 57017 56598 gene locus_tag LOCUS_32580 57017 56598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 58846 57029 gene locus_tag LOCUS_32590 58846 57029 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_32590 59015 59917 gene locus_tag LOCUS_32600 59015 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 59946 61682 gene locus_tag LOCUS_32610 59946 61682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 61739 63391 gene locus_tag LOCUS_32620 61739 63391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 63401 65383 gene locus_tag LOCUS_32630 63401 65383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123714.1 protein_id gnl|my_center|LOCUS_32630 65408 65638 gene locus_tag LOCUS_32640 65408 65638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228375.1 protein_id gnl|my_center|LOCUS_32640 65987 68146 gene locus_tag LOCUS_32650 65987 68146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 69085 68213 gene locus_tag LOCUS_32660 69085 68213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 70590 69163 gene locus_tag LOCUS_32670 70590 69163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975770.1 protein_id gnl|my_center|LOCUS_32670 70892 72412 gene locus_tag LOCUS_32680 70892 72412 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_32680 72444 73988 gene locus_tag LOCUS_32690 72444 73988 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_32690 74508 75761 gene locus_tag LOCUS_32700 74508 75761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 76648 75767 gene locus_tag LOCUS_32710 76648 75767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 77615 76704 gene locus_tag LOCUS_32720 gene coaA 77615 76704 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB3 protein_id gnl|my_center|LOCUS_32720 78448 77630 gene locus_tag LOCUS_32730 78448 77630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 80133 78454 gene locus_tag LOCUS_32740 gene hutU 80133 78454 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFF0 protein_id gnl|my_center|LOCUS_32740 80231 80965 gene locus_tag LOCUS_32750 80231 80965 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_32750 80965 81756 gene locus_tag LOCUS_32760 80965 81756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_32760 81796 82146 gene locus_tag LOCUS_32770 81796 82146 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_32770 82143 82550 gene locus_tag LOCUS_32780 82143 82550 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_32780 82577 82970 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq taacctgaaatagcggtgttt 83883 83005 gene locus_tag LOCUS_32790 83883 83005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 84025 84678 gene locus_tag LOCUS_32800 84025 84678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 85039 84824 gene locus_tag LOCUS_32810 85039 84824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 84980 87130 gene locus_tag LOCUS_32820 84980 87130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 87130 88011 gene locus_tag LOCUS_32830 87130 88011 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_32830 87998 89107 gene locus_tag LOCUS_32840 87998 89107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 89104 90012 gene locus_tag LOCUS_32850 89104 90012 CDS product cation ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_32850 90009 90725 gene locus_tag LOCUS_32860 90009 90725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_32860 90722 91573 gene locus_tag LOCUS_32870 90722 91573 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_32870 93394 91577 gene locus_tag LOCUS_32880 93394 91577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_32880 95287 93476 gene locus_tag LOCUS_32890 95287 93476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 96180 95284 gene locus_tag LOCUS_32900 96180 95284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32900 97091 96177 gene locus_tag LOCUS_32910 97091 96177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 99794 97119 gene locus_tag LOCUS_32920 gene polA 99794 97119 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_32920 101214 99808 gene locus_tag LOCUS_32930 101214 99808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 102620 101226 gene locus_tag LOCUS_32940 102620 101226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 104508 102553 gene locus_tag LOCUS_32950 104508 102553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 106431 104557 gene locus_tag LOCUS_32960 106431 104557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 107258 106428 gene locus_tag LOCUS_32970 107258 106428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 108765 107269 gene locus_tag LOCUS_32980 108765 107269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 110441 108765 gene locus_tag LOCUS_32990 110441 108765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 113009 110496 gene locus_tag LOCUS_33000 gene pheT 113009 110496 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH19 protein_id gnl|my_center|LOCUS_33000 114044 113019 gene locus_tag LOCUS_33010 gene pheS 114044 113019 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_33010 114285 115547 gene locus_tag LOCUS_33020 114285 115547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 115814 116383 gene locus_tag LOCUS_33030 115814 116383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 117782 116397 gene locus_tag LOCUS_33040 117782 116397 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_33040 118127 121429 gene locus_tag LOCUS_33050 118127 121429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_33050 122890 121481 gene locus_tag LOCUS_33060 122890 121481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 124948 122948 gene locus_tag LOCUS_33070 124948 122948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 125995 125159 gene locus_tag LOCUS_33080 125995 125159 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_33080 126523 126008 gene locus_tag LOCUS_33090 126523 126008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 126830 126531 gene locus_tag LOCUS_33100 126830 126531 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118393.1 protein_id gnl|my_center|LOCUS_33100 126960 127334 gene locus_tag LOCUS_33110 126960 127334 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185699.1 protein_id gnl|my_center|LOCUS_33110 127463 127975 gene locus_tag LOCUS_33120 127463 127975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 128217 127948 gene locus_tag LOCUS_33130 128217 127948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 129966 128407 gene locus_tag LOCUS_33140 129966 128407 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_33140 130023 132464 gene locus_tag LOCUS_33150 130023 132464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_33150 132485 133213 gene locus_tag LOCUS_33160 132485 133213 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_33160 134401 133214 gene locus_tag LOCUS_33170 134401 133214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 134876 134451 gene locus_tag LOCUS_33180 134876 134451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 135391 134876 gene locus_tag LOCUS_33190 135391 134876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 135508 137889 gene locus_tag LOCUS_33200 135508 137889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_33200 138477 137893 gene locus_tag LOCUS_33210 138477 137893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_33210 142779 139225 gene locus_tag LOCUS_33220 142779 139225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 146748 143068 gene locus_tag LOCUS_33230 146748 143068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 147106 147723 gene locus_tag LOCUS_33240 147106 147723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 150810 147712 gene locus_tag LOCUS_33250 150810 147712 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_33250 151936 150830 gene locus_tag LOCUS_33260 151936 150830 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_33260 155339 151908 gene locus_tag LOCUS_33270 155339 151908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 156304 155339 gene locus_tag LOCUS_33280 156304 155339 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_33280 156452 157930 gene locus_tag LOCUS_33290 156452 157930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 158670 157945 gene locus_tag LOCUS_33300 158670 157945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 158782 159249 gene locus_tag LOCUS_33310 gene phnB 158782 159249 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_33310 159861 159277 gene locus_tag LOCUS_33320 159861 159277 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_33320 161691 159886 gene locus_tag LOCUS_33330 161691 159886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 162856 161948 gene locus_tag LOCUS_33340 162856 161948 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_33340 162932 164719 gene locus_tag LOCUS_33350 162932 164719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 164726 166399 gene locus_tag LOCUS_33360 164726 166399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 166417 168093 gene locus_tag LOCUS_33370 166417 168093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 168111 169343 gene locus_tag LOCUS_33380 168111 169343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 171078 169360 gene locus_tag LOCUS_33390 171078 169360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 171173 171922 gene locus_tag LOCUS_33400 171173 171922 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_33400 171926 172954 gene locus_tag LOCUS_33410 171926 172954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_33410 172979 174229 gene locus_tag LOCUS_33420 172979 174229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 174226 175353 gene locus_tag LOCUS_33430 174226 175353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_33430 175892 175320 gene locus_tag LOCUS_33440 175892 175320 CDS product NimA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887488.1 protein_id gnl|my_center|LOCUS_33440 175958 177448 gene locus_tag LOCUS_33450 175958 177448 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196166.1 protein_id gnl|my_center|LOCUS_33450 178151 177465 gene locus_tag LOCUS_33460 178151 177465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 178720 178148 gene locus_tag LOCUS_33470 178720 178148 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ME35 protein_id gnl|my_center|LOCUS_33470 179275 178730 gene locus_tag LOCUS_33480 179275 178730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 181740 179398 gene locus_tag LOCUS_33490 181740 179398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 182277 181783 gene locus_tag LOCUS_33500 182277 181783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 184680 182308 gene locus_tag LOCUS_33510 184680 182308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_33510 184817 185194 gene locus_tag LOCUS_33520 184817 185194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 185984 185217 gene locus_tag LOCUS_33530 185984 185217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 186877 185984 gene locus_tag LOCUS_33540 gene hbd 186877 185984 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_33540 187441 186902 gene locus_tag LOCUS_33550 187441 186902 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_33550 188684 187464 gene locus_tag LOCUS_33560 188684 187464 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_33560 189033 188692 gene locus_tag LOCUS_33570 189033 188692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_33570 189553 189122 gene locus_tag LOCUS_33580 189553 189122 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_33580 189580 189906 gene locus_tag LOCUS_33590 189580 189906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587853.1 protein_id gnl|my_center|LOCUS_33590 190082 189903 gene locus_tag LOCUS_33600 190082 189903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 190002 190526 gene locus_tag LOCUS_33610 190002 190526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 190552 192564 gene locus_tag LOCUS_33620 190552 192564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118523.1 protein_id gnl|my_center|LOCUS_33620 193543 192812 gene locus_tag LOCUS_33630 193543 192812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 193659 195878 gene locus_tag LOCUS_33640 193659 195878 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_33640 196431 196928 gene locus_tag LOCUS_33650 196431 196928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 196963 197298 gene locus_tag LOCUS_33660 196963 197298 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_33660 198463 197306 gene locus_tag LOCUS_33670 198463 197306 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933863.1 protein_id gnl|my_center|LOCUS_33670 198617 203083 gene locus_tag LOCUS_33680 198617 203083 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_33680 204385 203156 gene locus_tag LOCUS_33690 gene hutI 204385 203156 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIE1 protein_id gnl|my_center|LOCUS_33690 204424 207885 gene locus_tag LOCUS_33700 204424 207885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 209714 207882 gene locus_tag LOCUS_33710 209714 207882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_33710 210042 210938 gene locus_tag LOCUS_33720 210042 210938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 211243 212136 gene locus_tag LOCUS_33730 211243 212136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 212267 212773 gene locus_tag LOCUS_33740 212267 212773 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_33740 213106 214551 gene locus_tag LOCUS_33750 213106 214551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 214706 218599 gene locus_tag LOCUS_33760 214706 218599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 219812 218589 gene locus_tag LOCUS_33770 219812 218589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_33770 220159 219833 gene locus_tag LOCUS_33780 220159 219833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 220655 220248 gene locus_tag LOCUS_33790 220655 220248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 220733 221872 gene locus_tag LOCUS_33800 220733 221872 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_33800 224586 221938 gene locus_tag LOCUS_33810 224586 221938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 227436 224773 gene locus_tag LOCUS_33820 227436 224773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 227711 232774 gene locus_tag LOCUS_33830 227711 232774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 243309 232843 gene locus_tag LOCUS_33840 243309 232843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 245995 243518 gene locus_tag LOCUS_33850 245995 243518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 246209 247354 gene locus_tag LOCUS_33860 246209 247354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence15 1147 2073 gene locus_tag LOCUS_33870 gene menA 1147 2073 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_33870 2076 3401 gene locus_tag LOCUS_33880 gene menE 2076 3401 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23971 protein_id gnl|my_center|LOCUS_33880 3398 5389 gene locus_tag LOCUS_33890 3398 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 5389 7395 gene locus_tag LOCUS_33900 5389 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 7602 10889 gene locus_tag LOCUS_33910 7602 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 13474 10886 gene locus_tag LOCUS_33920 13474 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 14131 13589 gene locus_tag LOCUS_33930 14131 13589 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_33930 15891 14128 gene locus_tag LOCUS_33940 15891 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 17194 15926 gene locus_tag LOCUS_33950 gene arcA 17194 15926 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZA0 protein_id gnl|my_center|LOCUS_33950 17222 17875 gene locus_tag LOCUS_33960 17222 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 21110 17898 gene locus_tag LOCUS_33970 21110 17898 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_33970 21726 21205 gene locus_tag LOCUS_33980 21726 21205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 21845 22954 gene locus_tag LOCUS_33990 21845 22954 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_33990 24390 22969 gene locus_tag LOCUS_34000 24390 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 25707 24463 gene locus_tag LOCUS_34010 25707 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 28422 25804 gene locus_tag LOCUS_34020 gene clpB 28422 25804 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM12 protein_id gnl|my_center|LOCUS_34020 29420 28455 gene locus_tag LOCUS_34030 29420 28455 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_34030 29601 30884 gene locus_tag LOCUS_34040 29601 30884 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_34040 30889 32205 gene locus_tag LOCUS_34050 30889 32205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 32195 33994 gene locus_tag LOCUS_34060 32195 33994 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_34060 34197 35252 gene locus_tag LOCUS_34070 34197 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 35537 35262 gene locus_tag LOCUS_34080 35537 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 36006 37466 gene locus_tag LOCUS_34090 36006 37466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 37480 37662 gene locus_tag LOCUS_34100 37480 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 38563 38087 gene locus_tag LOCUS_34110 38563 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 39020 38715 gene locus_tag LOCUS_34120 39020 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 39407 41752 gene locus_tag LOCUS_34130 39407 41752 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_34130 42666 41749 gene locus_tag LOCUS_34140 42666 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 42823 45306 gene locus_tag LOCUS_34150 42823 45306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 45347 45919 gene locus_tag LOCUS_34160 45347 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 45919 47121 gene locus_tag LOCUS_34170 45919 47121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 47140 48912 gene locus_tag LOCUS_34180 47140 48912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 49881 48934 gene locus_tag LOCUS_34190 49881 48934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 50705 49878 gene locus_tag LOCUS_34200 50705 49878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 50655 51287 gene locus_tag LOCUS_34210 50655 51287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 55912 51386 gene locus_tag LOCUS_34220 55912 51386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 56313 57416 gene locus_tag LOCUS_34230 56313 57416 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_34230 57463 58746 gene locus_tag LOCUS_34240 57463 58746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_34240 59830 58799 gene locus_tag LOCUS_34250 59830 58799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 63353 59880 gene locus_tag LOCUS_34260 63353 59880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 65458 63785 gene locus_tag LOCUS_34270 65458 63785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 66537 65773 gene locus_tag LOCUS_34280 66537 65773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_34280 67306 66713 gene locus_tag LOCUS_34290 67306 66713 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_34290 69071 67452 gene locus_tag LOCUS_34300 69071 67452 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 protein_id gnl|my_center|LOCUS_34300 69146 70270 gene locus_tag LOCUS_34310 69146 70270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 70300 71016 gene locus_tag LOCUS_34320 70300 71016 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 protein_id gnl|my_center|LOCUS_34320 71035 71643 gene locus_tag LOCUS_34330 71035 71643 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_34330 71640 74360 gene locus_tag LOCUS_34340 71640 74360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 74470 75072 gene locus_tag LOCUS_34350 74470 75072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 75596 75510 gene locus_tag LOCUS_t00430 75596 75510 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 77354 76500 gene locus_tag LOCUS_34360 77354 76500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 77574 77837 gene locus_tag LOCUS_34370 77574 77837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 79595 77880 gene locus_tag LOCUS_34380 79595 77880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 82031 79617 gene locus_tag LOCUS_34390 82031 79617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 82171 82731 gene locus_tag LOCUS_34400 82171 82731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 82728 83372 gene locus_tag LOCUS_34410 82728 83372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 83397 84113 gene locus_tag LOCUS_34420 83397 84113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_34420 84393 86219 gene locus_tag LOCUS_34430 84393 86219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 86216 87406 gene locus_tag LOCUS_34440 86216 87406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 90633 87388 gene locus_tag LOCUS_34450 90633 87388 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_34450 92201 90762 gene locus_tag LOCUS_34460 92201 90762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 92533 93369 gene locus_tag LOCUS_34470 92533 93369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 93362 95275 gene locus_tag LOCUS_34480 93362 95275 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263947.1 protein_id gnl|my_center|LOCUS_34480 95305 98130 gene locus_tag LOCUS_34490 95305 98130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 99243 98131 gene locus_tag LOCUS_34500 99243 98131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 99914 99333 gene locus_tag LOCUS_34510 99914 99333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 99913 100119 gene locus_tag LOCUS_34520 99913 100119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 102876 100051 gene locus_tag LOCUS_34530 102876 100051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 103195 102893 gene locus_tag LOCUS_34540 103195 102893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 103922 103224 gene locus_tag LOCUS_34550 103922 103224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 104518 103919 gene locus_tag LOCUS_34560 104518 103919 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085826.1 protein_id gnl|my_center|LOCUS_34560 104668 107466 gene locus_tag LOCUS_34570 104668 107466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 107541 107951 gene locus_tag LOCUS_34580 107541 107951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 107973 108383 gene locus_tag LOCUS_34590 107973 108383 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_34590 109062 108694 gene locus_tag LOCUS_34600 109062 108694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_34600 109976 109122 gene locus_tag LOCUS_34610 109976 109122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 110552 109980 gene locus_tag LOCUS_34620 110552 109980 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_34620 111611 110706 gene locus_tag LOCUS_34630 111611 110706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_34630 114046 111611 gene locus_tag LOCUS_34640 114046 111611 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_34640 114531 114043 gene locus_tag LOCUS_34650 114531 114043 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_34650 115408 114542 gene locus_tag LOCUS_34660 115408 114542 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_34660 116626 115436 gene locus_tag LOCUS_34670 116626 115436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_34670 117547 116639 gene locus_tag LOCUS_34680 117547 116639 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_34680 120137 117702 gene locus_tag LOCUS_34690 120137 117702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_34690 121908 120217 gene locus_tag LOCUS_34700 121908 120217 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_34700 122772 121981 gene locus_tag LOCUS_34710 122772 121981 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_34710 123743 122775 gene locus_tag LOCUS_34720 123743 122775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_34720 124654 123740 gene locus_tag LOCUS_34730 124654 123740 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_34730 125979 124654 gene locus_tag LOCUS_34740 125979 124654 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_34740 127954 125990 gene locus_tag LOCUS_34750 127954 125990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 129650 128043 gene locus_tag LOCUS_34760 129650 128043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_34760 132524 129705 gene locus_tag LOCUS_34770 gene uvrA 132524 129705 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_34770 134809 132656 gene locus_tag LOCUS_34780 134809 132656 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706114.1 protein_id gnl|my_center|LOCUS_34780 135617 134976 gene locus_tag LOCUS_34790 135617 134976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_34790 137902 135614 gene locus_tag LOCUS_34800 137902 135614 CDS product salicylyl-CoA 5-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_34800 138423 137980 gene locus_tag LOCUS_34810 138423 137980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_34810 138667 139086 gene locus_tag LOCUS_34820 138667 139086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_34820 139602 139120 gene locus_tag LOCUS_34830 139602 139120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 139784 142408 gene locus_tag LOCUS_34840 139784 142408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 142405 142824 gene locus_tag LOCUS_34850 142405 142824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 142821 145055 gene locus_tag LOCUS_34860 142821 145055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 146653 145010 gene locus_tag LOCUS_34870 146653 145010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 148455 146650 gene locus_tag LOCUS_34880 148455 146650 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_34880 148652 149500 gene locus_tag LOCUS_34890 148652 149500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 149588 151681 gene locus_tag LOCUS_34900 149588 151681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 151681 153384 gene locus_tag LOCUS_34910 151681 153384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 153906 153436 gene locus_tag LOCUS_34920 153906 153436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 154369 153920 gene locus_tag LOCUS_34930 154369 153920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 154530 157010 gene locus_tag LOCUS_34940 154530 157010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 157072 157815 gene locus_tag LOCUS_34950 157072 157815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 158862 157819 gene locus_tag LOCUS_34960 158862 157819 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_34960 160416 158890 gene locus_tag LOCUS_34970 gene sglT 160416 158890 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_34970 162300 160618 gene locus_tag LOCUS_34980 162300 160618 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_34980 162763 168021 gene locus_tag LOCUS_34990 162763 168021 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_34990 168114 168875 gene locus_tag LOCUS_35000 168114 168875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 169273 168905 gene locus_tag LOCUS_35010 169273 168905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_35010 171179 169293 gene locus_tag LOCUS_35020 171179 169293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 172339 171176 gene locus_tag LOCUS_35030 172339 171176 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_35030 173516 172341 gene locus_tag LOCUS_35040 173516 172341 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674031.1 protein_id gnl|my_center|LOCUS_35040 175043 173568 gene locus_tag LOCUS_35050 175043 173568 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_35050 176797 175040 gene locus_tag LOCUS_35060 176797 175040 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_35060 176940 178382 gene locus_tag LOCUS_35070 176940 178382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 179051 185080 gene locus_tag LOCUS_35080 179051 185080 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_35080 187212 185686 gene locus_tag LOCUS_35090 187212 185686 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_35090 187643 187212 gene locus_tag LOCUS_35100 187643 187212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 187668 189164 gene locus_tag LOCUS_35110 187668 189164 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_35110 189481 189639 gene locus_tag LOCUS_35120 189481 189639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 189702 190103 gene locus_tag LOCUS_35130 189702 190103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 190119 190472 gene locus_tag LOCUS_35140 190119 190472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 190495 192081 gene locus_tag LOCUS_35150 190495 192081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 192176 193306 gene locus_tag LOCUS_35160 gene pstS 192176 193306 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_35160 193316 196054 gene locus_tag LOCUS_35170 gene pstC 193316 196054 CDS product ABC high affinity phosphate uptake system permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_35170 196186 197988 gene locus_tag LOCUS_35180 gene pstA 196186 197988 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_35180 197988 198869 gene locus_tag LOCUS_35190 gene pstB 197988 198869 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_35190 198888 199541 gene locus_tag LOCUS_35200 gene phoU 198888 199541 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_35200 199552 200349 gene locus_tag LOCUS_35210 199552 200349 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_35210 200400 202187 gene locus_tag LOCUS_35220 gene phoR 200400 202187 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_35220 204498 202195 gene locus_tag LOCUS_35230 204498 202195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 207600 204574 gene locus_tag LOCUS_35240 207600 204574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 209566 208250 gene locus_tag LOCUS_35250 209566 208250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 219363 209563 gene locus_tag LOCUS_35260 219363 209563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 225131 219396 gene locus_tag LOCUS_35270 225131 219396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 <241055 225171 gene locus_tag LOCUS_35280 <241055 225171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence16 705 1826 gene locus_tag LOCUS_35290 705 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1934 4153 gene locus_tag LOCUS_35300 1934 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 4206 5474 gene locus_tag LOCUS_35310 4206 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 5499 6383 gene locus_tag LOCUS_35320 5499 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 6398 7552 gene locus_tag LOCUS_35330 6398 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 7561 8124 gene locus_tag LOCUS_35340 7561 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_35340 8121 8987 gene locus_tag LOCUS_35350 8121 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 8998 10914 gene locus_tag LOCUS_35360 8998 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 10928 11653 gene locus_tag LOCUS_35370 10928 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931010.1 protein_id gnl|my_center|LOCUS_35370 12421 12059 gene locus_tag LOCUS_35380 12421 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 12627 15959 gene locus_tag LOCUS_35390 12627 15959 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_35390 15973 17451 gene locus_tag LOCUS_35400 15973 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 17468 18055 gene locus_tag LOCUS_35410 17468 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 18082 18633 gene locus_tag LOCUS_35420 18082 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 20231 18990 gene locus_tag LOCUS_35430 20231 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 20593 21147 gene locus_tag LOCUS_35440 20593 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 21137 21370 gene locus_tag LOCUS_35450 21137 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 22094 22660 gene locus_tag LOCUS_35460 22094 22660 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_35460 23692 22751 gene locus_tag LOCUS_35470 23692 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 23857 27327 gene locus_tag LOCUS_35480 23857 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 30830 27324 gene locus_tag LOCUS_35490 30830 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 31242 30892 gene locus_tag LOCUS_35500 31242 30892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 31553 31239 gene locus_tag LOCUS_35510 31553 31239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 34488 31597 gene locus_tag LOCUS_35520 34488 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 34584 35636 gene locus_tag LOCUS_35530 gene yhaM 34584 35636 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_35530 36548 35658 gene locus_tag LOCUS_35540 36548 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 36599 37762 gene locus_tag LOCUS_35550 36599 37762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 37824 38330 gene locus_tag LOCUS_35560 gene yjeE 37824 38330 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942445.1 protein_id gnl|my_center|LOCUS_35560 38327 38980 gene locus_tag LOCUS_35570 38327 38980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 38980 40026 gene locus_tag LOCUS_35580 gene tsaD 38980 40026 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I738 protein_id gnl|my_center|LOCUS_35580 40023 40880 gene locus_tag LOCUS_35590 40023 40880 CDS product dTDP-glucose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_35590 40877 42271 gene locus_tag LOCUS_35600 40877 42271 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776792.1 protein_id gnl|my_center|LOCUS_35600 43671 42280 gene locus_tag LOCUS_35610 gene purF 43671 42280 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_35610 45035 43710 gene locus_tag LOCUS_35620 gene hemG 45035 43710 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_35620 46433 45042 gene locus_tag LOCUS_35630 gene pilR 46433 45042 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_35630 48097 46430 gene locus_tag LOCUS_35640 gene pilS 48097 46430 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_35640 49382 48177 gene locus_tag LOCUS_35650 gene pilC 49382 48177 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_35650 50525 49386 gene locus_tag LOCUS_35660 gene pilT-4 50525 49386 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_35660 50659 52506 gene locus_tag LOCUS_35670 50659 52506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_35670 52590 53033 gene locus_tag LOCUS_35680 52590 53033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 53057 53833 gene locus_tag LOCUS_35690 53057 53833 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_35690 53830 54258 gene locus_tag LOCUS_35700 53830 54258 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086222.1 protein_id gnl|my_center|LOCUS_35700 54255 55049 gene locus_tag LOCUS_35710 gene paaG 54255 55049 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_35710 55067 56227 gene locus_tag LOCUS_35720 55067 56227 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_35720 57555 56239 gene locus_tag LOCUS_35730 57555 56239 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_35730 58444 57590 gene locus_tag LOCUS_35740 58444 57590 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5X1 protein_id gnl|my_center|LOCUS_35740 60671 58449 gene locus_tag LOCUS_35750 gene purL 60671 58449 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU5 protein_id gnl|my_center|LOCUS_35750 61378 60668 gene locus_tag LOCUS_35760 gene purQ 61378 60668 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_35760 61665 61387 gene locus_tag LOCUS_35770 gene purS 61665 61387 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEB6 protein_id gnl|my_center|LOCUS_35770 62513 61680 gene locus_tag LOCUS_35780 62513 61680 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_35780 63311 62550 gene locus_tag LOCUS_35790 63311 62550 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_35790 64551 63517 gene locus_tag LOCUS_35800 gene metX 64551 63517 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW8 protein_id gnl|my_center|LOCUS_35800 64651 66258 gene locus_tag LOCUS_35810 64651 66258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 67790 66207 gene locus_tag LOCUS_35820 67790 66207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 67909 68304 gene locus_tag LOCUS_35830 67909 68304 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_35830 68308 69237 gene locus_tag LOCUS_35840 68308 69237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 69250 71154 gene locus_tag LOCUS_35850 69250 71154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 71154 73142 gene locus_tag LOCUS_35860 71154 73142 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705447.1 protein_id gnl|my_center|LOCUS_35860 75777 73405 gene locus_tag LOCUS_35870 75777 73405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 75920 76345 gene locus_tag LOCUS_35880 75920 76345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 77331 76426 gene locus_tag LOCUS_35890 77331 76426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 77627 78313 gene locus_tag LOCUS_35900 77627 78313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 79212 80360 gene locus_tag LOCUS_35910 79212 80360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 80418 81098 gene locus_tag LOCUS_35920 gene colR 80418 81098 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_35920 81123 82406 gene locus_tag LOCUS_35930 81123 82406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 82948 83202 gene locus_tag LOCUS_35940 82948 83202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 83199 83498 gene locus_tag LOCUS_35950 83199 83498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 87023 83505 gene locus_tag LOCUS_35960 87023 83505 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BR0 protein_id gnl|my_center|LOCUS_35960 87460 87041 gene locus_tag LOCUS_35970 87460 87041 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404768.1 protein_id gnl|my_center|LOCUS_35970 88838 87450 gene locus_tag LOCUS_35980 gene fadI 88838 87450 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3U0 protein_id gnl|my_center|LOCUS_35980 89735 88950 gene locus_tag LOCUS_35990 89735 88950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 89997 89719 gene locus_tag LOCUS_36000 89997 89719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 91466 90003 gene locus_tag LOCUS_36010 91466 90003 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_36010 91747 91463 gene locus_tag LOCUS_36020 91747 91463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 91892 95518 gene locus_tag LOCUS_36030 91892 95518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 95541 96476 gene locus_tag LOCUS_36040 gene echA4 95541 96476 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_36040 96495 97724 gene locus_tag LOCUS_36050 gene cfa 96495 97724 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476066.1 protein_id gnl|my_center|LOCUS_36050 97808 98437 gene locus_tag LOCUS_36060 97808 98437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 101534 98448 gene locus_tag LOCUS_36070 101534 98448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 101696 102301 gene locus_tag LOCUS_36080 gene tdk 101696 102301 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH4 protein_id gnl|my_center|LOCUS_36080 103949 102306 gene locus_tag LOCUS_36090 103949 102306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 104121 104549 gene locus_tag LOCUS_36100 104121 104549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 104546 105358 gene locus_tag LOCUS_36110 gene tatC 104546 105358 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_36110 107747 105372 gene locus_tag LOCUS_36120 107747 105372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 107875 108657 gene locus_tag LOCUS_36130 107875 108657 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_36130 109906 108632 gene locus_tag LOCUS_36140 109906 108632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_36140 109956 110951 gene locus_tag LOCUS_36150 109956 110951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_36150 111974 110970 gene locus_tag LOCUS_36160 111974 110970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 112071 113333 gene locus_tag LOCUS_36170 112071 113333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 113349 114176 gene locus_tag LOCUS_36180 gene uppP 113349 114176 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880L3 protein_id gnl|my_center|LOCUS_36180 116523 114163 gene locus_tag LOCUS_36190 116523 114163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 117257 116526 gene locus_tag LOCUS_36200 117257 116526 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_36200 118234 117254 gene locus_tag LOCUS_36210 118234 117254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 118301 119050 gene locus_tag LOCUS_36220 118301 119050 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_36220 119085 120104 gene locus_tag LOCUS_36230 gene fni 119085 120104 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD5 protein_id gnl|my_center|LOCUS_36230 120113 120448 gene locus_tag LOCUS_36240 120113 120448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 120475 121341 gene locus_tag LOCUS_36250 120475 121341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 122211 121354 gene locus_tag LOCUS_36260 122211 121354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 124464 122227 gene locus_tag LOCUS_36270 124464 122227 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_36270 126362 124899 gene locus_tag LOCUS_36280 gene gltX 126362 124899 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_36280 126448 127818 gene locus_tag LOCUS_36290 gene nagA 126448 127818 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_36290 129016 128048 gene locus_tag LOCUS_36300 129016 128048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 129116 129043 gene locus_tag LOCUS_t00440 129116 129043 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 129201 129518 gene locus_tag LOCUS_36310 129201 129518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 129508 130734 gene locus_tag LOCUS_36320 129508 130734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 130731 132200 gene locus_tag LOCUS_36330 130731 132200 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_36330 132540 132085 gene locus_tag LOCUS_36340 132540 132085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 133303 132608 gene locus_tag LOCUS_36350 133303 132608 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 protein_id gnl|my_center|LOCUS_36350 134433 133300 gene locus_tag LOCUS_36360 134433 133300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 135224 134430 gene locus_tag LOCUS_36370 135224 134430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 135129 135338 gene locus_tag LOCUS_36380 135129 135338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 136616 135393 gene locus_tag LOCUS_36390 136616 135393 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_36390 137417 136617 gene locus_tag LOCUS_36400 gene kynA 137417 136617 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_36400 139609 137465 gene locus_tag LOCUS_36410 139609 137465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 141415 139637 gene locus_tag LOCUS_36420 141415 139637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 142148 141441 gene locus_tag LOCUS_36430 142148 141441 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_36430 143383 142145 gene locus_tag LOCUS_36440 143383 142145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 144537 143380 gene locus_tag LOCUS_36450 144537 143380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_36450 144971 144534 gene locus_tag LOCUS_36460 144971 144534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 145167 144964 gene locus_tag LOCUS_36470 145167 144964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 146501 145188 gene locus_tag LOCUS_36480 146501 145188 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_36480 146755 146498 gene locus_tag LOCUS_36490 146755 146498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 147282 146770 gene locus_tag LOCUS_36500 147282 146770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 147378 148259 gene locus_tag LOCUS_36510 147378 148259 CDS product alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_36510 150002 148251 gene locus_tag LOCUS_36520 150002 148251 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_36520 150033 151061 gene locus_tag LOCUS_36530 150033 151061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 151110 153278 gene locus_tag LOCUS_36540 151110 153278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 153340 154824 gene locus_tag LOCUS_36550 153340 154824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 154828 155238 gene locus_tag LOCUS_36560 154828 155238 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_36560 155282 156889 gene locus_tag LOCUS_36570 155282 156889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_36570 163618 157016 gene locus_tag LOCUS_36580 163618 157016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 163787 166885 gene locus_tag LOCUS_36590 163787 166885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 171090 166870 gene locus_tag LOCUS_36600 171090 166870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 171690 171103 gene locus_tag LOCUS_36610 171690 171103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 171810 172721 gene locus_tag LOCUS_36620 gene dhmA1 171810 172721 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64302 protein_id gnl|my_center|LOCUS_36620 179987 173196 gene locus_tag LOCUS_36630 179987 173196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 199215 180010 gene locus_tag LOCUS_36640 199215 180010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 200557 199742 gene locus_tag LOCUS_36650 200557 199742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 200760 200572 gene locus_tag LOCUS_36660 200760 200572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 203300 200757 gene locus_tag LOCUS_36670 203300 200757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 203848 203510 gene locus_tag LOCUS_36680 203848 203510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 204849 203884 gene locus_tag LOCUS_36690 204849 203884 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT1 protein_id gnl|my_center|LOCUS_36690 205058 206356 gene locus_tag LOCUS_36700 205058 206356 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_36700 206381 207325 gene locus_tag LOCUS_36710 206381 207325 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_36710 207329 207610 gene locus_tag LOCUS_36720 207329 207610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 207612 207896 gene locus_tag LOCUS_36730 207612 207896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 207893 208597 gene locus_tag LOCUS_36740 207893 208597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 208594 209397 gene locus_tag LOCUS_36750 gene dapF 208594 209397 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX3 protein_id gnl|my_center|LOCUS_36750 209556 209332 gene locus_tag LOCUS_36760 209556 209332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 210532 209759 gene locus_tag LOCUS_36770 gene rfbF 210532 209759 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707823.1 protein_id gnl|my_center|LOCUS_36770 211432 210584 gene locus_tag LOCUS_36780 211432 210584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 211503 211859 gene locus_tag LOCUS_36790 211503 211859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 212129 215680 gene locus_tag LOCUS_36800 212129 215680 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223591.1 protein_id gnl|my_center|LOCUS_36800 217684 215867 gene locus_tag LOCUS_36810 217684 215867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 219942 217696 gene locus_tag LOCUS_36820 219942 217696 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX9 protein_id gnl|my_center|LOCUS_36820 221738 219999 gene locus_tag LOCUS_36830 221738 219999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404891.1 protein_id gnl|my_center|LOCUS_36830 222411 221731 gene locus_tag LOCUS_36840 gene trmB 222411 221731 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN01 protein_id gnl|my_center|LOCUS_36840 223448 222408 gene locus_tag LOCUS_36850 gene manC 223448 222408 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_36850 223826 223475 gene locus_tag LOCUS_tm00010 223826 223475 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 224630 223944 gene locus_tag LOCUS_36860 gene pyrE 224630 223944 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 protein_id gnl|my_center|LOCUS_36860 224775 225686 gene locus_tag LOCUS_36870 224775 225686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 225690 227024 gene locus_tag LOCUS_36880 225690 227024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 228314 227127 gene locus_tag LOCUS_36890 228314 227127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 229096 228329 gene locus_tag LOCUS_36900 229096 228329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_36900 229200 229682 gene locus_tag LOCUS_36910 229200 229682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 230189 232000 gene locus_tag LOCUS_36920 230189 232000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 232203 232982 gene locus_tag LOCUS_36930 232203 232982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 233454 233029 gene locus_tag LOCUS_36940 233454 233029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence17 2317 680 gene locus_tag LOCUS_36950 gene gpmI 2317 680 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG7 protein_id gnl|my_center|LOCUS_36950 4008 2317 gene locus_tag LOCUS_36960 gene pgi 4008 2317 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1U7 protein_id gnl|my_center|LOCUS_36960 5154 4042 gene locus_tag LOCUS_36970 5154 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 5153 6433 gene locus_tag LOCUS_36980 5153 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 7760 6579 gene locus_tag LOCUS_36990 7760 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 7966 8373 gene locus_tag LOCUS_37000 7966 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 9868 8309 gene locus_tag LOCUS_37010 9868 8309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887969.1 protein_id gnl|my_center|LOCUS_37010 9782 10561 gene locus_tag LOCUS_37020 gene crt 9782 10561 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_37020 10577 12274 gene locus_tag LOCUS_37030 10577 12274 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945404.1 protein_id gnl|my_center|LOCUS_37030 12274 14280 gene locus_tag LOCUS_37040 12274 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 14313 15365 gene locus_tag LOCUS_37050 14313 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 17323 15362 gene locus_tag LOCUS_37060 17323 15362 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_37060 18748 17336 gene locus_tag LOCUS_37070 18748 17336 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228219.1 protein_id gnl|my_center|LOCUS_37070 20438 18768 gene locus_tag LOCUS_37080 20438 18768 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_37080 20700 20428 gene locus_tag LOCUS_37090 20700 20428 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_37090 20811 22745 gene locus_tag LOCUS_37100 gene acsA 20811 22745 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WV5 protein_id gnl|my_center|LOCUS_37100 22742 23752 gene locus_tag LOCUS_37110 22742 23752 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889606.1 protein_id gnl|my_center|LOCUS_37110 25758 23986 gene locus_tag LOCUS_37120 25758 23986 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_37120 26072 28996 gene locus_tag LOCUS_37130 26072 28996 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_37130 29717 29076 gene locus_tag LOCUS_37140 29717 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 30393 29707 gene locus_tag LOCUS_37150 30393 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 30992 30390 gene locus_tag LOCUS_37160 30992 30390 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_37160 31121 32944 gene locus_tag LOCUS_37170 31121 32944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 33792 32974 gene locus_tag LOCUS_37180 33792 32974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 35294 33789 gene locus_tag LOCUS_37190 35294 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 38022 35410 gene locus_tag LOCUS_37200 gene bfeA 38022 35410 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_37200 41835 38434 gene locus_tag LOCUS_37210 41835 38434 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_37210 41963 45070 gene locus_tag LOCUS_37220 41963 45070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 45094 47451 gene locus_tag LOCUS_37230 45094 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 47489 48028 gene locus_tag LOCUS_37240 47489 48028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 50051 48411 gene locus_tag LOCUS_37250 50051 48411 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_37250 50159 52420 gene locus_tag LOCUS_37260 50159 52420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 53424 52447 gene locus_tag LOCUS_37270 53424 52447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 53752 55794 gene locus_tag LOCUS_37280 53752 55794 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_37280 55791 56564 gene locus_tag LOCUS_37290 gene paaG 55791 56564 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_37290 56569 58347 gene locus_tag LOCUS_37300 56569 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_37300 59195 58368 gene locus_tag LOCUS_37310 59195 58368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 60715 59333 gene locus_tag LOCUS_37320 gene pilR 60715 59333 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_37320 63614 60813 gene locus_tag LOCUS_37330 63614 60813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37330 65789 63813 gene locus_tag LOCUS_37340 65789 63813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 66848 66030 gene locus_tag LOCUS_37350 66848 66030 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_37350 66936 67469 gene locus_tag LOCUS_37360 66936 67469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 67552 67627 gene locus_tag LOCUS_t00450 67552 67627 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67752 68891 gene locus_tag LOCUS_37370 67752 68891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 68894 69094 gene locus_tag LOCUS_37380 68894 69094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 69153 69638 gene locus_tag LOCUS_37390 69153 69638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 73005 69724 gene locus_tag LOCUS_37400 73005 69724 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_37400 74114 73014 gene locus_tag LOCUS_37410 74114 73014 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_37410 76939 74111 gene locus_tag LOCUS_37420 76939 74111 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(75845..75847),aa:Sec) note codon on position 365 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_37420 77070 77636 gene locus_tag LOCUS_37430 77070 77636 