>Feature sequence01 1261 269 gene locus_tag LOCUS_00010 gene obg 1261 269 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_00010 1939 1361 gene locus_tag LOCUS_00020 gene adk 1939 1361 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_00020 2624 2097 gene locus_tag LOCUS_00030 gene hpt 2624 2097 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_00030 3546 2626 gene locus_tag LOCUS_00040 3546 2626 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583050.1 protein_id gnl|my_center|LOCUS_00040 3680 4330 gene locus_tag LOCUS_00050 gene upp 3680 4330 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_00050 4334 5290 gene locus_tag LOCUS_00060 gene yrbG 4334 5290 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_00060 6226 5318 gene locus_tag LOCUS_00070 6226 5318 CDS product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_00070 6482 7513 gene locus_tag LOCUS_00080 gene hemE 6482 7513 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1W0 protein_id gnl|my_center|LOCUS_00080 8282 7548 gene locus_tag LOCUS_00090 8282 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8745 8251 gene locus_tag LOCUS_00100 8745 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8879 10189 gene locus_tag LOCUS_00110 gene rimO 8879 10189 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_00110 10199 11764 gene locus_tag LOCUS_00120 gene bshC 10199 11764 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_00120 11757 12332 gene locus_tag LOCUS_00130 gene ygfA 11757 12332 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_00130 12445 12726 gene locus_tag LOCUS_00140 12445 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13778 12723 gene locus_tag LOCUS_00150 13778 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16006 13778 gene locus_tag LOCUS_00160 16006 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18037 16142 gene locus_tag LOCUS_00170 gene acsA 18037 16142 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_00170 18304 18573 gene locus_tag LOCUS_00180 18304 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18802 19026 gene locus_tag LOCUS_00190 18802 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20001 19414 gene locus_tag LOCUS_00200 gene coaE 20001 19414 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_00200 20975 19998 gene locus_tag LOCUS_00210 20975 19998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21297 20980 gene locus_tag LOCUS_00220 21297 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21858 21304 gene locus_tag LOCUS_00230 21858 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_00230 22194 21895 gene locus_tag LOCUS_00240 22194 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23470 22289 gene locus_tag LOCUS_00250 gene nusB 23470 22289 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_00250 24656 23553 gene locus_tag LOCUS_00260 gene vdh 24656 23553 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_00260 25107 26819 gene locus_tag LOCUS_00270 25107 26819 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_00270 26905 27333 gene locus_tag LOCUS_00280 26905 27333 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 protein_id gnl|my_center|LOCUS_00280 27719 27330 gene locus_tag LOCUS_00290 27719 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28661 27900 gene locus_tag LOCUS_00300 28661 27900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_00300 29613 28654 gene locus_tag LOCUS_00310 29613 28654 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_00310 30794 29673 gene locus_tag LOCUS_00320 30794 29673 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_00320 31395 32003 gene locus_tag LOCUS_00330 gene comB 31395 32003 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_00330 32078 34153 gene locus_tag LOCUS_00340 32078 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_00340 34583 35884 gene locus_tag LOCUS_00350 34583 35884 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_00350 36026 38233 gene locus_tag LOCUS_00360 36026 38233 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107511.1 protein_id gnl|my_center|LOCUS_00360 38329 39015 gene locus_tag LOCUS_00370 38329 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39024 41039 gene locus_tag LOCUS_00380 39024 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42873 41560 gene locus_tag LOCUS_00390 42873 41560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_00390 45939 42880 gene locus_tag LOCUS_00400 45939 42880 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_00400 47017 45944 gene locus_tag LOCUS_00410 47017 45944 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_00410 49164 47197 gene locus_tag LOCUS_00420 49164 47197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50638 49520 gene locus_tag LOCUS_00430 50638 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 53994 50671 gene locus_tag LOCUS_00440 53994 50671 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_00440 54334 56880 gene locus_tag LOCUS_00450 54334 56880 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_00450 57670 56957 gene locus_tag LOCUS_00460 57670 56957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_00460 59151 57673 gene locus_tag LOCUS_00470 59151 57673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_00470 59662 59204 gene locus_tag LOCUS_00480 59662 59204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_00480 61038 59680 gene locus_tag LOCUS_00490 gene gdhA 61038 59680 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_00490 61144 61521 gene locus_tag LOCUS_00500 61144 61521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61614 62462 gene locus_tag LOCUS_00510 61614 62462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62562 63062 gene locus_tag LOCUS_00520 62562 63062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63417 63611 gene locus_tag LOCUS_00530 63417 63611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63665 64852 gene locus_tag LOCUS_00540 63665 64852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64821 65792 gene locus_tag LOCUS_00550 64821 65792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 65789 66229 gene locus_tag LOCUS_00560 65789 66229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69136 66311 gene locus_tag LOCUS_00570 gene uvrA1 69136 66311 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_00570 69282 71609 gene locus_tag LOCUS_00580 69282 71609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 71776 72225 gene locus_tag LOCUS_00590 71776 72225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72546 74888 gene locus_tag LOCUS_00600 72546 74888 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_00600 76333 75014 gene locus_tag LOCUS_00610 gene rhlE 76333 75014 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_00610 76368 77705 gene locus_tag LOCUS_00620 gene pyrC1 76368 77705 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_00620 77760 78341 gene locus_tag LOCUS_00630 77760 78341 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_00630 78466 83925 gene locus_tag LOCUS_00640 78466 83925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_00640 83906 86233 gene locus_tag LOCUS_00650 gene pbpC 83906 86233 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_00650 86428 86874 gene locus_tag LOCUS_00660 86428 86874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 87458 86955 gene locus_tag LOCUS_00670 87458 86955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 87648 89585 gene locus_tag LOCUS_00680 gene dnaK 87648 89585 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_00680 89796 90668 gene locus_tag LOCUS_00690 89796 90668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 91212 91015 gene locus_tag LOCUS_00700 91212 91015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 92312 91329 gene locus_tag LOCUS_00710 92312 91329 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_00710 