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_37430 77629 80160 gene locus_tag LOCUS_37440 77629 80160 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_37440 80138 81121 gene locus_tag LOCUS_37450 80138 81121 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010218671.1 protein_id gnl|my_center|LOCUS_37450 81995 81582 gene locus_tag LOCUS_37460 81995 81582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 82435 82061 gene locus_tag LOCUS_37470 82435 82061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 82471 83529 gene locus_tag LOCUS_37480 82471 83529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 83870 84478 gene locus_tag LOCUS_37490 83870 84478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 84503 87388 gene locus_tag LOCUS_37500 84503 87388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 87392 90445 gene locus_tag LOCUS_37510 87392 90445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 90578 90811 gene locus_tag LOCUS_37520 90578 90811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 91380 92720 gene locus_tag LOCUS_37530 91380 92720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 93109 92774 gene locus_tag LOCUS_37540 93109 92774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 96362 93132 gene locus_tag LOCUS_37550 96362 93132 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT8 protein_id gnl|my_center|LOCUS_37550 96588 97616 gene locus_tag LOCUS_37560 96588 97616 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_37560 97620 98807 gene locus_tag LOCUS_37570 gene kbl 97620 98807 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J0 protein_id gnl|my_center|LOCUS_37570 99238 98954 gene locus_tag LOCUS_37580 99238 98954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 99427 101397 gene locus_tag LOCUS_37590 gene htpG 99427 101397 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ7 protein_id gnl|my_center|LOCUS_37590 102648 101407 gene locus_tag LOCUS_37600 102648 101407 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_37600 103970 102648 gene locus_tag LOCUS_37610 103970 102648 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090216.1 protein_id gnl|my_center|LOCUS_37610 104739 103909 gene locus_tag LOCUS_37620 gene cpdA 104739 103909 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_37620 105037 104753 gene locus_tag LOCUS_37630 105037 104753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 105589 105176 gene locus_tag LOCUS_37640 105589 105176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 105698 107050 gene locus_tag LOCUS_37650 105698 107050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_37650 107113 107188 gene locus_tag LOCUS_t00460 107113 107188 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 109510 107237 gene locus_tag LOCUS_37660 109510 107237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 109836 110537 gene locus_tag LOCUS_37670 gene aat 109836 110537 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM5 protein_id gnl|my_center|LOCUS_37670 110551 111912 gene locus_tag LOCUS_37680 110551 111912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 112057 112539 gene locus_tag LOCUS_37690 112057 112539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 112769 114121 gene locus_tag LOCUS_37700 gene rimO 112769 114121 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_37700 114150 115133 gene locus_tag LOCUS_37710 gene ribF 114150 115133 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG7 protein_id gnl|my_center|LOCUS_37710 115180 115554 gene locus_tag LOCUS_37720 115180 115554 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW4 protein_id gnl|my_center|LOCUS_37720 115573 116805 gene locus_tag LOCUS_37730 115573 116805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 117029 119182 gene locus_tag LOCUS_37740 117029 119182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 119993 119325 gene locus_tag LOCUS_37750 119993 119325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 120565 122709 gene locus_tag LOCUS_37760 120565 122709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 122896 125166 gene locus_tag LOCUS_37770 122896 125166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 126669 125275 gene locus_tag LOCUS_37780 126669 125275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 127811 126927 gene locus_tag LOCUS_37790 127811 126927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 128959 127922 gene locus_tag LOCUS_37800 gene ilvC 128959 127922 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC26 protein_id gnl|my_center|LOCUS_37800 129580 129005 gene locus_tag LOCUS_37810 gene ilvH 129580 129005 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_37810 131359 129590 gene locus_tag LOCUS_37820 gene ilvB 131359 129590 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C8 protein_id gnl|my_center|LOCUS_37820 132300 131350 gene locus_tag LOCUS_37830 132300 131350 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_37830 133984 132320 gene locus_tag LOCUS_37840 gene ilvD 133984 132320 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HKA0 protein_id gnl|my_center|LOCUS_37840 135520 134294 gene locus_tag LOCUS_37850 135520 134294 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_37850 137181 135517 gene locus_tag LOCUS_37860 137181 135517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 137773 137171 gene locus_tag LOCUS_37870 137773 137171 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_37870 139097 137778 gene locus_tag LOCUS_37880 139097 137778 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 protein_id gnl|my_center|LOCUS_37880 141527 139170 gene locus_tag LOCUS_37890 141527 139170 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_37890 142167 142565 gene locus_tag LOCUS_37900 142167 142565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 142640 144025 gene locus_tag LOCUS_37910 142640 144025 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_37910 144015 145604 gene locus_tag LOCUS_37920 144015 145604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 145616 148756 gene locus_tag LOCUS_37930 145616 148756 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_37930 148798 149244 gene locus_tag LOCUS_37940 148798 149244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 149331 150434 gene locus_tag LOCUS_37950 149331 150434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 150496 151746 gene locus_tag LOCUS_37960 150496 151746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_37960 151764 152663 gene locus_tag LOCUS_37970 151764 152663 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_37970 152723 153145 gene locus_tag LOCUS_37980 152723 153145 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_37980 153142 155481 gene locus_tag LOCUS_37990 153142 155481 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_37990 159082 155939 gene locus_tag LOCUS_38000 gene czcA 159082 155939 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_38000 160328 159093 gene locus_tag LOCUS_38010 160328 159093 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_38010 161620 160325 gene locus_tag LOCUS_38020 161620 160325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142450.1 protein_id gnl|my_center|LOCUS_38020 161988 162209 gene locus_tag LOCUS_38030 161988 162209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 162339 162608 gene locus_tag LOCUS_38040 162339 162608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 162818 163090 gene locus_tag LOCUS_38050 162818 163090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 163244 165898 gene locus_tag LOCUS_38060 163244 165898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 166036 165899 gene locus_tag LOCUS_38070 166036 165899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 166115 166681 gene locus_tag LOCUS_38080 166115 166681 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_38080 166798 167655 gene locus_tag LOCUS_38090 166798 167655 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_38090 167898 167695 gene locus_tag LOCUS_38100 167898 167695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 168284 167895 gene locus_tag LOCUS_38110 gene hvrA 168284 167895 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_38110 168694 168281 gene locus_tag LOCUS_38120 168694 168281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 169606 168764 gene locus_tag LOCUS_38130 169606 168764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 171092 169629 gene locus_tag LOCUS_38140 171092 169629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 171628 171089 gene locus_tag LOCUS_38150 171628 171089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 173004 171634 gene locus_tag LOCUS_38160 173004 171634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 173530 174327 gene locus_tag LOCUS_38170 173530 174327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 174608 174336 gene locus_tag LOCUS_38180 174608 174336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 174813 175478 gene locus_tag LOCUS_38190 174813 175478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 176788 175592 gene locus_tag LOCUS_38200 176788 175592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 177364 176795 gene locus_tag LOCUS_38210 177364 176795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 178508 177537 gene locus_tag LOCUS_38220 178508 177537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 178719 178522 gene locus_tag LOCUS_38230 178719 178522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 180255 180118 gene locus_tag LOCUS_38240 180255 180118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 181154 180882 gene locus_tag LOCUS_38250 181154 180882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 181625 181858 gene locus_tag LOCUS_38260 181625 181858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 182136 181876 gene locus_tag LOCUS_38270 182136 181876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 182892 182218 gene locus_tag LOCUS_38280 gene ycdA 182892 182218 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2USM6 protein_id gnl|my_center|LOCUS_38280 183162 182896 gene locus_tag LOCUS_38290 183162 182896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 183351 183181 gene locus_tag LOCUS_38300 183351 183181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 183760 183416 gene locus_tag LOCUS_38310 183760 183416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 184112 184459 gene locus_tag LOCUS_38320 184112 184459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 184887 185228 gene locus_tag LOCUS_38330 184887 185228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 185216 186433 gene locus_tag LOCUS_38340 185216 186433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 186805 189723 gene locus_tag LOCUS_38350 186805 189723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 189701 190129 gene locus_tag LOCUS_38360 189701 190129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 190181 190468 gene locus_tag LOCUS_38370 190181 190468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 190471 190917 gene locus_tag LOCUS_38380 190471 190917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 190947 198464 gene locus_tag LOCUS_38390 190947 198464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 198520 199467 gene locus_tag LOCUS_38400 198520 199467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 199877 202171 gene locus_tag LOCUS_38410 199877 202171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 203247 203579 gene locus_tag LOCUS_38420 203247 203579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 203576 204103 gene locus_tag LOCUS_38430 203576 204103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 204362 205126 gene locus_tag LOCUS_38440 204362 205126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 205107 205373 gene locus_tag LOCUS_38450 205107 205373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 205442 205876 gene locus_tag LOCUS_38460 205442 205876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 206121 206444 gene locus_tag LOCUS_38470 206121 206444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 206437 207972 gene locus_tag LOCUS_38480 206437 207972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 209395 208142 gene locus_tag LOCUS_38490 209395 208142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 209867 211126 gene locus_tag LOCUS_38500 209867 211126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 212721 211165 gene locus_tag LOCUS_38510 212721 211165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 213123 212755 gene locus_tag LOCUS_38520 213123 212755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 213729 213196 gene locus_tag LOCUS_38530 213729 213196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 217370 214905 gene locus_tag LOCUS_38540 217370 214905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 217951 217688 gene locus_tag LOCUS_38550 217951 217688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 <223463 218028 gene locus_tag LOCUS_38560 <223463 218028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861367.1:helicase >Feature sequence18 2198 2485 gene locus_tag LOCUS_38570 2198 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 2561 4888 gene locus_tag LOCUS_38580 2561 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 4902 5480 gene locus_tag LOCUS_38590 4902 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 7676 5559 gene locus_tag LOCUS_38600 7676 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 8158 8529 gene locus_tag LOCUS_38610 8158 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 8522 8962 gene locus_tag LOCUS_38620 8522 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 8955 10520 gene locus_tag LOCUS_38630 8955 10520 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_38630 11150 12157 gene locus_tag LOCUS_38640 11150 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 12524 12159 gene locus_tag LOCUS_38650 12524 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 12778 12539 gene locus_tag LOCUS_38660 12778 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 13461 12817 gene locus_tag LOCUS_38670 13461 12817 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_38670 15353 13515 gene locus_tag LOCUS_38680 15353 13515 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_38680 16110 15370 gene locus_tag LOCUS_38690 16110 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 18034 16151 gene locus_tag LOCUS_38700 18034 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 19370 18042 gene locus_tag LOCUS_38710 19370 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 20171 19425 gene locus_tag LOCUS_38720 20171 19425 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY4 protein_id gnl|my_center|LOCUS_38720 21586 20168 gene locus_tag LOCUS_38730 21586 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_38730 21665 22285 gene locus_tag LOCUS_38740 21665 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 23903 22290 gene locus_tag LOCUS_38750 23903 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 24185 25534 gene locus_tag LOCUS_38760 24185 25534 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_38760 25573 26775 gene locus_tag LOCUS_38770 gene pfk-2 25573 26775 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_38770 27535 26987 gene locus_tag LOCUS_38780 27535 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 28174 29745 gene locus_tag LOCUS_38790 28174 29745 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 protein_id gnl|my_center|LOCUS_38790 29738 30835 gene locus_tag LOCUS_38800 29738 30835 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390240.1 protein_id gnl|my_center|LOCUS_38800 31586 31164 gene locus_tag LOCUS_38810 31586 31164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 31809 31552 gene locus_tag LOCUS_38820 31809 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 32181 35504 gene locus_tag LOCUS_38830 32181 35504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 35964 35587 gene locus_tag LOCUS_38840 35964 35587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 36254 38314 gene locus_tag LOCUS_38850 gene nicT 36254 38314 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_38850 39143 38394 gene locus_tag LOCUS_38860 39143 38394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 39259 40299 gene locus_tag LOCUS_38870 39259 40299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 40962 42245 gene locus_tag LOCUS_38880 40962 42245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 42344 44299 gene locus_tag LOCUS_38890 42344 44299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 44420 44722 gene locus_tag LOCUS_38900 44420 44722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 44955 47363 gene locus_tag LOCUS_38910 44955 47363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_38910 47455 48114 gene locus_tag LOCUS_38920 47455 48114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 48198 48674 gene locus_tag LOCUS_38930 48198 48674 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_38930 48671 51040 gene locus_tag LOCUS_38940 48671 51040 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_38940 51040 51897 gene locus_tag LOCUS_38950 51040 51897 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_38950 52636 54138 gene locus_tag LOCUS_38960 52636 54138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 54651 54896 gene locus_tag LOCUS_38970 54651 54896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 55314 55129 gene locus_tag LOCUS_38980 55314 55129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 56860 55652 gene locus_tag LOCUS_38990 56860 55652 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227900.1 protein_id gnl|my_center|LOCUS_38990 60424 57152 gene locus_tag LOCUS_39000 60424 57152 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_39000 60530 61246 gene locus_tag LOCUS_39010 60530 61246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 61595 61263 gene locus_tag LOCUS_39020 61595 61263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 61719 62360 gene locus_tag LOCUS_39030 61719 62360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 62472 62849 gene locus_tag LOCUS_39040 62472 62849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 62846 63379 gene locus_tag LOCUS_39050 62846 63379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 63429 64589 gene locus_tag LOCUS_39060 gene ycbU 63429 64589 CDS product putative aminotransferase YcbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42253 protein_id gnl|my_center|LOCUS_39060 64855 64586 gene locus_tag LOCUS_39070 64855 64586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 66002 65022 gene locus_tag LOCUS_39080 66002 65022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 66692 66222 gene locus_tag LOCUS_39090 66692 66222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 67415 66714 gene locus_tag LOCUS_39100 67415 66714 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_39100 68361 67393 gene locus_tag LOCUS_39110 68361 67393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 68530 69942 gene locus_tag LOCUS_39120 68530 69942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_39120 69954 72107 gene locus_tag LOCUS_39130 69954 72107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 72121 72816 gene locus_tag LOCUS_39140 72121 72816 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_39140 73811 72813 gene locus_tag LOCUS_39150 73811 72813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 75830 74463 gene locus_tag LOCUS_39160 75830 74463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 75938 76867 gene locus_tag LOCUS_39170 75938 76867 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_39170 76864 77406 gene locus_tag LOCUS_39180 76864 77406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 79317 77398 gene locus_tag LOCUS_39190 79317 77398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 80442 79336 gene locus_tag LOCUS_39200 80442 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 80542 81729 gene locus_tag LOCUS_39210 80542 81729 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861197.1 protein_id gnl|my_center|LOCUS_39210 81742 82971 gene locus_tag LOCUS_39220 81742 82971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_39220 82999 83484 gene locus_tag LOCUS_39230 82999 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 83481 84434 gene locus_tag LOCUS_39240 83481 84434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 84466 85314 gene locus_tag LOCUS_39250 84466 85314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 85395 85928 gene locus_tag LOCUS_39260 85395 85928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 85889 86266 gene locus_tag LOCUS_39270 85889 86266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 86263 87825 gene locus_tag LOCUS_39280 86263 87825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 90509 87909 gene locus_tag LOCUS_39290 90509 87909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 90632 92044 gene locus_tag LOCUS_39300 90632 92044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 92041 93252 gene locus_tag LOCUS_39310 92041 93252 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_39310 93371 95017 gene locus_tag LOCUS_39320 93371 95017 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_39320 97409 94995 gene locus_tag LOCUS_39330 97409 94995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 97833 98012 gene locus_tag LOCUS_39340 97833 98012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 100088 98091 gene locus_tag LOCUS_39350 gene yuxL 100088 98091 CDS product putative peptidase YuxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39839 protein_id gnl|my_center|LOCUS_39350 101244 100144 gene locus_tag LOCUS_39360 101244 100144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_39360 103595 101274 gene locus_tag LOCUS_39370 103595 101274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_39370 105859 103613 gene locus_tag LOCUS_39380 105859 103613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 106414 106097 gene locus_tag LOCUS_39390 106414 106097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 108076 107069 gene locus_tag LOCUS_39400 108076 107069 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_39400 108288 110354 gene locus_tag LOCUS_39410 108288 110354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 111520 110360 gene locus_tag LOCUS_39420 111520 110360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 113009 111672 gene locus_tag LOCUS_39430 113009 111672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 113568 113041 gene locus_tag LOCUS_39440 113568 113041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 114656 113631 gene locus_tag LOCUS_39450 114656 113631 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729460.1 protein_id gnl|my_center|LOCUS_39450 118460 114663 gene locus_tag LOCUS_39460 118460 114663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_39460 120570 118441 gene locus_tag LOCUS_39470 120570 118441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_39470 120672 122063 gene locus_tag LOCUS_39480 120672 122063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225428.1 protein_id gnl|my_center|LOCUS_39480 122078 122323 gene locus_tag LOCUS_39490 122078 122323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39490 122432 122650 gene locus_tag LOCUS_39500 122432 122650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 124344 122620 gene locus_tag LOCUS_39510 124344 122620 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_39510 128772 124468 gene locus_tag LOCUS_39520 128772 124468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 130938 128800 gene locus_tag LOCUS_39530 130938 128800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 131009 132391 gene locus_tag LOCUS_39540 gene atoC 131009 132391 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_39540 132755 132396 gene locus_tag LOCUS_39550 132755 132396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 132639 137708 gene locus_tag LOCUS_39560 132639 137708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 138947 137784 gene locus_tag LOCUS_39570 138947 137784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 141338 138996 gene locus_tag LOCUS_39580 141338 138996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 145676 142338 gene locus_tag LOCUS_39590 145676 142338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 145830 146093 gene locus_tag LOCUS_39600 145830 146093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 147439 146081 gene locus_tag LOCUS_39610 147439 146081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 148902 147520 gene locus_tag LOCUS_39620 148902 147520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 151307 148941 gene locus_tag LOCUS_39630 151307 148941 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_39630 152427 151456 gene locus_tag LOCUS_39640 152427 151456 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_39640 152553 153338 gene locus_tag LOCUS_39650 152553 153338 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_39650 154532 153378 gene locus_tag LOCUS_39660 154532 153378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 154596 155465 gene locus_tag LOCUS_39670 154596 155465 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_39670 156350 155484 gene locus_tag LOCUS_39680 156350 155484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227664.1 protein_id gnl|my_center|LOCUS_39680 157274 156378 gene locus_tag LOCUS_39690 157274 156378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 158388 157354 gene locus_tag LOCUS_39700 158388 157354 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_39700 158583 160031 gene locus_tag LOCUS_39710 158583 160031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 160228 160539 gene locus_tag LOCUS_39720 160228 160539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 160583 160861 gene locus_tag LOCUS_39730 160583 160861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 160871 162166 gene locus_tag LOCUS_39740 gene ftsA 160871 162166 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_39740 162962 162144 gene locus_tag LOCUS_39750 162962 162144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056121.1 protein_id gnl|my_center|LOCUS_39750 163492 162959 gene locus_tag LOCUS_39760 163492 162959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 163596 165449 gene locus_tag LOCUS_39770 163596 165449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 165458 166072 gene locus_tag LOCUS_39780 165458 166072 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_39780 166081 167106 gene locus_tag LOCUS_39790 166081 167106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 167121 167717 gene locus_tag LOCUS_39800 167121 167717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 167725 169860 gene locus_tag LOCUS_39810 167725 169860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 169887 170315 gene locus_tag LOCUS_39820 169887 170315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 170325 170777 gene locus_tag LOCUS_39830 170325 170777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39830 171381 170788 gene locus_tag LOCUS_39840 171381 170788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 173444 172452 gene locus_tag LOCUS_39850 173444 172452 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_39850 173667 173975 gene locus_tag LOCUS_39860 173667 173975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 173972 175372 gene locus_tag LOCUS_39870 173972 175372 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404692.1 protein_id gnl|my_center|LOCUS_39870 176214 175345 gene locus_tag LOCUS_39880 176214 175345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 176260 177081 gene locus_tag LOCUS_39890 176260 177081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 177101 177604 gene locus_tag LOCUS_39900 177101 177604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 177601 178911 gene locus_tag LOCUS_39910 177601 178911 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_39910 180161 178890 gene locus_tag LOCUS_39920 180161 178890 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_39920 181546 180221 gene locus_tag LOCUS_39930 181546 180221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 182556 181543 gene locus_tag LOCUS_39940 182556 181543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 183436 182660 gene locus_tag LOCUS_39950 183436 182660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141009.1 protein_id gnl|my_center|LOCUS_39950 184805 183429 gene locus_tag LOCUS_39960 184805 183429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 184950 185924 gene locus_tag LOCUS_39970 gene trxB 184950 185924 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_39970 186022 187527 gene locus_tag LOCUS_39980 186022 187527 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_39980 187533 188624 gene locus_tag LOCUS_39990 187533 188624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_39990 188628 190445 gene locus_tag LOCUS_40000 188628 190445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_40000 190527 190754 gene locus_tag LOCUS_40010 190527 190754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 190751 191053 gene locus_tag LOCUS_40020 190751 191053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 193704 192769 gene locus_tag LOCUS_40030 193704 192769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 194246 194082 gene locus_tag LOCUS_40040 194246 194082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 194447 194989 gene locus_tag LOCUS_40050 194447 194989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 194982 195227 gene locus_tag LOCUS_40060 194982 195227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 197562 195238 gene locus_tag LOCUS_40070 197562 195238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 202249 197594 gene locus_tag LOCUS_40080 202249 197594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 203526 202264 gene locus_tag LOCUS_40090 203526 202264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 203854 203555 gene locus_tag LOCUS_40100 203854 203555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 204757 204299 gene locus_tag LOCUS_40110 204757 204299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 207445 204758 gene locus_tag LOCUS_40120 207445 204758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 209030 207432 gene locus_tag LOCUS_40130 209030 207432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 210496 209576 gene locus_tag LOCUS_40140 210496 209576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 211386 210514 gene locus_tag LOCUS_40150 211386 210514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 211696 211439 gene locus_tag LOCUS_40160 211696 211439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 211965 211792 gene locus_tag LOCUS_40170 211965 211792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 212680 212114 gene locus_tag LOCUS_40180 212680 212114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 214161 212770 gene locus_tag LOCUS_40190 214161 212770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 215157 217400 gene locus_tag LOCUS_40200 215157 217400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 218198 217425 gene locus_tag LOCUS_40210 218198 217425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 219270 218287 gene locus_tag LOCUS_40220 219270 218287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121746.1 protein_id gnl|my_center|LOCUS_40220 219254 219427 gene locus_tag LOCUS_40230 219254 219427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 220461 219694 gene locus_tag LOCUS_40240 gene ybgI 220461 219694 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_40240 221617 220454 gene locus_tag LOCUS_40250 221617 220454 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870462.1 protein_id gnl|my_center|LOCUS_40250 >Feature sequence19 1758 2645 gene locus_tag LOCUS_40260 1758 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3425 2661 gene locus_tag LOCUS_40270 3425 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 3488 3561 gene locus_tag LOCUS_t00470 3488 3561 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4075 3635 gene locus_tag LOCUS_40280 gene fur2 4075 3635 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289542.1 protein_id gnl|my_center|LOCUS_40280 4247 5590 gene locus_tag LOCUS_40290 4247 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5587 6213 gene locus_tag LOCUS_40300 5587 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 6220 7485 gene locus_tag LOCUS_40310 6220 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 7482 8897 gene locus_tag LOCUS_40320 7482 8897 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_40320 8894 10780 gene locus_tag LOCUS_40330 8894 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 11470 10781 gene locus_tag LOCUS_40340 11470 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 11647 14220 gene locus_tag LOCUS_40350 11647 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 15012 14236 gene locus_tag LOCUS_40360 15012 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 15164 15403 gene locus_tag LOCUS_40370 15164 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 15508 15822 gene locus_tag LOCUS_40380 15508 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 15834 16787 gene locus_tag LOCUS_40390 15834 16787 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_40390 16802 17704 gene locus_tag LOCUS_40400 16802 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 17708 18217 gene locus_tag LOCUS_40410 17708 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 18214 19221 gene locus_tag LOCUS_40420 18214 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_40420 19235 21274 gene locus_tag LOCUS_40430 19235 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 21326 22549 gene locus_tag LOCUS_40440 gene add1 21326 22549 CDS product adenosine deaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK25 protein_id gnl|my_center|LOCUS_40440 22652 23512 gene locus_tag LOCUS_40450 22652 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 23534 25453 gene locus_tag LOCUS_40460 23534 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 25450 27237 gene locus_tag LOCUS_40470 25450 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 27234 28415 gene locus_tag LOCUS_40480 27234 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 29403 28876 gene locus_tag LOCUS_40490 29403 28876 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_40490 29324 29563 gene locus_tag LOCUS_40500 29324 29563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 29569 30660 gene locus_tag LOCUS_40510 29569 30660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 31229 30774 gene locus_tag LOCUS_40520 31229 30774 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_40520 31827 31300 gene locus_tag LOCUS_40530 31827 31300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 32437 31832 gene locus_tag LOCUS_40540 32437 31832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 33606 32434 gene locus_tag LOCUS_40550 33606 32434 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_40550 33750 35735 gene locus_tag LOCUS_40560 33750 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 35732 36178 gene locus_tag LOCUS_40570 35732 36178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 36195 39686 gene locus_tag LOCUS_40580 36195 39686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 39696 43247 gene locus_tag LOCUS_40590 39696 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 43249 44904 gene locus_tag LOCUS_40600 43249 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 44980 48492 gene locus_tag LOCUS_40610 44980 48492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 50867 49155 gene locus_tag LOCUS_40620 50867 49155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 50994 52235 gene locus_tag LOCUS_40630 50994 52235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 53021 52257 gene locus_tag LOCUS_40640 53021 52257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_40640 53371 53018 gene locus_tag LOCUS_40650 53371 53018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 55097 53397 gene locus_tag LOCUS_40660 55097 53397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 57988 55100 gene locus_tag LOCUS_40670 gene gcvP 57988 55100 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_40670 58182 58937 gene locus_tag LOCUS_40680 58182 58937 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 protein_id gnl|my_center|LOCUS_40680 58957 60012 gene locus_tag LOCUS_40690 58957 60012 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919033.1 protein_id gnl|my_center|LOCUS_40690 60060 60296 gene locus_tag LOCUS_40700 60060 60296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40700 60293 60664 gene locus_tag LOCUS_40710 60293 60664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40710 60806 61939 gene locus_tag LOCUS_40720 60806 61939 CDS product heme biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_40720 61964 62143 gene locus_tag LOCUS_40730 61964 62143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 62171 62554 gene locus_tag LOCUS_40740 62171 62554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 62568 63551 gene locus_tag LOCUS_40750 62568 63551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 64452 63559 gene locus_tag LOCUS_40760 64452 63559 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_40760 64945 64442 gene locus_tag LOCUS_40770 64945 64442 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_40770 65009 65248 gene locus_tag LOCUS_40780 65009 65248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 65407 66459 gene locus_tag LOCUS_40790 65407 66459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 69259 66965 gene locus_tag LOCUS_40800 69259 66965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 69352 69888 gene locus_tag LOCUS_40810 69352 69888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_40810 71631 69964 gene locus_tag LOCUS_40820 71631 69964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 71870 73579 gene locus_tag LOCUS_40830 71870 73579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 73601 74257 gene locus_tag LOCUS_40840 73601 74257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 74257 75213 gene locus_tag LOCUS_40850 74257 75213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 75195 77612 gene locus_tag LOCUS_40860 75195 77612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 79540 77609 gene locus_tag LOCUS_40870 79540 77609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 80268 79579 gene locus_tag LOCUS_40880 80268 79579 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_40880 81977 80484 gene locus_tag LOCUS_40890 81977 80484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 82966 81983 gene locus_tag LOCUS_40900 82966 81983 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_40900 83884 82982 gene locus_tag LOCUS_40910 83884 82982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 85687 83987 gene locus_tag LOCUS_40920 85687 83987 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_40920 85815 86693 gene locus_tag LOCUS_40930 85815 86693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 88081 87089 gene locus_tag LOCUS_40940 88081 87089 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_40940 88904 88074 gene locus_tag LOCUS_40950 88904 88074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 90664 88925 gene locus_tag LOCUS_40960 90664 88925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 92010 90736 gene locus_tag LOCUS_40970 92010 90736 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895417.1 protein_id gnl|my_center|LOCUS_40970 92125 93276 gene locus_tag LOCUS_40980 gene atuD 92125 93276 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_40980 93375 95474 gene locus_tag LOCUS_40990 93375 95474 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_40990 95695 96960 gene locus_tag LOCUS_41000 95695 96960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 97089 98510 gene locus_tag LOCUS_41010 97089 98510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 98536 99276 gene locus_tag LOCUS_41020 98536 99276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 99476 99285 gene locus_tag LOCUS_41030 99476 99285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 102630 99688 gene locus_tag LOCUS_41040 102630 99688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 104314 102686 gene locus_tag LOCUS_41050 104314 102686 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_41050 105732 104347 gene locus_tag LOCUS_41060 105732 104347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 108676 105887 gene locus_tag LOCUS_41070 108676 105887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 110427 108709 gene locus_tag LOCUS_41080 110427 108709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 110497 111000 gene locus_tag LOCUS_41090 110497 111000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 113527 111479 gene locus_tag LOCUS_41100 113527 111479 CDS product ATP-dependent Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_41100 116180 113511 gene locus_tag LOCUS_41110 116180 113511 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_41110 117430 116180 gene locus_tag LOCUS_41120 gene yhcG 117430 116180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445164.1 protein_id gnl|my_center|LOCUS_41120 117754 117434 gene locus_tag LOCUS_41130 117754 117434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 121245 117754 gene locus_tag LOCUS_41140 121245 117754 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_41140 124842 121255 gene locus_tag LOCUS_41150 124842 121255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_41150 125512 124865 gene locus_tag LOCUS_41160 125512 124865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_41160 126099 125509 gene locus_tag LOCUS_41170 126099 125509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038866.1 protein_id gnl|my_center|LOCUS_41170 126304 126759 gene locus_tag LOCUS_41180 126304 126759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 130757 126657 gene locus_tag LOCUS_41190 130757 126657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 131241 130771 gene locus_tag LOCUS_41200 131241 130771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 131486 132586 gene locus_tag LOCUS_41210 131486 132586 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_41210 132583 133212 gene locus_tag LOCUS_41220 132583 133212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088253.1 protein_id gnl|my_center|LOCUS_41220 133209 133772 gene locus_tag LOCUS_41230 133209 133772 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_41230 133724 136138 gene locus_tag LOCUS_41240 133724 136138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 136384 136974 gene locus_tag LOCUS_41250 136384 136974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 137050 137514 gene locus_tag LOCUS_41260 137050 137514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 138361 137525 gene locus_tag LOCUS_41270 138361 137525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 140475 138358 gene locus_tag LOCUS_41280 140475 138358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 140751 140557 gene locus_tag LOCUS_41290 140751 140557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 141440 140748 gene locus_tag LOCUS_41300 141440 140748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 142484 141861 gene locus_tag LOCUS_41310 142484 141861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 142583 143152 gene locus_tag LOCUS_41320 142583 143152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_41320 144450 143173 gene locus_tag LOCUS_41330 144450 143173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 145781 144495 gene locus_tag LOCUS_41340 145781 144495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 146601 145837 gene locus_tag LOCUS_41350 146601 145837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 146695 147198 gene locus_tag LOCUS_41360 146695 147198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_41360 147253 151419 gene locus_tag LOCUS_41370 147253 151419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 151412 151942 gene locus_tag LOCUS_41380 151412 151942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 152050 153477 gene locus_tag LOCUS_41390 152050 153477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_41390 153494 153757 gene locus_tag LOCUS_41400 153494 153757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 153750 155843 gene locus_tag LOCUS_41410 153750 155843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_41410 155836 158922 gene locus_tag LOCUS_41420 155836 158922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 158915 161656 gene locus_tag LOCUS_41430 158915 161656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 161667 164177 gene locus_tag LOCUS_41440 161667 164177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 164459 164145 gene locus_tag LOCUS_41450 164459 164145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 164879 164487 gene locus_tag LOCUS_41460 164879 164487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 165391 164876 gene locus_tag LOCUS_41470 165391 164876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 166481 165486 gene locus_tag LOCUS_41480 166481 165486 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_41480 166564 168936 gene locus_tag LOCUS_41490 166564 168936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 171214 168923 gene locus_tag LOCUS_41500 171214 168923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 171742 171263 gene locus_tag LOCUS_41510 171742 171263 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029550.1 protein_id gnl|my_center|LOCUS_41510 171741 172160 gene locus_tag LOCUS_41520 171741 172160 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_41520 175273 172265 gene locus_tag LOCUS_41530 175273 172265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 177001 175556 gene locus_tag LOCUS_41540 177001 175556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 177246 177809 gene locus_tag LOCUS_41550 177246 177809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 177839 178561 gene locus_tag LOCUS_41560 177839 178561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 180381 178654 gene locus_tag LOCUS_41570 180381 178654 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_41570 181445 180378 gene locus_tag LOCUS_41580 181445 180378 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_41580 181542 182105 gene locus_tag LOCUS_41590 181542 182105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 182105 183598 gene locus_tag LOCUS_41600 182105 183598 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_41600 183666 184070 gene locus_tag LOCUS_41610 183666 184070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 184058 184393 gene locus_tag LOCUS_41620 184058 184393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 186455 185220 gene locus_tag LOCUS_41630 186455 185220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 186753 189074 gene locus_tag LOCUS_41640 186753 189074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 189094 190104 gene locus_tag LOCUS_41650 189094 190104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 190948 190037 gene locus_tag LOCUS_41660 190948 190037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 191654 190956 gene locus_tag LOCUS_41670 191654 190956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_41670 194747 191757 gene locus_tag LOCUS_41680 194747 191757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 197198 194784 gene locus_tag LOCUS_41690 197198 194784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_41690 197268 197930 gene locus_tag LOCUS_41700 197268 197930 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_41700 198829 197951 gene locus_tag LOCUS_41710 198829 197951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_41710 199694 198852 gene locus_tag LOCUS_41720 199694 198852 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227569.1 protein_id gnl|my_center|LOCUS_41720 200073 199714 gene locus_tag LOCUS_41730 200073 199714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 200238 201797 gene locus_tag LOCUS_41740 200238 201797 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_41740 203090 201801 gene locus_tag LOCUS_41750 203090 201801 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_41750 204524 203112 gene locus_tag LOCUS_41760 204524 203112 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_41760 204903 204556 gene locus_tag LOCUS_41770 204903 204556 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_41770 206172 204916 gene locus_tag LOCUS_41780 206172 204916 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_41780 207002 206556 gene locus_tag LOCUS_41790 207002 206556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 207035 208288 gene locus_tag LOCUS_41800 207035 208288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 212121 208285 gene locus_tag LOCUS_41810 212121 208285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 213137 212238 gene locus_tag LOCUS_41820 213137 212238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 213642 213154 gene locus_tag LOCUS_41830 213642 213154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 214403 214041 gene locus_tag LOCUS_41840 214403 214041 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_41840 216308 214590 gene locus_tag LOCUS_41850 216308 214590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence20 1123 428 gene locus_tag LOCUS_41860 1123 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 1674 1366 gene locus_tag LOCUS_41870 1674 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 6129 1894 gene locus_tag LOCUS_41880 6129 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 6555 7649 gene locus_tag LOCUS_41890 6555 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 9432 7720 gene locus_tag LOCUS_41900 9432 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 10182 9580 gene locus_tag LOCUS_41910 10182 9580 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_41910 10251 12809 gene locus_tag LOCUS_41920 10251 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 12884 14689 gene locus_tag LOCUS_41930 12884 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 14719 15093 gene locus_tag LOCUS_41940 gene cheY 14719 15093 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4H5 protein_id gnl|my_center|LOCUS_41940 15047 15796 gene locus_tag LOCUS_41950 15047 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 15798 16271 gene locus_tag LOCUS_41960 15798 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 16271 17107 gene locus_tag LOCUS_41970 16271 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 19733 17265 gene locus_tag LOCUS_41980 gene leuS 19733 17265 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSF0 protein_id gnl|my_center|LOCUS_41980 21153 19834 gene locus_tag LOCUS_41990 21153 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 21352 23760 gene locus_tag LOCUS_42000 21352 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_42000 23791 24276 gene locus_tag LOCUS_42010 23791 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919027.1 protein_id gnl|my_center|LOCUS_42010 24325 25155 gene locus_tag LOCUS_42020 24325 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 25312 26493 gene locus_tag LOCUS_42030 25312 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 26560 27762 gene locus_tag LOCUS_42040 gene aspC 26560 27762 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706588.1 protein_id gnl|my_center|LOCUS_42040 30347 27768 gene locus_tag LOCUS_42050 30347 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 32461 30332 gene locus_tag LOCUS_42060 32461 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 34252 32465 gene locus_tag LOCUS_42070 34252 32465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 34520 35296 gene locus_tag LOCUS_42080 34520 35296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 36220 35312 gene locus_tag LOCUS_42090 36220 35312 CDS product aspartate/glutamate/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869999.1 protein_id gnl|my_center|LOCUS_42090 37013 36222 gene locus_tag LOCUS_42100 37013 36222 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MF66 protein_id gnl|my_center|LOCUS_42100 37733 37023 gene locus_tag LOCUS_42110 37733 37023 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_42110 38636 37815 gene locus_tag LOCUS_42120 38636 37815 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_42120 41007 38653 gene locus_tag LOCUS_42130 41007 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 42283 41012 gene locus_tag LOCUS_42140 42283 41012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 42884 42312 gene locus_tag LOCUS_42150 42884 42312 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_42150 42965 43525 gene locus_tag LOCUS_42160 42965 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 44006 47503 gene locus_tag LOCUS_42170 44006 47503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 47715 50921 gene locus_tag LOCUS_42180 47715 50921 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCJ8 protein_id gnl|my_center|LOCUS_42180 51135 51545 gene locus_tag LOCUS_42190 51135 51545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 51647 51973 gene locus_tag LOCUS_42200 51647 51973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 53568 51985 gene locus_tag LOCUS_42210 53568 51985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_42210 54071 53625 gene locus_tag LOCUS_42220 gene fur 54071 53625 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_42220 54192 55433 gene locus_tag LOCUS_42230 54192 55433 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_42230 55430 56563 gene locus_tag LOCUS_42240 55430 56563 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_42240 56557 56802 gene locus_tag LOCUS_42250 56557 56802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 57322 56930 gene locus_tag LOCUS_42260 57322 56930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 57862 57356 gene locus_tag LOCUS_42270 57862 57356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 58770 57871 gene locus_tag LOCUS_42280 58770 57871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 59184 59540 gene locus_tag LOCUS_42290 59184 59540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 59524 59937 gene locus_tag LOCUS_42300 59524 59937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 59918 61381 gene locus_tag LOCUS_42310 59918 61381 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_42310 61434 62411 gene locus_tag LOCUS_42320 61434 62411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 62756 62322 gene locus_tag LOCUS_42330 62756 62322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 63882 62776 gene locus_tag LOCUS_42340 63882 62776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 63929 64603 gene locus_tag LOCUS_42350 63929 64603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 66888 64597 gene locus_tag LOCUS_42360 66888 64597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 66975 67277 gene locus_tag LOCUS_42370 66975 67277 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 protein_id gnl|my_center|LOCUS_42370 68125 67274 gene locus_tag LOCUS_42380 68125 67274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 68154 68375 gene locus_tag LOCUS_42390 68154 68375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 68372 68770 gene locus_tag LOCUS_42400 gene vapC 68372 68770 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY5 protein_id gnl|my_center|LOCUS_42400 68781 69773 gene locus_tag LOCUS_42410 gene cdh 68781 69773 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_42410 69839 70861 gene locus_tag LOCUS_42420 gene murB 69839 70861 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUJ2 protein_id gnl|my_center|LOCUS_42420 73335 70885 gene locus_tag LOCUS_42430 73335 70885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_42430 73590 74237 gene locus_tag LOCUS_42440 73590 74237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 76386 74221 gene locus_tag LOCUS_42450 gene deaD-1 76386 74221 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_42450 79627 76409 gene locus_tag LOCUS_42460 79627 76409 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404715.1 protein_id gnl|my_center|LOCUS_42460 80730 79624 gene locus_tag LOCUS_42470 80730 79624 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404714.1 protein_id gnl|my_center|LOCUS_42470 82117 80750 gene locus_tag LOCUS_42480 82117 80750 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880416.1 protein_id gnl|my_center|LOCUS_42480 82598 82170 gene locus_tag LOCUS_42490 82598 82170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 83914 82640 gene locus_tag LOCUS_42500 83914 82640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_42500 84593 84051 gene locus_tag LOCUS_42510 84593 84051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_42510 84927 84613 gene locus_tag LOCUS_42520 84927 84613 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_42520 86229 84955 gene locus_tag LOCUS_42530 86229 84955 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_42530 87818 86406 gene locus_tag LOCUS_42540 87818 86406 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938045.1 protein_id gnl|my_center|LOCUS_42540 89707 88391 gene locus_tag LOCUS_42550 89707 88391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 92358 89710 gene locus_tag LOCUS_42560 92358 89710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 94105 92381 gene locus_tag LOCUS_42570 gene pilB 94105 92381 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_42570 95224 94172 gene locus_tag LOCUS_42580 95224 94172 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_42580 95641 95246 gene locus_tag LOCUS_42590 95641 95246 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143787.1 protein_id gnl|my_center|LOCUS_42590 95856 95638 gene locus_tag LOCUS_42600 95856 95638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 96394 95897 gene locus_tag LOCUS_42610 96394 95897 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_42610 97407 96388 gene locus_tag LOCUS_42620 97407 96388 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_42620 98874 97420 gene locus_tag LOCUS_42630 98874 97420 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_42630 100089 98956 gene locus_tag LOCUS_42640 100089 98956 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_42640 100808 100086 gene locus_tag LOCUS_42650 100808 100086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 100890 103100 gene locus_tag LOCUS_42660 100890 103100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 103104 104204 gene locus_tag LOCUS_42670 103104 104204 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_42670 104201 106075 gene locus_tag LOCUS_42680 104201 106075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 107937 106093 gene locus_tag LOCUS_42690 107937 106093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228696.1 protein_id gnl|my_center|LOCUS_42690 108113 110248 gene locus_tag LOCUS_42700 108113 110248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_42700 110235 114056 gene locus_tag LOCUS_42710 110235 114056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_42710 117060 114184 gene locus_tag LOCUS_42720 117060 114184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 117076 117348 gene locus_tag LOCUS_42730 117076 117348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 120103 119891 gene locus_tag LOCUS_42740 120103 119891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 123685 121340 gene locus_tag LOCUS_42750 123685 121340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 123809 125173 gene locus_tag LOCUS_42760 123809 125173 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_42760 125200 125952 gene locus_tag LOCUS_42770 125200 125952 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_42770 125978 126268 gene locus_tag LOCUS_42780 125978 126268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 126265 126690 gene locus_tag LOCUS_42790 126265 126690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 126741 128651 gene locus_tag LOCUS_42800 gene ggt 126741 128651 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_42800 128696 130210 gene locus_tag LOCUS_42810 128696 130210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 130286 130843 gene locus_tag LOCUS_42820 130286 130843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 131061 131360 gene locus_tag LOCUS_42830 131061 131360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 131364 131543 gene locus_tag LOCUS_42840 131364 131543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 131540 132007 gene locus_tag LOCUS_42850 131540 132007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 134695 132023 gene locus_tag LOCUS_42860 134695 132023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_42860 135045 134692 gene locus_tag LOCUS_42870 135045 134692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 135194 139231 gene locus_tag LOCUS_42880 135194 139231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 139742 139254 gene locus_tag LOCUS_42890 139742 139254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 140310 139804 gene locus_tag LOCUS_42900 140310 139804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 141805 140483 gene locus_tag LOCUS_42910 141805 140483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 141982 144024 gene locus_tag LOCUS_42920 141982 144024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 144203 147004 gene locus_tag LOCUS_42930 144203 147004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 147233 148219 gene locus_tag LOCUS_42940 147233 148219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 148533 148393 gene locus_tag LOCUS_42950 148533 148393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 149249 149046 gene locus_tag LOCUS_42960 149249 149046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 149492 149343 gene locus_tag LOCUS_42970 149492 149343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 149522 151753 gene locus_tag LOCUS_42980 149522 151753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 152063 151788 gene locus_tag LOCUS_42990 152063 151788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 152350 152060 gene locus_tag LOCUS_43000 152350 152060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 153023 152334 gene locus_tag LOCUS_43010 153023 152334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 154362 153310 gene locus_tag LOCUS_43020 154362 153310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 155401 154685 gene locus_tag LOCUS_43030 155401 154685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 157024 155417 gene locus_tag LOCUS_43040 157024 155417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 159485 157194 gene locus_tag LOCUS_43050 gene aceA 159485 157194 CDS product isocitrate lyase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TZA8 protein_id gnl|my_center|LOCUS_43050 161391 159508 gene locus_tag LOCUS_43060 161391 159508 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7J5 protein_id gnl|my_center|LOCUS_43060 161804 163999 gene locus_tag LOCUS_43070 161804 163999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 164276 166495 gene locus_tag LOCUS_43080 164276 166495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 167211 166564 gene locus_tag LOCUS_43090 167211 166564 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_43090 167350 167682 gene locus_tag LOCUS_43100 167350 167682 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_43100 167694 170309 gene locus_tag LOCUS_43110 167694 170309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_43110 171851 170370 gene locus_tag LOCUS_43120 171851 170370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 172150 173961 gene locus_tag LOCUS_43130 gene typA 172150 173961 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403243.1 protein_id gnl|my_center|LOCUS_43130 174011 174301 gene locus_tag LOCUS_43140 174011 174301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 174298 174723 gene locus_tag LOCUS_43150 174298 174723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 174881 177115 gene locus_tag LOCUS_43160 174881 177115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 178488 177415 gene locus_tag LOCUS_43170 178488 177415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 178899 178516 gene locus_tag LOCUS_43180 178899 178516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 179707 180717 gene locus_tag LOCUS_43190 179707 180717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 180699 181283 gene locus_tag LOCUS_43200 180699 181283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 181280 182719 gene locus_tag LOCUS_43210 181280 182719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 182716 183147 gene locus_tag LOCUS_43220 182716 183147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_43220 183144 184301 gene locus_tag LOCUS_43230 183144 184301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 184294 184776 gene locus_tag LOCUS_43240 184294 184776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43240 184834 185025 gene locus_tag LOCUS_43250 184834 185025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 185148 187823 gene locus_tag LOCUS_43260 185148 187823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 188725 187844 gene locus_tag LOCUS_43270 188725 187844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 190357 188783 gene locus_tag LOCUS_43280 190357 188783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 190405 191718 gene locus_tag LOCUS_43290 190405 191718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 191806 192471 gene locus_tag LOCUS_43300 191806 192471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 192468 193502 gene locus_tag LOCUS_43310 192468 193502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 193967 194188 gene locus_tag LOCUS_43320 gene infA1 193967 194188 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_43320 194239 196668 gene locus_tag LOCUS_43330 194239 196668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 198352 196679 gene locus_tag LOCUS_43340 198352 196679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 198444 199337 gene locus_tag LOCUS_43350 198444 199337 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_43350 203975 199320 gene locus_tag LOCUS_43360 203975 199320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 204925 204047 gene locus_tag LOCUS_43370 204925 204047 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_43370 205047 206018 gene locus_tag LOCUS_43380 205047 206018 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_43380 206185 206628 gene locus_tag LOCUS_43390 206185 206628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 206638 207381 gene locus_tag LOCUS_43400 206638 207381 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229587.1 protein_id gnl|my_center|LOCUS_43400 211245 207385 gene locus_tag LOCUS_43410 211245 207385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 211628 213316 gene locus_tag LOCUS_43420 211628 213316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 213355 213546 gene locus_tag LOCUS_43430 213355 213546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence21 1999 248 gene locus_tag LOCUS_43440 1999 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 3189 2167 gene locus_tag LOCUS_43450 3189 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 2934 2839 gene locus_tag LOCUS_t00480 2934 2839 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3819 3229 gene locus_tag LOCUS_43460 3819 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 5101 3812 gene locus_tag LOCUS_43470 5101 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 7529 5295 gene locus_tag LOCUS_43480 7529 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 7818 9998 gene locus_tag LOCUS_43490 7818 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_43490 9959 10972 gene locus_tag LOCUS_43500 9959 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 10969 11979 gene locus_tag LOCUS_43510 10969 11979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_43510 15017 12135 gene locus_tag LOCUS_43520 15017 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_43520 16819 15122 gene locus_tag LOCUS_43530 16819 15122 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_43530 17257 21216 gene locus_tag LOCUS_43540 17257 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 21654 21295 gene locus_tag LOCUS_43550 21654 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 24519 21718 gene locus_tag LOCUS_43560 24519 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 24761 25039 gene locus_tag LOCUS_43570 24761 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 25014 25373 gene locus_tag LOCUS_43580 25014 25373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 26173 25421 gene locus_tag LOCUS_43590 26173 25421 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_43590 27180 26170 gene locus_tag LOCUS_43600 27180 26170 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_43600 27204 27863 gene locus_tag LOCUS_43610 27204 27863 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_43610 27881 28411 gene locus_tag LOCUS_43620 27881 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 28404 28898 gene locus_tag LOCUS_43630 28404 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 28903 29637 gene locus_tag LOCUS_43640 28903 29637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088188.1 protein_id gnl|my_center|LOCUS_43640 29639 30508 gene locus_tag LOCUS_43650 29639 30508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 30521 31099 gene locus_tag LOCUS_43660 30521 31099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_43660 32116 31187 gene locus_tag LOCUS_43670 32116 31187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_43670 32856 32113 gene locus_tag LOCUS_43680 32856 32113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 32958 33944 gene locus_tag LOCUS_43690 32958 33944 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_43690 33969 34511 gene locus_tag LOCUS_43700 gene rfbC 33969 34511 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403366.1 protein_id gnl|my_center|LOCUS_43700 34508 35455 gene locus_tag LOCUS_43710 gene fcl 34508 35455 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NET6 protein_id gnl|my_center|LOCUS_43710 36446 35472 gene locus_tag LOCUS_43720 36446 35472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 37416 36460 gene locus_tag LOCUS_43730 37416 36460 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_43730 38726 37413 gene locus_tag LOCUS_43740 38726 37413 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537513.1 protein_id gnl|my_center|LOCUS_43740 39970 38723 gene locus_tag LOCUS_43750 39970 38723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 40985 39945 gene locus_tag LOCUS_43760 40985 39945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 43503 40975 gene locus_tag LOCUS_43770 43503 40975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 46032 45667 gene locus_tag LOCUS_43780 46032 45667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 46302 46090 gene locus_tag LOCUS_43790 46302 46090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 48352 47006 gene locus_tag LOCUS_43800 48352 47006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 50140 48395 gene locus_tag LOCUS_43810 50140 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 50440 50826 gene locus_tag LOCUS_43820 50440 50826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 51136 51489 gene locus_tag LOCUS_43830 51136 51489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 52309 51491 gene locus_tag LOCUS_43840 52309 51491 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_43840 52431 52355 gene locus_tag LOCUS_t00490 52431 52355 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52623 53471 gene locus_tag LOCUS_43850 52623 53471 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_43850 56870 53481 gene locus_tag LOCUS_43860 56870 53481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 58278 56887 gene locus_tag LOCUS_43870 gene dnaB 58278 56887 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM5 protein_id gnl|my_center|LOCUS_43870 61854 58321 gene locus_tag LOCUS_43880 61854 58321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 61765 61962 gene locus_tag LOCUS_43890 61765 61962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 62021 63811 gene locus_tag LOCUS_43900 62021 63811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 66126 63724 gene locus_tag LOCUS_43910 66126 63724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 68434 66188 gene locus_tag LOCUS_43920 68434 66188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 69017 68439 gene locus_tag LOCUS_43930 69017 68439 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_43930 70627 69014 gene locus_tag LOCUS_43940 70627 69014 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141307.1 protein_id gnl|my_center|LOCUS_43940 71544 70636 gene locus_tag LOCUS_43950 71544 70636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 71665 72909 gene locus_tag LOCUS_43960 71665 72909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 73649 73897 gene locus_tag LOCUS_43970 73649 73897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 73855 74271 gene locus_tag LOCUS_43980 73855 74271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 76466 74373 gene locus_tag LOCUS_43990 76466 74373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 77915 76698 gene locus_tag LOCUS_44000 77915 76698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 79630 77912 gene locus_tag LOCUS_44010 79630 77912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 81513 79627 gene locus_tag LOCUS_44020 81513 79627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 81666 82484 gene locus_tag LOCUS_44030 81666 82484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 82498 83316 gene locus_tag LOCUS_44040 gene thiD 82498 83316 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887913.1 protein_id gnl|my_center|LOCUS_44040 83442 83885 gene locus_tag LOCUS_44050 83442 83885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 85175 83895 gene locus_tag LOCUS_44060 85175 83895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 85413 85979 gene locus_tag LOCUS_44070 85413 85979 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_44070 85976 88333 gene locus_tag LOCUS_44080 85976 88333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 88330 89358 gene locus_tag LOCUS_44090 88330 89358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 89395 90072 gene locus_tag LOCUS_44100 89395 90072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 90072 90698 gene locus_tag LOCUS_44110 90072 90698 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941911.1 protein_id gnl|my_center|LOCUS_44110 90799 92325 gene locus_tag LOCUS_44120 90799 92325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941912.1 protein_id gnl|my_center|LOCUS_44120 92336 93109 gene locus_tag LOCUS_44130 92336 93109 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036853.1 protein_id gnl|my_center|LOCUS_44130 93106 93801 gene locus_tag LOCUS_44140 93106 93801 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027337.1 protein_id gnl|my_center|LOCUS_44140 93768 95294 gene locus_tag LOCUS_44150 93768 95294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 96844 95480 gene locus_tag LOCUS_44160 96844 95480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_44160 96959 98062 gene locus_tag LOCUS_44170 gene idiA 96959 98062 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_44170 98130 99716 gene locus_tag LOCUS_44180 98130 99716 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_44180 99713 100786 gene locus_tag LOCUS_44190 gene fbpA1 99713 100786 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970876.1 protein_id gnl|my_center|LOCUS_44190 103455 101413 gene locus_tag LOCUS_44200 103455 101413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 104117 103710 gene locus_tag LOCUS_44210 104117 103710 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_44210 104683 104174 gene locus_tag LOCUS_44220 gene mobB 104683 104174 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971808.1 protein_id gnl|my_center|LOCUS_44220 104781 106076 gene locus_tag LOCUS_44230 104781 106076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 106107 107144 gene locus_tag LOCUS_44240 106107 107144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 107160 108533 gene locus_tag LOCUS_44250 107160 108533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 110399 108672 gene locus_tag LOCUS_44260 110399 108672 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_44260 111106 110396 gene locus_tag LOCUS_44270 111106 110396 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_44270 112569 111103 gene locus_tag LOCUS_44280 112569 111103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 113881 112577 gene locus_tag LOCUS_44290 113881 112577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 114153 115508 gene locus_tag LOCUS_44300 114153 115508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 115527 116537 gene locus_tag LOCUS_44310 115527 116537 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809293.1 protein_id gnl|my_center|LOCUS_44310 116541 117599 gene locus_tag LOCUS_44320 gene ldh 116541 117599 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A392 protein_id gnl|my_center|LOCUS_44320 117627 119375 gene locus_tag LOCUS_44330 117627 119375 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_44330 119372 120565 gene locus_tag LOCUS_44340 119372 120565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 122404 121487 gene locus_tag LOCUS_44350 122404 121487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 124780 122486 gene locus_tag LOCUS_44360 124780 122486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 125882 124848 gene locus_tag LOCUS_44370 125882 124848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 127011 125872 gene locus_tag LOCUS_44380 127011 125872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 128959 127904 gene locus_tag LOCUS_44390 128959 127904 CDS product dinitrogenase reductase activating glycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_44390 130491 129094 gene locus_tag LOCUS_44400 130491 129094 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918393.1 protein_id gnl|my_center|LOCUS_44400 130992 131297 gene locus_tag LOCUS_44410 130992 131297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 131299 132534 gene locus_tag LOCUS_44420 131299 132534 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_44420 133380 132613 gene locus_tag LOCUS_44430 133380 132613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 134903 133962 gene locus_tag LOCUS_44440 134903 133962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 135168 136142 gene locus_tag LOCUS_44450 135168 136142 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_44450 136286 137686 gene locus_tag LOCUS_44460 136286 137686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 139065 137770 gene locus_tag LOCUS_44470 139065 137770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_44470 139172 140425 gene locus_tag LOCUS_44480 gene pepT 139172 140425 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_44480 141193 140429 gene locus_tag LOCUS_44490 141193 140429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 142542 141190 gene locus_tag LOCUS_44500 142542 141190 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_44500 143295 142576 gene locus_tag LOCUS_44510 143295 142576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 144609 143299 gene locus_tag LOCUS_44520 144609 143299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 148522 144632 gene locus_tag LOCUS_44530 148522 144632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 149288 148563 gene locus_tag LOCUS_44540 gene menH 149288 148563 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_44540 149283 149744 gene locus_tag LOCUS_44550 149283 149744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 149803 151200 gene locus_tag LOCUS_44560 149803 151200 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_44560 151206 151421 gene locus_tag LOCUS_44570 151206 151421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 151430 152146 gene locus_tag LOCUS_44580 151430 152146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 152181 154604 gene locus_tag LOCUS_44590 gene thrA 152181 154604 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_44590 154613 155746 gene locus_tag LOCUS_44600 154613 155746 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_44600 157498 155849 gene locus_tag LOCUS_44610 157498 155849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 158779 158204 gene locus_tag LOCUS_44620 158779 158204 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_44620 161481 158776 gene locus_tag LOCUS_44630 161481 158776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 161749 162549 gene locus_tag LOCUS_44640 161749 162549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 163309 162563 gene locus_tag LOCUS_44650 163309 162563 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_44650 164253 163306 gene locus_tag LOCUS_44660 164253 163306 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_44660 164933 164250 gene locus_tag LOCUS_44670 164933 164250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_44670 165694 164930 gene locus_tag LOCUS_44680 165694 164930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106510.1 protein_id gnl|my_center|LOCUS_44680 166499 165696 gene locus_tag LOCUS_44690 166499 165696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 167323 166496 gene locus_tag LOCUS_44700 gene xapG 167323 166496 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_44700 170040 167320 gene locus_tag LOCUS_44710 170040 167320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 170084 170836 gene locus_tag LOCUS_44720 170084 170836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 171926 170808 gene locus_tag LOCUS_44730 171926 170808 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_44730 173769 171928 gene locus_tag LOCUS_44740 173769 171928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 175451 173769 gene locus_tag LOCUS_44750 175451 173769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 175740 177758 gene locus_tag LOCUS_44760 175740 177758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 177783 179819 gene locus_tag LOCUS_44770 177783 179819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 179935 180846 gene locus_tag LOCUS_44780 179935 180846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 181344 181892 gene locus_tag LOCUS_44790 181344 181892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 181979 182629 gene locus_tag LOCUS_44800 181979 182629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 182821 185400 gene locus_tag LOCUS_44810 182821 185400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 189005 185397 gene locus_tag LOCUS_44820 189005 185397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 189564 189115 gene locus_tag LOCUS_44830 189564 189115 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_44830 190583 190047 gene locus_tag LOCUS_44840 190583 190047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 191980 190646 gene locus_tag LOCUS_44850 191980 190646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 192079 192483 gene locus_tag LOCUS_44860 192079 192483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 193617 192460 gene locus_tag LOCUS_44870 193617 192460 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_44870 194863 193712 gene locus_tag LOCUS_44880 194863 193712 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_44880 194953 195519 gene locus_tag LOCUS_44890 194953 195519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 195618 196565 gene locus_tag LOCUS_44900 195618 196565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 197849 196569 gene locus_tag LOCUS_44910 197849 196569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 199109 197853 gene locus_tag LOCUS_44920 199109 197853 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_44920 199228 200829 gene locus_tag LOCUS_44930 199228 200829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 200957 202054 gene locus_tag LOCUS_44940 200957 202054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 202068 203417 gene locus_tag LOCUS_44950 202068 203417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_44950 203410 204111 gene locus_tag LOCUS_44960 203410 204111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119722.1 protein_id gnl|my_center|LOCUS_44960 205094 204108 gene locus_tag LOCUS_44970 205094 204108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 205187 206098 gene locus_tag LOCUS_44980 205187 206098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 206086 207465 gene locus_tag LOCUS_44990 206086 207465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 208598 207462 gene locus_tag LOCUS_45000 208598 207462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 209410 208595 gene locus_tag LOCUS_45010 209410 208595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_45010 209575 210657 gene locus_tag LOCUS_45020 gene pfk-1 209575 210657 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 protein_id gnl|my_center|LOCUS_45020 210670 211941 gene locus_tag LOCUS_45030 210670 211941 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_45030 212411 211980 gene locus_tag LOCUS_45040 212411 211980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 212568 213272 gene locus_tag LOCUS_45050 212568 213272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence22 5538 2959 gene locus_tag LOCUS_45060 5538 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 5622 5891 gene locus_tag LOCUS_45070 5622 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 5885 6271 gene locus_tag LOCUS_45080 5885 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 6456 7265 gene locus_tag LOCUS_45090 6456 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 7283 8467 gene locus_tag LOCUS_45100 gene thlA 7283 8467 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AR0 protein_id gnl|my_center|LOCUS_45100 8498 9274 gene locus_tag LOCUS_45110 8498 9274 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_45110 9308 10099 gene locus_tag LOCUS_45120 9308 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 10096 12921 gene locus_tag LOCUS_45130 10096 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 13081 16203 gene locus_tag LOCUS_45140 13081 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 16312 16758 gene locus_tag LOCUS_45150 16312 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 18334 16784 gene locus_tag LOCUS_45160 18334 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 protein_id gnl|my_center|LOCUS_45160 19261 18455 gene locus_tag LOCUS_45170 19261 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 21130 19337 gene locus_tag LOCUS_45180 21130 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 21585 21127 gene locus_tag LOCUS_45190 21585 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 22490 21585 gene locus_tag LOCUS_45200 22490 21585 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_45200 22927 22526 gene locus_tag LOCUS_45210 gene ytrA 22927 22526 CDS product HTH-type transcriptional repressor YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34712 protein_id gnl|my_center|LOCUS_45210 24054 22942 gene locus_tag LOCUS_45220 24054 22942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 25695 24172 gene locus_tag LOCUS_45230 25695 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 27527 25692 gene locus_tag LOCUS_45240 27527 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 29260 27551 gene locus_tag LOCUS_45250 gene proS 29260 27551 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_45250 31128 29305 gene locus_tag LOCUS_45260 31128 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 34052 31185 gene locus_tag LOCUS_45270 34052 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 34966 34070 gene locus_tag LOCUS_45280 gene dhmA 34966 34070 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_45280 35465 36445 gene locus_tag LOCUS_45290 gene ephA 35465 36445 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_45290 37020 36442 gene locus_tag LOCUS_45300 37020 36442 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_45300 37194 37607 gene locus_tag LOCUS_45310 37194 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 37604 38221 gene locus_tag LOCUS_45320 37604 38221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 41952 38218 gene locus_tag LOCUS_45330 41952 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 43480 42044 gene locus_tag LOCUS_45340 43480 42044 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_45340 45433 43526 gene locus_tag LOCUS_45350 45433 43526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 45768 46460 gene locus_tag LOCUS_45360 45768 46460 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_45360 46465 47904 gene locus_tag LOCUS_45370 46465 47904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 48782 47901 gene locus_tag LOCUS_45380 48782 47901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 50158 48779 gene locus_tag LOCUS_45390 50158 48779 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 protein_id gnl|my_center|LOCUS_45390 51018 50200 gene locus_tag LOCUS_45400 51018 50200 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_45400 51111 52004 gene locus_tag LOCUS_45410 51111 52004 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_45410 52012 52749 gene locus_tag LOCUS_45420 52012 52749 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_45420 52746 53642 gene locus_tag LOCUS_45430 gene nadK 52746 53642 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_45430 53639 57646 gene locus_tag LOCUS_45440 53639 57646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 57628 59355 gene locus_tag LOCUS_45450 57628 59355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 60417 59359 gene locus_tag LOCUS_45460 60417 59359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_45460 60686 61840 gene locus_tag LOCUS_45470 gene aspC-2 60686 61840 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCN2 protein_id gnl|my_center|LOCUS_45470 61865 63151 gene locus_tag LOCUS_45480 61865 63151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 64059 65114 gene locus_tag LOCUS_45490 64059 65114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 65146 65901 gene locus_tag LOCUS_45500 65146 65901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 68137 65942 gene locus_tag LOCUS_45510 68137 65942 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_45510 69714 68251 gene locus_tag LOCUS_45520 69714 68251 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_45520 70135 70530 gene locus_tag LOCUS_45530 70135 70530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 70601 71527 gene locus_tag LOCUS_45540 70601 71527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_45540 71524 73152 gene locus_tag LOCUS_45550 71524 73152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_45550 73145 74440 gene locus_tag LOCUS_45560 73145 74440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405384.1 protein_id gnl|my_center|LOCUS_45560 76067 74586 gene locus_tag LOCUS_45570 76067 74586 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_45570 78421 76076 gene locus_tag LOCUS_45580 78421 76076 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_45580 79592 78432 gene locus_tag LOCUS_45590 79592 78432 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW7 protein_id gnl|my_center|LOCUS_45590 81279 79621 gene locus_tag LOCUS_45600 81279 79621 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_45600 81345 83423 gene locus_tag LOCUS_45610 81345 83423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 83564 84664 gene locus_tag LOCUS_45620 83564 84664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 84774 85901 gene locus_tag LOCUS_45630 84774 85901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 90628 85904 gene locus_tag LOCUS_45640 90628 85904 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_45640 91552 90683 gene locus_tag LOCUS_45650 91552 90683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 91723 92421 gene locus_tag LOCUS_45660 91723 92421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 93784 92459 gene locus_tag LOCUS_45670 gene rho 93784 92459 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_45670 94419 93781 gene locus_tag LOCUS_45680 gene engB 94419 93781 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD57 protein_id gnl|my_center|LOCUS_45680 97097 94677 gene locus_tag LOCUS_45690 gene lon 97097 94677 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL28 protein_id gnl|my_center|LOCUS_45690 98367 97132 gene locus_tag LOCUS_45700 gene clpX 98367 97132 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_45700 99110 98508 gene locus_tag LOCUS_45710 gene clpP 99110 98508 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_45710 100453 99140 gene locus_tag LOCUS_45720 gene tig 100453 99140 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F314 protein_id gnl|my_center|LOCUS_45720 100616 100531 gene locus_tag LOCUS_t00500 100616 100531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 100750 100675 gene locus_tag LOCUS_t00510 100750 100675 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 100995 100762 gene locus_tag LOCUS_45730 100995 100762 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_45730 101688 101002 gene locus_tag LOCUS_45740 101688 101002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 102303 101938 gene locus_tag LOCUS_45750 102303 101938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 102716 102300 gene locus_tag LOCUS_45760 102716 102300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121288.1 protein_id gnl|my_center|LOCUS_45760 102778 104226 gene locus_tag LOCUS_45770 102778 104226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 105667 104153 gene locus_tag LOCUS_45780 105667 104153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 105731 106489 gene locus_tag LOCUS_45790 105731 106489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_45790 107415 106516 gene locus_tag LOCUS_45800 107415 106516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 107663 108016 gene locus_tag LOCUS_45810 107663 108016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 108425 108027 gene locus_tag LOCUS_45820 108425 108027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 109525 109301 gene locus_tag LOCUS_45830 109525 109301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 109954 110631 gene locus_tag LOCUS_45840 109954 110631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 110879 112102 gene locus_tag LOCUS_45850 110879 112102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 112159 112557 gene locus_tag LOCUS_45860 112159 112557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 113076 113333 gene locus_tag LOCUS_45870 113076 113333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 113358 113885 gene locus_tag LOCUS_45880 113358 113885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45880 116284 114395 gene locus_tag LOCUS_45890 116284 114395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 116844 116557 gene locus_tag LOCUS_45900 116844 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 117321 117025 gene locus_tag LOCUS_45910 117321 117025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 118171 117461 gene locus_tag LOCUS_45920 118171 117461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45920 118765 118190 gene locus_tag LOCUS_45930 118765 118190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 118854 119300 gene locus_tag LOCUS_45940 118854 119300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972215.1 protein_id gnl|my_center|LOCUS_45940 122002 119327 gene locus_tag LOCUS_45950 122002 119327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_45950 122345 122007 gene locus_tag LOCUS_45960 122345 122007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 122572 123120 gene locus_tag LOCUS_45970 122572 123120 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_45970 123120 123392 gene locus_tag LOCUS_45980 123120 123392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 123389 123727 gene locus_tag LOCUS_45990 123389 123727 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_45990 123724 124377 gene locus_tag LOCUS_46000 123724 124377 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_46000 124374 124862 gene locus_tag LOCUS_46010 124374 124862 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_46010 124859 125242 gene locus_tag LOCUS_46020 124859 125242 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_46020 125239 126756 gene locus_tag LOCUS_46030 125239 126756 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_46030 126761 128221 gene locus_tag LOCUS_46040 126761 128221 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_46040 128218 128472 gene locus_tag LOCUS_46050 128218 128472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 128465 130195 gene locus_tag LOCUS_46060 128465 130195 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_46060 130296 130535 gene locus_tag LOCUS_46070 130296 130535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 130590 131225 gene locus_tag LOCUS_46080 130590 131225 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_46080 132102 131257 gene locus_tag LOCUS_46090 132102 131257 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_46090 134219 132102 gene locus_tag LOCUS_46100 134219 132102 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_46100 135124 134447 gene locus_tag LOCUS_46110 135124 134447 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46110 135285 137345 gene locus_tag LOCUS_46120 135285 137345 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_46120 137384 139882 gene locus_tag LOCUS_46130 137384 139882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 143561 139899 gene locus_tag LOCUS_46140 143561 139899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 144501 143701 gene locus_tag LOCUS_46150 144501 143701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 145021 144491 gene locus_tag LOCUS_46160 145021 144491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 146335 145034 gene locus_tag LOCUS_46170 146335 145034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 147066 146338 gene locus_tag LOCUS_46180 147066 146338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 148412 147090 gene locus_tag LOCUS_46190 148412 147090 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_46190 149578 148547 gene locus_tag LOCUS_46200 149578 148547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 150377 149589 gene locus_tag LOCUS_46210 150377 149589 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_46210 151729 150443 gene locus_tag LOCUS_46220 gene colS 151729 150443 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_46220 152390 151704 gene locus_tag LOCUS_46230 gene colR 152390 151704 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_46230 152507 154666 gene locus_tag LOCUS_46240 152507 154666 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_46240 154755 155180 gene locus_tag LOCUS_46250 154755 155180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 156321 155794 gene locus_tag LOCUS_46260 156321 155794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 156638 156318 gene locus_tag LOCUS_46270 156638 156318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 159823 156671 gene locus_tag LOCUS_46280 159823 156671 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_46280 159853 162069 gene locus_tag LOCUS_46290 159853 162069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 162753 162088 gene locus_tag LOCUS_46300 gene lexA 162753 162088 CDS product lexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33927 protein_id gnl|my_center|LOCUS_46300 163055 164332 gene locus_tag LOCUS_46310 163055 164332 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_46310 164329 165678 gene locus_tag LOCUS_46320 164329 165678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 165710 168232 gene locus_tag LOCUS_46330 165710 168232 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_46330 168522 169193 gene locus_tag LOCUS_46340 168522 169193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 169300 169962 gene locus_tag LOCUS_46350 169300 169962 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_46350 172782 170026 gene locus_tag LOCUS_46360 172782 170026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_46360 173180 172779 gene locus_tag LOCUS_46370 173180 172779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 175069 173279 gene locus_tag LOCUS_46380 175069 173279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 177390 175153 gene locus_tag LOCUS_46390 177390 175153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 177506 178396 gene locus_tag LOCUS_46400 177506 178396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 178462 180195 gene locus_tag LOCUS_46410 178462 180195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 180198 182021 gene locus_tag LOCUS_46420 180198 182021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_46420 182270 182049 gene locus_tag LOCUS_46430 182270 182049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 183567 182461 gene locus_tag LOCUS_46440 gene glvI 183567 182461 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN8 protein_id gnl|my_center|LOCUS_46440 183766 185163 gene locus_tag LOCUS_46450 183766 185163 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403936.1 protein_id gnl|my_center|LOCUS_46450 185165 188299 gene locus_tag LOCUS_46460 185165 188299 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_46460 190771 188306 gene locus_tag LOCUS_46470 190771 188306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 191231 193276 gene locus_tag LOCUS_46480 gene metG 191231 193276 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ9 protein_id gnl|my_center|LOCUS_46480 193288 194097 gene locus_tag LOCUS_46490 193288 194097 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975449.1 protein_id gnl|my_center|LOCUS_46490 194723 194917 gene locus_tag LOCUS_46500 194723 194917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 >Feature sequence23 2749 164 gene locus_tag LOCUS_46510 2749 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 4888 2891 gene locus_tag LOCUS_46520 4888 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 5034 5642 gene locus_tag LOCUS_46530 gene queE 5034 5642 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC0 protein_id gnl|my_center|LOCUS_46530 5642 6700 gene locus_tag LOCUS_46540 gene fadB5 5642 6700 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_46540 7442 8302 gene locus_tag LOCUS_46550 7442 8302 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122377.1 protein_id gnl|my_center|LOCUS_46550 8341 11313 gene locus_tag LOCUS_46560 8341 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 11318 12259 gene locus_tag LOCUS_46570 11318 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 12261 14432 gene locus_tag LOCUS_46580 12261 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 14915 14574 gene locus_tag LOCUS_46590 14915 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 14979 18209 gene locus_tag LOCUS_46600 14979 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 18346 18687 gene locus_tag LOCUS_46610 18346 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 18848 19318 gene locus_tag LOCUS_46620 18848 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 19832 19320 gene locus_tag LOCUS_46630 19832 19320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700968.1 protein_id gnl|my_center|LOCUS_46630 21373 20369 gene locus_tag LOCUS_46640 gene socC 21373 20369 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_46640 21789 21520 gene locus_tag LOCUS_46650 21789 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 22057 23289 gene locus_tag LOCUS_46660 22057 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 23286 23660 gene locus_tag LOCUS_46670 23286 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 23644 25236 gene locus_tag LOCUS_46680 23644 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 25255 28347 gene locus_tag LOCUS_46690 25255 28347 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_46690 31398 28447 gene locus_tag LOCUS_46700 31398 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 31801 31640 gene locus_tag LOCUS_46710 31801 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 32526 31798 gene locus_tag LOCUS_46720 32526 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 33004 32531 gene locus_tag LOCUS_46730 33004 32531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 33034 33990 gene locus_tag LOCUS_46740 33034 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 34293 33994 gene locus_tag LOCUS_46750 34293 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 34405 37329 gene locus_tag LOCUS_46760 34405 37329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 37488 39092 gene locus_tag LOCUS_46770 37488 39092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 39521 39309 gene locus_tag LOCUS_46780 39521 39309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 39891 40970 gene locus_tag LOCUS_46790 39891 40970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 41303 42562 gene locus_tag LOCUS_46800 41303 42562 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_46800 42908 42573 gene locus_tag LOCUS_46810 42908 42573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 43235 43531 gene locus_tag LOCUS_46820 43235 43531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 43512 43895 gene locus_tag LOCUS_46830 43512 43895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 43941 46574 gene locus_tag LOCUS_46840 43941 46574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 46966 46709 gene locus_tag LOCUS_46850 46966 46709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 47899 47483 gene locus_tag LOCUS_46860 47899 47483 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_46860 48143 47892 gene locus_tag LOCUS_46870 48143 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 49875 48319 gene locus_tag LOCUS_46880 49875 48319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 50240 49872 gene locus_tag LOCUS_46890 50240 49872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 50841 50308 gene locus_tag LOCUS_46900 50841 50308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 51170 50838 gene locus_tag LOCUS_46910 51170 50838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 51525 51328 gene locus_tag LOCUS_46920 51525 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 51665 51865 gene locus_tag LOCUS_46930 51665 51865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 53268 52054 gene locus_tag LOCUS_46940 53268 52054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 53446 53757 gene locus_tag LOCUS_46950 53446 53757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 54620 54330 gene locus_tag LOCUS_46960 54620 54330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 56512 55160 gene locus_tag LOCUS_46970 56512 55160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 57045 56830 gene locus_tag LOCUS_46980 57045 56830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 57406 57026 gene locus_tag LOCUS_46990 gene spbB 57406 57026 CDS product histone-like nucleoid-structuring protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_46990 58193 57417 gene locus_tag LOCUS_47000 58193 57417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 59704 58190 gene locus_tag LOCUS_47010 59704 58190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 59753 59917 gene locus_tag LOCUS_47020 59753 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 60604 60047 gene locus_tag LOCUS_47030 60604 60047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 62079 60607 gene locus_tag LOCUS_47040 62079 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 62519 63160 gene locus_tag LOCUS_47050 62519 63160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 63646 63335 gene locus_tag LOCUS_47060 63646 63335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 65319 64660 gene locus_tag LOCUS_47070 65319 64660 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT41 protein_id gnl|my_center|LOCUS_47070 65566 65312 gene locus_tag LOCUS_47080 65566 65312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 65984 65637 gene locus_tag LOCUS_47090 65984 65637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 66411 66572 gene locus_tag LOCUS_47100 66411 66572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 66770 67177 gene locus_tag LOCUS_47110 66770 67177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 67171 68073 gene locus_tag LOCUS_47120 67171 68073 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084400.1 protein_id gnl|my_center|LOCUS_47120 68371 71499 gene locus_tag LOCUS_47130 68371 71499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 71477 71905 gene locus_tag LOCUS_47140 71477 71905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 72275 71919 gene locus_tag LOCUS_47150 72275 71919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 72571 72837 gene locus_tag LOCUS_47160 72571 72837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 72860 73201 gene locus_tag LOCUS_47170 72860 73201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 73228 80601 gene locus_tag LOCUS_47180 73228 80601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 80809 82521 gene locus_tag LOCUS_47190 80809 82521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947786.1 protein_id gnl|my_center|LOCUS_47190 83415 82561 gene locus_tag LOCUS_47200 83415 82561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 84374 83412 gene locus_tag LOCUS_47210 84374 83412 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_47210 84580 84374 gene locus_tag LOCUS_47220 84580 84374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 84767 84570 gene locus_tag LOCUS_47230 84767 84570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 85347 85655 gene locus_tag LOCUS_47240 85347 85655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 91259 86025 gene locus_tag LOCUS_47250 91259 86025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 92511 91873 gene locus_tag LOCUS_47260 92511 91873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 97064 92523 gene locus_tag LOCUS_47270 97064 92523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 104110 97070 gene locus_tag LOCUS_47280 104110 97070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 104747 104121 gene locus_tag LOCUS_47290 104747 104121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 105528 104755 gene locus_tag LOCUS_47300 105528 104755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 106825 105521 gene locus_tag LOCUS_47310 106825 105521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 107557 108831 gene locus_tag LOCUS_47320 107557 108831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 109983 108850 gene locus_tag LOCUS_47330 109983 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 110737 111198 gene locus_tag LOCUS_47340 110737 111198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 