93667 92318 gene locus_tag LOCUS_00720 93667 92318 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_00720 94541 93648 gene locus_tag LOCUS_00730 94541 93648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 96534 94531 gene locus_tag LOCUS_00740 96534 94531 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_00740 97183 96758 gene locus_tag LOCUS_00750 97183 96758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 97520 97167 gene locus_tag LOCUS_00760 gene rsbV_2 97520 97167 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6Z7 protein_id gnl|my_center|LOCUS_00760 98920 97565 gene locus_tag LOCUS_00770 98920 97565 CDS product sigma factor sigB regulation protein rsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016890.1 protein_id gnl|my_center|LOCUS_00770 99728 100408 gene locus_tag LOCUS_00780 99728 100408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 100573 100875 gene locus_tag LOCUS_00790 100573 100875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 100879 101121 gene locus_tag LOCUS_00800 100879 101121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 102136 101126 gene locus_tag LOCUS_00810 102136 101126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 102401 103195 gene locus_tag LOCUS_00820 102401 103195 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_00820 103689 103261 gene locus_tag LOCUS_00830 103689 103261 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_00830 103911 105302 gene locus_tag LOCUS_00840 103911 105302 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_00840 105289 106638 gene locus_tag LOCUS_00850 105289 106638 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_00850 106665 106934 gene locus_tag LOCUS_00860 gene acpP 106665 106934 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYY5 protein_id gnl|my_center|LOCUS_00860 107116 109491 gene locus_tag LOCUS_00870 107116 109491 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_00870 109491 110354 gene locus_tag LOCUS_00880 109491 110354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 110486 111322 gene locus_tag LOCUS_00890 110486 111322 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_00890 111356 112381 gene locus_tag LOCUS_00900 111356 112381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 114279 112378 gene locus_tag LOCUS_00910 114279 112378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 115110 114406 gene locus_tag LOCUS_00920 115110 114406 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_00920 115481 115098 gene locus_tag LOCUS_00930 115481 115098 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936745.1 protein_id gnl|my_center|LOCUS_00930 115772 116377 gene locus_tag LOCUS_00940 115772 116377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 116804 118588 gene locus_tag LOCUS_00950 116804 118588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 118607 119110 gene locus_tag LOCUS_00960 118607 119110 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_00960 119146 119595 gene locus_tag LOCUS_00970 119146 119595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 119669 120967 gene locus_tag LOCUS_00980 119669 120967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 123120 121024 gene locus_tag LOCUS_00990 gene ftsH 123120 121024 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_00990 123541 123188 gene locus_tag LOCUS_01000 gene rsfS 123541 123188 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_01000 123682 124365 gene locus_tag LOCUS_01010 123682 124365 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_01010 124469 125770 gene locus_tag LOCUS_01020 gene ahcY 124469 125770 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_01020 125864 126997 gene locus_tag LOCUS_01030 125864 126997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 127006 127704 gene locus_tag LOCUS_01040 127006 127704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 128809 127712 gene locus_tag LOCUS_01050 128809 127712 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_01050 129570 128806 gene locus_tag LOCUS_01060 129570 128806 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_01060 130382 129567 gene locus_tag LOCUS_01070 130382 129567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 130514 131455 gene locus_tag LOCUS_01080 130514 131455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 131526 132110 gene locus_tag LOCUS_01090 131526 132110 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_01090 132185 132445 gene locus_tag LOCUS_01100 132185 132445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 132442 133020 gene locus_tag LOCUS_01110 gene gmk 132442 133020 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_01110 133319 133897 gene locus_tag LOCUS_01120 gene nadD 133319 133897 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_01120 133963 136635 gene locus_tag LOCUS_01130 133963 136635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 138753 136636 gene locus_tag LOCUS_01140 138753 136636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 139333 139076 gene locus_tag LOCUS_01150 gene rpmA 139333 139076 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_01150 139653 139342 gene locus_tag LOCUS_01160 139653 139342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 139943 140449 gene locus_tag LOCUS_01170 139943 140449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 140820 141815 gene locus_tag LOCUS_01180 gene nrdB 140820 141815 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_01180 141951 144431 gene locus_tag LOCUS_01190 gene nrdA 141951 144431 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_01190 145318 144533 gene locus_tag LOCUS_01200 145318 144533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 146499 145363 gene locus_tag LOCUS_01210 146499 145363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 146668 147363 gene locus_tag LOCUS_01220 146668 147363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 147662 148276 gene locus_tag LOCUS_01230 147662 148276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 148281 148769 gene locus_tag LOCUS_01240 148281 148769 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_01240 148857 150695 gene locus_tag LOCUS_01250 148857 150695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 150958 153924 gene locus_tag LOCUS_01260 150958 153924 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_01260 153937 155436 gene locus_tag LOCUS_01270 153937 155436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_01270 155506 156777 gene locus_tag LOCUS_01280 155506 156777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 156849 158837 gene locus_tag LOCUS_01290 156849 158837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 158850 160196 gene locus_tag LOCUS_01300 158850 160196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_01300 160228 160983 gene locus_tag LOCUS_01310 160228 160983 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_01310 160980 163286 gene locus_tag LOCUS_01320 160980 163286 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01320 163896 164666 gene locus_tag LOCUS_01330 163896 164666 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_01330 164737 165930 gene locus_tag LOCUS_01340 164737 165930 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_01340 166621 166061 gene locus_tag LOCUS_01350 166621 166061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_01350 166914 167609 gene locus_tag LOCUS_01360 166914 167609 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_01360 167695 168159 gene locus_tag LOCUS_01370 167695 168159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_01370 168189 168731 gene locus_tag LOCUS_01380 168189 168731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 168946 170433 gene locus_tag LOCUS_01390 168946 170433 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_01390 170460 170915 gene locus_tag LOCUS_01400 170460 170915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 171517 170918 gene locus_tag LOCUS_01410 171517 170918 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_01410 171988 171536 gene locus_tag LOCUS_01420 171988 171536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 172776 172012 gene locus_tag LOCUS_01430 172776 172012 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_01430 173695 172976 gene locus_tag LOCUS_01440 gene pdxJ 173695 172976 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_01440 173752 174204 gene locus_tag LOCUS_01450 173752 174204 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_01450 174201 174734 gene locus_tag LOCUS_01460 174201 174734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 174731 175327 gene locus_tag LOCUS_01470 gene pabA 174731 175327 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070943.1 protein_id gnl|my_center|LOCUS_01470 175458 176225 gene locus_tag LOCUS_01480 gene pcbD 175458 176225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_01480 176222 176884 gene locus_tag LOCUS_01490 176222 176884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 176877 177764 gene locus_tag LOCUS_01500 gene nadK 176877 177764 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_01500 177859 179040 gene locus_tag LOCUS_01510 177859 179040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 179101 179760 gene locus_tag LOCUS_01520 179101 179760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 179839 180567 gene locus_tag LOCUS_01530 gene uppS 179839 180567 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_01530 180615 183230 gene locus_tag LOCUS_01540 gene bamA 180615 183230 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_01540 183236 183778 gene locus_tag LOCUS_01550 183236 183778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 183797 184327 gene locus_tag LOCUS_01560 183797 184327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_01560 184463 185383 gene locus_tag LOCUS_01570 184463 185383 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_01570 186538 185360 gene locus_tag LOCUS_01580 186538 185360 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_01580 187513 186542 gene locus_tag LOCUS_01590 187513 186542 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_01590 187608 188438 gene locus_tag LOCUS_01600 187608 188438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 protein_id gnl|my_center|LOCUS_01600 189173 190342 gene locus_tag LOCUS_01610 189173 190342 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_01610 190500 191495 gene locus_tag LOCUS_01620 190500 191495 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_01620 191536 193359 gene locus_tag LOCUS_01630 gene trkG 191536 193359 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_01630 193395 194159 gene locus_tag LOCUS_01640 gene sau96I-like 193395 194159 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_01640 195400 194135 gene locus_tag LOCUS_01650 195400 194135 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_01650 195546 196334 gene locus_tag LOCUS_01660 gene dapF 195546 196334 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_01660 196402 199755 gene locus_tag LOCUS_01670 gene secA 196402 199755 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_01670 199748 200257 gene locus_tag LOCUS_01680 199748 200257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 200462 201709 gene locus_tag LOCUS_01690 200462 201709 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_01690 202203 201811 gene locus_tag LOCUS_01700 202203 201811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_01700 202518 202216 gene locus_tag LOCUS_01710 202518 202216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968800.1 protein_id gnl|my_center|LOCUS_01710 204039 202900 gene locus_tag LOCUS_01720 204039 202900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_01720 204681 204433 gene locus_tag LOCUS_01730 204681 204433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 204563 205519 gene locus_tag LOCUS_01740 204563 205519 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_01740 205738 205508 gene locus_tag LOCUS_01750 205738 205508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 206015 206404 gene locus_tag LOCUS_01760 206015 206404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 208780 206495 gene locus_tag LOCUS_01770 gene pepN 208780 206495 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_01770 209416 208829 gene locus_tag LOCUS_01780 209416 208829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_01780 209599 210099 gene locus_tag LOCUS_01790 209599 210099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 211017 210139 gene locus_tag LOCUS_01800 211017 210139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_01800 214296 211111 gene locus_tag LOCUS_01810 214296 211111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 215413 214355 gene locus_tag LOCUS_01820 gene fjo30 215413 214355 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_01820 215572 216180 gene locus_tag LOCUS_01830 215572 216180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57544 protein_id gnl|my_center|LOCUS_01830 216187 216870 gene locus_tag LOCUS_01840 216187 216870 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_01840 217005 220358 gene locus_tag LOCUS_01850 gene porU 217005 220358 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_01850 220385 221554 gene locus_tag LOCUS_01860 gene porV 220385 221554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_01860 221595 222854 gene locus_tag LOCUS_01870 221595 222854 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_01870 222935 223540 gene locus_tag LOCUS_01880 222935 223540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 225040 223637 gene locus_tag LOCUS_01890 gene lpdA1 225040 223637 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_01890 226693 225104 gene locus_tag LOCUS_01900 gene sucB 226693 225104 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_01900 229454 226722 gene locus_tag LOCUS_01910 gene sucA 229454 226722 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01910 229801 232833 gene locus_tag LOCUS_01920 229801 232833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 232985 233593 gene locus_tag LOCUS_01930 gene rpsP 232985 233593 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SR3 protein_id gnl|my_center|LOCUS_01930 233606 234154 gene locus_tag LOCUS_01940 gene rimM 233606 234154 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_01940 234144 234824 gene locus_tag LOCUS_01950 gene trmD 234144 234824 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_01950 234925 235275 gene locus_tag LOCUS_01960 gene rplS 234925 235275 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_01960 235400 236239 gene locus_tag LOCUS_01970 235400 236239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499927.1 protein_id gnl|my_center|LOCUS_01970 236232 236834 gene locus_tag LOCUS_01980 gene ubiE 236232 236834 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_01980 236909 239722 gene locus_tag LOCUS_01990 gene carB 236909 239722 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_01990 239835 240077 gene locus_tag LOCUS_02000 239835 240077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 240980 240081 gene locus_tag LOCUS_02010 240980 240081 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_02010 244106 241242 gene locus_tag LOCUS_02020 244106 241242 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T17 protein_id gnl|my_center|LOCUS_02020 244345 244785 gene locus_tag LOCUS_02030 244345 244785 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_02030 245880 245068 gene locus_tag LOCUS_02040 gene lgt 245880 245068 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A337 protein_id