111296 117475 gene locus_tag LOCUS_47350 111296 117475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 120808 117494 gene locus_tag LOCUS_47360 120808 117494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 124458 120940 gene locus_tag LOCUS_47370 124458 120940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 124677 124898 gene locus_tag LOCUS_47380 124677 124898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 125985 125269 gene locus_tag LOCUS_47390 125985 125269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 128075 125985 gene locus_tag LOCUS_47400 gene fusA 128075 125985 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F983 protein_id gnl|my_center|LOCUS_47400 131401 128252 gene locus_tag LOCUS_47410 131401 128252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_47410 131498 132763 gene locus_tag LOCUS_47420 131498 132763 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_47420 132765 133337 gene locus_tag LOCUS_47430 gene tag 132765 133337 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_47430 133339 134748 gene locus_tag LOCUS_47440 133339 134748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_47440 135654 134776 gene locus_tag LOCUS_47450 135654 134776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_47450 137562 135664 gene locus_tag LOCUS_47460 137562 135664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_47460 138755 137559 gene locus_tag LOCUS_47470 gene lpxB 138755 137559 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_47470 138943 138752 gene locus_tag LOCUS_47480 138943 138752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 139418 138948 gene locus_tag LOCUS_47490 139418 138948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 139863 139390 gene locus_tag LOCUS_47500 139863 139390 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_47500 140262 139948 gene locus_tag LOCUS_47510 gene ihfB-2 140262 139948 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_47510 142214 140322 gene locus_tag LOCUS_47520 gene rpsA 142214 140322 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_47520 143613 142456 gene locus_tag LOCUS_47530 gene queG 143613 142456 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI8 protein_id gnl|my_center|LOCUS_47530 144290 143616 gene locus_tag LOCUS_47540 gene cmk 144290 143616 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQK7 protein_id gnl|my_center|LOCUS_47540 145176 144280 gene locus_tag LOCUS_47550 145176 144280 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_47550 146348 145173 gene locus_tag LOCUS_47560 146348 145173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 147145 146345 gene locus_tag LOCUS_47570 gene scpA 147145 146345 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIP8 protein_id gnl|my_center|LOCUS_47570 148414 147242 gene locus_tag LOCUS_47580 148414 147242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 149197 148421 gene locus_tag LOCUS_47590 149197 148421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 150062 149220 gene locus_tag LOCUS_47600 150062 149220 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_47600 150243 150503 gene locus_tag LOCUS_47610 150243 150503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 152038 150632 gene locus_tag LOCUS_47620 152038 150632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 153895 152096 gene locus_tag LOCUS_47630 gene uvrC 153895 152096 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_47630 154267 153929 gene locus_tag LOCUS_47640 154267 153929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 155325 154312 gene locus_tag LOCUS_47650 gene dusA 155325 154312 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 protein_id gnl|my_center|LOCUS_47650 157027 155327 gene locus_tag LOCUS_47660 157027 155327 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_47660 158173 157163 gene locus_tag LOCUS_47670 158173 157163 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_47670 158475 158188 gene locus_tag LOCUS_47680 158475 158188 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_47680 158660 158472 gene locus_tag LOCUS_47690 158660 158472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 161933 158706 gene locus_tag LOCUS_47700 161933 158706 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J9 protein_id gnl|my_center|LOCUS_47700 165696 162373 gene locus_tag LOCUS_47710 gene mcm 165696 162373 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_47710 165899 166192 gene locus_tag LOCUS_47720 165899 166192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 166176 166676 gene locus_tag LOCUS_47730 166176 166676 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141695.1 protein_id gnl|my_center|LOCUS_47730 167517 166633 gene locus_tag LOCUS_47740 167517 166633 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_47740 167637 168455 gene locus_tag LOCUS_47750 167637 168455 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_47750 168477 169931 gene locus_tag LOCUS_47760 168477 169931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 171577 169940 gene locus_tag LOCUS_47770 171577 169940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 171762 171580 gene locus_tag LOCUS_47780 171762 171580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 173383 171680 gene locus_tag LOCUS_47790 173383 171680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_47790 173962 173399 gene locus_tag LOCUS_47800 173962 173399 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_47800 174765 173959 gene locus_tag LOCUS_47810 174765 173959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 178153 174677 gene locus_tag LOCUS_47820 178153 174677 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_47820 178824 178186 gene locus_tag LOCUS_47830 178824 178186 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_47830 180288 178861 gene locus_tag LOCUS_47840 180288 178861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 180509 180291 gene locus_tag LOCUS_47850 180509 180291 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_47850 181452 180496 gene locus_tag LOCUS_47860 gene miaA 181452 180496 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_47860 183767 181476 gene locus_tag LOCUS_47870 183767 181476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 184489 183809 gene locus_tag LOCUS_47880 184489 183809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 185276 184482 gene locus_tag LOCUS_47890 185276 184482 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_47890 186875 185301 gene locus_tag LOCUS_47900 186875 185301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 189550 187061 gene locus_tag LOCUS_47910 189550 187061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 191338 189554 gene locus_tag LOCUS_47920 191338 189554 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_47920 191390 193759 gene locus_tag LOCUS_47930 191390 193759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 193852 195057 gene locus_tag LOCUS_47940 193852 195057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence24 2513 2244 gene locus_tag LOCUS_47950 gene rpsO 2513 2244 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72ER5 protein_id gnl|my_center|LOCUS_47950 3513 2602 gene locus_tag LOCUS_47960 gene truB 3513 2602 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66922 protein_id gnl|my_center|LOCUS_47960 4550 3510 gene locus_tag LOCUS_47970 4550 3510 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_47970 4881 4537 gene locus_tag LOCUS_47980 gene rbfA 4881 4537 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32731 protein_id gnl|my_center|LOCUS_47980 5171 4878 gene locus_tag LOCUS_47990 5171 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_47990 8076 5206 gene locus_tag LOCUS_48000 8076 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 9661 8138 gene locus_tag LOCUS_48010 9661 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 10238 9675 gene locus_tag LOCUS_48020 gene rimP 10238 9675 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X299 protein_id gnl|my_center|LOCUS_48020 10658 12160 gene locus_tag LOCUS_48030 10658 12160 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 protein_id gnl|my_center|LOCUS_48030 12343 14619 gene locus_tag LOCUS_48040 12343 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 14632 16695 gene locus_tag LOCUS_48050 14632 16695 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103281.1 protein_id gnl|my_center|LOCUS_48050 16734 19223 gene locus_tag LOCUS_48060 16734 19223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 19250 20242 gene locus_tag LOCUS_48070 19250 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 21001 20342 gene locus_tag LOCUS_48080 21001 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 22365 21085 gene locus_tag LOCUS_48090 22365 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528200.1 protein_id gnl|my_center|LOCUS_48090 22406 23770 gene locus_tag LOCUS_48100 22406 23770 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404096.1 protein_id gnl|my_center|LOCUS_48100 23780 24745 gene locus_tag LOCUS_48110 23780 24745 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_48110 26543 24732 gene locus_tag LOCUS_48120 26543 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 28102 26540 gene locus_tag LOCUS_48130 28102 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 30549 28186 gene locus_tag LOCUS_48140 30549 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 31976 30546 gene locus_tag LOCUS_48150 31976 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 33669 31969 gene locus_tag LOCUS_48160 33669 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 33812 33666 gene locus_tag LOCUS_48170 33812 33666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 35333 33837 gene locus_tag LOCUS_48180 35333 33837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 35866 35330 gene locus_tag LOCUS_48190 35866 35330 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886826.1 protein_id gnl|my_center|LOCUS_48190 36085 36648 gene locus_tag LOCUS_48200 36085 36648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 37343 40432 gene locus_tag LOCUS_48210 37343 40432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 40746 43832 gene locus_tag LOCUS_48220 40746 43832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 45010 43853 gene locus_tag LOCUS_48230 45010 43853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 47945 45495 gene locus_tag LOCUS_48240 47945 45495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 49123 47942 gene locus_tag LOCUS_48250 49123 47942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141120.1 protein_id gnl|my_center|LOCUS_48250 49525 52527 gene locus_tag LOCUS_48260 49525 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 52543 55581 gene locus_tag LOCUS_48270 52543 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 55581 58622 gene locus_tag LOCUS_48280 55581 58622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 59149 58625 gene locus_tag LOCUS_48290 59149 58625 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_48290 60696 59146 gene locus_tag LOCUS_48300 60696 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 60829 61596 gene locus_tag LOCUS_48310 60829 61596 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_48310 62996 61671 gene locus_tag LOCUS_48320 62996 61671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 64672 62996 gene locus_tag LOCUS_48330 64672 62996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 65250 64669 gene locus_tag LOCUS_48340 65250 64669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 66753 65275 gene locus_tag LOCUS_48350 66753 65275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 66718 66948 gene locus_tag LOCUS_48360 66718 66948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 68701 66965 gene locus_tag LOCUS_48370 68701 66965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 69757 68801 gene locus_tag LOCUS_48380 69757 68801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 70362 69754 gene locus_tag LOCUS_48390 70362 69754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 72754 70406 gene locus_tag LOCUS_48400 72754 70406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_48400 74021 72798 gene locus_tag LOCUS_48410 74021 72798 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_48410 74240 75874 gene locus_tag LOCUS_48420 74240 75874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 76005 77498 gene locus_tag LOCUS_48430 gene dacB 76005 77498 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_48430 77534 78106 gene locus_tag LOCUS_48440 77534 78106 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 protein_id gnl|my_center|LOCUS_48440 78141 78707 gene locus_tag LOCUS_48450 78141 78707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 78711 79571 gene locus_tag LOCUS_48460 78711 79571 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_48460 80701 80297 gene locus_tag LOCUS_48470 80701 80297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 82144 81371 gene locus_tag LOCUS_48480 82144 81371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 82980 82558 gene locus_tag LOCUS_48490 82980 82558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 83984 83055 gene locus_tag LOCUS_48500 83984 83055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 85676 84897 gene locus_tag LOCUS_48510 85676 84897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 85847 86149 gene locus_tag LOCUS_48520 85847 86149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 86348 89734 gene locus_tag LOCUS_48530 86348 89734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 89731 90549 gene locus_tag LOCUS_48540 89731 90549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088178.1 protein_id gnl|my_center|LOCUS_48540 90546 90941 gene locus_tag LOCUS_48550 90546 90941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088179.1 protein_id gnl|my_center|LOCUS_48550 91896 90973 gene locus_tag LOCUS_48560 91896 90973 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904367.1 protein_id gnl|my_center|LOCUS_48560 92726 91899 gene locus_tag LOCUS_48570 gene tktB 92726 91899 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_48570 93738 92695 gene locus_tag LOCUS_48580 93738 92695 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088173.1 protein_id gnl|my_center|LOCUS_48580 95827 93725 gene locus_tag LOCUS_48590 95827 93725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 95865 96989 gene locus_tag LOCUS_48600 95865 96989 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957744.1 protein_id gnl|my_center|LOCUS_48600 96976 98487 gene locus_tag LOCUS_48610 96976 98487 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J62 protein_id gnl|my_center|LOCUS_48610 98484 99488 gene locus_tag LOCUS_48620 98484 99488 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_48620 100119 99499 gene locus_tag LOCUS_48630 100119 99499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 100198 100845 gene locus_tag LOCUS_48640 100198 100845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 100861 101052 gene locus_tag LOCUS_48650 100861 101052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 101924 103813 gene locus_tag LOCUS_48660 101924 103813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_48660 104576 104343 gene locus_tag LOCUS_48670 gene soxD 104576 104343 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87387 protein_id gnl|my_center|LOCUS_48670 105799 104591 gene locus_tag LOCUS_48680 105799 104591 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_48680 108417 105796 gene locus_tag LOCUS_48690 108417 105796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 108545 109870 gene locus_tag LOCUS_48700 108545 109870 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814774.1 protein_id gnl|my_center|LOCUS_48700 109867 111558 gene locus_tag LOCUS_48710 109867 111558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_48710 111563 112807 gene locus_tag LOCUS_48720 111563 112807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_48720 113013 112825 gene locus_tag LOCUS_48730 113013 112825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 112918 113613 gene locus_tag LOCUS_48740 112918 113613 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_48740 116869 113894 gene locus_tag LOCUS_48750 116869 113894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 118590 116965 gene locus_tag LOCUS_48760 118590 116965 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_48760 119154 118591 gene locus_tag LOCUS_48770 119154 118591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 119249 121279 gene locus_tag LOCUS_48780 119249 121279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 121276 121755 gene locus_tag LOCUS_48790 121276 121755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_48790 123882 121786 gene locus_tag LOCUS_48800 123882 121786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 protein_id gnl|my_center|LOCUS_48800 124587 123892 gene locus_tag LOCUS_48810 gene pgl 124587 123892 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_48810 126048 124591 gene locus_tag LOCUS_48820 gene zwf 126048 124591 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_48820 126756 126100 gene locus_tag LOCUS_48830 126756 126100 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529740.1 protein_id gnl|my_center|LOCUS_48830 126857 128875 gene locus_tag LOCUS_48840 126857 128875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 128949 129521 gene locus_tag LOCUS_48850 128949 129521 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_48850 129683 130432 gene locus_tag LOCUS_48860 129683 130432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 132904 130442 gene locus_tag LOCUS_48870 132904 130442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 133547 132888 gene locus_tag LOCUS_48880 133547 132888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 134205 133714 gene locus_tag LOCUS_48890 134205 133714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 135352 134198 gene locus_tag LOCUS_48900 135352 134198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 135649 136677 gene locus_tag LOCUS_48910 135649 136677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 137153 136746 gene locus_tag LOCUS_48920 137153 136746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 138817 137159 gene locus_tag LOCUS_48930 138817 137159 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_48930 139081 138845 gene locus_tag LOCUS_48940 139081 138845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 139426 139181 gene locus_tag LOCUS_48950 139426 139181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 140137 139436 gene locus_tag LOCUS_48960 gene yniC 140137 139436 CDS product 2-deoxyglucose-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77247 protein_id gnl|my_center|LOCUS_48960 140445 140936 gene locus_tag LOCUS_48970 140445 140936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 140980 141846 gene locus_tag LOCUS_48980 140980 141846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_48980 143685 142576 gene locus_tag LOCUS_48990 143685 142576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 144018 145682 gene locus_tag LOCUS_49000 144018 145682 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728900.1 protein_id gnl|my_center|LOCUS_49000 146791 145688 gene locus_tag LOCUS_49010 146791 145688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 148023 146935 gene locus_tag LOCUS_49020 148023 146935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 149376 148390 gene locus_tag LOCUS_49030 149376 148390 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_49030 150004 149414 gene locus_tag LOCUS_49040 150004 149414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 151354 150203 gene locus_tag LOCUS_49050 151354 150203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 151653 151456 gene locus_tag LOCUS_49060 151653 151456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 151561 153411 gene locus_tag LOCUS_49070 151561 153411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 155657 153387 gene locus_tag LOCUS_49080 155657 153387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 158044 155672 gene locus_tag LOCUS_49090 158044 155672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49090 158199 158849 gene locus_tag LOCUS_49100 158199 158849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 162411 158947 gene locus_tag LOCUS_49110 162411 158947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 163669 162695 gene locus_tag LOCUS_49120 163669 162695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 164257 163727 gene locus_tag LOCUS_49130 164257 163727 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_49130 165660 164254 gene locus_tag LOCUS_49140 165660 164254 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_49140 166436 165660 gene locus_tag LOCUS_49150 166436 165660 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_49150 166459 166947 gene locus_tag LOCUS_49160 166459 166947 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_49160 167885 166932 gene locus_tag LOCUS_49170 167885 166932 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_49170 167926 169770 gene locus_tag LOCUS_49180 167926 169770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_49180 169771 170871 gene locus_tag LOCUS_49190 169771 170871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence25 658 365 gene locus_tag LOCUS_49200 658 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 3669 730 gene locus_tag LOCUS_49210 3669 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 5923 3698 gene locus_tag LOCUS_49220 5923 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 7711 6173 gene locus_tag LOCUS_49230 gene guaA 7711 6173 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_49230 9803 7773 gene locus_tag LOCUS_49240 9803 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 11000 9855 gene locus_tag LOCUS_49250 11000 9855 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_49250 11026 12690 gene locus_tag LOCUS_49260 11026 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 12687 13727 gene locus_tag LOCUS_49270 12687 13727 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_49270 13746 14108 gene locus_tag LOCUS_49280 13746 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 14593 15174 gene locus_tag LOCUS_49290 14593 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 15228 17180 gene locus_tag LOCUS_49300 15228 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 17394 17594 gene locus_tag LOCUS_49310 17394 17594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 17605 18069 gene locus_tag LOCUS_49320 17605 18069 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_49320 19623 18088 gene locus_tag LOCUS_49330 19623 18088 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_49330 20476 19754 gene locus_tag LOCUS_49340 20476 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 22100 20469 gene locus_tag LOCUS_49350 22100 20469 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_49350 24151 22097 gene locus_tag LOCUS_49360 24151 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 24062 24253 gene locus_tag LOCUS_49370 24062 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 25790 24243 gene locus_tag LOCUS_49380 25790 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 27674 25818 gene locus_tag LOCUS_49390 27674 25818 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_49390 29161 27800 gene locus_tag LOCUS_49400 29161 27800 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_49400 29289 31487 gene locus_tag LOCUS_49410 29289 31487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 32264 31500 gene locus_tag LOCUS_49420 32264 31500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 32635 32261 gene locus_tag LOCUS_49430 32635 32261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 33220 32660 gene locus_tag LOCUS_49440 33220 32660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 33318 33779 gene locus_tag LOCUS_49450 gene dtd 33318 33779 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE39 protein_id gnl|my_center|LOCUS_49450 34073 33789 gene locus_tag LOCUS_49460 34073 33789 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_49460 34358 36508 gene locus_tag LOCUS_49470 34358 36508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546646.1 protein_id gnl|my_center|LOCUS_49470 36510 37265 gene locus_tag LOCUS_49480 36510 37265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 37301 39130 gene locus_tag LOCUS_49490 37301 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 39120 39797 gene locus_tag LOCUS_49500 39120 39797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 39871 40686 gene locus_tag LOCUS_49510 39871 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_49510 41248 41039 gene locus_tag LOCUS_49520 41248 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 41156 42268 gene locus_tag LOCUS_49530 41156 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 42284 43081 gene locus_tag LOCUS_49540 42284 43081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 43171 45204 gene locus_tag LOCUS_49550 43171 45204 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_49550 45818 46696 gene locus_tag LOCUS_49560 45818 46696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 47128 48075 gene locus_tag LOCUS_49570 47128 48075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 49677 48307 gene locus_tag LOCUS_49580 49677 48307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 51101 50433 gene locus_tag LOCUS_49590 51101 50433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 51603 51316 gene locus_tag LOCUS_49600 51603 51316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 53699 51618 gene locus_tag LOCUS_49610 53699 51618 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_49610 54137 54529 gene locus_tag LOCUS_49620 54137 54529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 54569 55216 gene locus_tag LOCUS_49630 54569 55216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_49630 55265 55543 gene locus_tag LOCUS_49640 55265 55543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_49640 55554 56777 gene locus_tag LOCUS_49650 55554 56777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_49650 56805 57629 gene locus_tag LOCUS_49660 56805 57629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 57641 58033 gene locus_tag LOCUS_49670 57641 58033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_49670 58021 60660 gene locus_tag LOCUS_49680 58021 60660 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_49680 60657 64607 gene locus_tag LOCUS_49690 60657 64607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 64607 67063 gene locus_tag LOCUS_49700 64607 67063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_49700 67075 71319 gene locus_tag LOCUS_49710 67075 71319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 72082 71339 gene locus_tag LOCUS_49720 72082 71339 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_49720 72789 72190 gene locus_tag LOCUS_49730 72789 72190 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_49730 72936 74576 gene locus_tag LOCUS_49740 72936 74576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 74578 75078 gene locus_tag LOCUS_49750 gene nfi 74578 75078 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123255.1 protein_id gnl|my_center|LOCUS_49750 76850 75084 gene locus_tag LOCUS_49760 76850 75084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 77073 79880 gene locus_tag LOCUS_49770 77073 79880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 80164 82998 gene locus_tag LOCUS_49780 80164 82998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 83104 85365 gene locus_tag LOCUS_49790 83104 85365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 85637 86374 gene locus_tag LOCUS_49800 85637 86374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 87082 91002 gene locus_tag LOCUS_49810 87082 91002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 91122 93518 gene locus_tag LOCUS_49820 91122 93518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 94555 93548 gene locus_tag LOCUS_49830 94555 93548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 96420 94603 gene locus_tag LOCUS_49840 96420 94603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 96691 97224 gene locus_tag LOCUS_49850 gene infC 96691 97224 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z3 protein_id gnl|my_center|LOCUS_49850 97221 97742 gene locus_tag LOCUS_49860 97221 97742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 100451 97743 gene locus_tag LOCUS_49870 100451 97743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 100493 101497 gene locus_tag LOCUS_49880 100493 101497 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_49880 101705 102166 gene locus_tag LOCUS_49890 101705 102166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 103977 102238 gene locus_tag LOCUS_49900 103977 102238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 104036 104716 gene locus_tag LOCUS_49910 104036 104716 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_49910 104778 106871 gene locus_tag LOCUS_49920 104778 106871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 107878 106811 gene locus_tag LOCUS_49930 107878 106811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 108981 107881 gene locus_tag LOCUS_49940 108981 107881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 109973 109008 gene locus_tag LOCUS_49950 109973 109008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 110042 110992 gene locus_tag LOCUS_49960 gene prs 110042 110992 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHU3 protein_id gnl|my_center|LOCUS_49960 111031 111753 gene locus_tag LOCUS_49970 111031 111753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 111785 112876 gene locus_tag LOCUS_49980 111785 112876 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_49980 112876 114105 gene locus_tag LOCUS_49990 112876 114105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121734.1 protein_id gnl|my_center|LOCUS_49990 114102 115481 gene locus_tag LOCUS_50000 114102 115481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 115510 115680 gene locus_tag LOCUS_50010 115510 115680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 115681 116253 gene locus_tag LOCUS_50020 115681 116253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 120461 116280 gene locus_tag LOCUS_50030 120461 116280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 122024 120519 gene locus_tag LOCUS_50040 122024 120519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 122154 124361 gene locus_tag LOCUS_50050 122154 124361 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_50050 125610 124627 gene locus_tag LOCUS_50060 125610 124627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 125650 127188 gene locus_tag LOCUS_50070 gene lnt 125650 127188 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_50070 127303 128298 gene locus_tag LOCUS_50080 127303 128298 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967760.1 protein_id gnl|my_center|LOCUS_50080 128369 129904 gene locus_tag LOCUS_50090 128369 129904 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256096.1 protein_id gnl|my_center|LOCUS_50090 129941 130408 gene locus_tag LOCUS_50100 129941 130408 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770111.1 protein_id gnl|my_center|LOCUS_50100 130416 131228 gene locus_tag LOCUS_50110 130416 131228 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_50110 131399 133441 gene locus_tag LOCUS_50120 131399 133441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 134213 133413 gene locus_tag LOCUS_50130 134213 133413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_50130 135862 134753 gene locus_tag LOCUS_50140 gene pflA 135862 134753 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_50140 136894 135863 gene locus_tag LOCUS_50150 136894 135863 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873588.1 protein_id gnl|my_center|LOCUS_50150 139959 137116 gene locus_tag LOCUS_50160 139959 137116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 142984 139934 gene locus_tag LOCUS_50170 142984 139934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 145076 142968 gene locus_tag LOCUS_50180 145076 142968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_50180 145227 146864 gene locus_tag LOCUS_50190 145227 146864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 146929 152253 gene locus_tag LOCUS_50200 146929 152253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 152656 152324 gene locus_tag LOCUS_50210 152656 152324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 152837 155839 gene locus_tag LOCUS_50220 152837 155839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 156151 157821 gene locus_tag LOCUS_50230 156151 157821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 158053 159546 gene locus_tag LOCUS_50240 158053 159546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 159563 161041 gene locus_tag LOCUS_50250 159563 161041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 161136 162719 gene locus_tag LOCUS_50260 161136 162719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 162914 164500 gene locus_tag LOCUS_50270 162914 164500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 164622 166193 gene locus_tag LOCUS_50280 164622 166193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 166362 167882 gene locus_tag LOCUS_50290 166362 167882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 >Feature sequence26 866 3754 gene locus_tag LOCUS_50300 866 3754 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_50300 9522 3739 gene locus_tag LOCUS_50310 9522 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 10983 9550 gene locus_tag LOCUS_50320 10983 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 13016 11064 gene locus_tag LOCUS_50330 13016 11064 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_50330 13260 14219 gene locus_tag LOCUS_50340 13260 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814937.1 protein_id gnl|my_center|LOCUS_50340 14602 14790 gene locus_tag LOCUS_50350 14602 14790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 15026 17947 gene locus_tag LOCUS_50360 15026 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 18087 20948 gene locus_tag LOCUS_50370 18087 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 20972 23425 gene locus_tag LOCUS_50380 20972 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_50380 23447 24442 gene locus_tag LOCUS_50390 23447 24442 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_50390 24469 25248 gene locus_tag LOCUS_50400 24469 25248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_50400 25233 26945 gene locus_tag LOCUS_50410 25233 26945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 27001 28512 gene locus_tag LOCUS_50420 27001 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 29179 28931 gene locus_tag LOCUS_50430 29179 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 29350 30699 gene locus_tag LOCUS_50440 29350 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 30701 31363 gene locus_tag LOCUS_50450 30701 31363 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_50450 31370 32287 gene locus_tag LOCUS_50460 gene hemF 31370 32287 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 protein_id gnl|my_center|LOCUS_50460 32284 32907 gene locus_tag LOCUS_50470 32284 32907 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_50470 32919 33731 gene locus_tag LOCUS_50480 32919 33731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 33731 34741 gene locus_tag LOCUS_50490 33731 34741 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392828.1 protein_id gnl|my_center|LOCUS_50490 35534 34707 gene locus_tag LOCUS_50500 gene modA 35534 34707 CDS product molybdate-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37329 protein_id gnl|my_center|LOCUS_50500 37451 35538 gene locus_tag LOCUS_50510 37451 35538 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_50510 39356 37548 gene locus_tag LOCUS_50520 39356 37548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 39556 41373 gene locus_tag LOCUS_50530 39556 41373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 41767 41357 gene locus_tag LOCUS_50540 41767 41357 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_50540 42261 43601 gene locus_tag LOCUS_50550 42261 43601 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_50550 44870 43662 gene locus_tag LOCUS_50560 44870 43662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50560 46467 44893 gene locus_tag LOCUS_50570 gene secD 46467 44893 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_50570 46793 46464 gene locus_tag LOCUS_50580 46793 46464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 48023 46875 gene locus_tag LOCUS_50590 gene tgt 48023 46875 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9Z5 protein_id gnl|my_center|LOCUS_50590 48891 48082 gene locus_tag LOCUS_50600 48891 48082 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_50600 49103 49294 gene locus_tag LOCUS_50610 49103 49294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 49299 49829 gene locus_tag LOCUS_50620 49299 49829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 49826 50566 gene locus_tag LOCUS_50630 49826 50566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_50630 50574 51491 gene locus_tag LOCUS_50640 50574 51491 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_50640 52296 52009 gene locus_tag LOCUS_50650 52296 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 53369 52341 gene locus_tag LOCUS_50660 53369 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 55796 53418 gene locus_tag LOCUS_50670 55796 53418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 56045 58246 gene locus_tag LOCUS_50680 56045 58246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 58314 58955 gene locus_tag LOCUS_50690 58314 58955 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_50690 58945 60948 gene locus_tag LOCUS_50700 gene kefB 58945 60948 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918093.1 protein_id gnl|my_center|LOCUS_50700 60945 62930 gene locus_tag LOCUS_50710 gene nadE 60945 62930 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_50710 62948 64219 gene locus_tag LOCUS_50720 gene erg3 62948 64219 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_50720 64255 65253 gene locus_tag LOCUS_50730 64255 65253 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_50730 66121 65264 gene locus_tag LOCUS_50740 66121 65264 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_50740 67830 66133 gene locus_tag LOCUS_50750 gene nadB 67830 66133 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U5 protein_id gnl|my_center|LOCUS_50750 67958 68770 gene locus_tag LOCUS_50760 67958 68770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 68780 70585 gene locus_tag LOCUS_50770 68780 70585 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_50770 70594 73476 gene locus_tag LOCUS_50780 70594 73476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 74482 73478 gene locus_tag LOCUS_50790 74482 73478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 77051 74505 gene locus_tag LOCUS_50800 77051 74505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 78773 77070 gene locus_tag LOCUS_50810 78773 77070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 80384 78783 gene locus_tag LOCUS_50820 80384 78783 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_50820 80486 81076 gene locus_tag LOCUS_50830 80486 81076 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_50830 81073 82929 gene locus_tag LOCUS_50840 81073 82929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 82934 87535 gene locus_tag LOCUS_50850 82934 87535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 88794 88009 gene locus_tag LOCUS_50860 88794 88009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 88921 89523 gene locus_tag LOCUS_50870 88921 89523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 89523 90779 gene locus_tag LOCUS_50880 89523 90779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 90846 92672 gene locus_tag LOCUS_50890 90846 92672 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_50890 92936 93226 gene locus_tag LOCUS_50900 92936 93226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 93426 93500 gene locus_tag LOCUS_t00520 93426 93500 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 93503 93578 gene locus_tag LOCUS_t00530 93503 93578 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 93590 93666 gene locus_tag LOCUS_t00540 93590 93666 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 93676 93751 gene locus_tag LOCUS_t00550 93676 93751 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 93820 93896 gene locus_tag LOCUS_t00560 93820 93896 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 93954 94031 gene locus_tag LOCUS_t00570 93954 94031 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 94034 94107 gene locus_tag LOCUS_t00580 94034 94107 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 94117 94192 gene locus_tag LOCUS_t00590 94117 94192 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 94466 95014 gene locus_tag LOCUS_50910 94466 95014 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_50910 95128 95634 gene locus_tag LOCUS_50920 gene aroK 95128 95634 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL5 protein_id gnl|my_center|LOCUS_50920 95631 96374 gene locus_tag LOCUS_50930 95631 96374 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_50930 96388 96741 gene locus_tag LOCUS_50940 96388 96741 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_50940 96745 97821 gene locus_tag LOCUS_50950 96745 97821 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_50950 97827 98741 gene locus_tag LOCUS_50960 gene menB 97827 98741 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYX3 protein_id gnl|my_center|LOCUS_50960 99415 98771 gene locus_tag LOCUS_50970 99415 98771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 100658 100194 gene locus_tag LOCUS_50980 100658 100194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 101933 100731 gene locus_tag LOCUS_50990 101933 100731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 103565 102117 gene locus_tag LOCUS_51000 103565 102117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 104058 103858 gene locus_tag LOCUS_51010 104058 103858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 104643 105797 gene locus_tag LOCUS_51020 gene sbcD 104643 105797 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23479 protein_id gnl|my_center|LOCUS_51020 105813 108236 gene locus_tag LOCUS_51030 105813 108236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 108288 111566 gene locus_tag LOCUS_51040 gene sucA 108288 111566 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_51040 116417 111606 gene locus_tag LOCUS_51050 116417 111606 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_51050 116573 117040 gene locus_tag LOCUS_51060 116573 117040 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_51060 117092 117637 gene locus_tag LOCUS_51070 117092 117637 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223688.1 protein_id gnl|my_center|LOCUS_51070 117731 117916 gene locus_tag LOCUS_51080 gene rpmF 117731 117916 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_51080 117918 118931 gene locus_tag LOCUS_51090 gene plsX 117918 118931 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67186 protein_id gnl|my_center|LOCUS_51090 118956 119897 gene locus_tag LOCUS_51100 gene fabD-2 118956 119897 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_51100 119938 120681 gene locus_tag LOCUS_51110 gene fabG 119938 120681 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_51110 120768 121010 gene locus_tag LOCUS_51120 gene acpP 120768 121010 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_51120 121040 122296 gene locus_tag LOCUS_51130 121040 122296 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_51130 122314 123282 gene locus_tag LOCUS_51140 122314 123282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 124915 123329 gene locus_tag LOCUS_51150 124915 123329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_51150 125889 124954 gene locus_tag LOCUS_51160 gene pyrF 125889 124954 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_51160 126908 125898 gene locus_tag LOCUS_51170 126908 125898 CDS product oxidoreductase ion channel protein IolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 protein_id gnl|my_center|LOCUS_51170 126903 128942 gene locus_tag LOCUS_51180 126903 128942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 129400 132279 gene locus_tag LOCUS_51190 gene ileS 129400 132279 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AR5 protein_id gnl|my_center|LOCUS_51190 132431 135928 gene locus_tag LOCUS_51200 132431 135928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 135925 137592 gene locus_tag LOCUS_51210 135925 137592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 137613 139361 gene locus_tag LOCUS_51220 137613 139361 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_51220 139372 142353 gene locus_tag LOCUS_51230 139372 142353 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_51230 142945 142358 gene locus_tag LOCUS_51240 142945 142358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_51240 143506 142952 gene locus_tag LOCUS_51250 143506 142952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351096.1 protein_id gnl|my_center|LOCUS_51250 149213 143517 gene locus_tag LOCUS_51260 149213 143517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530879.1 protein_id gnl|my_center|LOCUS_51260 150110 150865 gene locus_tag LOCUS_51270 150110 150865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 <151814 150932 gene locus_tag LOCUS_51280 <151814 150932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390968.1:TonB-dependent receptor >Feature sequence27 1919 1293 gene locus_tag LOCUS_51290 gene hisG 1919 1293 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM15 protein_id gnl|my_center|LOCUS_51290 2905 1916 gene locus_tag LOCUS_51300 gene hisZ 2905 1916 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV6 protein_id gnl|my_center|LOCUS_51300 4386 2902 gene locus_tag LOCUS_51310 4386 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 6010 4661 gene locus_tag LOCUS_51320 6010 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 6098 7453 gene locus_tag LOCUS_51330 6098 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 7508 8341 gene locus_tag LOCUS_51340 7508 8341 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_51340 8427 9791 gene locus_tag LOCUS_51350 8427 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 11569 10346 gene locus_tag LOCUS_51360 11569 10346 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_51360 13919 11661 gene locus_tag LOCUS_51370 13919 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 14409 13984 gene locus_tag LOCUS_51380 gene ndk 14409 13984 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP5 protein_id gnl|my_center|LOCUS_51380 15139 14429 gene locus_tag LOCUS_51390 15139 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 16033 15164 gene locus_tag LOCUS_51400 gene sucD 16033 15164 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EA4 protein_id gnl|my_center|LOCUS_51400 17240 16044 gene locus_tag LOCUS_51410 gene sucC 17240 16044 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_51410 18945 17374 gene locus_tag LOCUS_51420 18945 17374 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_51420 20043 18973 gene locus_tag LOCUS_51430 20043 18973 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_51430 20645 20040 gene locus_tag LOCUS_51440 20645 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 21907 20702 gene locus_tag LOCUS_51450 21907 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_51450 22383 21904 gene locus_tag LOCUS_51460 gene moaC 22383 21904 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_51460 22507 23133 gene locus_tag LOCUS_51470 22507 23133 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_51470 23549 23262 gene locus_tag LOCUS_51480 gene hupB 23549 23262 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_51480 25141 23747 gene locus_tag LOCUS_51490 gene rsmB 25141 23747 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_51490 26138 25176 gene locus_tag LOCUS_51500 gene fmt 26138 25176 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_51500 27604 26183 gene locus_tag LOCUS_51510 27604 26183 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_51510 28561 27638 gene locus_tag LOCUS_51520 28561 27638 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_51520 28646 29416 gene locus_tag LOCUS_51530 28646 29416 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_51530 29413 30738 gene locus_tag LOCUS_51540 gene trmFO 29413 30738 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_51540 30726 31667 gene locus_tag LOCUS_51550 gene xerC 30726 31667 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 protein_id gnl|my_center|LOCUS_51550 31690 32613 gene locus_tag LOCUS_51560 31690 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 32681 33715 gene locus_tag LOCUS_51570 32681 33715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 36197 33687 gene locus_tag LOCUS_51580 36197 33687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143648.1 protein_id gnl|my_center|LOCUS_51580 37130 36228 gene locus_tag LOCUS_51590 37130 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 38750 37173 gene locus_tag LOCUS_51600 38750 37173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 41022 38794 gene locus_tag LOCUS_51610 41022 38794 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_51610 41728 41060 gene locus_tag LOCUS_51620 41728 41060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 41769 42281 gene locus_tag LOCUS_51630 gene smpB 41769 42281 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_51630 43952 42315 gene locus_tag LOCUS_51640 gene chvG 43952 42315 CDS product sensor protein ChvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07737 protein_id gnl|my_center|LOCUS_51640 44412 43966 gene locus_tag LOCUS_51650 44412 43966 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD2 protein_id gnl|my_center|LOCUS_51650 45230 44466 gene locus_tag LOCUS_51660 45230 44466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_51660 45569 45396 gene locus_tag LOCUS_51670 45569 45396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 46291 48672 gene locus_tag LOCUS_51680 46291 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 49175 49579 gene locus_tag LOCUS_51690 49175 49579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 49956 50837 gene locus_tag LOCUS_51700 49956 50837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 51361 50834 gene locus_tag LOCUS_51710 51361 50834 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_51710 51479 51967 gene locus_tag LOCUS_51720 gene ogt 51479 51967 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73R74 protein_id gnl|my_center|LOCUS_51720 52516 51971 gene locus_tag LOCUS_51730 52516 51971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 54861 52528 gene locus_tag LOCUS_51740 54861 52528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 55840 54992 gene locus_tag LOCUS_51750 55840 54992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 59286 55840 gene locus_tag LOCUS_51760 59286 55840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 59426 62821 gene locus_tag LOCUS_51770 59426 62821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 62825 63037 gene locus_tag LOCUS_51780 62825 63037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 63163 63363 gene locus_tag LOCUS_51790 63163 63363 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_51790 63365 64246 gene locus_tag LOCUS_51800 63365 64246 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_51800 64275 65336 gene locus_tag LOCUS_51810 gene argC 64275 65336 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD17 protein_id gnl|my_center|LOCUS_51810 65333 66172 gene locus_tag LOCUS_51820 65333 66172 CDS product putative acetylglutamate kinase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUG6 protein_id gnl|my_center|LOCUS_51820 66169 67341 gene locus_tag LOCUS_51830 gene argD 66169 67341 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH5 protein_id gnl|my_center|LOCUS_51830 67338 68558 gene locus_tag LOCUS_51840 67338 68558 CDS product acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_51840 68648 70639 gene locus_tag LOCUS_51850 68648 70639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 70766 71356 gene locus_tag LOCUS_51860 70766 71356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 71664 71359 gene locus_tag LOCUS_51870 71664 71359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 72162 71701 gene locus_tag LOCUS_51880 72162 71701 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_51880 73418 72162 gene locus_tag LOCUS_51890 73418 72162 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_51890 74764 73436 gene locus_tag LOCUS_51900 74764 73436 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_51900 75508 74765 gene locus_tag LOCUS_51910 75508 74765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_51910 77024 75579 gene locus_tag LOCUS_51920 gene ycf24 77024 75579 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_51920 77540 77052 gene locus_tag LOCUS_51930 77540 77052 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_51930 78467 77739 gene locus_tag LOCUS_51940 78467 77739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 78586 79344 gene locus_tag LOCUS_51950 78586 79344 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_51950 79359 81098 gene locus_tag LOCUS_51960 79359 81098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 81250 82002 gene locus_tag LOCUS_51970 81250 82002 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857879.1 protein_id gnl|my_center|LOCUS_51970 83800 82496 gene locus_tag LOCUS_51980 83800 82496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 84027 84767 gene locus_tag LOCUS_51990 84027 84767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 84764 85492 gene locus_tag LOCUS_52000 84764 85492 CDS product cytochrome C biogenesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_52000 85492 86184 gene locus_tag LOCUS_52010 85492 86184 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_52010 86177 86314 gene locus_tag LOCUS_52020 86177 86314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 86311 86793 gene locus_tag LOCUS_52030 gene ccmE 86311 86793 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIG4 protein_id gnl|my_center|LOCUS_52030 86795 88801 gene locus_tag LOCUS_52040 86795 88801 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_52040 88798 89310 gene locus_tag LOCUS_52050 88798 89310 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_52050 89310 89981 gene locus_tag LOCUS_52060 89310 89981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 89978 91381 gene locus_tag LOCUS_52070 89978 91381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 93070 91382 gene locus_tag LOCUS_52080 93070 91382 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104467.1 protein_id gnl|my_center|LOCUS_52080 93497 93075 gene locus_tag LOCUS_52090 93497 93075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 93650 96307 gene locus_tag LOCUS_52100 93650 96307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 98752 96311 gene locus_tag LOCUS_52110 98752 96311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 100322 98919 gene locus_tag LOCUS_52120 100322 98919 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_52120 100541 100831 gene locus_tag LOCUS_52130 100541 100831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 