gnl|my_center|LOCUS_02040 247343 245907 gene locus_tag LOCUS_02050 247343 245907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 247827 247357 gene locus_tag LOCUS_02060 247827 247357 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_02060 249042 248779 gene locus_tag LOCUS_02070 249042 248779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 251913 249319 gene locus_tag LOCUS_02080 gene clpC 251913 249319 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404069.1 protein_id gnl|my_center|LOCUS_02080 252633 252004 gene locus_tag LOCUS_02090 252633 252004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_02090 253279 252656 gene locus_tag LOCUS_02100 253279 252656 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_02100 253475 254407 gene locus_tag LOCUS_02110 253475 254407 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_02110 254411 254815 gene locus_tag LOCUS_02120 254411 254815 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_02120 254812 255747 gene locus_tag LOCUS_02130 254812 255747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_02130 255965 256210 gene locus_tag LOCUS_02140 255965 256210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 256209 256294 gene locus_tag LOCUS_t00010 256209 256294 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 256647 257618 gene locus_tag LOCUS_02150 256647 257618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 257593 258444 gene locus_tag LOCUS_02160 257593 258444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204740.1 protein_id gnl|my_center|LOCUS_02160 259575 258874 gene locus_tag LOCUS_02170 259575 258874 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_02170 260015 259942 gene locus_tag LOCUS_t00020 260015 259942 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 260126 261010 gene locus_tag LOCUS_02180 gene era 260126 261010 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_02180 261122 261478 gene locus_tag LOCUS_02190 261122 261478 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_02190 261541 262848 gene locus_tag LOCUS_02200 gene der 261541 262848 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_02200 262915 263208 gene locus_tag LOCUS_02210 262915 263208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 264377 263301 gene locus_tag LOCUS_02220 gene fabH1 264377 263301 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_02220 264996 264406 gene locus_tag LOCUS_02230 264996 264406 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_02230 265287 266126 gene locus_tag LOCUS_02240 gene accD 265287 266126 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_02240 266732 266208 gene locus_tag LOCUS_02250 266732 266208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 266990 267859 gene locus_tag LOCUS_02260 266990 267859 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_02260 268084 269319 gene locus_tag LOCUS_02270 gene nqrF 268084 269319 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_02270 269591 269367 gene locus_tag LOCUS_02280 269591 269367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 269694 270062 gene locus_tag LOCUS_02290 gene groES-2 269694 270062 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02290 270436 270188 gene locus_tag LOCUS_02300 270436 270188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 271211 271702 gene locus_tag LOCUS_02310 271211 271702 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_02310 271731 274133 gene locus_tag LOCUS_02320 271731 274133 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_02320 274163 274384 gene locus_tag LOCUS_02330 274163 274384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 274658 275827 gene locus_tag LOCUS_02340 274658 275827 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_02340 275924 276286 gene locus_tag LOCUS_02350 275924 276286 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_02350 276369 278171 gene locus_tag LOCUS_02360 276369 278171 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_02360 278342 278932 gene locus_tag LOCUS_02370 278342 278932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_02370 278935 279426 gene locus_tag LOCUS_02380 278935 279426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 279429 280220 gene locus_tag LOCUS_02390 279429 280220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 282132 280435 gene locus_tag LOCUS_02400 282132 280435 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_02400 282309 282470 gene locus_tag LOCUS_02410 gene rpmH 282309 282470 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F6 protein_id gnl|my_center|LOCUS_02410 282492 282893 gene locus_tag LOCUS_02420 282492 282893 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S8 protein_id gnl|my_center|LOCUS_02420 283169 284830 gene locus_tag LOCUS_02430 283169 284830 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_02430 284830 285642 gene locus_tag LOCUS_02440 284830 285642 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869940.1 protein_id gnl|my_center|LOCUS_02440 285639 286352 gene locus_tag LOCUS_02450 285639 286352 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_02450 286382 286897 gene locus_tag LOCUS_02460 286382 286897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence02 1436 3109 gene locus_tag LOCUS_02470 gene hutU 1436 3109 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 protein_id gnl|my_center|LOCUS_02470 3560 3162 gene locus_tag LOCUS_02480 3560 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4503 4024 gene locus_tag LOCUS_02490 4503 4024 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_02490 4664 5881 gene locus_tag LOCUS_02500 4664 5881 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_02500 6143 7732 gene locus_tag LOCUS_02510 6143 7732 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_02510 8623 7820 gene locus_tag LOCUS_02520 8623 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 9644 8730 gene locus_tag LOCUS_02530 9644 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 11271 9901 gene locus_tag LOCUS_02540 11271 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 12613 11615 gene locus_tag LOCUS_02550 12613 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 13397 12753 gene locus_tag LOCUS_02560 13397 12753 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_02560 15463 13445 gene locus_tag LOCUS_02570 15463 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 16560 15568 gene locus_tag LOCUS_02580 16560 15568 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_02580 19293 16705 gene locus_tag LOCUS_02590 19293 16705 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6J9 protein_id gnl|my_center|LOCUS_02590 19479 20852 gene locus_tag LOCUS_02600 19479 20852 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_02600 20856 21659 gene locus_tag LOCUS_02610 20856 21659 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_02610 21920 24163 gene locus_tag LOCUS_02620 21920 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 24735 24160 gene locus_tag LOCUS_02630 24735 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_02630 25732 24827 gene locus_tag LOCUS_02640 25732 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25860 26195 gene locus_tag LOCUS_02650 25860 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 26336 28141 gene locus_tag LOCUS_02660 26336 28141 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_02660 28455 28138 gene locus_tag LOCUS_02670 28455 28138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 30323 28455 gene locus_tag LOCUS_02680 30323 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 32348 30381 gene locus_tag LOCUS_02690 32348 30381 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865024.1 protein_id gnl|my_center|LOCUS_02690 33061 34065 gene locus_tag LOCUS_02700 33061 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 34301 34849 gene locus_tag