100863 102230 gene locus_tag LOCUS_52140 100863 102230 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_52140 103441 104175 gene locus_tag LOCUS_52150 103441 104175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 104189 105115 gene locus_tag LOCUS_52160 104189 105115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_52160 107368 108699 gene locus_tag LOCUS_52170 107368 108699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 109639 109211 gene locus_tag LOCUS_52180 109639 109211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 109687 111315 gene locus_tag LOCUS_52190 109687 111315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 113528 111312 gene locus_tag LOCUS_52200 gene relA 113528 111312 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_52200 113651 114529 gene locus_tag LOCUS_52210 113651 114529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 114531 115529 gene locus_tag LOCUS_52220 114531 115529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_52220 116923 115859 gene locus_tag LOCUS_52230 gene mexH 116923 115859 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_52230 117707 116967 gene locus_tag LOCUS_52240 117707 116967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 120479 117714 gene locus_tag LOCUS_52250 120479 117714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 121408 120476 gene locus_tag LOCUS_52260 121408 120476 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_52260 122199 121549 gene locus_tag LOCUS_52270 gene ypmQ 122199 121549 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_52270 123104 122214 gene locus_tag LOCUS_52280 gene ctaB 123104 122214 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_52280 123374 123862 gene locus_tag LOCUS_52290 123374 123862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 123877 128946 gene locus_tag LOCUS_52300 123877 128946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 128950 129738 gene locus_tag LOCUS_52310 128950 129738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 129751 130227 gene locus_tag LOCUS_52320 129751 130227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 131714 130398 gene locus_tag LOCUS_52330 131714 130398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 133093 131729 gene locus_tag LOCUS_52340 133093 131729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 133665 133096 gene locus_tag LOCUS_52350 133665 133096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 133754 134263 gene locus_tag LOCUS_52360 133754 134263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 134266 135168 gene locus_tag LOCUS_52370 134266 135168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 139060 135713 gene locus_tag LOCUS_52380 139060 135713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 139342 139800 gene locus_tag LOCUS_52390 139342 139800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 140127 139834 gene locus_tag LOCUS_52400 140127 139834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 >Feature sequence28 480 1079 gene locus_tag LOCUS_52410 480 1079 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_52410 1094 3184 gene locus_tag LOCUS_52420 1094 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 3889 3191 gene locus_tag LOCUS_52430 3889 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 5721 4357 gene locus_tag LOCUS_52440 5721 4357 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_52440 7366 5714 gene locus_tag LOCUS_52450 7366 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 7485 8699 gene locus_tag LOCUS_52460 gene pgk 7485 8699 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_52460 8696 9439 gene locus_tag LOCUS_52470 gene tpiA 8696 9439 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 protein_id gnl|my_center|LOCUS_52470 9568 10071 gene locus_tag LOCUS_52480 9568 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 10146 10232 gene locus_tag LOCUS_t00600 10146 10232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10305 10736 gene locus_tag LOCUS_52490 10305 10736 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_52490 10775 12514 gene locus_tag LOCUS_52500 10775 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 12522 14117 gene locus_tag LOCUS_52510 12522 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 14813 14118 gene locus_tag LOCUS_52520 gene msrA 14813 14118 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_52520 15119 15559 gene locus_tag LOCUS_52530 gene mraZ 15119 15559 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK88 protein_id gnl|my_center|LOCUS_52530 15593 16531 gene locus_tag LOCUS_52540 gene mraW 15593 16531 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DED4 protein_id gnl|my_center|LOCUS_52540 16549 16935 gene locus_tag LOCUS_52550 16549 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 16932 18923 gene locus_tag LOCUS_52560 gene ftsI 16932 18923 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_52560 18923 20419 gene locus_tag LOCUS_52570 gene murE 18923 20419 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_52570 20412 21851 gene locus_tag LOCUS_52580 gene murF 20412 21851 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBF2 protein_id gnl|my_center|LOCUS_52580 21851 22936 gene locus_tag LOCUS_52590 gene mraY 21851 22936 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728U5 protein_id gnl|my_center|LOCUS_52590 22947 24047 gene locus_tag LOCUS_52600 gene spoVE 22947 24047 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07373 protein_id gnl|my_center|LOCUS_52600 24044 25120 gene locus_tag LOCUS_52610 gene murG 24044 25120 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_52610 25113 26516 gene locus_tag LOCUS_52620 gene murC 25113 26516 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_52620 26513 27433 gene locus_tag LOCUS_52630 26513 27433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 27446 28687 gene locus_tag LOCUS_52640 gene ftsA 27446 28687 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_52640 28739 30175 gene locus_tag LOCUS_52650 28739 30175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 30644 30198 gene locus_tag LOCUS_52660 gene vapC33 30644 30198 CDS product ribonuclease VapC33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF69 protein_id gnl|my_center|LOCUS_52660 30907 30641 gene locus_tag LOCUS_52670 30907 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 31592 31083 gene locus_tag LOCUS_52680 31592 31083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 31689 32123 gene locus_tag LOCUS_52690 31689 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 32180 33970 gene locus_tag LOCUS_52700 32180 33970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 34801 35301 gene locus_tag LOCUS_52710 34801 35301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 35246 35854 gene locus_tag LOCUS_52720 35246 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 36781 36077 gene locus_tag LOCUS_52730 gene drrA 36781 36077 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_52730 38723 36771 gene locus_tag LOCUS_52740 38723 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 38946 39602 gene locus_tag LOCUS_52750 38946 39602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 41343 39847 gene locus_tag LOCUS_52760 41343 39847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 42795 41371 gene locus_tag LOCUS_52770 42795 41371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 43574 42795 gene locus_tag LOCUS_52780 43574 42795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_52780 45093 43606 gene locus_tag LOCUS_52790 45093 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 45861 45283 gene locus_tag LOCUS_52800 45861 45283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 47016 45964 gene locus_tag LOCUS_52810 47016 45964 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_52810 47210 48751 gene locus_tag LOCUS_52820 47210 48751 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_52820 48748 49956 gene locus_tag LOCUS_52830 48748 49956 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_52830 49970 51418 gene locus_tag LOCUS_52840 49970 51418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 51562 52110 gene locus_tag LOCUS_52850 51562 52110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 53372 52194 gene locus_tag LOCUS_52860 53372 52194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 55333 53357 gene locus_tag LOCUS_52870 55333 53357 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390858.1 protein_id gnl|my_center|LOCUS_52870 58374 55483 gene locus_tag LOCUS_52880 58374 55483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 60506 58761 gene locus_tag LOCUS_52890 60506 58761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 61000 60503 gene locus_tag LOCUS_52900 61000 60503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 61204 62316 gene locus_tag LOCUS_52910 61204 62316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 62321 63415 gene locus_tag LOCUS_52920 62321 63415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 63508 64434 gene locus_tag LOCUS_52930 63508 64434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 64481 64957 gene locus_tag LOCUS_52940 64481 64957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 65100 65444 gene locus_tag LOCUS_52950 65100 65444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 66307 65477 gene locus_tag LOCUS_52960 66307 65477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 66564 68945 gene locus_tag LOCUS_52970 66564 68945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 69240 69001 gene locus_tag LOCUS_52980 69240 69001 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_52980 69356 70891 gene locus_tag LOCUS_52990 69356 70891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 71659 70922 gene locus_tag LOCUS_53000 71659 70922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 74666 71652 gene locus_tag LOCUS_53010 74666 71652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 74753 76138 gene locus_tag LOCUS_53020 74753 76138 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861820.1 protein_id gnl|my_center|LOCUS_53020 76272 76577 gene locus_tag LOCUS_53030 76272 76577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 76677 77249 gene locus_tag LOCUS_53040 76677 77249 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_53040 77280 79721 gene locus_tag LOCUS_53050 77280 79721 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_53050 79839 81176 gene locus_tag LOCUS_53060 79839 81176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 81319 83019 gene locus_tag LOCUS_53070 81319 83019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 84413 83049 gene locus_tag LOCUS_53080 84413 83049 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_53080 84578 85501 gene locus_tag LOCUS_53090 84578 85501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 87025 85550 gene locus_tag LOCUS_53100 87025 85550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 87131 88660 gene locus_tag LOCUS_53110 87131 88660 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_53110 90206 88632 gene locus_tag LOCUS_53120 90206 88632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 91773 90223 gene locus_tag LOCUS_53130 91773 90223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 93045 91774 gene locus_tag LOCUS_53140 93045 91774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142896.1 protein_id gnl|my_center|LOCUS_53140 95048 93843 gene locus_tag LOCUS_53150 gene argG 95048 93843 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_53150 95644 95051 gene locus_tag LOCUS_53160 95644 95051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 97089 95644 gene locus_tag LOCUS_53170 97089 95644 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H2 protein_id gnl|my_center|LOCUS_53170 97367 97086 gene locus_tag LOCUS_53180 97367 97086 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_53180 98518 97373 gene locus_tag LOCUS_53190 gene pntA 98518 97373 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_53190 99474 98656 gene locus_tag LOCUS_53200 99474 98656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_53200 99934 99608 gene locus_tag LOCUS_53210 99934 99608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_53210 100377 99931 gene locus_tag LOCUS_53220 100377 99931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 101006 100389 gene locus_tag LOCUS_53230 gene sigW 101006 100389 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_53230 101066 101998 gene locus_tag LOCUS_53240 101066 101998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 103357 102155 gene locus_tag LOCUS_53250 103357 102155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 107237 103827 gene locus_tag LOCUS_53260 107237 103827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 108156 107347 gene locus_tag LOCUS_53270 108156 107347 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFQ6 protein_id gnl|my_center|LOCUS_53270 108222 109031 gene locus_tag LOCUS_53280 108222 109031 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_53280 109089 110816 gene locus_tag LOCUS_53290 109089 110816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 110909 113110 gene locus_tag LOCUS_53300 110909 113110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 113101 114069 gene locus_tag LOCUS_53310 113101 114069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 115200 114085 gene locus_tag LOCUS_53320 115200 114085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 115384 116250 gene locus_tag LOCUS_53330 115384 116250 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_53330 118495 116270 gene locus_tag LOCUS_53340 118495 116270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 118884 118495 gene locus_tag LOCUS_53350 118884 118495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 119024 120421 gene locus_tag LOCUS_53360 119024 120421 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865396.1 protein_id gnl|my_center|LOCUS_53360 120414 121835 gene locus_tag LOCUS_53370 120414 121835 CDS product ketoisovalerate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_53370 123619 122162 gene locus_tag LOCUS_53380 123619 122162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 125334 123616 gene locus_tag LOCUS_53390 125334 123616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 128459 125436 gene locus_tag LOCUS_53400 128459 125436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 128782 129588 gene locus_tag LOCUS_53410 gene trmJ 128782 129588 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_53410 131342 129624 gene locus_tag LOCUS_53420 131342 129624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144164.1 protein_id gnl|my_center|LOCUS_53420 131494 132144 gene locus_tag LOCUS_53430 131494 132144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 132146 133753 gene locus_tag LOCUS_53440 132146 133753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 133764 134180 gene locus_tag LOCUS_53450 133764 134180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 135036 134164 gene locus_tag LOCUS_53460 135036 134164 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_53460 135222 136160 gene locus_tag LOCUS_53470 135222 136160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 136245 136318 gene locus_tag LOCUS_t00610 136245 136318 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 136869 136510 gene locus_tag LOCUS_53480 136869 136510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 139326 136990 gene locus_tag LOCUS_53490 139326 136990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 139575 141989 gene locus_tag LOCUS_53500 139575 141989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 142083 142439 gene locus_tag LOCUS_53510 142083 142439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 142423 142812 gene locus_tag LOCUS_53520 142423 142812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 145876 142826 gene locus_tag LOCUS_53530 145876 142826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 147052 146033 gene locus_tag LOCUS_53540 147052 146033 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_53540 147191 150373 gene locus_tag LOCUS_53550 147191 150373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 150615 150385 gene locus_tag LOCUS_53560 150615 150385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 >Feature sequence29 1271 123 gene locus_tag LOCUS_53570 1271 123 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706662.1 protein_id gnl|my_center|LOCUS_53570 1432 5025 gene locus_tag LOCUS_53580 1432 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 5022 6359 gene locus_tag LOCUS_53590 5022 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 6363 8090 gene locus_tag LOCUS_53600 6363 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 8136 10427 gene locus_tag LOCUS_53610 8136 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 11015 10428 gene locus_tag LOCUS_53620 11015 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 11416 11105 gene locus_tag LOCUS_53630 11416 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 11610 13208 gene locus_tag LOCUS_53640 11610 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 14216 13938 gene locus_tag LOCUS_53650 14216 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 14109 15422 gene locus_tag LOCUS_53660 14109 15422 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200641.1 protein_id gnl|my_center|LOCUS_53660 18228 15463 gene locus_tag LOCUS_53670 18228 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 20166 18337 gene locus_tag LOCUS_53680 20166 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 21070 20180 gene locus_tag LOCUS_53690 21070 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 21315 22445 gene locus_tag LOCUS_53700 21315 22445 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_53700 22442 23134 gene locus_tag LOCUS_53710 gene lolD 22442 23134 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J04 protein_id gnl|my_center|LOCUS_53710 23168 39472 gene locus_tag LOCUS_53720 23168 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 39514 41943 gene locus_tag LOCUS_53730 39514 41943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_53730 42681 41950 gene locus_tag LOCUS_53740 42681 41950 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_53740 43202 42693 gene locus_tag LOCUS_53750 43202 42693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 43329 44957 gene locus_tag LOCUS_53760 43329 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 45210 45503 gene locus_tag LOCUS_53770 45210 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 45621 46739 gene locus_tag LOCUS_53780 45621 46739 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_53780 46732 47286 gene locus_tag LOCUS_53790 gene mogA 46732 47286 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_53790 50345 48192 gene locus_tag LOCUS_53800 50345 48192 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_53800 50837 50349 gene locus_tag LOCUS_53810 50837 50349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 50926 52422 gene locus_tag LOCUS_53820 50926 52422 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_53820 53781 52441 gene locus_tag LOCUS_53830 53781 52441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_53830 54925 53819 gene locus_tag LOCUS_53840 54925 53819 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_53840 55073 55435 gene locus_tag LOCUS_53850 55073 55435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 55436 56254 gene locus_tag LOCUS_53860 55436 56254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 56256 57560 gene locus_tag LOCUS_53870 56256 57560 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_53870 57557 58399 gene locus_tag LOCUS_53880 57557 58399 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_53880 58421 59719 gene locus_tag LOCUS_53890 58421 59719 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_53890 59730 60842 gene locus_tag LOCUS_53900 59730 60842 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_53900 60930 61793 gene locus_tag LOCUS_53910 60930 61793 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118351.1 protein_id gnl|my_center|LOCUS_53910 62717 61809 gene locus_tag LOCUS_53920 62717 61809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 62768 62690 gene locus_tag LOCUS_t00620 62768 62690 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62855 62778 gene locus_tag LOCUS_t00630 62855 62778 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64946 63201 gene locus_tag LOCUS_53930 64946 63201 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_53930 65047 66033 gene locus_tag LOCUS_53940 gene hemB 65047 66033 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW7 protein_id gnl|my_center|LOCUS_53940 66030 67298 gene locus_tag LOCUS_53950 gene hemL 66030 67298 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_53950 67408 67665 gene locus_tag LOCUS_53960 67408 67665 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_53960 67795 68898 gene locus_tag LOCUS_53970 67795 68898 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_53970 68974 69360 gene locus_tag LOCUS_53980 gene gcvH 68974 69360 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_53980 69357 69845 gene locus_tag LOCUS_53990 69357 69845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 69842 71206 gene locus_tag LOCUS_54000 69842 71206 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_54000 71176 72582 gene locus_tag LOCUS_54010 71176 72582 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_54010 72552 73670 gene locus_tag LOCUS_54020 72552 73670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 73677 74420 gene locus_tag LOCUS_54030 73677 74420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104212.1 protein_id gnl|my_center|LOCUS_54030 74417 75970 gene locus_tag LOCUS_54040 74417 75970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 protein_id gnl|my_center|LOCUS_54040 75967 77316 gene locus_tag LOCUS_54050 75967 77316 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_54050 77313 78698 gene locus_tag LOCUS_54060 77313 78698 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_54060 79593 78991 gene locus_tag LOCUS_54070 79593 78991 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_54070 82559 79596 gene locus_tag LOCUS_54080 82559 79596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 82722 84407 gene locus_tag LOCUS_54090 82722 84407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 85886 84411 gene locus_tag LOCUS_54100 85886 84411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 86918 85998 gene locus_tag LOCUS_54110 gene rhaT 86918 85998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124908.1 protein_id gnl|my_center|LOCUS_54110 87040 90516 gene locus_tag LOCUS_54120 87040 90516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 90909 90529 gene locus_tag LOCUS_54130 90909 90529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 96686 90906 gene locus_tag LOCUS_54140 96686 90906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 96879 97463 gene locus_tag LOCUS_54150 96879 97463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_54150 99236 97908 gene locus_tag LOCUS_54160 99236 97908 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_54160 99696 99986 gene locus_tag LOCUS_54170 99696 99986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 102137 100170 gene locus_tag LOCUS_54180 102137 100170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 102346 103725 gene locus_tag LOCUS_54190 102346 103725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_54190 103722 104915 gene locus_tag LOCUS_54200 gene alr 103722 104915 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_54200 108157 105002 gene locus_tag LOCUS_54210 108157 105002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 110801 108327 gene locus_tag LOCUS_54220 110801 108327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 111604 110798 gene locus_tag LOCUS_54230 111604 110798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 112444 111665 gene locus_tag LOCUS_54240 112444 111665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 112588 113322 gene locus_tag LOCUS_54250 112588 113322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_54250 114024 113341 gene locus_tag LOCUS_54260 114024 113341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 115493 114021 gene locus_tag LOCUS_54270 115493 114021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 115799 115545 gene locus_tag LOCUS_54280 115799 115545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 116503 117444 gene locus_tag LOCUS_54290 116503 117444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 118781 117882 gene locus_tag LOCUS_54300 118781 117882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_54300 120814 118799 gene locus_tag LOCUS_54310 120814 118799 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_54310 122991 120880 gene locus_tag LOCUS_54320 122991 120880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 124074 123148 gene locus_tag LOCUS_54330 124074 123148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 124206 125090 gene locus_tag LOCUS_54340 124206 125090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 125096 126217 gene locus_tag LOCUS_54350 125096 126217 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_54350 126254 127498 gene locus_tag LOCUS_54360 126254 127498 CDS product trans-homoaconitate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978517.1 protein_id gnl|my_center|LOCUS_54360 127582 128442 gene locus_tag LOCUS_54370 gene xerD 127582 128442 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB4 protein_id gnl|my_center|LOCUS_54370 128471 128848 gene locus_tag LOCUS_54380 128471 128848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 129990 128845 gene locus_tag LOCUS_54390 129990 128845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 130136 132001 gene locus_tag LOCUS_54400 gene argS 130136 132001 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P28 protein_id gnl|my_center|LOCUS_54400 132011 133504 gene locus_tag LOCUS_54410 132011 133504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 134024 133479 gene locus_tag LOCUS_54420 134024 133479 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH37 protein_id gnl|my_center|LOCUS_54420 135508 134054 gene locus_tag LOCUS_54430 135508 134054 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_54430 137799 135574 gene locus_tag LOCUS_54440 137799 135574 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_54440 137910 138734 gene locus_tag LOCUS_54450 gene proC 137910 138734 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_54450 138833 141004 gene locus_tag LOCUS_54460 138833 141004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 141182 143179 gene locus_tag LOCUS_54470 141182 143179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 143160 143525 gene locus_tag LOCUS_54480 143160 143525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 >Feature sequence30 1487 591 gene locus_tag LOCUS_54490 1487 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 1666 1580 gene locus_tag LOCUS_t00640 1666 1580 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2050 2664 gene locus_tag LOCUS_54500 2050 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 3023 5422 gene locus_tag LOCUS_54510 gene priA 3023 5422 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_54510 5612 6694 gene locus_tag LOCUS_54520 5612 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_54520 6725 8167 gene locus_tag LOCUS_54530 6725 8167 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_54530 8182 9366 gene locus_tag LOCUS_54540 8182 9366 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_54540 9363 10532 gene locus_tag LOCUS_54550 9363 10532 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_54550 10529 11884 gene locus_tag LOCUS_54560 gene hemN 10529 11884 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_54560 11973 14771 gene locus_tag LOCUS_54570 11973 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 15428 16411 gene locus_tag LOCUS_54580 15428 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 16451 16846 gene locus_tag LOCUS_54590 16451 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 16854 17633 gene locus_tag LOCUS_54600 16854 17633 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_54600 17636 18160 gene locus_tag LOCUS_54610 17636 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 20350 20631 gene locus_tag LOCUS_54620 20350 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 22506 21505 gene locus_tag LOCUS_54630 22506 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 22825 22517 gene locus_tag LOCUS_54640 22825 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 24740 22827 gene locus_tag LOCUS_54650 24740 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 24767 25534 gene locus_tag LOCUS_54660 24767 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 25534 26802 gene locus_tag LOCUS_54670 25534 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 26799 28292 gene locus_tag LOCUS_54680 26799 28292 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888197.1 protein_id gnl|my_center|LOCUS_54680 29641 28244 gene locus_tag LOCUS_54690 29641 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 29782 30768 gene locus_tag LOCUS_54700 gene moxR 29782 30768 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_54700 30771 32123 gene locus_tag LOCUS_54710 30771 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 32120 33943 gene locus_tag LOCUS_54720 32120 33943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 34004 34657 gene locus_tag LOCUS_54730 34004 34657 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_54730 34669 35409 gene locus_tag LOCUS_54740 34669 35409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 35550 38504 gene locus_tag LOCUS_54750 35550 38504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_54750 39354 38722 gene locus_tag LOCUS_54760 39354 38722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 40269 39370 gene locus_tag LOCUS_54770 40269 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 41656 40334 gene locus_tag LOCUS_54780 41656 40334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 41785 42468 gene locus_tag LOCUS_54790 41785 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 42477 44579 gene locus_tag LOCUS_54800 42477 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 45609 44551 gene locus_tag LOCUS_54810 45609 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_54810 45726 47495 gene locus_tag LOCUS_54820 45726 47495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 47492 49060 gene locus_tag LOCUS_54830 47492 49060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 51402 49651 gene locus_tag LOCUS_54840 51402 49651 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_54840 51926 51408 gene locus_tag LOCUS_54850 51926 51408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120318.1 protein_id gnl|my_center|LOCUS_54850 53168 52011 gene locus_tag LOCUS_54860 gene argE 53168 52011 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_54860 53226 53918 gene locus_tag LOCUS_54870 gene lolD1 53226 53918 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_54870 55321 53930 gene locus_tag LOCUS_54880 55321 53930 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_54880 55400 56626 gene locus_tag LOCUS_54890 55400 56626 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_54890 56820 58202 gene locus_tag LOCUS_54900 56820 58202 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_54900 58799 58224 gene locus_tag LOCUS_54910 58799 58224 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_54910 61401 58792 gene locus_tag LOCUS_54920 61401 58792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 61522 62577 gene locus_tag LOCUS_54930 61522 62577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 63904 62600 gene locus_tag LOCUS_54940 63904 62600 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_54940 64200 63901 gene locus_tag LOCUS_54950 64200 63901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 64141 64674 gene locus_tag LOCUS_54960 64141 64674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 65147 64617 gene locus_tag LOCUS_54970 65147 64617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 65336 67741 gene locus_tag LOCUS_54980 65336 67741 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_54980 67738 68271 gene locus_tag LOCUS_54990 67738 68271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 68326 70734 gene locus_tag LOCUS_55000 68326 70734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_55000 71453 70737 gene locus_tag LOCUS_55010 71453 70737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 71822 73681 gene locus_tag LOCUS_55020 71822 73681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 74514 73708 gene locus_tag LOCUS_55030 74514 73708 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_55030 76438 74534 gene locus_tag LOCUS_55040 76438 74534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 77253 76438 gene locus_tag LOCUS_55050 77253 76438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 78080 77265 gene locus_tag LOCUS_55060 78080 77265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 79226 78126 gene locus_tag LOCUS_55070 79226 78126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 80086 79391 gene locus_tag LOCUS_55080 80086 79391 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_55080 80244 81692 gene locus_tag LOCUS_55090 gene pyk 80244 81692 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_55090 81806 83518 gene locus_tag LOCUS_55100 81806 83518 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_55100 83605 84537 gene locus_tag LOCUS_55110 83605 84537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_55110 84537 85886 gene locus_tag LOCUS_55120 84537 85886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 85883 87073 gene locus_tag LOCUS_55130 85883 87073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 87106 89283 gene locus_tag LOCUS_55140 87106 89283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 89544 89350 gene locus_tag LOCUS_55150 89544 89350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 90417 91541 gene locus_tag LOCUS_55160 90417 91541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 91612 91836 gene locus_tag LOCUS_55170 91612 91836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 92330 92509 gene locus_tag LOCUS_55180 92330 92509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 93240 92605 gene locus_tag LOCUS_55190 93240 92605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 94333 93221 gene locus_tag LOCUS_55200 94333 93221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 94406 94657 gene locus_tag LOCUS_55210 94406 94657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 95187 99995 gene locus_tag LOCUS_55220 95187 99995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 100403 102532 gene locus_tag LOCUS_55230 100403 102532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 106413 102664 gene locus_tag LOCUS_55240 106413 102664 CDS product type I restriction-modification system, restriction (R) subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_55240 107729 106410 gene locus_tag LOCUS_55250 107729 106410 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_55250 110068 107726 gene locus_tag LOCUS_55260 110068 107726 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704240.1 protein_id gnl|my_center|LOCUS_55260 111788 110721 gene locus_tag LOCUS_55270 111788 110721 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_55270 111911 113059 gene locus_tag LOCUS_55280 111911 113059 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_55280 113103 114371 gene locus_tag LOCUS_55290 113103 114371 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_55290 115390 114539 gene locus_tag LOCUS_55300 115390 114539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 115632 115459 gene locus_tag LOCUS_55310 115632 115459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 117701 115776 gene locus_tag LOCUS_55320 117701 115776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 118248 117703 gene locus_tag LOCUS_55330 118248 117703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 120606 118483 gene locus_tag LOCUS_55340 120606 118483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 121364 120603 gene locus_tag LOCUS_55350 121364 120603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 121458 123173 gene locus_tag LOCUS_55360 121458 123173 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_55360 124834 123170 gene locus_tag LOCUS_55370 124834 123170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 125249 124890 gene locus_tag LOCUS_55380 125249 124890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 125416 126213 gene locus_tag LOCUS_55390 gene fdhD 125416 126213 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_55390 128372 126246 gene locus_tag LOCUS_55400 128372 126246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 131199 128455 gene locus_tag LOCUS_55410 131199 128455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 131406 132617 gene locus_tag LOCUS_55420 131406 132617 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0R6 protein_id gnl|my_center|LOCUS_55420 133478 132639 gene locus_tag LOCUS_55430 133478 132639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 >Feature sequence31 952 239 gene locus_tag LOCUS_55440 gene rnc 952 239 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_55440 2937 1021 gene locus_tag LOCUS_55450 gene mutL 2937 1021 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAX3 protein_id gnl|my_center|LOCUS_55450 5033 2934 gene locus_tag LOCUS_55460 gene glyS 5033 2934 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKV5 protein_id gnl|my_center|LOCUS_55460 6072 5026 gene locus_tag LOCUS_55470 gene glyQ 6072 5026 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_55470 6876 6121 gene locus_tag LOCUS_55480 gene recO 6876 6121 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM9 protein_id gnl|my_center|LOCUS_55480 7944 6889 gene locus_tag LOCUS_55490 7944 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 8023 9303 gene locus_tag LOCUS_55500 8023 9303 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_55500 9306 9932 gene locus_tag LOCUS_55510 9306 9932 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCY3 protein_id gnl|my_center|LOCUS_55510 9929 10564 gene locus_tag LOCUS_55520 gene plsY 9929 10564 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_55520 10561 11571 gene locus_tag LOCUS_55530 gene gpsA 10561 11571 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_55530 12496 11534 gene locus_tag LOCUS_55540 12496 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 12766 13335 gene locus_tag LOCUS_55550 12766 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 14535 13357 gene locus_tag LOCUS_55560 14535 13357 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704422.1 protein_id gnl|my_center|LOCUS_55560 14591 16441 gene locus_tag LOCUS_55570 14591 16441 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_55570 16519 18426 gene locus_tag LOCUS_55580 16519 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 18447 19784 gene locus_tag LOCUS_55590 18447 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 20175 19876 gene locus_tag LOCUS_55600 20175 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 20370 22922 gene locus_tag LOCUS_55610 20370 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 23300 23046 gene locus_tag LOCUS_55620 23300 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 23506 23297 gene locus_tag LOCUS_55630 23506 23297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 25108 23561 gene locus_tag LOCUS_55640 25108 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 25623 25105 gene locus_tag LOCUS_55650 25623 25105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 26070 25765 gene locus_tag LOCUS_55660 26070 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 27741 26206 gene locus_tag LOCUS_55670 27741 26206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 27857 28246 gene locus_tag LOCUS_55680 gene apaG 27857 28246 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_55680 29347 28451 gene locus_tag LOCUS_55690 29347 28451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_55690 30012 29629 gene locus_tag LOCUS_55700 30012 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 30780 30166 gene locus_tag LOCUS_55710 30780 30166 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403113.1 protein_id gnl|my_center|LOCUS_55710 30833 34210 gene locus_tag LOCUS_55720 30833 34210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_55720 34207 35184 gene locus_tag LOCUS_55730 34207 35184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_55730 35181 36548 gene locus_tag LOCUS_55740 35181 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_55740 36558 37601 gene locus_tag LOCUS_55750 36558 37601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_55750 37614 38534 gene locus_tag LOCUS_55760 37614 38534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_55760 39995 42157 gene locus_tag LOCUS_55770 gene recD2 39995 42157 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_55770 43190 42171 gene locus_tag LOCUS_55780 43190 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 44087 43212 gene locus_tag LOCUS_55790 44087 43212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 45340 44087 gene locus_tag LOCUS_55800 45340 44087 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943131.1 protein_id gnl|my_center|LOCUS_55800 47097 45337 gene locus_tag LOCUS_55810 47097 45337 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943132.1 protein_id gnl|my_center|LOCUS_55810 46978 47220 gene locus_tag LOCUS_55820 46978 47220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 48970 47258 gene locus_tag LOCUS_55830 48970 47258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 50130 48967 gene locus_tag LOCUS_55840 50130 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 50720 50127 gene locus_tag LOCUS_55850 50720 50127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 52789 50741 gene locus_tag LOCUS_55860 52789 50741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 53959 52907 gene locus_tag LOCUS_55870 53959 52907 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_55870 56251 54134 gene locus_tag LOCUS_55880 56251 54134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 56803 56270 gene locus_tag LOCUS_55890 56803 56270 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_55890 57025 57909 gene locus_tag LOCUS_55900 57025 57909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 57995 61879 gene locus_tag LOCUS_55910 57995 61879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 62562 63908 gene locus_tag LOCUS_55920 62562 63908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 65035 63830 gene locus_tag LOCUS_55930 65035 63830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 66324 65032 gene locus_tag LOCUS_55940 gene adh 66324 65032 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_55940 66485 68911 gene locus_tag LOCUS_55950 66485 68911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_55950 69816 68965 gene locus_tag LOCUS_55960 69816 68965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 71637 69892 gene locus_tag LOCUS_55970 71637 69892 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_55970 72323 71634 gene locus_tag LOCUS_55980 72323 71634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 72805 72365 gene locus_tag LOCUS_55990 72805 72365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 73267 72908 gene locus_tag LOCUS_56000 73267 72908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 73148 75058 gene locus_tag LOCUS_56010 73148 75058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 75080 75994 gene locus_tag LOCUS_56020 75080 75994 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_56020 76043 76834 gene locus_tag LOCUS_56030 76043 76834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 76846 78276 gene locus_tag LOCUS_56040 76846 78276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 79993 78263 gene locus_tag LOCUS_56050 79993 78263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 82371 80092 gene locus_tag LOCUS_56060 gene maeB 82371 80092 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_56060 82436 82960 gene locus_tag LOCUS_56070 82436 82960 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 protein_id gnl|my_center|LOCUS_56070 82957 85068 gene locus_tag LOCUS_56080 82957 85068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 86116 85085 gene locus_tag LOCUS_56090 gene kch 86116 85085 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_56090 86281 86730 gene locus_tag LOCUS_56100 86281 86730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 87333 87980 gene locus_tag LOCUS_56110 87333 87980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_56110 89352 88168 gene locus_tag LOCUS_56120 89352 88168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_56120 90675 89368 gene locus_tag LOCUS_56130 90675 89368 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_56130 93039 90688 gene locus_tag LOCUS_56140 gene pbpC 93039 90688 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 protein_id gnl|my_center|LOCUS_56140 96443 93039 gene locus_tag LOCUS_56150 96443 93039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 96723 97238 gene locus_tag LOCUS_56160 96723 97238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 97902 97348 gene locus_tag LOCUS_56170 97902 97348 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427634.1 protein_id gnl|my_center|LOCUS_56170 97957 98202 gene locus_tag LOCUS_56180 97957 98202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 101300 98199 gene locus_tag LOCUS_56190 101300 98199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 102966 101347 gene locus_tag LOCUS_56200 102966 101347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 103061 103303 gene locus_tag LOCUS_56210 103061 103303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 104199 103312 gene locus_tag LOCUS_56220 104199 103312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 104496 105089 gene locus_tag LOCUS_56230 104496 105089 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_56230 105079 107412 gene locus_tag LOCUS_56240 105079 107412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 107582 109306 gene locus_tag LOCUS_56250 107582 109306 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_56250 109645 109310 gene locus_tag LOCUS_56260 109645 109310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 110035 109655 gene locus_tag LOCUS_56270 110035 109655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 111022 110048 gene locus_tag LOCUS_56280 111022 110048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_56280 112783 111044 gene locus_tag LOCUS_56290 112783 111044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 113913 112843 gene locus_tag LOCUS_56300 113913 112843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 116245 113945 gene locus_tag LOCUS_56310 116245 113945 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_56310 116937 116242 gene locus_tag LOCUS_56320 116937 116242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 117027 117782 gene locus_tag LOCUS_56330 117027 117782 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405125.1 protein_id gnl|my_center|LOCUS_56330 118701 117769 gene locus_tag LOCUS_56340 118701 117769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 120149 118704 gene locus_tag LOCUS_56350 120149 118704 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_56350 120187 121344 gene locus_tag LOCUS_56360 gene rffA 120187 121344 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJW2 protein_id gnl|my_center|LOCUS_56360 121337 122284 gene locus_tag LOCUS_56370 121337 122284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_56370 123217 122285 gene locus_tag LOCUS_56380 gene arnC 123217 122285 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT08 protein_id gnl|my_center|LOCUS_56380 124215 123214 gene locus_tag LOCUS_56390 124215 123214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 125183 124212 gene locus_tag LOCUS_56400 125183 124212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 126286 125180 gene locus_tag LOCUS_56410 126286 125180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 127830 126283 gene locus_tag LOCUS_56420 127830 126283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103407.1 protein_id gnl|my_center|LOCUS_56420 128564 127827 gene locus_tag LOCUS_56430 128564 127827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW5 protein_id gnl|my_center|LOCUS_56430 >Feature sequence32 3867 4604 gene locus_tag LOCUS_56440 3867 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 4615 6174 gene locus_tag LOCUS_56450 4615 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 6876 6286 gene locus_tag LOCUS_56460 6876 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 7251 8765 gene locus_tag LOCUS_56470 7251 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 8786 10087 gene locus_tag LOCUS_56480 8786 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_56480 11363 10101 gene locus_tag LOCUS_56490 gene ribBA 11363 10101 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_56490 11516 12748 gene locus_tag LOCUS_56500 gene sucB 11516 12748 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_56500 12745 14208 gene locus_tag LOCUS_56510 12745 14208 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_56510 14237 14992 gene locus_tag LOCUS_56520 14237 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 15758 16216 gene locus_tag LOCUS_56530 15758 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 16242 17930 gene locus_tag LOCUS_56540 16242 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 17921 18400 gene locus_tag LOCUS_56550 17921 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 18450 18665 gene locus_tag LOCUS_56560 18450 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 18925 19728 gene locus_tag LOCUS_56570 18925 19728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731381.1 protein_id gnl|my_center|LOCUS_56570 19746 20963 gene locus_tag LOCUS_56580 19746 20963 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_56580 21621 21100 gene locus_tag LOCUS_56590 gene apt 21621 21100 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_56590 21942 21643 gene locus_tag LOCUS_56600 21942 21643 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KMH9 protein_id gnl|my_center|LOCUS_56600 22603 21968 gene locus_tag LOCUS_56610 22603 21968 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_56610 23266 22616 gene locus_tag LOCUS_56620 gene pcm 23266 22616 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ5 protein_id gnl|my_center|LOCUS_56620 24109 23309 gene locus_tag LOCUS_56630 gene surE 24109 23309 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_56630 25027 24119 gene locus_tag LOCUS_56640 gene mtnP 25027 24119 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_56640 25271 27526 gene locus_tag LOCUS_56650 25271 27526 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_56650 27534 28568 gene locus_tag LOCUS_56660 gene fabH 27534 28568 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_56660 28577 30109 gene locus_tag LOCUS_56670 28577 30109 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_56670 30210 31247 gene locus_tag LOCUS_56680 30210 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 32941 31259 gene locus_tag LOCUS_56690 32941 31259 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP90 protein_id gnl|my_center|LOCUS_56690 33964 33089 gene locus_tag LOCUS_56700 33964 33089 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932506.1 protein_id gnl|my_center|LOCUS_56700 35163 33961 gene locus_tag LOCUS_56710 35163 33961 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_56710 35450 35160 gene locus_tag LOCUS_56720 35450 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 36507 35464 gene locus_tag LOCUS_56730 36507 35464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 37497 36526 gene locus_tag LOCUS_56740 37497 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 38825 37557 gene locus_tag LOCUS_56750 38825 37557 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868275.1 protein_id gnl|my_center|LOCUS_56750 39702 38914 gene locus_tag LOCUS_56760 39702 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 40612 39713 gene locus_tag LOCUS_56770 40612 39713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 42194 40620 gene locus_tag LOCUS_56780 42194 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 43319 43927 gene locus_tag LOCUS_56790 43319 43927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 43929 45257 gene locus_tag LOCUS_56800 43929 45257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 45232 46002 gene locus_tag LOCUS_56810 gene cutC 45232 46002 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q87 protein_id gnl|my_center|LOCUS_56810 46161 48203 gene locus_tag LOCUS_56820 46161 48203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 48223 51048 gene locus_tag LOCUS_56830 48223 51048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_56830 51058 51264 gene locus_tag LOCUS_56840 51058 51264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 51289 54552 gene locus_tag LOCUS_56850 51289 54552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 54568 55746 gene locus_tag LOCUS_56860 54568 55746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 55743 61940 gene locus_tag LOCUS_56870 55743 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 62295 61945 gene locus_tag LOCUS_56880 62295 61945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 64140 62311 gene locus_tag LOCUS_56890 64140 62311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 65375 64266 gene locus_tag LOCUS_56900 65375 64266 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 protein_id gnl|my_center|LOCUS_56900 66077 66376 gene locus_tag LOCUS_56910 66077 66376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 66345 68519 gene locus_tag LOCUS_56920 66345 68519 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_56920 68509 70713 gene locus_tag LOCUS_56930 68509 70713 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_56930 70729 72300 gene locus_tag LOCUS_56940 70729 72300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 72297 72836 gene locus_tag LOCUS_56950 72297 72836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 73155 72964 gene locus_tag LOCUS_56960 73155 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 73060 74124 gene locus_tag LOCUS_56970 73060 74124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 74232 75869 gene locus_tag LOCUS_56980 74232 75869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 75899 79933 gene locus_tag LOCUS_56990 75899 79933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 80108 80587 gene locus_tag LOCUS_57000 80108 80587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 80736 80963 gene locus_tag LOCUS_57010 80736 80963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 82000 81101 gene locus_tag LOCUS_57020 82000 81101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 82944 82000 gene locus_tag LOCUS_57030 82944 82000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_57030 83810 82944 gene locus_tag LOCUS_57040 83810 82944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 84743 83823 gene locus_tag LOCUS_57050 84743 83823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 85884 84847 gene locus_tag LOCUS_57060 85884 84847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 87073 85970 gene locus_tag LOCUS_57070 87073 85970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 87149 88876 gene locus_tag LOCUS_57080 87149 88876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 88877 93040 gene locus_tag LOCUS_57090 88877 93040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 96107 92964 gene locus_tag LOCUS_57100 96107 92964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 98449 96140 gene locus_tag LOCUS_57110 98449 96140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 99024 98449 gene locus_tag LOCUS_57120 99024 98449 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_57120 99170 100588 gene locus_tag LOCUS_57130 99170 100588 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_57130 100635 102251 gene locus_tag LOCUS_57140 100635 102251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 102934 102266 gene locus_tag LOCUS_57150 102934 102266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 103057 103971 gene locus_tag LOCUS_57160 103057 103971 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_57160 107675 104451 gene locus_tag LOCUS_57170 107675 104451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 107823 108812 gene locus_tag LOCUS_57180 107823 108812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 110327 108828 gene locus_tag LOCUS_57190 gene speE1 110327 108828 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_57190 112273 110324 gene locus_tag LOCUS_57200 112273 110324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891790.1 protein_id gnl|my_center|LOCUS_57200 112505 112287 gene locus_tag LOCUS_57210 112505 112287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 112680 112507 gene locus_tag LOCUS_57220 112680 112507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 113759 112677 gene locus_tag LOCUS_57230 113759 112677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 115039 113756 gene locus_tag LOCUS_57240 115039 113756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_57240 115920 115066 gene locus_tag LOCUS_57250 115920 115066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 116680 115913 gene locus_tag LOCUS_57260 116680 115913 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_57260 117818 116709 gene locus_tag LOCUS_57270 117818 116709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 119725 117815 gene locus_tag LOCUS_57280 119725 117815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 121332 119722 gene locus_tag LOCUS_57290 121332 119722 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_57290 121387 123432 gene locus_tag LOCUS_57300 121387 123432 CDS product DMSO reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459173.1 protein_id gnl|my_center|LOCUS_57300 123429 124835 gene locus_tag LOCUS_57310 123429 124835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 125782 124724 gene locus_tag LOCUS_57320 125782 124724 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_57320 >Feature sequence33 1752 847 gene locus_tag LOCUS_57330 1752 847 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_57330 2723 1752 gene locus_tag LOCUS_57340 2723 1752 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_57340 3589 2732 gene locus_tag LOCUS_57350 gene rmlD 3589 2732 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_57350 4694 3615 gene locus_tag LOCUS_57360 4694 3615 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_57360 7186 4715 gene locus_tag LOCUS_57370 7186 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 8389 7211 gene locus_tag LOCUS_57380 gene atoB 8389 7211 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_57380 8559 10538 gene locus_tag LOCUS_57390 8559 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 10544 12478 gene locus_tag LOCUS_57400 10544 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 12549 13244 gene locus_tag LOCUS_57410 12549 13244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 15041 13227 gene locus_tag LOCUS_57420 15041 13227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 17419 15038 gene locus_tag LOCUS_57430 17419 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 17303 17608 gene locus_tag LOCUS_57440 17303 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 19307 17598 gene locus_tag LOCUS_57450 19307 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 23047 19295 gene locus_tag LOCUS_57460 23047 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 23179 24018 gene locus_tag LOCUS_57470 23179 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 24057 25742 gene locus_tag LOCUS_57480 24057 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 25758 25994 gene locus_tag LOCUS_57490 gene acpP 25758 25994 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZE9 protein_id gnl|my_center|LOCUS_57490 25991 26713 gene locus_tag LOCUS_57500 25991 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 26805 27404 gene locus_tag LOCUS_57510 26805 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 30480 27409 gene locus_tag LOCUS_57520 30480 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 30702 31241 gene locus_tag LOCUS_57530 30702 31241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 31279 32628 gene locus_tag LOCUS_57540 gene xseA 31279 32628 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_57540 32625 32834 gene locus_tag LOCUS_57550 32625 32834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 32831 33727 gene locus_tag LOCUS_57560 32831 33727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 33724 34287 gene locus_tag LOCUS_57570 33724 34287 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_57570 34296 35345 gene locus_tag LOCUS_57580 34296 35345 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887434.1 protein_id gnl|my_center|LOCUS_57580 36261 35434 gene locus_tag LOCUS_57590 36261 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 36566 40144 gene locus_tag LOCUS_57600 36566 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 41032 40157 gene locus_tag LOCUS_57610 41032 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 44328 41053 gene locus_tag LOCUS_57620 44328 41053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 44367 45824 gene locus_tag LOCUS_57630 44367 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 46839 45841 gene locus_tag LOCUS_57640 46839 45841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 48035 46890 gene locus_tag LOCUS_57650 48035 46890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 48069 49757 gene locus_tag LOCUS_57660 48069 49757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 49847 51403 gene locus_tag LOCUS_57670 49847 51403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 51400 53010 gene locus_tag LOCUS_57680 51400 53010 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_57680 53032 53910 gene locus_tag LOCUS_57690 53032 53910 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_57690 55268 53907 gene locus_tag LOCUS_57700 55268 53907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57700 55474 55265 gene locus_tag LOCUS_57710 55474 55265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 58455 55471 gene locus_tag LOCUS_57720 58455 55471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_57720 60517 58442 gene locus_tag LOCUS_57730 60517 58442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 61008 63869 gene locus_tag LOCUS_57740 61008 63869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 64302 63946 gene locus_tag LOCUS_57750 64302 63946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 64667 64437 gene locus_tag LOCUS_57760 64667 64437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 64581 65033 gene locus_tag LOCUS_57770 64581 65033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 65118 65597 gene locus_tag LOCUS_57780 65118 65597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 65594 66211 gene locus_tag LOCUS_57790 65594 66211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 66255 67286 gene locus_tag LOCUS_57800 gene ruvB 66255 67286 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E7 protein_id gnl|my_center|LOCUS_57800 67295 68188 gene locus_tag LOCUS_57810 67295 68188 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_57810 69612 68185 gene locus_tag LOCUS_57820 69612 68185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 70494 69646 gene locus_tag LOCUS_57830 gene wzm 70494 69646 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_57830 70504 71664 gene locus_tag LOCUS_57840 70504 71664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 71670 72092 gene locus_tag LOCUS_57850 71670 72092 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCR4 protein_id gnl|my_center|LOCUS_57850 72089 73138 gene locus_tag LOCUS_57860 72089 73138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57860 73157 74614 gene locus_tag LOCUS_57870 73157 74614 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_57870 76751 74961 gene locus_tag LOCUS_57880 76751 74961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 77964 76888 gene locus_tag LOCUS_57890 77964 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 78120 78836 gene locus_tag LOCUS_57900 78120 78836 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_57900 78855 80615 gene locus_tag LOCUS_57910 gene ctaD 78855 80615 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_57910 80651 81283 gene locus_tag LOCUS_57920 gene cyoC 80651 81283 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_57920 81313 81645 gene locus_tag LOCUS_57930 81313 81645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 81647 81847 gene locus_tag LOCUS_57940 81647 81847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 81860 82141 gene locus_tag LOCUS_57950 81860 82141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 82166 82987 gene locus_tag LOCUS_57960 82166 82987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 82984 84207 gene locus_tag LOCUS_57970 82984 84207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 84267 84467 gene locus_tag LOCUS_57980 84267 84467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 84507 85286 gene locus_tag LOCUS_57990 84507 85286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 85283 85942 gene locus_tag LOCUS_58000 gene rpe 85283 85942 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_58000 85939 86787 gene locus_tag LOCUS_58010 gene bamD 85939 86787 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY1 protein_id gnl|my_center|LOCUS_58010 86787 87542 gene locus_tag LOCUS_58020 86787 87542 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_58020 87806 89020 gene locus_tag LOCUS_58030 87806 89020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 89045 89344 gene locus_tag LOCUS_58040 89045 89344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 89530 89348 gene locus_tag LOCUS_58050 89530 89348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 89912 90976 gene locus_tag LOCUS_58060 gene rlmN 89912 90976 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3P9 protein_id gnl|my_center|LOCUS_58060 92700 90973 gene locus_tag LOCUS_58070 92700 90973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 94299 93301 gene locus_tag LOCUS_58080 94299 93301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 94925 96709 gene locus_tag LOCUS_58090 94925 96709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 99437 96807 gene locus_tag LOCUS_58100 99437 96807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 101107 99785 gene locus_tag LOCUS_58110 101107 99785 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640098.1 protein_id gnl|my_center|LOCUS_58110 101261 101824 gene locus_tag LOCUS_58120 101261 101824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 101899 102816 gene locus_tag LOCUS_58130 101899 102816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 102917 106060 gene locus_tag LOCUS_58140 102917 106060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 106343 106104 gene locus_tag LOCUS_58150 106343 106104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 112128 106381 gene locus_tag LOCUS_58160 112128 106381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 112447 112220 gene locus_tag LOCUS_58170 112447 112220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 113305 113075 gene locus_tag LOCUS_58180 113305 113075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 113837 113298 gene locus_tag LOCUS_58190 113837 113298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 114218 115471 gene locus_tag LOCUS_58200 114218 115471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 115588 116970 gene locus_tag LOCUS_58210 115588 116970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 >Feature sequence34 1069 290 gene locus_tag LOCUS_58220 1069 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 1665 2714 gene locus_tag LOCUS_58230 1665 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 2935 4032 gene locus_tag LOCUS_58240 2935 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 6664 4244 gene locus_tag LOCUS_58250 6664 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 8184 6676 gene locus_tag LOCUS_58260 8184 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 9465 8191 gene locus_tag LOCUS_58270 gene gltA 9465 8191 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_58270 10326 9655 gene locus_tag LOCUS_58280 10326 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 10480 10974 gene locus_tag LOCUS_58290 gene ppiB 10480 10974 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_58290 10994 12295 gene locus_tag LOCUS_58300 gene tyrS2 10994 12295 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834C7 protein_id gnl|my_center|LOCUS_58300 12288 13610 gene locus_tag LOCUS_58310 12288 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 13744 14436 gene locus_tag LOCUS_58320 13744 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 14529 15887 gene locus_tag LOCUS_58330 14529 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 15941 16201 gene locus_tag LOCUS_58340 15941 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 16223 17575 gene locus_tag LOCUS_58350 16223 17575 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_58350 17876 17592 gene locus_tag LOCUS_58360 17876 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 19142 17904 gene locus_tag LOCUS_58370 gene hadHB 19142 17904 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_58370 19245 19562 gene locus_tag LOCUS_58380 19245 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 19632 23213 gene locus_tag LOCUS_58390 19632 23213 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_58390 24656 23598 gene locus_tag LOCUS_58400 24656 23598 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_229694.2 protein_id gnl|my_center|LOCUS_58400 24770 26176 gene locus_tag LOCUS_58410 24770 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 26173 27579 gene locus_tag LOCUS_58420 26173 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 30319 27563 gene locus_tag LOCUS_58430 30319 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 30702 30409 gene locus_tag LOCUS_58440 30702 30409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 31688 30702 gene locus_tag LOCUS_58450 31688 30702 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975262.1 protein_id gnl|my_center|LOCUS_58450 32472 31717 gene locus_tag LOCUS_58460 32472 31717 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809706.1 protein_id gnl|my_center|LOCUS_58460 33233 32592 gene locus_tag LOCUS_58470 33233 32592 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_58470 36121 33314 gene locus_tag LOCUS_58480 gene uvrA 36121 33314 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_58480 37692 36202 gene locus_tag LOCUS_58490 37692 36202 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_58490 37772 38572 gene locus_tag LOCUS_58500 37772 38572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 38575 39360 gene locus_tag LOCUS_58510 38575 39360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 39423 39986 gene locus_tag LOCUS_58520 39423 39986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 40656 39970 gene locus_tag LOCUS_58530 40656 39970 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_58530 40981 41283 gene locus_tag LOCUS_58540 40981 41283 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_58540 41527 42519 gene locus_tag LOCUS_58550 41527 42519 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_58550 43504 42536 gene locus_tag LOCUS_58560 43504 42536 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 protein_id gnl|my_center|LOCUS_58560 44309 43506 gene locus_tag LOCUS_58570 44309 43506 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_58570 45160 44306 gene locus_tag LOCUS_58580 gene kdsA 45160 44306 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61654 protein_id gnl|my_center|LOCUS_58580 46269 45199 gene locus_tag LOCUS_58590 46269 45199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 48104 46341 gene locus_tag LOCUS_58600 48104 46341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 49850 48186 gene locus_tag LOCUS_58610 gene pyrG 49850 48186 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT4 protein_id gnl|my_center|LOCUS_58610 50650 49856 gene locus_tag LOCUS_58620 gene kdsB 50650 49856 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_58620 50792 51988 gene locus_tag LOCUS_58630 50792 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 51943 52755 gene locus_tag LOCUS_58640 gene rsmA 51943 52755 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_58640 55445 53136 gene locus_tag LOCUS_58650 55445 53136 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_58650 58007 55614 gene locus_tag LOCUS_58660 58007 55614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 59797 58043 gene locus_tag LOCUS_58670 59797 58043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_58670 61721 59814 gene locus_tag LOCUS_58680 61721 59814 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_58680 61851 61988 gene locus_tag LOCUS_58690 61851 61988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 62041 63423 gene locus_tag LOCUS_58700 62041 63423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 64135 63446 gene locus_tag LOCUS_58710 64135 63446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 64386 65042 gene locus_tag LOCUS_58720 64386 65042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 65029 65595 gene locus_tag LOCUS_58730 65029 65595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_58730 66728 65619 gene locus_tag LOCUS_58740 gene leuB 66728 65619 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIE1 protein_id gnl|my_center|LOCUS_58740 67321 66725 gene locus_tag LOCUS_58750 gene leuD 67321 66725 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_58750 68739 67318 gene locus_tag LOCUS_58760 gene leuC 68739 67318 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_58760 70348 68741 gene locus_tag LOCUS_58770 gene leuA 70348 68741 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC27 protein_id gnl|my_center|LOCUS_58770 70594 70932 gene locus_tag LOCUS_58780 70594 70932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 70944 71657 gene locus_tag LOCUS_58790 70944 71657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_58790 72734 71646 gene locus_tag LOCUS_58800 72734 71646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_58800 74053 72758 gene locus_tag LOCUS_58810 74053 72758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 74267 74824 gene locus_tag LOCUS_58820 74267 74824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 74821 75861 gene locus_tag LOCUS_58830 74821 75861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 76628 75855 gene locus_tag LOCUS_58840 76628 75855 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_58840 76761 77969 gene locus_tag LOCUS_58850 76761 77969 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_58850 78957 77896 gene locus_tag LOCUS_58860 78957 77896 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_58860 79082 79417 gene locus_tag LOCUS_58870 79082 79417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 79532 80326 gene locus_tag LOCUS_58880 79532 80326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 80378 83308 gene locus_tag LOCUS_58890 80378 83308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 83391 84608 gene locus_tag LOCUS_58900 83391 84608 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_58900 85345 84605 gene locus_tag LOCUS_58910 85345 84605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 85419 87980 gene locus_tag LOCUS_58920 85419 87980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 88017 89399 gene locus_tag LOCUS_58930 gene pilR 88017 89399 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037720.1 protein_id gnl|my_center|LOCUS_58930 90277 89405 gene locus_tag LOCUS_58940 90277 89405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 91977 90274 gene locus_tag LOCUS_58950 91977 90274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 93011 91974 gene locus_tag LOCUS_58960 93011 91974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_58960 95125 93035 gene locus_tag LOCUS_58970 95125 93035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 96161 95118 gene locus_tag LOCUS_58980 gene moxR 96161 95118 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121417.1 protein_id gnl|my_center|LOCUS_58980 96229 97524 gene locus_tag LOCUS_58990 gene aspC3 96229 97524 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 protein_id gnl|my_center|LOCUS_58990 97569 98789 gene locus_tag LOCUS_59000 97569 98789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 98786 101554 gene locus_tag LOCUS_59010 98786 101554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 101547 103733 gene locus_tag LOCUS_59020 101547 103733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 104028 105731 gene locus_tag LOCUS_59030 104028 105731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 105835 109905 gene locus_tag LOCUS_59040 105835 109905 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_59040 109967 111388 gene locus_tag LOCUS_59050 gene hemN 109967 111388 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67886 protein_id gnl|my_center|LOCUS_59050 111889 112284 gene locus_tag LOCUS_59060 111889 112284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 113708 112302 gene locus_tag LOCUS_59070 113708 112302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 115096 113756 gene locus_tag LOCUS_59080 gene gdhA 115096 113756 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_59080 115837 115712 gene locus_tag LOCUS_59090 115837 115712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 >Feature sequence35 127 945 gene locus_tag LOCUS_59100 127 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 6094 1277 gene locus_tag LOCUS_59110 6094 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120047.1 protein_id gnl|my_center|LOCUS_59110 10866 6091 gene locus_tag LOCUS_59120 10866 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027635.1 protein_id gnl|my_center|LOCUS_59120 11767 10868 gene locus_tag LOCUS_59130 11767 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120046.1 protein_id gnl|my_center|LOCUS_59130 12775 11948 gene locus_tag LOCUS_59140 12775 11948 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_59140 13263 12772 gene locus_tag LOCUS_59150 13263 12772 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_59150 15505 13256 gene locus_tag LOCUS_59160 15505 13256 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_59160 16448 15948 gene locus_tag LOCUS_59170 16448 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 19881 16486 gene locus_tag LOCUS_59180 19881 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 20155 22272 gene locus_tag LOCUS_59190 gene btuB 20155 22272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_59190 23943 22279 gene locus_tag LOCUS_59200 23943 22279 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462598.1 protein_id gnl|my_center|LOCUS_59200 24114 25286 gene locus_tag LOCUS_59210 24114 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 25297 27222 gene locus_tag LOCUS_59220 25297 27222 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_59220 28507 27242 gene locus_tag LOCUS_59230 28507 27242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_59230 29507 28575 gene locus_tag LOCUS_59240 29507 28575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 29979 30791 gene locus_tag LOCUS_59250 29979 30791 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_59250 30929 34672 gene locus_tag LOCUS_59260 30929 34672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 37569 34684 gene locus_tag LOCUS_59270 37569 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 39322 37601 gene locus_tag LOCUS_59280 39322 37601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 39453 39932 gene locus_tag LOCUS_59290 39453 39932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 41213 39978 gene locus_tag LOCUS_59300 41213 39978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 41722 41270 gene locus_tag LOCUS_59310 41722 41270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 42479 43450 gene locus_tag LOCUS_59320 42479 43450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 protein_id gnl|my_center|LOCUS_59320 43443 44315 gene locus_tag LOCUS_59330 43443 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259449.1 protein_id gnl|my_center|LOCUS_59330 44328 45866 gene locus_tag LOCUS_59340 44328 45866 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_59340 48780 46327 gene locus_tag LOCUS_59350 48780 46327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 51120 48787 gene locus_tag LOCUS_59360 51120 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 53274 51292 gene locus_tag LOCUS_59370 53274 51292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 54277 53657 gene locus_tag LOCUS_59380 54277 53657 CDS product major intrinsic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_59380 54343 56271 gene locus_tag LOCUS_59390 54343 56271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 61262 56265 gene locus_tag LOCUS_59400 61262 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090812.1 protein_id gnl|my_center|LOCUS_59400 61280 61996 gene locus_tag LOCUS_59410 61280 61996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 64675 61988 gene locus_tag LOCUS_59420 64675 61988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 66328 64760 gene locus_tag LOCUS_59430 66328 64760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 66544 68208 gene locus_tag LOCUS_59440 66544 68208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 68274 69446 gene locus_tag LOCUS_59450 68274 69446 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_59450 70130 69450 gene locus_tag LOCUS_59460 gene fkpA 70130 69450 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_59460 72145 70181 gene locus_tag LOCUS_59470 72145 70181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 73023 74066 gene locus_tag LOCUS_59480 73023 74066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_59480 76260 74035 gene locus_tag LOCUS_59490 gene dpp4 76260 74035 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_59490 76386 76547 gene locus_tag LOCUS_59500 76386 76547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 76609 78405 gene locus_tag LOCUS_59510 76609 78405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_59510 78405 80894 gene locus_tag LOCUS_59520 78405 80894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_59520 82446 80926 gene locus_tag LOCUS_59530 82446 80926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 82556 83899 gene locus_tag LOCUS_59540 82556 83899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 86189 83922 gene locus_tag LOCUS_59550 86189 83922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 86296 87438 gene locus_tag LOCUS_59560 86296 87438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 87464 89917 gene locus_tag LOCUS_59570 87464 89917 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_59570 89970 91763 gene locus_tag LOCUS_59580 89970 91763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 92011 94728 gene locus_tag LOCUS_59590 92011 94728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 95724 95080 gene locus_tag LOCUS_59600 95724 95080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 95985 95734 gene locus_tag LOCUS_59610 95985 95734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 96179 96003 gene locus_tag LOCUS_59620 96179 96003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 97062 97685 gene locus_tag LOCUS_59630 97062 97685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 98421 97801 gene locus_tag LOCUS_59640 98421 97801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 99765 98425 gene locus_tag LOCUS_59650 99765 98425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 100027 99902 gene locus_tag LOCUS_59660 100027 99902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 100928 103513 gene locus_tag LOCUS_59670 100928 103513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 103917 106073 gene locus_tag LOCUS_59680 103917 106073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 106184 107083 gene locus_tag LOCUS_59690 106184 107083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 108051 107101 gene locus_tag LOCUS_59700 108051 107101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 111597 108199 gene locus_tag LOCUS_59710 111597 108199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 >Feature sequence36 2360 1071 gene locus_tag LOCUS_59720 2360 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 5004 2362 gene locus_tag LOCUS_59730 5004 2362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085336.1 protein_id gnl|my_center|LOCUS_59730 5363 5007 gene locus_tag LOCUS_59740 5363 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 5599 5399 gene locus_tag LOCUS_59750 5599 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 5495 7459 gene locus_tag LOCUS_59760 5495 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 7471 8202 gene locus_tag LOCUS_59770 7471 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_59770 8207 9190 gene locus_tag LOCUS_59780 8207 9190 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_59780 9177 9620 gene locus_tag LOCUS_59790 9177 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 11162 10185 gene locus_tag LOCUS_59800 11162 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 13263 11200 gene locus_tag LOCUS_59810 13263 11200 CDS product beta-lactam sensor/signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118053.1 protein_id gnl|my_center|LOCUS_59810 13651 13268 gene locus_tag LOCUS_59820 13651 13268 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118054.1 protein_id gnl|my_center|LOCUS_59820 13884 16100 gene locus_tag LOCUS_59830 13884 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_59830 16123 17232 gene locus_tag LOCUS_59840 16123 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 17229 18515 gene locus_tag LOCUS_59850 17229 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 18648 20642 gene locus_tag LOCUS_59860 18648 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 20684 21754 gene locus_tag LOCUS_59870 20684 21754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 23536 21770 gene locus_tag LOCUS_59880 23536 21770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 25054 23555 gene locus_tag LOCUS_59890 25054 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 26653 25187 gene locus_tag LOCUS_59900 gene panF 26653 25187 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_59900 26947 26657 gene locus_tag LOCUS_59910 26947 26657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 27213 26944 gene locus_tag LOCUS_59920 27213 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 28695 27244 gene locus_tag LOCUS_59930 gene atpD 28695 27244 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_59930 29609 28737 gene locus_tag LOCUS_59940 gene atpG 29609 28737 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_59940 31406 29667 gene locus_tag LOCUS_59950 31406 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 32036 31431 gene locus_tag LOCUS_59960 gene atpH 32036 31431 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_59960 32619 32041 gene locus_tag LOCUS_59970 gene atpF 32619 32041 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140679.1 protein_id gnl|my_center|LOCUS_59970 33030 32713 gene locus_tag LOCUS_59980 33030 32713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 34063 33176 gene locus_tag LOCUS_59990 gene atpB 34063 33176 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_59990 34494 34060 gene locus_tag LOCUS_60000 34494 34060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 34757 34491 gene locus_tag LOCUS_60010 34757 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 34871 36130 gene locus_tag LOCUS_60020 34871 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 36130 37869 gene locus_tag LOCUS_60030 36130 37869 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_60030 37952 38608 gene locus_tag LOCUS_60040 37952 38608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 38698 38925 gene locus_tag LOCUS_60050 38698 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 38949 39401 gene locus_tag LOCUS_60060 38949 39401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 40085 39417 gene locus_tag LOCUS_60070 40085 39417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 40917 40225 gene locus_tag LOCUS_60080 40917 40225 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980178.1 protein_id gnl|my_center|LOCUS_60080 41011 42432 gene locus_tag LOCUS_60090 41011 42432 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_60090 42908 43645 gene locus_tag LOCUS_60100 42908 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 45265 43658 gene locus_tag LOCUS_60110 gene pckA2 45265 43658 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_60110 45756 45433 gene locus_tag LOCUS_60120 45756 45433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 46516 45743 gene locus_tag LOCUS_60130 46516 45743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 47876 46596 gene locus_tag LOCUS_60140 gene purD 47876 46596 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV0 protein_id gnl|my_center|LOCUS_60140 48895 47873 gene locus_tag LOCUS_60150 gene pta 48895 47873 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_60150 48967 50058 gene locus_tag LOCUS_60160 gene mtnA 48967 50058 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX9 protein_id gnl|my_center|LOCUS_60160 50135 51211 gene locus_tag LOCUS_60170 gene ddl 50135 51211 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_60170 51263 51988 gene locus_tag LOCUS_60180 51263 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 52026 52580 gene locus_tag LOCUS_60190 52026 52580 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_60190 52784 54592 gene locus_tag LOCUS_60200 gene ilvB-1 52784 54592 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN4 protein_id gnl|my_center|LOCUS_60200 54659 55795 gene locus_tag LOCUS_60210 gene tqsA 54659 55795 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_60210 55802 56563 gene locus_tag LOCUS_60220 55802 56563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 58455 56530 gene locus_tag LOCUS_60230 58455 56530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 58573 58770 gene locus_tag LOCUS_60240 58573 58770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 58775 59218 gene locus_tag LOCUS_60250 gene rpiB 58775 59218 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_60250 59211 60464 gene locus_tag LOCUS_60260 gene glyA 59211 60464 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_60260 60493 61053 gene locus_tag LOCUS_60270 60493 61053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 61058 62329 gene locus_tag LOCUS_60280 gene kdtA 61058 62329 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105256.1 protein_id gnl|my_center|LOCUS_60280 62326 63399 gene locus_tag LOCUS_60290 gene lpxK 62326 63399 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_60290 63396 63674 gene locus_tag LOCUS_60300 63396 63674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 64003 65919 gene locus_tag LOCUS_60310 64003 65919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_60310 65932 67173 gene locus_tag LOCUS_60320 65932 67173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_60320 67319 67708 gene locus_tag LOCUS_60330 67319 67708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 67716 68621 gene locus_tag LOCUS_60340 67716 68621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 72639 69379 gene locus_tag LOCUS_60350 72639 69379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 72657 73676 gene locus_tag LOCUS_60360 72657 73676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 73669 74124 gene locus_tag LOCUS_60370 gene tadA 73669 74124 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21335 protein_id gnl|my_center|LOCUS_60370 74163 74252 gene locus_tag LOCUS_t00650 74163 74252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 74282 74371 gene locus_tag LOCUS_t00660 74282 74371 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75428 77242 gene locus_tag LOCUS_60380 75428 77242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 77266 78252 gene locus_tag LOCUS_60390 77266 78252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 78545 79213 gene locus_tag LOCUS_60400 78545 79213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 79265 80020 gene locus_tag LOCUS_60410 79265 80020 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_60410 80017 81030 gene locus_tag LOCUS_60420 80017 81030 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_60420 81031 81438 gene locus_tag LOCUS_60430 81031 81438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 81759 82856 gene locus_tag LOCUS_60440 gene dnaN 81759 82856 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH4 protein_id gnl|my_center|LOCUS_60440 82864 83946 gene locus_tag LOCUS_60450 gene recF 82864 83946 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ4 protein_id gnl|my_center|LOCUS_60450 86491 83930 gene locus_tag LOCUS_60460 86491 83930 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_60460 86746 86501 gene locus_tag LOCUS_60470 86746 86501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 88928 86820 gene locus_tag LOCUS_60480 88928 86820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 89003 89827 gene locus_tag LOCUS_60490 gene mutM 89003 89827 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_60490 90104 89832 gene locus_tag LOCUS_60500 90104 89832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 90484 90176 gene locus_tag LOCUS_60510 90484 90176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 93102 90634 gene locus_tag LOCUS_60520 gene gyrB 93102 90634 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_60520 94550 93246 gene locus_tag LOCUS_60530 94550 93246 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_60530 95599 94547 gene locus_tag LOCUS_60540 95599 94547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 99340 95603 gene locus_tag LOCUS_60550 99340 95603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 101475 99754 gene locus_tag LOCUS_60560 101475 99754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 101548 102234 gene locus_tag LOCUS_60570 101548 102234 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_60570 102231 103127 gene locus_tag LOCUS_60580 102231 103127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 103163 104374 gene locus_tag LOCUS_60590 gene pulF 103163 104374 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_60590 104410 106077 gene locus_tag LOCUS_60600 gene pulE 104410 106077 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_60600 106127 107032 gene locus_tag LOCUS_60610 106127 107032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 >Feature sequence37 970 173 gene locus_tag LOCUS_60620 970 173 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535488.1 protein_id gnl|my_center|LOCUS_60620 1773 967 gene locus_tag LOCUS_60630 1773 967 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_60630 1847 3949 gene locus_tag LOCUS_60640 1847 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248417.1 protein_id gnl|my_center|LOCUS_60640 4121 5074 gene locus_tag LOCUS_60650 4121 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 5130 9830 gene locus_tag LOCUS_60660 5130 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 12080 9900 gene locus_tag LOCUS_60670 12080 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 15533 12249 gene locus_tag LOCUS_60680 15533 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_60680 18886 15548 gene locus_tag LOCUS_60690 18886 15548 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_60690 22224 18913 gene locus_tag LOCUS_60700 22224 18913 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_60700 22877 22356 gene locus_tag LOCUS_60710 22877 22356 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_60710 23399 24499 gene locus_tag LOCUS_60720 gene rmlB 23399 24499 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C734 protein_id gnl|my_center|LOCUS_60720 24499 25059 gene locus_tag LOCUS_60730 gene rfbC 24499 25059 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_60730 25093 26556 gene locus_tag LOCUS_60740 25093 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 27405 27124 gene locus_tag LOCUS_60750 27405 27124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 29128 27554 gene locus_tag LOCUS_60760 29128 27554 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_60760 29190 30701 gene locus_tag LOCUS_60770 29190 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 30688 32178 gene locus_tag LOCUS_60780 30688 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 32165 33031 gene locus_tag LOCUS_60790 32165 33031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_60790 33136 35415 gene locus_tag LOCUS_60800 33136 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 37074 35458 gene locus_tag LOCUS_60810 37074 35458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 37737 37147 gene locus_tag LOCUS_60820 37737 37147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 38765 37749 gene locus_tag LOCUS_60830 38765 37749 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_60830 39550 38762 gene locus_tag LOCUS_60840 39550 38762 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_60840 40709 39558 gene locus_tag LOCUS_60850 40709 39558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_60850 43694 41532 gene locus_tag LOCUS_60860 gene fadJ 43694 41532 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK77 protein_id gnl|my_center|LOCUS_60860 44226 43996 gene locus_tag LOCUS_60870 44226 43996 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_60870 44624 45682 gene locus_tag LOCUS_60880 gene pilM 44624 45682 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_60880 45704 46321 gene locus_tag LOCUS_60890 45704 46321 CDS product fimbrial type-4 assembly membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545919.1 protein_id gnl|my_center|LOCUS_60890 46353 46940 gene locus_tag LOCUS_60900 46353 46940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 46940 47566 gene locus_tag LOCUS_60910 46940 47566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 47653 50454 gene locus_tag LOCUS_60920 47653 50454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 50467 51021 gene locus_tag LOCUS_60930 50467 51021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 51051 53123 gene locus_tag LOCUS_60940 51051 53123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 53229 54200 gene locus_tag LOCUS_60950 53229 54200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 54775 56106 gene locus_tag LOCUS_60960 54775 56106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 56202 57623 gene locus_tag LOCUS_60970 56202 57623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 58742 57564 gene locus_tag LOCUS_60980 58742 57564 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_60980 60085 58739 gene locus_tag LOCUS_60990 60085 58739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 61074 60055 gene locus_tag LOCUS_61000 61074 60055 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_61000 61487 61071 gene locus_tag LOCUS_61010 61487 61071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_61010 61570 62676 gene locus_tag LOCUS_61020 gene aroC 61570 62676 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_61020 62681 63289 gene locus_tag LOCUS_61030 62681 63289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 63289 64713 gene locus_tag LOCUS_61040 63289 64713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 64730 65980 gene locus_tag LOCUS_61050 64730 65980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 67014 65872 gene locus_tag LOCUS_61060 gene mnmA 67014 65872 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_61060 67730 67014 gene locus_tag LOCUS_61070 67730 67014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 68872 67727 gene locus_tag LOCUS_61080 68872 67727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 69728 68925 gene locus_tag LOCUS_61090 69728 68925 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_61090 69930 69757 gene locus_tag LOCUS_61100 69930 69757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 69981 70709 gene locus_tag LOCUS_61110 gene truC 69981 70709 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_61110 71466 70642 gene locus_tag LOCUS_61120 71466 70642 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 protein_id gnl|my_center|LOCUS_61120 72311 71523 gene locus_tag LOCUS_61130 72311 71523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 72836 74086 gene locus_tag LOCUS_61140 72836 74086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 74284 76275 gene locus_tag LOCUS_61150 74284 76275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 76283 77296 gene locus_tag LOCUS_61160 76283 77296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_61160 77417 78472 gene locus_tag LOCUS_61170 77417 78472 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_61170 78549 81656 gene locus_tag LOCUS_61180 78549 81656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_61180 81673 83358 gene locus_tag LOCUS_61190 81673 83358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 85947 83392 gene locus_tag LOCUS_61200 85947 83392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 87176 85971 gene locus_tag LOCUS_61210 87176 85971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 87915 87319 gene locus_tag LOCUS_61220 87915 87319 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_61220 89819 87918 gene locus_tag LOCUS_61230 89819 87918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 89924 90478 gene locus_tag LOCUS_61240 89924 90478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 90525 92144 gene locus_tag LOCUS_61250 90525 92144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 94858 92141 gene locus_tag LOCUS_61260 94858 92141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 95993 95007 gene locus_tag LOCUS_61270 95993 95007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 96607 95990 gene locus_tag LOCUS_61280 96607 95990 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_61280 97830 96616 gene locus_tag LOCUS_61290 97830 96616 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_61290 >Feature sequence38 <1 2135 gene locus_tag LOCUS_61300 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C 3483 2875 gene locus_tag LOCUS_61310 3483 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 4049 4957 gene locus_tag LOCUS_61320 4049 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 5213 5890 gene locus_tag LOCUS_61330 5213 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 6554 5901 gene locus_tag LOCUS_61340 6554 5901 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_61340 7513 6551 gene locus_tag LOCUS_61350 7513 6551 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_61350 9760 7670 gene locus_tag LOCUS_61360 9760 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 10892 9777 gene locus_tag LOCUS_61370 10892 9777 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_61370 12447 10945 gene locus_tag LOCUS_61380 12447 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 14060 12450 gene locus_tag LOCUS_61390 14060 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_61390 14807 14064 gene locus_tag LOCUS_61400 14807 14064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_61400 15877 14804 gene locus_tag LOCUS_61410 15877 14804 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_61410 17135 16026 gene locus_tag LOCUS_61420 17135 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 18118 17132 gene locus_tag LOCUS_61430 18118 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 19892 18135 gene locus_tag LOCUS_61440 19892 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 21514 20075 gene locus_tag LOCUS_61450 21514 20075 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_61450 22254 21511 gene locus_tag LOCUS_61460 22254 21511 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256999.1 protein_id gnl|my_center|LOCUS_61460 22317 24512 gene locus_tag LOCUS_61470 22317 24512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 24512 26032 gene locus_tag LOCUS_61480 24512 26032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 28150 26837 gene locus_tag LOCUS_61490 28150 26837 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_61490 29384 28155 gene locus_tag LOCUS_61500 gene fadA 29384 28155 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_61500 30226 29462 gene locus_tag LOCUS_61510 30226 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 30305 31228 gene locus_tag LOCUS_61520 30305 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 31286 32641 gene locus_tag LOCUS_61530 31286 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 32658 33875 gene locus_tag LOCUS_61540 32658 33875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 35215 33881 gene locus_tag LOCUS_61550 gene creD 35215 33881 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_61550 36223 35321 gene locus_tag LOCUS_61560 36223 35321 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010891.2 protein_id gnl|my_center|LOCUS_61560 36567 36388 gene locus_tag LOCUS_61570 36567 36388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 37968 36736 gene locus_tag LOCUS_61580 gene glgC 37968 36736 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2E1 protein_id gnl|my_center|LOCUS_61580 39906 38062 gene locus_tag LOCUS_61590 39906 38062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 40262 39951 gene locus_tag LOCUS_61600 40262 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 40904 40269 gene locus_tag LOCUS_61610 gene cyoC 40904 40269 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_61610 42573 40918 gene locus_tag LOCUS_61620 42573 40918 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_61620 43598 42573 gene locus_tag LOCUS_61630 43598 42573 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_61630 44458 43601 gene locus_tag LOCUS_61640 44458 43601 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_61640 45003 44455 gene locus_tag LOCUS_61650 45003 44455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 46207 44996 gene locus_tag LOCUS_61660 46207 44996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 46842 46207 gene locus_tag LOCUS_61670 46842 46207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 protein_id gnl|my_center|LOCUS_61670 47383 46829 gene locus_tag LOCUS_61680 47383 46829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_61680 48782 47394 gene locus_tag LOCUS_61690 48782 47394 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_61690 51881 48822 gene locus_tag LOCUS_61700 51881 48822 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_61700 52565 51906 gene locus_tag LOCUS_61710 52565 51906 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_61710 52924 54318 gene locus_tag LOCUS_61720 52924 54318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 54402 58457 gene locus_tag LOCUS_61730 54402 58457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 59428 60027 gene locus_tag LOCUS_61740 59428 60027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 60024 60431 gene locus_tag LOCUS_61750 60024 60431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 60442 61677 gene locus_tag LOCUS_61760 60442 61677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 64042 61886 gene locus_tag LOCUS_61770 64042 61886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 64808 64113 gene locus_tag LOCUS_61780 64808 64113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 66654 64855 gene locus_tag LOCUS_61790 gene batD 66654 64855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_61790 67619 66657 gene locus_tag LOCUS_61800 67619 66657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 68632 67616 gene locus_tag LOCUS_61810 gene batB 68632 67616 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_61810 69632 68634 gene locus_tag LOCUS_61820 gene batA 69632 68634 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_61820 70720 69629 gene locus_tag LOCUS_61830 70720 69629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 71643 70717 gene locus_tag LOCUS_61840 71643 70717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61840 72648 71656 gene locus_tag LOCUS_61850 72648 71656 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_61850 72840 73568 gene locus_tag LOCUS_61860 72840 73568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 74894 73710 gene locus_tag LOCUS_61870 74894 73710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_61870 76050 74905 gene locus_tag LOCUS_61880 76050 74905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_61880 76766 76047 gene locus_tag LOCUS_61890 gene tptC 76766 76047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_61890 76873 77937 gene locus_tag LOCUS_61900 76873 77937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 77988 79967 gene locus_tag LOCUS_61910 77988 79967 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_61910 83555 80115 gene locus_tag LOCUS_61920 83555 80115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 83766 84851 gene locus_tag LOCUS_61930 gene rbsR 83766 84851 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765639.1 protein_id gnl|my_center|LOCUS_61930 84859 87123 gene locus_tag LOCUS_61940 84859 87123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 87315 88226 gene locus_tag LOCUS_61950 87315 88226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 88228 89931 gene locus_tag LOCUS_61960 88228 89931 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_61960 90009 90221 gene locus_tag LOCUS_61970 90009 90221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 92950 90635 gene locus_tag LOCUS_61980 92950 90635 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204019.1 protein_id gnl|my_center|LOCUS_61980 95661 93031 gene locus_tag LOCUS_61990 95661 93031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 96624 95674 gene locus_tag LOCUS_62000 96624 95674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 97471 96839 gene locus_tag LOCUS_62010 97471 96839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 97854 97468 gene locus_tag LOCUS_62020 97854 97468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 >Feature sequence39 943 251 gene locus_tag LOCUS_62030 943 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 1934 954 gene locus_tag LOCUS_62040 1934 954 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 protein_id gnl|my_center|LOCUS_62040 2614 1952 gene locus_tag LOCUS_62050 2614 1952 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706709.1 protein_id gnl|my_center|LOCUS_62050 2991 2611 gene locus_tag LOCUS_62060 2991 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 3583 3290 gene locus_tag LOCUS_62070 3583 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 