LOCUS_02710 34301 34849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 34969 35430 gene locus_tag LOCUS_02720 34969 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 36475 35441 gene locus_tag LOCUS_02730 36475 35441 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_02730 36829 39831 gene locus_tag LOCUS_02740 36829 39831 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_02740 39843 41372 gene locus_tag LOCUS_02750 39843 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_02750 41523 44795 gene locus_tag LOCUS_02760 41523 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 44797 48153 gene locus_tag LOCUS_02770 44797 48153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 48157 49494 gene locus_tag LOCUS_02780 48157 49494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 49496 51124 gene locus_tag LOCUS_02790 gene treF 49496 51124 CDS product cytoplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS37 protein_id gnl|my_center|LOCUS_02790 51207 52889 gene locus_tag LOCUS_02800 51207 52889 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_02800 52931 54577 gene locus_tag LOCUS_02810 gene malL 52931 54577 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_02810 54804 56480 gene locus_tag LOCUS_02820 54804 56480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 56750 58459 gene locus_tag LOCUS_02830 56750 58459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 59372 58503 gene locus_tag LOCUS_02840 59372 58503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_02840 59433 60044 gene locus_tag LOCUS_02850 59433 60044 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272903.1 protein_id gnl|my_center|LOCUS_02850 60085 60912 gene locus_tag LOCUS_02860 60085 60912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 61275 62855 gene locus_tag LOCUS_02870 61275 62855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_02870 62865 63503 gene locus_tag LOCUS_02880 62865 63503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 63567 64532 gene locus_tag LOCUS_02890 63567 64532 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_02890 67643 64743 gene locus_tag LOCUS_02900 67643 64743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_02900 67931 71008 gene locus_tag LOCUS_02910 67931 71008 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_02910 71013 72605 gene locus_tag LOCUS_02920 71013 72605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_02920 72635 74239 gene locus_tag LOCUS_02930 72635 74239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 74421 75605 gene locus_tag LOCUS_02940 74421 75605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 75645 77933 gene locus_tag LOCUS_02950 75645 77933 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_02950 77930 78730 gene locus_tag LOCUS_02960 77930 78730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 78844 80256 gene locus_tag LOCUS_02970 gene xylE 78844 80256 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_02970 80531 80731 gene locus_tag LOCUS_02980 80531 80731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 80786 81352 gene locus_tag LOCUS_02990 80786 81352 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_02990 81867 81349 gene locus_tag LOCUS_03000 81867 81349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 82548 81937 gene locus_tag LOCUS_03010 82548 81937 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_03010 82660 83556 gene locus_tag LOCUS_03020 82660 83556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 83556 85142 gene locus_tag LOCUS_03030 83556 85142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 85693 85217 gene locus_tag LOCUS_03040 85693 85217 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_03040 86635 85823 gene locus_tag LOCUS_03050 86635 85823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 87376 86855 gene locus_tag LOCUS_03060 87376 86855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 87692 87342 gene locus_tag LOCUS_03070 87692 87342 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_03070 88461 87697 gene locus_tag LOCUS_03080 gene truC 88461 87697 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD4 protein_id gnl|my_center|LOCUS_03080 89566 88454 gene locus_tag LOCUS_03090 89566 88454 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_03090 91327 89702 gene locus_tag LOCUS_03100 91327 89702 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_03100 92836 91526 gene locus_tag LOCUS_03110 gene murA 92836 91526 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_03110 93481 92840 gene locus_tag LOCUS_03120 93481 92840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_03120 93691 95553 gene locus_tag LOCUS_03130 93691 95553 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_03130 96129 95800 gene locus_tag LOCUS_03140 96129 95800 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 protein_id gnl|my_center|LOCUS_03140 96571 97173 gene locus_tag LOCUS_03150 96571 97173 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_03150 97174 97803 gene locus_tag LOCUS_03160 97174 97803 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_03160 97800 98324 gene locus_tag LOCUS_03170 97800 98324 CDS product exosortase/archaeosortase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403397.1 protein_id gnl|my_center|LOCUS_03170 98314 98730 gene locus_tag LOCUS_03180 98314 98730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 98808 99830 gene locus_tag LOCUS_03190 98808 99830 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524633.1 protein_id gnl|my_center|LOCUS_03190 100248 100030 gene locus_tag LOCUS_03200 gene ypeB 100248 100030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422484.1 protein_id gnl|my_center|LOCUS_03200 101138 100248 gene locus_tag LOCUS_03210 101138 100248 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_03210 101404 103359 gene locus_tag LOCUS_03220 101404 103359 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_03220 103963 103397 gene locus_tag LOCUS_03230 103963 103397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 104123 106207 gene locus_tag LOCUS_03240 104123 106207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 107002 106316 gene locus_tag LOCUS_03250 107002 106316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 107193 108074 gene locus_tag LOCUS_03260 107193 108074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 108317 108787 gene locus_tag LOCUS_03270 108317 108787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 109450 109523 gene locus_tag LOCUS_t00030 109450 109523 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 109553 109627 gene locus_tag LOCUS_t00040 109553 109627 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 109795 110739 gene locus_tag LOCUS_03280 gene accA 109795 110739 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_03280 110842 111690 gene locus_tag LOCUS_03290 110842 111690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_03290 111733 112515 gene locus_tag LOCUS_03300 111733 112515 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_03300 112763 115618 gene locus_tag LOCUS_03310 112763 115618 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_03310 116525 115797 gene locus_tag LOCUS_03320 116525 115797 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 protein_id gnl|my_center|LOCUS_03320 116713 117381 gene locus_tag LOCUS_03330 116713 117381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03330 117382 120480 gene locus_tag LOCUS_03340 117382 120480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 120467 120868 gene locus_tag LOCUS_03350 120467 120868 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_03350 121008 121955 gene locus_tag LOCUS_03360 121008 121955 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_03360 122470 122036 gene locus_tag LOCUS_03370 gene ppi 122470 122036 