3772 4191 gene locus_tag LOCUS_62080 3772 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 4188 4487 gene locus_tag LOCUS_62090 4188 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 4568 7912 gene locus_tag LOCUS_62100 4568 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 8063 8647 gene locus_tag LOCUS_62110 8063 8647 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_62110 9283 8663 gene locus_tag LOCUS_62120 9283 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 10167 9280 gene locus_tag LOCUS_62130 10167 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 10308 12806 gene locus_tag LOCUS_62140 10308 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 14108 12822 gene locus_tag LOCUS_62150 14108 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 14309 17065 gene locus_tag LOCUS_62160 14309 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 17450 17890 gene locus_tag LOCUS_62170 17450 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 17901 18152 gene locus_tag LOCUS_62180 17901 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 18187 20244 gene locus_tag LOCUS_62190 18187 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 21039 23240 gene locus_tag LOCUS_62200 21039 23240 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_62200 23658 23269 gene locus_tag LOCUS_62210 23658 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 23789 24811 gene locus_tag LOCUS_62220 23789 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62220 24808 25233 gene locus_tag LOCUS_62230 24808 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 25258 26712 gene locus_tag LOCUS_62240 25258 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 28490 26709 gene locus_tag LOCUS_62250 28490 26709 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 protein_id gnl|my_center|LOCUS_62250 30004 28502 gene locus_tag LOCUS_62260 30004 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 30823 30386 gene locus_tag LOCUS_62270 30823 30386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710095.1 protein_id gnl|my_center|LOCUS_62270 32591 30969 gene locus_tag LOCUS_62280 32591 30969 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_62280 34437 32623 gene locus_tag LOCUS_62290 34437 32623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 34436 35095 gene locus_tag LOCUS_62300 34436 35095 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_62300 35811 35056 gene locus_tag LOCUS_62310 35811 35056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 36197 35829 gene locus_tag LOCUS_62320 36197 35829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 37569 36205 gene locus_tag LOCUS_62330 37569 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 38110 39480 gene locus_tag LOCUS_62340 38110 39480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 41914 39500 gene locus_tag LOCUS_62350 41914 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 41998 43785 gene locus_tag LOCUS_62360 41998 43785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765190.1 protein_id gnl|my_center|LOCUS_62360 44188 45909 gene locus_tag LOCUS_62370 gene aslA 44188 45909 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122345.1 protein_id gnl|my_center|LOCUS_62370 45967 48216 gene locus_tag LOCUS_62380 45967 48216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_62380 48542 49450 gene locus_tag LOCUS_62390 48542 49450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 49765 50106 gene locus_tag LOCUS_62400 49765 50106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 50493 50122 gene locus_tag LOCUS_62410 50493 50122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 53040 51622 gene locus_tag LOCUS_62420 gene hsdM 53040 51622 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_62420 56432 53058 gene locus_tag LOCUS_62430 gene hsdR 56432 53058 CDS product type I restriction-modification system deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_62430 56557 57891 gene locus_tag LOCUS_62440 56557 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 59401 57833 gene locus_tag LOCUS_62450 59401 57833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 60171 59410 gene locus_tag LOCUS_62460 60171 59410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 61758 60181 gene locus_tag LOCUS_62470 61758 60181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 61838 62902 gene locus_tag LOCUS_62480 61838 62902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 62899 64056 gene locus_tag LOCUS_62490 gene clpX 62899 64056 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_62490 64283 64909 gene locus_tag LOCUS_62500 64283 64909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 65008 67179 gene locus_tag LOCUS_62510 gene recD2 65008 67179 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_62510 67271 68020 gene locus_tag LOCUS_62520 67271 68020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 69871 68075 gene locus_tag LOCUS_62530 69871 68075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120050.1 protein_id gnl|my_center|LOCUS_62530 73428 69868 gene locus_tag LOCUS_62540 73428 69868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031106.1 protein_id gnl|my_center|LOCUS_62540 74534 73386 gene locus_tag LOCUS_62550 74534 73386 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_62550 74616 76067 gene locus_tag LOCUS_62560 74616 76067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 76149 77096 gene locus_tag LOCUS_62570 76149 77096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 77213 77371 gene locus_tag LOCUS_62580 77213 77371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 77590 78441 gene locus_tag LOCUS_62590 77590 78441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 81704 78381 gene locus_tag LOCUS_62600 81704 78381 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709380.1 protein_id gnl|my_center|LOCUS_62600 83081 81714 gene locus_tag LOCUS_62610 83081 81714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 83414 83214 gene locus_tag LOCUS_62620 83414 83214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 85042 83555 gene locus_tag LOCUS_62630 85042 83555 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083337.1 protein_id gnl|my_center|LOCUS_62630 88469 85356 gene locus_tag LOCUS_62640 88469 85356 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_62640 90713 88482 gene locus_tag LOCUS_62650 90713 88482 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_62650 91969 90713 gene locus_tag LOCUS_62660 91969 90713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 93453 92014 gene locus_tag LOCUS_62670 93453 92014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 >Feature sequence40 1789 2517 gene locus_tag LOCUS_62680 1789 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 3963 2551 gene locus_tag LOCUS_62690 gene mtaD 3963 2551 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_62690 4130 3975 gene locus_tag LOCUS_62700 gene rpmG 4130 3975 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_62700 4275 4199 gene locus_tag LOCUS_t00670 4275 4199 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4384 4309 gene locus_tag LOCUS_t00680 4384 4309 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5109 4483 gene locus_tag LOCUS_62710 5109 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 5616 5236 gene locus_tag LOCUS_62720 5616 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 6064 6657 gene locus_tag LOCUS_62730 gene sodA 6064 6657 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_62730 6881 7174 gene locus_tag LOCUS_62740 6881 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 7312 7386 gene locus_tag LOCUS_t00690 7312 7386 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7511 8866 gene locus_tag LOCUS_62750 gene tilS 7511 8866 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V1 protein_id gnl|my_center|LOCUS_62750 8863 10818 gene locus_tag LOCUS_62760 gene ftsH-2 8863 10818 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_62760 10819 11724 gene locus_tag LOCUS_62770 10819 11724 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8H8 protein_id gnl|my_center|LOCUS_62770 11736 12539 gene locus_tag LOCUS_62780 11736 12539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393731.1 protein_id gnl|my_center|LOCUS_62780 12536 13273 gene locus_tag LOCUS_62790 12536 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 13273 14640 gene locus_tag LOCUS_62800 gene glmM 13273 14640 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99ZW8 protein_id gnl|my_center|LOCUS_62800 17235 14665 gene locus_tag LOCUS_62810 17235 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 18665 17403 gene locus_tag LOCUS_62820 18665 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 18798 19646 gene locus_tag LOCUS_62830 18798 19646 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_62830 19643 20185 gene locus_tag LOCUS_62840 19643 20185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 20182 21429 gene locus_tag LOCUS_62850 20182 21429 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_62850 21542 22477 gene locus_tag LOCUS_62860 21542 22477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 22979 22494 gene locus_tag LOCUS_62870 22979 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 26109 23305 gene locus_tag LOCUS_62880 26109 23305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 26669 26106 gene locus_tag LOCUS_62890 26669 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704782.1 protein_id gnl|my_center|LOCUS_62890 26668 27438 gene locus_tag LOCUS_62900 26668 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 28261 27704 gene locus_tag LOCUS_62910 28261 27704 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_62910 29426 28335 gene locus_tag LOCUS_62920 gene queA 29426 28335 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_62920 30428 29457 gene locus_tag LOCUS_62930 30428 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 31386 30418 gene locus_tag LOCUS_62940 31386 30418 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_62940 33051 31396 gene locus_tag LOCUS_62950 33051 31396 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933296.1 protein_id gnl|my_center|LOCUS_62950 33609 33157 gene locus_tag LOCUS_62960 gene hspA-1 33609 33157 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_62960 33954 35303 gene locus_tag LOCUS_62970 33954 35303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 35507 35346 gene locus_tag LOCUS_62980 35507 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 35794 36108 gene locus_tag LOCUS_62990 gene rplU 35794 36108 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA28 protein_id gnl|my_center|LOCUS_62990 36119 36376 gene locus_tag LOCUS_63000 gene rpmA 36119 36376 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_63000 36431 37489 gene locus_tag LOCUS_63010 gene obg 36431 37489 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_63010 37486 38124 gene locus_tag LOCUS_63020 gene nadD 37486 38124 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX46 protein_id gnl|my_center|LOCUS_63020 38161 38571 gene locus_tag LOCUS_63030 gene rsfS 38161 38571 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBS8 protein_id gnl|my_center|LOCUS_63030 38942 38619 gene locus_tag LOCUS_63040 38942 38619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 38833 40287 gene locus_tag LOCUS_63050 38833 40287 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I133 protein_id gnl|my_center|LOCUS_63050 40504 40668 gene locus_tag LOCUS_63060 40504 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 41171 42382 gene locus_tag LOCUS_63070 41171 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 42873 43643 gene locus_tag LOCUS_63080 42873 43643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 43640 44263 gene locus_tag LOCUS_63090 43640 44263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 44411 45274 gene locus_tag LOCUS_63100 44411 45274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 48180 45271 gene locus_tag LOCUS_63110 48180 45271 CDS product periplasmic peptidase family S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_63110 51291 48295 gene locus_tag LOCUS_63120 51291 48295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_63120 52917 51361 gene locus_tag LOCUS_63130 52917 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 55688 52914 gene locus_tag LOCUS_63140 55688 52914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 55806 56129 gene locus_tag LOCUS_63150 55806 56129 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975686.1 protein_id gnl|my_center|LOCUS_63150 57551 56136 gene locus_tag LOCUS_63160 57551 56136 CDS product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_63160 57710 58813 gene locus_tag LOCUS_63170 57710 58813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 60350 58899 gene locus_tag LOCUS_63180 60350 58899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 62166 60376 gene locus_tag LOCUS_63190 62166 60376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 62216 62905 gene locus_tag LOCUS_63200 62216 62905 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_63200 62886 65273 gene locus_tag LOCUS_63210 62886 65273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 66132 65227 gene locus_tag LOCUS_63220 66132 65227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 66541 71658 gene locus_tag LOCUS_63230 66541 71658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 72595 71696 gene locus_tag LOCUS_63240 gene echA2 72595 71696 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_63240 73102 72671 gene locus_tag LOCUS_63250 73102 72671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 73646 73113 gene locus_tag LOCUS_63260 73646 73113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 75406 73661 gene locus_tag LOCUS_63270 75406 73661 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_63270 78324 75445 gene locus_tag LOCUS_63280 78324 75445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 79376 78378 gene locus_tag LOCUS_63290 79376 78378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 79647 79432 gene locus_tag LOCUS_63300 79647 79432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 81545 79806 gene locus_tag LOCUS_63310 81545 79806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 81645 83297 gene locus_tag LOCUS_63320 81645 83297 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_63320 83297 85222 gene locus_tag LOCUS_63330 83297 85222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 85349 87799 gene locus_tag LOCUS_63340 85349 87799 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_63340 89249 88050 gene locus_tag LOCUS_63350 89249 88050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 90423 89254 gene locus_tag LOCUS_63360 90423 89254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 92813 90420 gene locus_tag LOCUS_63370 92813 90420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_63370 >Feature sequence41 1323 991 gene locus_tag LOCUS_63380 1323 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 4133 1734 gene locus_tag LOCUS_63390 4133 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 4725 4135 gene locus_tag LOCUS_63400 4725 4135 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_63400 5030 6250 gene locus_tag LOCUS_63410 5030 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 6482 6706 gene locus_tag LOCUS_63420 6482 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 6732 6860 gene locus_tag LOCUS_63430 6732 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 6888 7265 gene locus_tag LOCUS_63440 6888 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 7709 8152 gene locus_tag LOCUS_63450 7709 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 10485 8218 gene locus_tag LOCUS_63460 10485 8218 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_63460 11753 10536 gene locus_tag LOCUS_63470 11753 10536 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_63470 13879 11948 gene locus_tag LOCUS_63480 13879 11948 CDS product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368471.1 protein_id gnl|my_center|LOCUS_63480 17002 14123 gene locus_tag LOCUS_63490 17002 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 17683 17093 gene locus_tag LOCUS_63500 17683 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 17884 18450 gene locus_tag LOCUS_63510 17884 18450 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_63510 18462 21455 gene locus_tag LOCUS_63520 18462 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 22822 21524 gene locus_tag LOCUS_63530 gene aprE 22822 21524 CDS product subtilisin E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04189 protein_id gnl|my_center|LOCUS_63530 25394 23016 gene locus_tag LOCUS_63540 25394 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 26320 25517 gene locus_tag LOCUS_63550 26320 25517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 28009 26342 gene locus_tag LOCUS_63560 28009 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 29085 28108 gene locus_tag LOCUS_63570 29085 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_63570 30207 29254 gene locus_tag LOCUS_63580 30207 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 32515 30458 gene locus_tag LOCUS_63590 32515 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 32684 35104 gene locus_tag LOCUS_63600 32684 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 35522 35178 gene locus_tag LOCUS_63610 35522 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 35981 36517 gene locus_tag LOCUS_63620 35981 36517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 37070 36903 gene locus_tag LOCUS_63630 37070 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 37327 38586 gene locus_tag LOCUS_63640 37327 38586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 38982 38596 gene locus_tag LOCUS_63650 38982 38596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 39197 40306 gene locus_tag LOCUS_63660 39197 40306 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_63660 40360 43623 gene locus_tag LOCUS_63670 40360 43623 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_63670 44505 43624 gene locus_tag LOCUS_63680 44505 43624 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_63680 44663 45139 gene locus_tag LOCUS_63690 44663 45139 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 protein_id gnl|my_center|LOCUS_63690 45132 47345 gene locus_tag LOCUS_63700 45132 47345 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_63700 47360 47980 gene locus_tag LOCUS_63710 47360 47980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_63710 48558 47977 gene locus_tag LOCUS_63720 48558 47977 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_63720 48584 51187 gene locus_tag LOCUS_63730 48584 51187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 51293 52822 gene locus_tag LOCUS_63740 51293 52822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 52893 54572 gene locus_tag LOCUS_63750 52893 54572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 57915 54601 gene locus_tag LOCUS_63760 57915 54601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 58231 59718 gene locus_tag LOCUS_63770 58231 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 60293 59733 gene locus_tag LOCUS_63780 60293 59733 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_63780 62895 60253 gene locus_tag LOCUS_63790 62895 60253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 62957 63520 gene locus_tag LOCUS_63800 62957 63520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 64244 63579 gene locus_tag LOCUS_63810 64244 63579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 64695 64399 gene locus_tag LOCUS_63820 64695 64399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 65006 64734 gene locus_tag LOCUS_63830 65006 64734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 65119 65838 gene locus_tag LOCUS_63840 65119 65838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 66012 67715 gene locus_tag LOCUS_63850 66012 67715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 71289 68302 gene locus_tag LOCUS_63860 71289 68302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 72029 71298 gene locus_tag LOCUS_63870 72029 71298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 72628 72026 gene locus_tag LOCUS_63880 72628 72026 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_63880 74722 72782 gene locus_tag LOCUS_63890 74722 72782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 76184 74928 gene locus_tag LOCUS_63900 76184 74928 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_63900 76314 77645 gene locus_tag LOCUS_63910 76314 77645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 78229 77720 gene locus_tag LOCUS_63920 78229 77720 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_63920 80634 78250 gene locus_tag LOCUS_63930 80634 78250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 80716 81567 gene locus_tag LOCUS_63940 80716 81567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 81615 82448 gene locus_tag LOCUS_63950 81615 82448 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 protein_id gnl|my_center|LOCUS_63950 83911 82529 gene locus_tag LOCUS_63960 83911 82529 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_63960 84623 83922 gene locus_tag LOCUS_63970 84623 83922 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887702.1 protein_id gnl|my_center|LOCUS_63970 84800 86044 gene locus_tag LOCUS_63980 84800 86044 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545350.1 protein_id gnl|my_center|LOCUS_63980 86041 86769 gene locus_tag LOCUS_63990 86041 86769 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971886.1 protein_id gnl|my_center|LOCUS_63990 86769 87980 gene locus_tag LOCUS_64000 86769 87980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_64000 88008 88535 gene locus_tag LOCUS_64010 88008 88535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 88735 90231 gene locus_tag LOCUS_64020 gene cat2 88735 90231 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404986.1 protein_id gnl|my_center|LOCUS_64020 90228 91703 gene locus_tag LOCUS_64030 90228 91703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 91700 92458 gene locus_tag LOCUS_64040 91700 92458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 >Feature sequence42 143 727 gene locus_tag LOCUS_64050 143 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 724 1263 gene locus_tag LOCUS_64060 724 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 1286 3217 gene locus_tag LOCUS_64070 1286 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 3303 3788 gene locus_tag LOCUS_64080 gene pulG 3303 3788 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_64080 3791 4300 gene locus_tag LOCUS_64090 gene oxpG 3791 4300 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_64090 4303 5127 gene locus_tag LOCUS_64100 4303 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 5124 5582 gene locus_tag LOCUS_64110 gene dut 5124 5582 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UII1 protein_id gnl|my_center|LOCUS_64110 9375 5569 gene locus_tag LOCUS_64120 9375 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 9565 13068 gene locus_tag LOCUS_64130 9565 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 14326 13046 gene locus_tag LOCUS_64140 gene argD 14326 13046 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJU9 protein_id gnl|my_center|LOCUS_64140 14911 14327 gene locus_tag LOCUS_64150 gene recR 14911 14327 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_64150 15211 14918 gene locus_tag LOCUS_64160 15211 14918 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213992.1 protein_id gnl|my_center|LOCUS_64160 17101 15251 gene locus_tag LOCUS_64170 17101 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 20254 17324 gene locus_tag LOCUS_64180 20254 17324 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_64180 21495 20854 gene locus_tag LOCUS_64190 21495 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 21969 21508 gene locus_tag LOCUS_64200 21969 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 22637 22870 gene locus_tag LOCUS_64210 22637 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 22928 23779 gene locus_tag LOCUS_64220 gene accD 22928 23779 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_64220 24229 23792 gene locus_tag LOCUS_64230 24229 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 25566 24226 gene locus_tag LOCUS_64240 gene folC 25566 24226 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_64240 26951 25566 gene locus_tag LOCUS_64250 gene lpdA2 26951 25566 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 protein_id gnl|my_center|LOCUS_64250 27280 26996 gene locus_tag LOCUS_64260 27280 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 27471 28799 gene locus_tag LOCUS_64270 27471 28799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 28869 29402 gene locus_tag LOCUS_64280 28869 29402 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_64280 29415 31088 gene locus_tag LOCUS_64290 29415 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 31109 32863 gene locus_tag LOCUS_64300 gene dnaG 31109 32863 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT6 protein_id gnl|my_center|LOCUS_64300 32920 34617 gene locus_tag LOCUS_64310 gene rpoD 32920 34617 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_64310 36008 34614 gene locus_tag LOCUS_64320 36008 34614 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_64320 35946 36098 gene locus_tag LOCUS_64330 35946 36098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 36700 36137 gene locus_tag LOCUS_64340 36700 36137 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_64340 36808 37656 gene locus_tag LOCUS_64350 36808 37656 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX92 protein_id gnl|my_center|LOCUS_64350 37653 38288 gene locus_tag LOCUS_64360 37653 38288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 38629 38315 gene locus_tag LOCUS_64370 38629 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 38714 39418 gene locus_tag LOCUS_64380 gene lepB 38714 39418 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E75 protein_id gnl|my_center|LOCUS_64380 39388 40080 gene locus_tag LOCUS_64390 gene lepB 39388 40080 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E75 protein_id gnl|my_center|LOCUS_64390 40091 40564 gene locus_tag LOCUS_64400 40091 40564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 40571 42310 gene locus_tag LOCUS_64410 40571 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 43120 42323 gene locus_tag LOCUS_64420 43120 42323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 43593 43117 gene locus_tag LOCUS_64430 43593 43117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 44192 43590 gene locus_tag LOCUS_64440 gene rpoE 44192 43590 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_64440 44399 44854 gene locus_tag LOCUS_64450 44399 44854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 44891 45637 gene locus_tag LOCUS_64460 44891 45637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_64460 45634 46083 gene locus_tag LOCUS_64470 45634 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 46513 47583 gene locus_tag LOCUS_64480 gene rsgA 46513 47583 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_64480 48989 47601 gene locus_tag LOCUS_64490 gene glmU 48989 47601 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX6 protein_id gnl|my_center|LOCUS_64490 49946 48999 gene locus_tag LOCUS_64500 49946 48999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 50604 49993 gene locus_tag LOCUS_64510 50604 49993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 51191 50607 gene locus_tag LOCUS_64520 gene mglA 51191 50607 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_64520 51703 51206 gene locus_tag LOCUS_64530 gene mglB 51703 51206 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_64530 51912 53627 gene locus_tag LOCUS_64540 51912 53627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 53657 55447 gene locus_tag LOCUS_64550 53657 55447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 55465 57426 gene locus_tag LOCUS_64560 55465 57426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 58250 57519 gene locus_tag LOCUS_64570 58250 57519 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_64570 58377 58787 gene locus_tag LOCUS_64580 58377 58787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_64580 58863 61745 gene locus_tag LOCUS_64590 58863 61745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 64163 61749 gene locus_tag LOCUS_64600 gene mutS2 64163 61749 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FQ9 protein_id gnl|my_center|LOCUS_64600 64470 64261 gene locus_tag LOCUS_64610 gene rpsU2 64470 64261 CDS product 30S ribosomal protein S21 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B4 protein_id gnl|my_center|LOCUS_64610 65434 64580 gene locus_tag LOCUS_64620 65434 64580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 65780 67420 gene locus_tag LOCUS_64630 65780 67420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 67386 68726 gene locus_tag LOCUS_64640 67386 68726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 68781 68856 gene locus_tag LOCUS_t00700 68781 68856 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 68890 69624 gene locus_tag LOCUS_64650 68890 69624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 69621 70331 gene locus_tag LOCUS_64660 gene ylmE 69621 70331 CDS product UPF0001 protein YlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31727 protein_id gnl|my_center|LOCUS_64660 70436 70936 gene locus_tag LOCUS_64670 70436 70936 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_64670 70947 72791 gene locus_tag LOCUS_64680 70947 72791 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_64680 75372 72712 gene locus_tag LOCUS_64690 75372 72712 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_64690 75468 76463 gene locus_tag LOCUS_64700 75468 76463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 76491 78041 gene locus_tag LOCUS_64710 76491 78041 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_64710 78045 80009 gene locus_tag LOCUS_64720 78045 80009 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_64720 80398 80006 gene locus_tag LOCUS_64730 80398 80006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 80670 80395 gene locus_tag LOCUS_64740 80670 80395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 80801 82189 gene locus_tag LOCUS_64750 80801 82189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 >Feature sequence43 1004 1312 gene locus_tag LOCUS_64760 1004 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64760 1900 2508 gene locus_tag LOCUS_64770 1900 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 5644 2390 gene locus_tag LOCUS_64780 5644 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_64780 7109 5697 gene locus_tag LOCUS_64790 7109 5697 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D289 protein_id gnl|my_center|LOCUS_64790 7970 7176 gene locus_tag LOCUS_64800 7970 7176 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_64800 8915 8037 gene locus_tag LOCUS_64810 8915 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 9088 9855 gene locus_tag LOCUS_64820 9088 9855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084036.1 protein_id gnl|my_center|LOCUS_64820 12918 10465 gene locus_tag LOCUS_64830 12918 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_64830 13055 13804 gene locus_tag LOCUS_64840 13055 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 14670 14062 gene locus_tag LOCUS_64850 14670 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_64850 14854 15453 gene locus_tag LOCUS_64860 14854 15453 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_64860 15450 16775 gene locus_tag LOCUS_64870 15450 16775 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_64870 16786 17763 gene locus_tag LOCUS_64880 16786 17763 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_64880 17756 18382 gene locus_tag LOCUS_64890 17756 18382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 18379 19323 gene locus_tag LOCUS_64900 18379 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_64900 20224 19298 gene locus_tag LOCUS_64910 20224 19298 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_64910 21115 20339 gene locus_tag LOCUS_64920 21115 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 21698 21135 gene locus_tag LOCUS_64930 21698 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_64930 22912 21767 gene locus_tag LOCUS_64940 22912 21767 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_64940 24455 22923 gene locus_tag LOCUS_64950 24455 22923 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_64950 26066 24468 gene locus_tag LOCUS_64960 26066 24468 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_64960 26178 27371 gene locus_tag LOCUS_64970 26178 27371 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_64970 27371 28123 gene locus_tag LOCUS_64980 27371 28123 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031092.1 protein_id gnl|my_center|LOCUS_64980 28602 29540 gene locus_tag LOCUS_64990 28602 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 29509 30651 gene locus_tag LOCUS_65000 29509 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 32529 30910 gene locus_tag LOCUS_65010 32529 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 33385 33585 gene locus_tag LOCUS_65020 33385 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 34683 33790 gene locus_tag LOCUS_65030 34683 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 35146 34673 gene locus_tag LOCUS_65040 35146 34673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 36177 35191 gene locus_tag LOCUS_65050 36177 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 36234 39308 gene locus_tag LOCUS_65060 gene sbcC 36234 39308 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIS6 protein_id gnl|my_center|LOCUS_65060 39369 39593 gene locus_tag LOCUS_65070 39369 39593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 39590 39910 gene locus_tag LOCUS_65080 39590 39910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 39912 40979 gene locus_tag LOCUS_65090 39912 40979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_65090 44140 40988 gene locus_tag LOCUS_65100 44140 40988 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_65100 44410 50076 gene locus_tag LOCUS_65110 44410 50076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65110 51090 50095 gene locus_tag LOCUS_65120 51090 50095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 51126 52919 gene locus_tag LOCUS_65130 51126 52919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 52929 53993 gene locus_tag LOCUS_65140 52929 53993 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_65140 53993 57109 gene locus_tag LOCUS_65150 53993 57109 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_65150 57106 57960 gene locus_tag LOCUS_65160 57106 57960 CDS product putative ABC transporter antibiotic-transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702595.1 protein_id gnl|my_center|LOCUS_65160 57957 58676 gene locus_tag LOCUS_65170 57957 58676 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258570.1 protein_id gnl|my_center|LOCUS_65170 58673 59422 gene locus_tag LOCUS_65180 58673 59422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258569.1 protein_id gnl|my_center|LOCUS_65180 59559 60932 gene locus_tag LOCUS_65190 59559 60932 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_65190 60957 62495 gene locus_tag LOCUS_65200 60957 62495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 65917 63212 gene locus_tag LOCUS_65210 65917 63212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 66515 65931 gene locus_tag LOCUS_65220 66515 65931 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875926.1 protein_id gnl|my_center|LOCUS_65220 66730 66515 gene locus_tag LOCUS_65230 66730 66515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 67202 66723 gene locus_tag LOCUS_65240 67202 66723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 67152 67451 gene locus_tag LOCUS_65250 67152 67451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 67877 67467 gene locus_tag LOCUS_65260 gene ycf35 67877 67467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_65260 69459 67912 gene locus_tag LOCUS_65270 gene ycf46 69459 67912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_65270 70863 69481 gene locus_tag LOCUS_65280 gene asnC 70863 69481 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185B5 protein_id gnl|my_center|LOCUS_65280 72197 70884 gene locus_tag LOCUS_65290 72197 70884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 72609 72199 gene locus_tag LOCUS_65300 72609 72199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_65300 73204 72599 gene locus_tag LOCUS_65310 73204 72599 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_65310 75830 73233 gene locus_tag LOCUS_65320 75830 73233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 77346 75940 gene locus_tag LOCUS_65330 77346 75940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 79892 77343 gene locus_tag LOCUS_65340 79892 77343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 79983 81140 gene locus_tag LOCUS_65350 79983 81140 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_65350 81174 81548 gene locus_tag LOCUS_65360 81174 81548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 >Feature sequence44 3442 368 gene locus_tag LOCUS_65370 3442 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 3545 3742 gene locus_tag LOCUS_65380 3545 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 3749 4267 gene locus_tag LOCUS_65390 3749 4267 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_65390 5570 4233 gene locus_tag LOCUS_65400 5570 4233 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_65400 7813 5570 gene locus_tag LOCUS_65410 7813 5570 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_65410 9067 7988 gene locus_tag LOCUS_65420 9067 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 9846 9238 gene locus_tag LOCUS_65430 9846 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 11961 9850 gene locus_tag LOCUS_65440 11961 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 12215 13015 gene locus_tag LOCUS_65450 12215 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 13092 15080 gene locus_tag LOCUS_65460 13092 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142453.1 protein_id gnl|my_center|LOCUS_65460 16872 15139 gene locus_tag LOCUS_65470 16872 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 16887 17516 gene locus_tag LOCUS_65480 16887 17516 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_65480 17668 18681 gene locus_tag LOCUS_65490 17668 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 21880 18803 gene locus_tag LOCUS_65500 21880 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 23402 21870 gene locus_tag LOCUS_65510 23402 21870 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_65510 24310 23399 gene locus_tag LOCUS_65520 24310 23399 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_65520 24768 24307 gene locus_tag LOCUS_65530 24768 24307 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_65530 24850 26913 gene locus_tag LOCUS_65540 24850 26913 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_65540 27770 27201 gene locus_tag LOCUS_65550 27770 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 27820 28371 gene locus_tag LOCUS_65560 27820 28371 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_65560 28389 29126 gene locus_tag LOCUS_65570 28389 29126 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_65570 29153 31051 gene locus_tag LOCUS_65580 29153 31051 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_65580 31087 31317 gene locus_tag LOCUS_65590 31087 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 31497 32627 gene locus_tag LOCUS_65600 31497 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 32736 33788 gene locus_tag LOCUS_65610 32736 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 36808 33785 gene locus_tag LOCUS_65620 36808 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_65620 36875 40966 gene locus_tag LOCUS_65630 36875 40966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 42411 41206 gene locus_tag LOCUS_65640 42411 41206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 42995 42453 gene locus_tag LOCUS_65650 42995 42453 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_65650 43183 44310 gene locus_tag LOCUS_65660 43183 44310 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_65660 44493 46199 gene locus_tag LOCUS_65670 44493 46199 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_65670 46228 47103 gene locus_tag LOCUS_65680 gene pstS 46228 47103 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_65680 47116 47793 gene locus_tag LOCUS_65690 47116 47793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 48126 49307 gene locus_tag LOCUS_65700 48126 49307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767593.1 protein_id gnl|my_center|LOCUS_65700 50059 49316 gene locus_tag LOCUS_65710 50059 49316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 50110 50739 gene locus_tag LOCUS_65720 50110 50739 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_65720 50812 51549 gene locus_tag LOCUS_65730 50812 51549 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_65730 51546 53186 gene locus_tag LOCUS_65740 51546 53186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 53228 54949 gene locus_tag LOCUS_65750 53228 54949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 54992 56557 gene locus_tag LOCUS_65760 54992 56557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140644.1 protein_id gnl|my_center|LOCUS_65760 56578 57177 gene locus_tag LOCUS_65770 56578 57177 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_65770 57174 59630 gene locus_tag LOCUS_65780 57174 59630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 60615 59599 gene locus_tag LOCUS_65790 60615 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 60874 63099 gene locus_tag LOCUS_65800 60874 63099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 63895 63122 gene locus_tag LOCUS_65810 63895 63122 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969781.1 protein_id gnl|my_center|LOCUS_65810 64102 63935 gene locus_tag LOCUS_65820 64102 63935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 64115 64936 gene locus_tag LOCUS_65830 64115 64936 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_65830 64951 65931 gene locus_tag LOCUS_65840 64951 65931 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_65840 65950 66711 gene locus_tag LOCUS_65850 gene dhrS4 65950 66711 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_65850 66805 67140 gene locus_tag LOCUS_65860 66805 67140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 67137 69740 gene locus_tag LOCUS_65870 67137 69740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_65870 69826 72357 gene locus_tag LOCUS_65880 69826 72357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 73862 72411 gene locus_tag LOCUS_65890 73862 72411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 74958 73882 gene locus_tag LOCUS_65900 74958 73882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 76462 74960 gene locus_tag LOCUS_65910 76462 74960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 76741 78072 gene locus_tag LOCUS_65920 76741 78072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 78764 78147 gene locus_tag LOCUS_65930 78764 78147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 >Feature sequence45 1453 473 gene locus_tag LOCUS_65940 1453 473 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_65940 1710 1952 gene locus_tag LOCUS_65950 1710 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 1837 2232 gene locus_tag LOCUS_65960 1837 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 2229 3035 gene locus_tag LOCUS_65970 gene dapB 2229 3035 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD52 protein_id gnl|my_center|LOCUS_65970 4777 2978 gene locus_tag LOCUS_65980 4777 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765190.1 protein_id gnl|my_center|LOCUS_65980 6948 4780 gene locus_tag LOCUS_65990 6948 4780 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_65990 7133 8095 gene locus_tag LOCUS_66000 gene pulF 7133 8095 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_66000 8125 9816 gene locus_tag LOCUS_66010 8125 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 10978 9821 gene locus_tag LOCUS_66020 10978 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 12285 10984 gene locus_tag LOCUS_66030 12285 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 14490 12394 gene locus_tag LOCUS_66040 14490 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 15573 14518 gene locus_tag LOCUS_66050 15573 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 16316 15579 gene locus_tag LOCUS_66060 16316 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 17752 16547 gene locus_tag LOCUS_66070 17752 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 18907 17777 gene locus_tag LOCUS_66080 18907 17777 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_66080 19002 19427 gene locus_tag LOCUS_66090 19002 19427 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_66090 20385 19438 gene locus_tag LOCUS_66100 20385 19438 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_66100 22493 20382 gene locus_tag LOCUS_66110 22493 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 22703 25336 gene locus_tag LOCUS_66120 gene mutS 22703 25336 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_66120 25825 25571 gene locus_tag LOCUS_66130 25825 25571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 26088 27185 gene locus_tag LOCUS_66140 gene rbsR 26088 27185 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_66140 27282 28799 gene locus_tag LOCUS_66150 gene gltB2 27282 28799 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_66150 29719 28811 gene locus_tag LOCUS_66160 29719 28811 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_66160 30463 29777 gene locus_tag LOCUS_66170 30463 29777 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120671.1 protein_id gnl|my_center|LOCUS_66170 30669 34112 gene locus_tag LOCUS_66180 30669 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 34749 34060 gene locus_tag LOCUS_66190 34749 34060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 34630 34965 gene locus_tag LOCUS_66200 34630 34965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 34981 35172 gene locus_tag LOCUS_66210 34981 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 35744 35169 gene locus_tag LOCUS_66220 35744 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_66220 35976 35782 gene locus_tag LOCUS_66230 35976 35782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 36019 40656 gene locus_tag LOCUS_66240 36019 40656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 42293 40764 gene locus_tag LOCUS_66250 42293 40764 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_66250 42838 42293 gene locus_tag LOCUS_66260 42838 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 42980 44002 gene locus_tag LOCUS_66270 gene dmt 42980 44002 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_66270 43999 45888 gene locus_tag LOCUS_66280 43999 45888 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_66280 45896 47383 gene locus_tag LOCUS_66290 45896 47383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 47398 48630 gene locus_tag LOCUS_66300 gene acrE 47398 48630 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_66300 49985 49095 gene locus_tag LOCUS_66310 49985 49095 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_66310 51087 50089 gene locus_tag LOCUS_66320 gene moxR 51087 50089 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_66320 51927 51124 gene locus_tag LOCUS_66330 51927 51124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 54107 51939 gene locus_tag LOCUS_66340 54107 51939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 55795 54086 gene locus_tag LOCUS_66350 55795 54086 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_66350 57087 55807 gene locus_tag LOCUS_66360 57087 55807 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325333.1 protein_id gnl|my_center|LOCUS_66360 57950 57084 gene locus_tag LOCUS_66370 57950 57084 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_66370 58892 58026 gene locus_tag LOCUS_66380 58892 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 60831 59026 gene locus_tag LOCUS_66390 60831 59026 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_66390 60968 61240 gene locus_tag LOCUS_66400 60968 61240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66400 61237 61554 gene locus_tag LOCUS_66410 61237 61554 CDS product toxin MazF5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_66410 61571 62827 gene locus_tag LOCUS_66420 61571 62827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 63320 63529 gene locus_tag LOCUS_66430 63320 63529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 63682 64170 gene locus_tag LOCUS_66440 63682 64170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 66216 64180 gene locus_tag LOCUS_66450 66216 64180 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_66450 66272 68737 gene locus_tag LOCUS_66460 66272 68737 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_66460 68898 69485 gene locus_tag LOCUS_66470 68898 69485 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_66470 69509 70261 gene locus_tag LOCUS_66480 69509 70261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 70287 73277 gene locus_tag LOCUS_66490 70287 73277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 73340 73996 gene locus_tag LOCUS_66500 73340 73996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 76649 74358 gene locus_tag LOCUS_66510 76649 74358 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_66510 76840 78297 gene locus_tag LOCUS_66520 76840 78297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 >Feature sequence46 1711 455 gene locus_tag LOCUS_66530 1711 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968156.1 protein_id gnl|my_center|LOCUS_66530 2500 1718 gene locus_tag LOCUS_66540 2500 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968155.1 protein_id gnl|my_center|LOCUS_66540 2800 2582 gene locus_tag LOCUS_66550 2800 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 5130 3313 gene locus_tag LOCUS_66560 gene shc 5130 3313 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_66560 6003 5134 gene locus_tag LOCUS_66570 6003 5134 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_66570 7648 5963 gene locus_tag LOCUS_66580 7648 5963 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_66580 8496 7696 gene locus_tag LOCUS_66590 8496 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 8865 8500 gene locus_tag LOCUS_66600 8865 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 10069 8867 gene locus_tag LOCUS_66610 10069 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_66610 10521 10048 gene locus_tag LOCUS_66620 gene gcvH 10521 10048 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_66620 11740 10523 gene locus_tag LOCUS_66630 gene iscS 11740 10523 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_66630 13077 11737 gene locus_tag LOCUS_66640 13077 11737 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_66640 13311 14216 gene locus_tag LOCUS_66650 13311 14216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061388.1 protein_id gnl|my_center|LOCUS_66650 15079 14162 gene locus_tag LOCUS_66660 15079 14162 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_66660 15157 15618 gene locus_tag LOCUS_66670 15157 15618 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731249.1 protein_id gnl|my_center|LOCUS_66670 15690 17873 gene locus_tag LOCUS_66680 gene katG 15690 17873 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TK84 protein_id gnl|my_center|LOCUS_66680 19254 17938 gene locus_tag LOCUS_66690 19254 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 21488 19251 gene locus_tag LOCUS_66700 21488 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66700 21644 22084 gene locus_tag LOCUS_66710 21644 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_66710 22096 23559 gene locus_tag LOCUS_66720 22096 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 24395 23556 gene locus_tag LOCUS_66730 24395 23556 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_66730 24610 25551 gene locus_tag LOCUS_66740 24610 25551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 26310 27002 gene locus_tag LOCUS_66750 26310 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 28010 27033 gene locus_tag LOCUS_66760 28010 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 29127 28039 gene locus_tag LOCUS_66770 29127 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 29280 30272 gene locus_tag LOCUS_66780 29280 30272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 30432 31778 gene locus_tag LOCUS_66790 30432 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 31775 32794 gene locus_tag LOCUS_66800 gene rtcA 31775 32794 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XUT2 protein_id gnl|my_center|LOCUS_66800 32831 35380 gene locus_tag LOCUS_66810 32831 35380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 35355 36227 gene locus_tag LOCUS_66820 35355 36227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_66820 36247 37905 gene locus_tag LOCUS_66830 36247 37905 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_66830 41067 37945 gene locus_tag LOCUS_66840 41067 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 43537 41153 gene locus_tag LOCUS_66850 43537 41153 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_66850 43910 46147 gene locus_tag LOCUS_66860 43910 46147 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_66860 46240 47076 gene locus_tag LOCUS_66870 46240 47076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 47076 48041 gene locus_tag LOCUS_66880 47076 48041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_66880 48038 48898 gene locus_tag LOCUS_66890 48038 48898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 49201 48983 gene locus_tag LOCUS_66900 49201 48983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 49280 50128 gene locus_tag LOCUS_66910 49280 50128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 50877 50164 gene locus_tag LOCUS_66920 50877 50164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 53141 50874 gene locus_tag LOCUS_66930 53141 50874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 53753 54739 gene locus_tag LOCUS_66940 53753 54739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 54766 55776 gene locus_tag LOCUS_66950 54766 55776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 55903 56130 gene locus_tag LOCUS_66960 55903 56130 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFG9 protein_id gnl|my_center|LOCUS_66960 56127 56516 gene locus_tag LOCUS_66970 56127 56516 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_66970 56547 57878 gene locus_tag LOCUS_66980 56547 57878 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_66980 57979 58503 gene locus_tag LOCUS_66990 57979 58503 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_66990 58500 59378 gene locus_tag LOCUS_67000 58500 59378 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339357.1 protein_id gnl|my_center|LOCUS_67000 61557 59329 gene locus_tag LOCUS_67010 61557 59329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 61652 63967 gene locus_tag LOCUS_67020 61652 63967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 63964 66366 gene locus_tag LOCUS_67030 63964 66366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 66403 67602 gene locus_tag LOCUS_67040 66403 67602 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_67040 67599 68393 gene locus_tag LOCUS_67050 67599 68393 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 protein_id gnl|my_center|LOCUS_67050 68593 70332 gene locus_tag LOCUS_67060 68593 70332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 70419 71780 gene locus_tag LOCUS_67070 70419 71780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67070 73628 71811 gene locus_tag LOCUS_67080 73628 71811 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_67080 73851 74717 gene locus_tag LOCUS_67090 73851 74717 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_67090 75034 74804 gene locus_tag LOCUS_67100 75034 74804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 >Feature sequence47 805 2106 gene locus_tag LOCUS_67110 805 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 2310 2900 gene locus_tag LOCUS_67120 2310 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 3100 3402 gene locus_tag LOCUS_67130 3100 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 3484 3741 gene locus_tag LOCUS_67140 3484 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 3751 4629 gene locus_tag LOCUS_67150 3751 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 4658 5551 gene locus_tag LOCUS_67160 4658 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 6105 7037 gene locus_tag LOCUS_67170 6105 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_67170 7065 8087 gene locus_tag LOCUS_67180 7065 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 8513 8100 gene locus_tag LOCUS_67190 8513 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 8778 8506 gene locus_tag LOCUS_67200 8778 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 9223 8822 gene locus_tag LOCUS_67210 9223 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 9804 9223 gene locus_tag LOCUS_67220 9804 9223 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_67220 10252 9818 gene locus_tag LOCUS_67230 10252 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 11493 10450 gene locus_tag LOCUS_67240 gene nadA 11493 10450 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U4 protein_id gnl|my_center|LOCUS_67240 11832 14333 gene locus_tag LOCUS_67250 11832 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 14481 15335 gene locus_tag LOCUS_67260 14481 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 16385 15342 gene locus_tag LOCUS_67270 16385 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 17069 16470 gene locus_tag LOCUS_67280 17069 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 17744 17157 gene locus_tag LOCUS_67290 17744 17157 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_67290 20117 17772 gene locus_tag LOCUS_67300 20117 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 20727 20323 gene locus_tag LOCUS_67310 20727 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 21863 20898 gene locus_tag LOCUS_67320 21863 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_67320 22229 23623 gene locus_tag LOCUS_67330 22229 23623 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_67330 23712 26747 gene locus_tag LOCUS_67340 23712 26747 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_67340 26837 27055 gene locus_tag LOCUS_67350 26837 27055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 29715 27253 gene locus_tag LOCUS_67360 29715 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_67360 32813 29955 gene locus_tag LOCUS_67370 32813 29955 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_67370 33736 32867 gene locus_tag LOCUS_67380 33736 32867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 33787 34470 gene locus_tag LOCUS_67390 33787 34470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 34913 35890 gene locus_tag LOCUS_67400 34913 35890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 36151 35927 gene locus_tag LOCUS_67410 36151 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 36630 36223 gene locus_tag LOCUS_67420 36630 36223 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682163.1 protein_id gnl|my_center|LOCUS_67420 36905 36627 gene locus_tag LOCUS_67430 36905 36627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 37212 36970 gene locus_tag LOCUS_67440 37212 36970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 37347 38393 gene locus_tag LOCUS_67450 37347 38393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 39240 38449 gene locus_tag LOCUS_67460 39240 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 39648 40766 gene locus_tag LOCUS_67470 39648 40766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 40803 42260 gene locus_tag LOCUS_67480 40803 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 42257 43999 gene locus_tag LOCUS_67490 42257 43999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 44043 45161 gene locus_tag LOCUS_67500 44043 45161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 46353 45712 gene locus_tag LOCUS_67510 46353 45712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 46234 47745 gene locus_tag LOCUS_67520 46234 47745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 48464 47907 gene locus_tag LOCUS_67530 48464 47907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 49504 50118 gene locus_tag LOCUS_67540 49504 50118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 50515 50141 gene locus_tag LOCUS_67550 50515 50141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 51164 50808 gene locus_tag LOCUS_67560 51164 50808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 51733 51476 gene locus_tag LOCUS_67570 51733 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 52733 53407 gene locus_tag LOCUS_67580 52733 53407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 53838 54575 gene locus_tag LOCUS_67590 53838 54575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 54836 55483 gene locus_tag LOCUS_67600 54836 55483 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_67600 55471 58635 gene locus_tag LOCUS_67610 55471 58635 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_67610 58664 59224 gene locus_tag LOCUS_67620 58664 59224 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_67620 59224 61170 gene locus_tag LOCUS_67630 59224 61170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 61192 61995 gene locus_tag LOCUS_67640 61192 61995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 61992 62816 gene locus_tag LOCUS_67650 61992 62816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67650 62886 64652 gene locus_tag LOCUS_67660 62886 64652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 65056 64649 gene locus_tag LOCUS_67670 gene vapC 65056 64649 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930F9 protein_id gnl|my_center|LOCUS_67670 65286 65053 gene locus_tag LOCUS_67680 65286 65053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 >Feature sequence48 298 110 gene locus_tag LOCUS_67690 298 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 204 2492 gene locus_tag LOCUS_67700 204 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 3237 2518 gene locus_tag LOCUS_67710 3237 2518 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_67710 3322 3702 gene locus_tag LOCUS_67720 3322 3702 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_67720 3704 5032 gene locus_tag LOCUS_67730 3704 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 5029 6354 gene locus_tag LOCUS_67740 5029 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 6367 7434 gene locus_tag LOCUS_67750 gene ychF 6367 7434 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z7 protein_id gnl|my_center|LOCUS_67750 7464 8177 gene locus_tag LOCUS_67760 gene smuG1 7464 8177 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_67760 9182 8961 gene locus_tag LOCUS_67770 9182 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 10355 9201 gene locus_tag LOCUS_67780 10355 9201 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_67780 11462 10368 gene locus_tag LOCUS_67790 gene hppD 11462 10368 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404122.1 protein_id gnl|my_center|LOCUS_67790 11904 11593 gene locus_tag LOCUS_67800 11904 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 12345 11944 gene locus_tag LOCUS_67810 12345 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 12425 13588 gene locus_tag LOCUS_67820 12425 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 13653 15944 gene locus_tag LOCUS_67830 13653 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 15985 16617 gene locus_tag LOCUS_67840 15985 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 16645 18699 gene locus_tag LOCUS_67850 16645 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_67850 19952 18696 gene locus_tag LOCUS_67860 19952 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 20014 21144 gene locus_tag LOCUS_67870 20014 21144 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_67870 21141 22304 gene locus_tag LOCUS_67880 21141 22304 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_67880 22301 23719 gene locus_tag LOCUS_67890 22301 23719 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_67890 24173 23769 gene locus_tag LOCUS_67900 24173 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 24332 27649 gene locus_tag LOCUS_67910 24332 27649 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_67910 27797 29461 gene locus_tag LOCUS_67920 gene asnB 27797 29461 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_67920 30048 29458 gene locus_tag LOCUS_67930 30048 29458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 30985 30050 gene locus_tag LOCUS_67940 gene folD 30985 30050 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_67940 31279 31737 gene locus_tag LOCUS_67950 gene rplM 31279 31737 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_67950 31734 32126 gene locus_tag LOCUS_67960 gene rpsI 31734 32126 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T3 protein_id gnl|my_center|LOCUS_67960 32138 32983 gene locus_tag LOCUS_67970 gene rpsB 32138 32983 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_67970 33128 33781 gene locus_tag LOCUS_67980 gene tsf 33128 33781 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_67980 33778 34521 gene locus_tag LOCUS_67990 gene pyrH 33778 34521 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6G5 protein_id gnl|my_center|LOCUS_67990 35759 34518 gene locus_tag LOCUS_68000 35759 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 37087 35774 gene locus_tag LOCUS_68010 gene dnaA 37087 35774 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG6 protein_id gnl|my_center|LOCUS_68010 37345 38415 gene locus_tag LOCUS_68020 gene mutY 37345 38415 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 protein_id gnl|my_center|LOCUS_68020 38435 39715 gene locus_tag LOCUS_68030 gene serS 38435 39715 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H55 protein_id gnl|my_center|LOCUS_68030 39728 39815 gene locus_tag LOCUS_t00710 39728 39815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41222 39822 gene locus_tag LOCUS_68040 41222 39822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 42693 41251 gene locus_tag LOCUS_68050 42693 41251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 43482 42820 gene locus_tag LOCUS_68060 43482 42820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 45216 43855 gene locus_tag LOCUS_68070 gene pilR 45216 43855 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037720.1 protein_id gnl|my_center|LOCUS_68070 45517 45236 gene locus_tag LOCUS_68080 45517 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 46770 45514 gene locus_tag LOCUS_68090 46770 45514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 47445 46873 gene locus_tag LOCUS_68100 47445 46873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 49472 47985 gene locus_tag LOCUS_68110 gene cafA 49472 47985 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_68110 50640 49504 gene locus_tag LOCUS_68120 gene rodA 50640 49504 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_68120 52369 50609 gene locus_tag LOCUS_68130 52369 50609 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_68130 52887 52366 gene locus_tag LOCUS_68140 52887 52366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 53717 52884 gene locus_tag LOCUS_68150 53717 52884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 54753 53728 gene locus_tag LOCUS_68160 gene mreB-1 54753 53728 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_68160 56279 54858 gene locus_tag LOCUS_68170 56279 54858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 56454 58382 gene locus_tag LOCUS_68180 56454 58382 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R77 protein_id gnl|my_center|LOCUS_68180 58379 58990 gene locus_tag LOCUS_68190 gene ruvA 58379 58990 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_68190 >Feature sequence49 <1 1477 gene locus_tag LOCUS_68200 <1 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022506.1:phycocyanobilin lyase 4830 2176 gene locus_tag LOCUS_68210 gene alaS 4830 2176 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ3 protein_id gnl|my_center|LOCUS_68210 4992 5930 gene locus_tag LOCUS_68220 4992 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676321.1 protein_id gnl|my_center|LOCUS_68220 7272 5935 gene locus_tag LOCUS_68230 7272 5935 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_68230 7750 7601 gene locus_tag LOCUS_68240 7750 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 7866 9470 gene locus_tag LOCUS_68250 7866 9470 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259102.1 protein_id gnl|my_center|LOCUS_68250 10194 9478 gene locus_tag LOCUS_68260 10194 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 12378 10207 gene locus_tag LOCUS_68270 12378 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 16000 12494 gene locus_tag LOCUS_68280 16000 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 16685 15993 gene locus_tag LOCUS_68290 16685 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 16812 17135 gene locus_tag LOCUS_68300 16812 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 17135 19954 gene locus_tag LOCUS_68310 17135 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_68310 20011 20877 gene locus_tag LOCUS_68320 20011 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 21092 20874 gene locus_tag LOCUS_68330 21092 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 22177 21104 gene locus_tag LOCUS_68340 22177 21104 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MB1 protein_id gnl|my_center|LOCUS_68340 23403 22177 gene locus_tag LOCUS_68350 gene nqrF 23403 22177 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_68350 24034 23417 gene locus_tag LOCUS_68360 gene nqrE 24034 23417 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6X2 protein_id gnl|my_center|LOCUS_68360 24664 24038 gene locus_tag LOCUS_68370 gene nqrD 24664 24038 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_68370 25452 24664 gene locus_tag LOCUS_68380 gene nqrC 25452 24664 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_68380 26686 25439 gene locus_tag LOCUS_68390 gene nqrB 26686 25439 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_68390 28059 26686 gene locus_tag LOCUS_68400 gene nqrA 28059 26686 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBZ0 protein_id gnl|my_center|LOCUS_68400 28503 29534 gene locus_tag LOCUS_68410 28503 29534 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228521.1 protein_id gnl|my_center|LOCUS_68410 29623 31389 gene locus_tag LOCUS_68420 29623 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 31417 31929 gene locus_tag LOCUS_68430 31417 31929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 31859 32068 gene locus_tag LOCUS_68440 31859 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 32099 32755 gene locus_tag LOCUS_68450 32099 32755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_68450 32752 34287 gene locus_tag LOCUS_68460 gene nnr 32752 34287 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_68460 34349 35200 gene locus_tag LOCUS_68470 gene fadB2 34349 35200 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402318.1 protein_id gnl|my_center|LOCUS_68470 35369 36622 gene locus_tag LOCUS_68480 35369 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 37035 38231 gene locus_tag LOCUS_68490 37035 38231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 38590 38676 gene locus_tag LOCUS_t00720 38590 38676 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41600 39357 gene locus_tag LOCUS_68500 41600 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 41733 44396 gene locus_tag LOCUS_68510 41733 44396 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_68510 44384 45532 gene locus_tag LOCUS_68520 44384 45532 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_68520 47168 45537 gene locus_tag LOCUS_68530 47168 45537 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_68530 47224 48123 gene locus_tag LOCUS_68540 47224 48123 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_68540 48159 49349 gene locus_tag LOCUS_68550 48159 49349 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_68550 50059 49346 gene locus_tag LOCUS_68560 50059 49346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 51356 50151 gene locus_tag LOCUS_68570 gene fabF 51356 50151 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_68570 51614 51363 gene locus_tag LOCUS_68580 51614 51363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 52176 51817 gene locus_tag LOCUS_68590 52176 51817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 52265 54040 gene locus_tag LOCUS_68600 52265 54040 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_68600 54093 56936 gene locus_tag LOCUS_68610 54093 56936 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_68610 56933 57574 gene locus_tag LOCUS_68620 56933 57574 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_68620 >Feature sequence50 2260 272 gene locus_tag LOCUS_68630 2260 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 3726 2272 gene locus_tag LOCUS_68640 3726 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 5779 3926 gene locus_tag LOCUS_68650 5779 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 6627 5794 gene locus_tag LOCUS_68660 6627 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 9071 6627 gene locus_tag LOCUS_68670 9071 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 11820 9415 gene locus_tag LOCUS_68680 11820 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 12398 11817 gene locus_tag LOCUS_68690 12398 11817 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_68690 12506 12682 gene locus_tag LOCUS_68700 12506 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 13551 13249 gene locus_tag LOCUS_68710 13551 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 14508 17771 gene locus_tag LOCUS_68720 14508 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_68720 17972 18955 gene locus_tag LOCUS_68730 17972 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 18958 20154 gene locus_tag LOCUS_68740 18958 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 21913 20171 gene locus_tag LOCUS_68750 21913 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 24784 22214 gene locus_tag LOCUS_68760 24784 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 24933 26066 gene locus_tag LOCUS_68770 24933 26066 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_68770 27574 26078 gene locus_tag LOCUS_68780 27574 26078 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_68780 27732 28121 gene locus_tag LOCUS_68790 27732 28121 CDS product beta-lactamase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_68790 28118 30034 gene locus_tag LOCUS_68800 28118 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 31643 30114 gene locus_tag LOCUS_68810 31643 30114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_68810 32404 31658 gene locus_tag LOCUS_68820 32404 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 32540 32412 gene locus_tag LOCUS_68830 32540 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 33964 32537 gene locus_tag LOCUS_68840 gene dur3 33964 32537 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_68840 34383 33961 gene locus_tag LOCUS_68850 34383 33961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 35948 34395 gene locus_tag LOCUS_68860 35948 34395 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_68860 36440 35982 gene locus_tag LOCUS_68870 36440 35982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 36617 37114 gene locus_tag LOCUS_68880 36617 37114 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_68880 37233 39962 gene locus_tag LOCUS_68890 37233 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 39982 40995 gene locus_tag LOCUS_68900 39982 40995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 41244 42011 gene locus_tag LOCUS_68910 41244 42011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 42029 43354 gene locus_tag LOCUS_68920 42029 43354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 44798 43401 gene locus_tag LOCUS_68930 44798 43401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 47504 45024 gene locus_tag LOCUS_68940 gene celD 47504 45024 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_68940 47736 49061 gene locus_tag LOCUS_68950 47736 49061 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_68950 49051 51240 gene locus_tag LOCUS_68960 gene plpD 49051 51240 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_68960 52549 51320 gene locus_tag LOCUS_68970 52549 51320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_68970 52596 54383 gene locus_tag LOCUS_68980 52596 54383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 54385 55473 gene locus_tag LOCUS_68990 54385 55473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 55478 56134 gene locus_tag LOCUS_69000 55478 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 >Feature sequence51 3644 2166 gene locus_tag LOCUS_69010 3644 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 4682 3708 gene locus_tag LOCUS_69020 4682 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 6283 4730 gene locus_tag LOCUS_69030 6283 4730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087024.1 protein_id gnl|my_center|LOCUS_69030 8009 6303 gene locus_tag LOCUS_69040 8009 6303 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 protein_id gnl|my_center|LOCUS_69040 9890 8103 gene locus_tag LOCUS_69050 gene aepA 9890 8103 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_69050 10562 9921 gene locus_tag LOCUS_69060 10562 9921 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087030.1 protein_id gnl|my_center|LOCUS_69060 14066 10815 gene locus_tag LOCUS_69070 14066 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 14483 17395 gene locus_tag LOCUS_69080 gene btuB 14483 17395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_69080 17454 18866 gene locus_tag LOCUS_69090 17454 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 19297 18863 gene locus_tag LOCUS_69100 19297 18863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 19770 19378 gene locus_tag LOCUS_69110 19770 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 20275 21537 gene locus_tag LOCUS_69120 20275 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 21622 22824 gene locus_tag LOCUS_69130 21622 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 23679 22855 gene locus_tag LOCUS_69140 23679 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937664.1 protein_id gnl|my_center|LOCUS_69140 25267 23693 gene locus_tag LOCUS_69150 25267 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 25472 26221 gene locus_tag LOCUS_69160 25472 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 28145 26631 gene locus_tag LOCUS_69170 28145 26631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 28312 31440 gene locus_tag LOCUS_69180 28312 31440 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_69180 33539 31437 gene locus_tag LOCUS_69190 gene sppA 33539 31437 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNJ6 protein_id gnl|my_center|LOCUS_69190 35074 33539 gene locus_tag LOCUS_69200 35074 33539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_69200 36003 35074 gene locus_tag LOCUS_69210 36003 35074 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_69210 37745 36000 gene locus_tag LOCUS_69220 37745 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 38830 37790 gene locus_tag LOCUS_69230 38830 37790 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_69230 40260 38827 gene locus_tag LOCUS_69240 40260 38827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 41371 40247 gene locus_tag LOCUS_69250 gene truD 41371 40247 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_69250 43822 41381 gene locus_tag LOCUS_69260 43822 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_69260 44176 45279 gene locus_tag LOCUS_69270 44176 45279 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_69270 45325 47301 gene locus_tag LOCUS_69280 45325 47301 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_69280 48826 47261 gene locus_tag LOCUS_69290 48826 47261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 48770 49057 gene locus_tag LOCUS_69300 48770 49057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 49291 49983 gene locus_tag LOCUS_69310 49291 49983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 49980 50642 gene locus_tag LOCUS_69320 49980 50642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 50844 51725 gene locus_tag LOCUS_69330 gene selD 50844 51725 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_69330 51963 52970 gene locus_tag LOCUS_69340 51963 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 52967 54025 gene locus_tag LOCUS_69350 52967 54025 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 protein_id gnl|my_center|LOCUS_69350 54667 54059 gene locus_tag LOCUS_69360 54667 54059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 >Feature sequence52 402 328 gene locus_tag LOCUS_t00730 402 328 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 606 532 gene locus_tag LOCUS_t00740 606 532 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 715 630 gene locus_tag LOCUS_t00750 715 630 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 824 749 gene locus_tag LOCUS_t00760 824 749 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1503 928 gene locus_tag LOCUS_69370 1503 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 1507 1695 gene locus_tag LOCUS_69380 1507 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 2303 1749 gene locus_tag LOCUS_69390 gene frr 2303 1749 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH63 protein_id gnl|my_center|LOCUS_69390 2980 2405 gene locus_tag LOCUS_69400 2980 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 3813 4016 gene locus_tag LOCUS_69410 3813 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 4093 5475 gene locus_tag LOCUS_69420 4093 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 6833 5472 gene locus_tag LOCUS_69430 6833 5472 CDS product capsular polysaccharide biosynthesis protein CapK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_69430 8269 9558 gene locus_tag LOCUS_69440 8269 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 9829 10413 gene locus_tag LOCUS_69450 9829 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 10671 11009 gene locus_tag LOCUS_69460 10671 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 11655 11065 gene locus_tag LOCUS_69470 11655 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 12669 11989 gene locus_tag LOCUS_69480 12669 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 14446 12674 gene locus_tag LOCUS_69490 14446 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69490 14952 15551 gene locus_tag LOCUS_69500 14952 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 15573 16154 gene locus_tag LOCUS_69510 15573 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 16955 17923 gene locus_tag LOCUS_69520 16955 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 18188 19414 gene locus_tag LOCUS_69530 18188 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 20812 19715 gene locus_tag LOCUS_69540 20812 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69540 22087 20837 gene locus_tag LOCUS_69550 22087 20837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_69550 24512 22134 gene locus_tag LOCUS_69560 24512 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 25161 24493 gene locus_tag LOCUS_69570 25161 24493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 25292 26179 gene locus_tag LOCUS_69580 25292 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 26324 28510 gene locus_tag LOCUS_69590 26324 28510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 28785 29075 gene locus_tag LOCUS_69600 28785 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 29085 31358 gene locus_tag LOCUS_69610 29085 31358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 33703 31367 gene locus_tag LOCUS_69620 33703 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 36377 33726 gene locus_tag LOCUS_69630 36377 33726 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5W6 protein_id gnl|my_center|LOCUS_69630 36435 37010 gene locus_tag LOCUS_69640 36435 37010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 37831 37031 gene locus_tag LOCUS_69650 gene parA 37831 37031 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_69650 39222 37855 gene locus_tag LOCUS_69660 gene sdaA 39222 37855 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_69660 39376 39978 gene locus_tag LOCUS_69670 39376 39978 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_69670 39975 40412 gene locus_tag LOCUS_69680 39975 40412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 40409 40732 gene locus_tag LOCUS_69690 40409 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_69690 >Feature sequence53 1217 2266 gene locus_tag LOCUS_69700 1217 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 2849 2277 gene locus_tag LOCUS_69710 2849 2277 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_69710 2948 4618 gene locus_tag LOCUS_69720 2948 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 7513 4649 gene locus_tag LOCUS_69730 7513 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 9499 7619 gene locus_tag LOCUS_69740 9499 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 10787 9561 gene locus_tag LOCUS_69750 10787 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 10960 11523 gene locus_tag LOCUS_69760 10960 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 13855 12035 gene locus_tag LOCUS_69770 13855 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 13966 15039 gene locus_tag LOCUS_69780 gene ansA 13966 15039 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_69780 16781 15057 gene locus_tag LOCUS_69790 16781 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 17138 16839 gene locus_tag LOCUS_69800 17138 16839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 17431 17150 gene locus_tag LOCUS_69810 17431 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 18286 17471 gene locus_tag LOCUS_69820 18286 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 18620 19810 gene locus_tag LOCUS_69830 18620 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 19807 20673 gene locus_tag LOCUS_69840 19807 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 20675 21016 gene locus_tag LOCUS_69850 20675 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 21083 22159 gene locus_tag LOCUS_69860 21083 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 22156 23031 gene locus_tag LOCUS_69870 22156 23031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 24239 22971 gene locus_tag LOCUS_69880 24239 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 25006 24239 gene locus_tag LOCUS_69890 25006 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 26079 25003 gene locus_tag LOCUS_69900 26079 25003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 26900 26076 gene locus_tag LOCUS_69910 26900 26076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 28339 26930 gene locus_tag LOCUS_69920 28339 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 29387 28323 gene locus_tag LOCUS_69930 29387 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 30466 29384 gene locus_tag LOCUS_69940 30466 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 32002 30530 gene locus_tag LOCUS_69950 32002 30530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69950 32332 32012 gene locus_tag LOCUS_69960 32332 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 34086 32431 gene locus_tag LOCUS_69970 34086 32431 CDS product kumamolisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230162.1 protein_id gnl|my_center|LOCUS_69970 34820 37921 gene locus_tag LOCUS_69980 34820 37921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 42006 37894 gene locus_tag LOCUS_69990 42006 37894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 >Feature sequence54 1841 189 gene locus_tag LOCUS_70000 1841 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 1907 3781 gene locus_tag LOCUS_70010 1907 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70010 3888 4346 gene locus_tag LOCUS_70020 3888 4346 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 protein_id gnl|my_center|LOCUS_70020 4383 5255 gene locus_tag LOCUS_70030 gene prmC 4383 5255 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727D9 protein_id gnl|my_center|LOCUS_70030 5322 5789 gene locus_tag LOCUS_70040 5322 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 6711 5797 gene locus_tag LOCUS_70050 6711 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 6753 7403 gene locus_tag LOCUS_70060 6753 7403 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_70060 8569 7400 gene locus_tag LOCUS_70070 8569 7400 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_70070 8978 8640 gene locus_tag LOCUS_70080 gene rsbV 8978 8640 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 protein_id gnl|my_center|LOCUS_70080 9478 9047 gene locus_tag LOCUS_70090 9478 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 9623 10864 gene locus_tag LOCUS_70100 9623 10864 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_70100 10864 11832 gene locus_tag LOCUS_70110 10864 11832 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_70110 12886 11957 gene locus_tag LOCUS_70120 12886 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 13848 12979 gene locus_tag LOCUS_70130 13848 12979 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_70130 16235 13845 gene locus_tag LOCUS_70140 16235 13845 CDS product dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_70140 16736 16254 gene locus_tag LOCUS_70150 16736 16254 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_70150 17095 17520 gene locus_tag LOCUS_70160 17095 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 23067 17524 gene locus_tag LOCUS_70170 23067 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 23266 23072 gene locus_tag LOCUS_70180 23266 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 24172 23402 gene locus_tag LOCUS_70190 24172 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 24877 24185 gene locus_tag LOCUS_70200 24877 24185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 25223 25375 gene locus_tag LOCUS_70210 25223 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_70210 25379 26197 gene locus_tag LOCUS_70220 25379 26197 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257811.1 protein_id gnl|my_center|LOCUS_70220 27809 26373 gene locus_tag LOCUS_70230 27809 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 30236 27906 gene locus_tag LOCUS_70240 30236 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 30623 30252 gene locus_tag LOCUS_70250 30623 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 33659 30756 gene locus_tag LOCUS_70260 33659 30756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 34198 33674 gene locus_tag LOCUS_70270 34198 33674 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_70270 34265 37465 gene locus_tag LOCUS_70280 34265 37465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 40147 37532 gene locus_tag LOCUS_70290 40147 37532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 >Feature sequence55 5147 270 gene locus_tag LOCUS_70300 5147 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 6548 5160 gene locus_tag LOCUS_70310 6548 5160 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089359.1 protein_id gnl|my_center|LOCUS_70310 6659 7285 gene locus_tag LOCUS_70320 gene sigW 6659 7285 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_70320 7269 8135 gene locus_tag LOCUS_70330 7269 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 8147 9622 gene locus_tag LOCUS_70340 8147 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 10465 9635 gene locus_tag LOCUS_70350 10465 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 10501 12012 gene locus_tag LOCUS_70360 10501 12012 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_70360 12037 12756 gene locus_tag LOCUS_70370 12037 12756 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970447.1 protein_id gnl|my_center|LOCUS_70370 16347 12799 gene locus_tag LOCUS_70380 16347 12799 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QR6 protein_id gnl|my_center|LOCUS_70380 16969 16340 gene locus_tag LOCUS_70390 16969 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 17874 16966 gene locus_tag LOCUS_70400 17874 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459825.1 protein_id gnl|my_center|LOCUS_70400 18825 18025 gene locus_tag LOCUS_70410 18825 18025 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_70410 21588 18931 gene locus_tag LOCUS_70420 21588 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 24413 21585 gene locus_tag LOCUS_70430 24413 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 24348 24614 gene locus_tag LOCUS_70440 24348 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 24601 25758 gene locus_tag LOCUS_70450 gene menC 24601 25758 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4D0 protein_id gnl|my_center|LOCUS_70450 25764 27353 gene locus_tag LOCUS_70460 25764 27353 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_70460 27350 27904 gene locus_tag LOCUS_70470 27350 27904 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268255.1 protein_id gnl|my_center|LOCUS_70470 27958 28965 gene locus_tag LOCUS_70480 27958 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 30330 29023 gene locus_tag LOCUS_70490 30330 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 >Feature sequence56 935 576 gene locus_tag LOCUS_70500 935 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 2322 964 gene locus_tag LOCUS_70510 2322 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 5075 2364 gene locus_tag LOCUS_70520 5075 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 6816 5167 gene locus_tag LOCUS_70530 6816 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 8473 6911 gene locus_tag LOCUS_70540 8473 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 10099 8489 gene locus_tag LOCUS_70550 10099 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 10275 11405 gene locus_tag LOCUS_70560 10275 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 13053 11422 gene locus_tag LOCUS_70570 13053 11422 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_70570 17494 13133 gene locus_tag LOCUS_70580 17494 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 17880 18497 gene locus_tag LOCUS_70590 17880 18497 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_70590 18490 21273 gene locus_tag LOCUS_70600 18490 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 24119 21270 gene locus_tag LOCUS_70610 24119 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 27915 24253 gene locus_tag LOCUS_70620 27915 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 28103 30529 gene locus_tag LOCUS_70630 28103 30529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_70630 >Feature sequence57 323 1105 gene locus_tag LOCUS_70640 gene nagB 323 1105 CDS product glucosamine-6-phosphate deaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35000 protein_id gnl|my_center|LOCUS_70640 2122 1139 gene locus_tag LOCUS_70650 gene etfA 2122 1139 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_70650 2916 2122 gene locus_tag LOCUS_70660 2916 2122 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_70660 3196 3927 gene locus_tag LOCUS_70670 3196 3927 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_70670 3937 4365 gene locus_tag LOCUS_70680 3937 4365 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_70680 4415 5158 gene locus_tag LOCUS_70690 4415 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 5192 6571 gene locus_tag LOCUS_70700 gene tolB 5192 6571 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_70700 6795 7367 gene locus_tag LOCUS_70710 6795 7367 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_70710 7430 8197 gene locus_tag LOCUS_70720 7430 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 8361 8600 gene locus_tag LOCUS_70730 gene rpsT 8361 8600 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21477 protein_id gnl|my_center|LOCUS_70730 9185 8652 gene locus_tag LOCUS_70740 9185 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 10273 9182 gene locus_tag LOCUS_70750 10273 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 10915 10367 gene locus_tag LOCUS_70760 gene nusB 10915 10367 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ2 protein_id gnl|my_center|LOCUS_70760 11402 10923 gene locus_tag LOCUS_70770 gene ribH 11402 10923 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_70770 11557 11481 gene locus_tag LOCUS_t00770 11557 11481 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12157 11600 gene locus_tag LOCUS_70780 12157 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 12485 12162 gene locus_tag LOCUS_70790 gene hup 12485 12162 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_70790 14049 12604 gene locus_tag LOCUS_70800 gene der 14049 12604 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIV4 protein_id gnl|my_center|LOCUS_70800 14615 14046 gene locus_tag LOCUS_70810 14615 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 14745 14831 gene locus_tag LOCUS_t00780 14745 14831 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14927 16303 gene locus_tag LOCUS_70820 14927 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 16415 16801 gene locus_tag LOCUS_70830 16415 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 17551 16943 gene locus_tag LOCUS_70840 17551 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 19555 17555 gene locus_tag LOCUS_70850 19555 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256846.1 protein_id gnl|my_center|LOCUS_70850 19691 20041 gene locus_tag LOCUS_70860 19691 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 20051 22114 gene locus_tag LOCUS_70870 20051 22114 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072247.1 protein_id gnl|my_center|LOCUS_70870 22173 22682 gene locus_tag LOCUS_70880 22173 22682 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0L2 protein_id gnl|my_center|LOCUS_70880 22734 23888 gene locus_tag LOCUS_70890 22734 23888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 23900 25600 gene locus_tag LOCUS_70900 23900 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70900 25696 26811 gene locus_tag LOCUS_70910 25696 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 26834 28039 gene locus_tag LOCUS_70920 26834 28039 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_70920 28051 29217 gene locus_tag LOCUS_70930 28051 29217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870170.1 protein_id gnl|my_center|LOCUS_70930 29214 31058 gene locus_tag LOCUS_70940 29214 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 >Feature sequence58 1383 919 gene locus_tag LOCUS_70950 1383 919 CDS product transcription activator effector-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931873.1 protein_id gnl|my_center|LOCUS_70950 1835 1398 gene locus_tag LOCUS_70960 1835 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049417.1 protein_id gnl|my_center|LOCUS_70960 2081 2899 gene locus_tag LOCUS_70970 2081 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 4395 2920 gene locus_tag LOCUS_70980 4395 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 4613 6454 gene locus_tag LOCUS_70990 4613 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 7621 6476 gene locus_tag LOCUS_71000 gene metB 7621 6476 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_71000 7974 7627 gene locus_tag LOCUS_71010 7974 7627 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 protein_id gnl|my_center|LOCUS_71010 11322 7987 gene locus_tag LOCUS_71020 11322 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71020 12833 11343 gene locus_tag LOCUS_71030 12833 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 14270 12900 gene locus_tag LOCUS_71040 14270 12900 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_71040 16037 14310 gene locus_tag LOCUS_71050 16037 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71050 17246 16041 gene locus_tag LOCUS_71060 17246 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71060 20800 17243 gene locus_tag LOCUS_71070 20800 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 21034 20813 gene locus_tag LOCUS_71080 21034 20813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 20969 24964 gene locus_tag LOCUS_71090 20969 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 25778 25158 gene locus_tag LOCUS_71100 25778 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71100 26744 25794 gene locus_tag LOCUS_71110 26744 25794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71110 26921 29497 gene locus_tag LOCUS_71120 gene hrpB 26921 29497 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035530.1 protein_id gnl|my_center|LOCUS_71120 >Feature sequence59 2290 215 gene locus_tag LOCUS_71130 gene fusA2 2290 215 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_71130 2866 2396 gene locus_tag LOCUS_71140 gene rpsG 2866 2396 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8C0 protein_id gnl|my_center|LOCUS_71140 3297 2923 gene locus_tag LOCUS_71150 gene rpsL 3297 2923 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_71150 5584 3755 gene locus_tag LOCUS_71160 5584 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 8245 5936 gene locus_tag LOCUS_71170 8245 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 8333 11932 gene locus_tag LOCUS_71180 8333 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 12511 13158 gene locus_tag LOCUS_71190 12511 13158 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY9 protein_id gnl|my_center|LOCUS_71190 13155 15455 gene locus_tag LOCUS_71200 13155 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 15546 15752 gene locus_tag LOCUS_71210 15546 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 15736 16233 gene locus_tag LOCUS_71220 15736 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 16272 16997 gene locus_tag LOCUS_71230 16272 16997 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_71230 17231 19165 gene locus_tag LOCUS_71240 17231 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71240 20463 19162 gene locus_tag LOCUS_71250 20463 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 22681 20489 gene locus_tag LOCUS_71260 22681 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 23735 22653 gene locus_tag LOCUS_71270 23735 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 <26762 23871 gene locus_tag LOCUS_71280 <26762 23871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918809.1:membrane protein >Feature sequence60 3159 730 gene locus_tag LOCUS_71290 3159 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_71290 5920 3212 gene locus_tag LOCUS_71300 5920 3212 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_71300 6176 8866 gene locus_tag LOCUS_71310 gene aceE 6176 8866 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_71310 8894 10216 gene locus_tag LOCUS_71320 8894 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71320 10224 12041 gene locus_tag LOCUS_71330 gene lpdA 10224 12041 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC3 protein_id gnl|my_center|LOCUS_71330 12038 12781 gene locus_tag LOCUS_71340 12038 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_71340 13810 12782 gene locus_tag LOCUS_71350 gene hemE 13810 12782 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1W0 protein_id gnl|my_center|LOCUS_71350 14179 14916 gene locus_tag LOCUS_71360 14179 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 15081 15935 gene locus_tag LOCUS_71370 15081 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71370 15994 16764 gene locus_tag LOCUS_71380 15994 16764 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_71380 16764 18008 gene locus_tag LOCUS_71390 16764 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 18093 18869 gene locus_tag LOCUS_71400 18093 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 18896 22084 gene locus_tag LOCUS_71410 18896 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 22627 23274 gene locus_tag LOCUS_71420 22627 23274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 >Feature sequence61 317 392 gene locus_tag LOCUS_t00790 317 392 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 409 636 gene locus_tag LOCUS_71430 409 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 636 1169 gene locus_tag LOCUS_71440 gene nusG 636 1169 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_71440 1229 1654 gene locus_tag LOCUS_71450 gene rplK 1229 1654 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EG5 protein_id gnl|my_center|LOCUS_71450 1759 2463 gene locus_tag LOCUS_71460 gene rplA 1759 2463 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_71460 2475 3002 gene locus_tag LOCUS_71470 gene rplJ 2475 3002 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CG41 protein_id gnl|my_center|LOCUS_71470 3072 3452 gene locus_tag LOCUS_71480 gene rplL 3072 3452 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_71480 3903 8150 gene locus_tag LOCUS_71490 gene rpoB 3903 8150 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QH7 protein_id gnl|my_center|LOCUS_71490 8188 12363 gene locus_tag LOCUS_71500 gene rpoC 8188 12363 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_71500 19493 12615 gene locus_tag LOCUS_71510 19493 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 19960 21762 gene locus_tag LOCUS_71520 19960 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 21766 22455 gene locus_tag LOCUS_71530 21766 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 >Feature sequence62 3817 785 gene locus_tag LOCUS_71540 3817 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 5699 3822 gene locus_tag LOCUS_71550 5699 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 7288 5696 gene locus_tag LOCUS_71560 7288 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 8380 7376 gene locus_tag LOCUS_71570 8380 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71570 10203 8404 gene locus_tag LOCUS_71580 10203 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 12707 10284 gene locus_tag LOCUS_71590 12707 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_71590 14493 12736 gene locus_tag LOCUS_71600 14493 12736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_71600 17292 14542 gene locus_tag LOCUS_71610 17292 14542 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031100.1 protein_id gnl|my_center|LOCUS_71610 17549 17406 gene locus_tag LOCUS_71620 17549 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 17820 17677 gene locus_tag LOCUS_71630 17820 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 18064 17921 gene locus_tag LOCUS_71640 18064 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 21560 19077 gene locus_tag LOCUS_71650 21560 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 >Feature sequence63 1085 225 gene locus_tag LOCUS_71660 1085 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 1867 1082 gene locus_tag LOCUS_71670 1867 1082 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256334.1 protein_id gnl|my_center|LOCUS_71670 5784 1864 gene locus_tag LOCUS_71680 5784 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 5919 6728 gene locus_tag LOCUS_71690 5919 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 7951 6695 gene locus_tag LOCUS_71700 7951 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_71700 8011 8631 gene locus_tag LOCUS_71710 8011 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 10630 8711 gene locus_tag LOCUS_71720 10630 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 11716 10796 gene locus_tag LOCUS_71730 11716 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 14240 11784 gene locus_tag LOCUS_71740 14240 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_71740 14371 15747 gene locus_tag LOCUS_71750 14371 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_71750 15737 17128 gene locus_tag LOCUS_71760 gene murD 15737 17128 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P775 protein_id gnl|my_center|LOCUS_71760 17152 17958 gene locus_tag LOCUS_71770 17152 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71770 17973 20174 gene locus_tag LOCUS_71780 17973 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 >Feature sequence64 311 1441 gene locus_tag LOCUS_71790 311 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 1438 4536 gene locus_tag LOCUS_71800 gene czcA 1438 4536 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_71800 4592 6370 gene locus_tag LOCUS_71810 4592 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 6367 7371 gene locus_tag LOCUS_71820 6367 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 7545 8981 gene locus_tag LOCUS_71830 7545 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 10658 9048 gene locus_tag LOCUS_71840 10658 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 10840 14256 gene locus_tag LOCUS_71850 10840 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_71850 15924 14389 gene locus_tag LOCUS_71860 gene comM 15924 14389 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_71860 16802 16581 gene locus_tag LOCUS_71870 16802 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 16704 17246 gene locus_tag LOCUS_71880 16704 17246 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120523.1 protein_id gnl|my_center|LOCUS_71880 17378 17992 gene locus_tag LOCUS_71890 17378 17992 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120523.1 protein_id gnl|my_center|LOCUS_71890 18109 19470 gene locus_tag LOCUS_71900 18109 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 >Feature sequence65 2058 253 gene locus_tag LOCUS_71910 2058 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 5603 2193 gene locus_tag LOCUS_71920 5603 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 6397 5747 gene locus_tag LOCUS_71930 6397 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71930 6520 7620 gene locus_tag LOCUS_71940 6520 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 13235 7644 gene locus_tag LOCUS_71950 13235 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 15817 13232 gene locus_tag LOCUS_71960 15817 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 17242 15830 gene locus_tag LOCUS_71970 17242 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 18657 17383 gene locus_tag LOCUS_71980 18657 17383 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_71980 >Feature sequence66 643 2316 gene locus_tag LOCUS_71990 643 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 2646 2338 gene locus_tag LOCUS_72000 2646 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 2916 5624 gene locus_tag LOCUS_72010 2916 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 6469 5747 gene locus_tag LOCUS_72020 6469 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 6902 6657 gene locus_tag LOCUS_72030 6902 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 7036 7767 gene locus_tag LOCUS_72040 7036 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040