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_03370 122943 122467 gene locus_tag LOCUS_03380 122943 122467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 123866 122973 gene locus_tag LOCUS_03390 123866 122973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_03390 123993 126308 gene locus_tag LOCUS_03400 gene mrcA 123993 126308 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_03400 128378 126342 gene locus_tag LOCUS_03410 128378 126342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 129246 128503 gene locus_tag LOCUS_03420 129246 128503 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_03420 130891 129407 gene locus_tag LOCUS_03430 130891 129407 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ75 protein_id gnl|my_center|LOCUS_03430 133203 131497 gene locus_tag LOCUS_03440 gene pckA 133203 131497 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_03440 133342 134844 gene locus_tag LOCUS_03450 133342 134844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_03450 134932 135474 gene locus_tag LOCUS_03460 134932 135474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 135486 135869 gene locus_tag LOCUS_03470 135486 135869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_03470 135876 136409 gene locus_tag LOCUS_03480 135876 136409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 137374 136406 gene locus_tag LOCUS_03490 137374 136406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 144988 137480 gene locus_tag LOCUS_03500 144988 137480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 145365 145892 gene locus_tag LOCUS_03510 145365 145892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 148368 146239 gene locus_tag LOCUS_03520 148368 146239 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_03520 149203 148481 gene locus_tag LOCUS_03530 149203 148481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 149356 149748 gene locus_tag LOCUS_03540 149356 149748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 149907 152297 gene locus_tag LOCUS_03550 149907 152297 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_03550 152453 152902 gene locus_tag LOCUS_03560 152453 152902 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_03560 152944 153303 gene locus_tag LOCUS_03570 152944 153303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_03570 153312 154313 gene locus_tag LOCUS_03580 153312 154313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002660364.1 protein_id gnl|my_center|LOCUS_03580 154423 154962 gene locus_tag LOCUS_03590 154423 154962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 155387 155088 gene locus_tag LOCUS_03600 155387 155088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 155329 156756 gene locus_tag LOCUS_03610 155329 156756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 156824 157099 gene locus_tag LOCUS_03620 gene rpsO 156824 157099 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_03620 157245 159386 gene locus_tag LOCUS_03630 gene pnp 157245 159386 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_03630 159490 160353 gene locus_tag LOCUS_03640 gene rpoD 159490 160353 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_03640 160474 161439 gene locus_tag LOCUS_03650 gene trxB1 160474 161439 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_03650 161557 162276 gene locus_tag LOCUS_03660 161557 162276 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_03660 163888 162668 gene locus_tag LOCUS_03670 163888 162668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 164529 163888 gene locus_tag LOCUS_03680 gene pdxH 164529 163888 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_03680 164642 165226 gene locus_tag LOCUS_03690 164642 165226 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_03690 165227 165805 gene locus_tag LOCUS_03700 165227 165805 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_03700 165865 167805 gene locus_tag LOCUS_03710 165865 167805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 167939 168012 gene locus_tag LOCUS_t00050 167939 168012 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 168710 168225 gene locus_tag LOCUS_03720 gene paaD 168710 168225 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 protein_id gnl|my_center|LOCUS_03720 169517 168762 gene locus_tag LOCUS_03730 169517 168762 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_03730 170162 169521 gene locus_tag LOCUS_03740 170162 169521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 171256 170258 gene locus_tag LOCUS_03750 gene paaA 171256 170258 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_03750 171966 171379 gene locus_tag LOCUS_03760 171966 171379 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_03760 172126 173037 gene locus_tag LOCUS_03770 172126 173037 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_03770 173743 173024 gene locus_tag LOCUS_03780 173743 173024 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242007.1 protein_id gnl|my_center|LOCUS_03780 174790 175647 gene locus_tag LOCUS_03790 174790 175647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_03790 175650 178202 gene locus_tag LOCUS_03800 175650 178202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 178707 178264 gene locus_tag LOCUS_03810 gene rplI 178707 178264 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_03810 178988 178731 gene locus_tag LOCUS_03820 gene rpsR 178988 178731 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_03820 179356 178985 gene locus_tag LOCUS_03830 gene rpsF 179356 178985 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_03830 179552 179941 gene locus_tag LOCUS_03840 179552 179941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 179926 180294 gene locus_tag LOCUS_03850 179926 180294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 180393 182246 gene locus_tag LOCUS_03860 180393 182246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 183383 182247 gene locus_tag LOCUS_03870 183383 182247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 184339 183407 gene locus_tag LOCUS_03880 184339 183407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 184457 185041 gene locus_tag LOCUS_03890 gene tpm 184457 185041 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_03890 185878 185099 gene locus_tag LOCUS_03900 185878 185099 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_03900 186281 185880 gene locus_tag LOCUS_03910 gene apaG 186281 185880 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_03910 186384 187046 gene locus_tag LOCUS_03920 gene ung2 186384 187046 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_03920 188573 187080 gene locus_tag LOCUS_03930 188573 187080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 188738 190699 gene locus_tag LOCUS_03940 gene gyrB 188738 190699 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_03940 190775 191935 gene locus_tag LOCUS_03950 gene aspC3 190775 191935 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_03950 191932 192792 gene locus_tag LOCUS_03960 gene tyrA 191932 192792 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_03960 193818 193198 gene locus_tag LOCUS_03970 193818 193198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 194162 193815 gene locus_tag LOCUS_03980 194162 193815 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence03 1085 99 gene locus_tag LOCUS_03990 1085 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2209 1196 gene locus_tag LOCUS_04000 gene gldB 2209 1196 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_04000 2254 2883 gene locus_tag LOCUS_04010 2254 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3803 2880 gene locus_tag LOCUS_04020 3803 2880 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_04020 4559 3828 gene locus_tag LOCUS_04030 4559 3828 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_04030 5551 4634 gene locus_tag LOCUS_04040 5551 4634 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_04040 7348 5552 gene locus_tag LOCUS_04050 7348 5552 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_04050 9450 7414 gene locus_tag LOCUS_04060 gene dsbD 9450 7414 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_04060 9534 9764 gene locus_tag LOCUS_04070 9534 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 9895 10176 gene locus_tag LOCUS_04080 9895 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_04080 10206 11213 gene locus_tag LOCUS_04090 10206 11213 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_04090 11334 12161 gene locus_tag LOCUS_04100 11334 12161 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_04100 12683 12270 gene locus_tag LOCUS_04110 12683 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12963 13757 gene locus_tag LOCUS_04120 12963 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 13815 14099 gene locus_tag LOCUS_04130 13815 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15478 14159 gene locus_tag LOCUS_04140 15478 14159 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_04140 15963 15475 gene locus_tag LOCUS_04150 gene ribH 15963 15475 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_04150 17118 16420 gene locus_tag LOCUS_04160 17118 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403954.1 protein_id gnl|my_center|LOCUS_04160 18339 17320 gene locus_tag LOCUS_04170 gene pdhA 18339 17320 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_04170 18449 19549 gene locus_tag LOCUS_04180 gene recF 18449 19549 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_04180 19542 19865 gene locus_tag LOCUS_04190 19542 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_04190 20757 20071 gene locus_tag LOCUS_04200 20757 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20824 21714 gene locus_tag LOCUS_04210 20824 21714 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_04210 21883 22479 gene locus_tag LOCUS_04220 21883 22479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 22507 23175 gene locus_tag LOCUS_04230 22507 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 23207 23692 gene locus_tag LOCUS_04240 gene yisT 23207 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07939 protein_id gnl|my_center|LOCUS_04240 23813 25357 gene locus_tag LOCUS_04250 gene gltX 23813 25357 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_04250 25357 25572 gene locus_tag LOCUS_04260 25357 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 28561 25619 gene locus_tag LOCUS_04270 28561 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 31069 28895 gene locus_tag LOCUS_04280 31069 28895 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_04280 32598 31315 gene locus_tag LOCUS_04290 gene cat2 32598 31315 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_04290 33167 33637 gene locus_tag LOCUS_04300 33167 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 34034 33627 gene locus_tag LOCUS_04310 34034 33627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 35700 34240 gene locus_tag LOCUS_04320 gene gltD 35700 34240 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_04320 40224 35701 gene locus_tag LOCUS_04330 gene gltB 40224 35701 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_04330 41560 40448 gene locus_tag LOCUS_04340 41560 40448 CDS product pyrroloquinoline-quinone glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_04340 43456 41690 gene locus_tag LOCUS_04350 gene fadD 43456 41690 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_04350 43637 43963 gene locus_tag LOCUS_04360 43637 43963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 44442 44023 gene locus_tag LOCUS_04370 gene ndk 44442 44023 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_04370 44638 45681 gene locus_tag LOCUS_04380 gene fjo19 44638 45681 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_04380 45668 46603 gene locus_tag LOCUS_04390 45668 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 46605 47144 gene locus_tag LOCUS_04400 46605 47144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 47211 47663 gene locus_tag LOCUS_04410 47211 47663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 47668 48246 gene locus_tag LOCUS_04420 47668 48246 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_04420 48276 48893 gene locus_tag LOCUS_04430 gene udk 48276 48893 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_04430 48890 49582 gene locus_tag LOCUS_04440 48890 49582 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393255.1 protein_id gnl|my_center|LOCUS_04440 50114 49761 gene locus_tag LOCUS_04450 50114 49761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 50231 50434 gene locus_tag LOCUS_04460 50231 50434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 50491 51237 gene locus_tag LOCUS_04470 50491 51237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 51480 51680 gene locus_tag LOCUS_04480 51480 51680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 51668 52324 gene locus_tag LOCUS_04490 51668 52324 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_04490 52350 52988 gene locus_tag LOCUS_04500 52350 52988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 52988 53467 gene locus_tag LOCUS_04510 52988 53467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 53545 55701 gene locus_tag LOCUS_04520 53545 55701 CDS product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_04520 56322 57236 gene locus_tag LOCUS_04530 gene rssA 56322 57236 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_04530 57214 57828 gene locus_tag LOCUS_04540 57214 57828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 58011 59699 gene locus_tag LOCUS_04550 58011 59699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 59752 61230 gene locus_tag LOCUS_04560 gene glyQS 59752 61230 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB5 protein_id gnl|my_center|LOCUS_04560 61349 61660 gene locus_tag LOCUS_04570 61349 61660 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_04570 61641 61898 gene locus_tag LOCUS_04580 61641 61898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_04580 62138 63004 gene locus_tag LOCUS_04590 62138 63004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 63413 63105 gene locus_tag LOCUS_04600 63413 63105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 64022 65335 gene locus_tag LOCUS_04610 gene ndh 64022 65335 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_04610 65826 66470 gene locus_tag LOCUS_04620 65826 66470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 66489 67208 gene locus_tag LOCUS_04630 gene algR 66489 67208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_04630 68364 67309 gene locus_tag LOCUS_04640 68364 67309 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_04640 68489 70081 gene locus_tag LOCUS_04650 68489 70081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_04650 70184 71200 gene locus_tag LOCUS_04660 70184 71200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 71226 72005 gene locus_tag LOCUS_04670 71226 72005 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_04670 72119 73075 gene locus_tag LOCUS_04680 72119 73075 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_04680 73246 74283 gene locus_tag LOCUS_04690 73246 74283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 74342 75154 gene locus_tag LOCUS_04700 74342 75154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 75186 76769 gene locus_tag LOCUS_04710 75186 76769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 76830 77672 gene locus_tag LOCUS_04720 76830 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 79515 77707 gene locus_tag LOCUS_04730 gene uvrC 79515 77707 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_04730 81809 79527 gene locus_tag LOCUS_04740 gene mrcA 81809 79527 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04740 84339 81850 gene locus_tag LOCUS_04750 gene sprE 84339 81850 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_04750 84592 85413 gene locus_tag LOCUS_04760 84592 85413 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_04760 85431 85871 gene locus_tag LOCUS_04770 85431 85871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259085.1 protein_id gnl|my_center|LOCUS_04770 85906 86061 gene locus_tag LOCUS_04780 85906 86061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 86067 86471 gene locus_tag LOCUS_04790 86067 86471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 86550 87635 gene locus_tag LOCUS_04800 gene atpB 86550 87635 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_04800 87674 87862 gene locus_tag LOCUS_04810 87674 87862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 88053 88448 gene locus_tag LOCUS_04820 gene atpF 88053 88448 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_04820 88458 89015 gene locus_tag LOCUS_04830 gene atpH 88458 89015 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_04830 89045 90619 gene locus_tag LOCUS_04840 gene atpA 89045 90619 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_04840 90710 91591 gene locus_tag LOCUS_04850 gene atpG 90710 91591 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_04850 92120 91650 gene locus_tag LOCUS_04860 92120 91650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 92737 92204 gene locus_tag LOCUS_04870 92737 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 96805 92849 gene locus_tag LOCUS_04880 96805 92849 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865167.1 protein_id gnl|my_center|LOCUS_04880 97794 96937 gene locus_tag LOCUS_04890 97794 96937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 98489 97941 gene locus_tag LOCUS_04900 98489 97941 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_04900 98609 100144 gene locus_tag LOCUS_04910 98609 100144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 100144 101574 gene locus_tag LOCUS_04920 100144 101574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_04920 101652 102260 gene locus_tag LOCUS_04930 101652 102260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_04930 102395 103531 gene locus_tag LOCUS_04940 gene purK 102395 103531 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_04940 103528 104049 gene locus_tag LOCUS_04950 gene purE 103528 104049 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_04950 106083 104050 gene locus_tag LOCUS_04960 106083 104050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 106250 106819 gene locus_tag LOCUS_04970 106250 106819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 107617 106847 gene locus_tag LOCUS_04980 107617 106847 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_04980 109687 107663 gene locus_tag LOCUS_04990 gene uvrB 109687 107663 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_04990 110350 111993 gene locus_tag LOCUS_05000 110350 111993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 111999 112430 gene locus_tag LOCUS_05010 111999 112430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 112826 113113 gene locus_tag LOCUS_05020 112826 113113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 114059 113145 gene locus_tag LOCUS_05030 114059 113145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_05030 115370 114153 gene locus_tag LOCUS_05040 115370 114153 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_05040 115948 115493 gene locus_tag LOCUS_05050 gene ssb 115948 115493 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P624 protein_id gnl|my_center|LOCUS_05050 117098 116052 gene locus_tag LOCUS_05060 gene mutY 117098 116052 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_05060 117332 117631 gene locus_tag LOCUS_05070 117332 117631 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_05070 117640 118464 gene locus_tag LOCUS_05080 117640 118464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 118652 120205 gene locus_tag LOCUS_05090 gene cafA 118652 120205 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_05090 120364 122625 gene locus_tag LOCUS_05100 120364 122625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 124126 122630 gene locus_tag LOCUS_05110 124126 122630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 125262 124234 gene locus_tag LOCUS_05120 gene hemH 125262 124234 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_05120 127558 125384 gene locus_tag LOCUS_05130 127558 125384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 127708 129135 gene locus_tag LOCUS_05140 gene cry 127708 129135 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_05140 129225 130250 gene locus_tag LOCUS_05150 129225 130250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_05150 130406 131167 gene locus_tag LOCUS_05160 gene tpiA 130406 131167 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_05160 131167 132015 gene locus_tag LOCUS_05170 gene prmA 131167 132015 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_05170 132012 136823 gene locus_tag LOCUS_05180 132012 136823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 136857 138236 gene locus_tag LOCUS_05190 136857 138236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_05190 139328 138285 gene locus_tag LOCUS_05200 gene nce 139328 138285 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 protein_id gnl|my_center|LOCUS_05200 140705 139413 gene locus_tag LOCUS_05210 140705 139413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 140928 141317 gene locus_tag LOCUS_05220 gene rbfA 140928 141317 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHT9 protein_id gnl|my_center|LOCUS_05220 141423 142562 gene locus_tag LOCUS_05230 141423 142562 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_05230 142668 145598 gene locus_tag LOCUS_05240 142668 145598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 145753 145962 gene locus_tag LOCUS_05250 145753 145962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 146014 146355 gene locus_tag LOCUS_05260 146014 146355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 146364 146990 gene locus_tag LOCUS_05270 146364 146990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 147435 148004 gene locus_tag LOCUS_05280 147435 148004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 148008 149126 gene locus_tag LOCUS_05290 148008 149126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 149137 149844 gene locus_tag LOCUS_05300 149137 149844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_05300 149841 151004 gene locus_tag LOCUS_05310 149841 151004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 151001 152275 gene locus_tag LOCUS_05320 151001 152275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 152329 153021 gene locus_tag LOCUS_05330 152329 153021 CDS product sigma E regulatory protein, MucB/RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_05330 154157 153285 gene locus_tag LOCUS_05340 154157 153285 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_05340 154311 154925 gene locus_tag LOCUS_05350 154311 154925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 156162 155476 gene locus_tag LOCUS_05360 156162 155476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 156369 157565 gene locus_tag LOCUS_05370 gene porY 156369 157565 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_05370 160106 157662 gene locus_tag LOCUS_05380 160106 157662 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_05380 160365 161873 gene locus_tag LOCUS_05390 gene atpD 160365 161873 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_05390 161884 162132 gene locus_tag LOCUS_05400 161884 162132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 162304 163521 gene locus_tag LOCUS_05410 162304 163521 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_05410 164325 163951 gene locus_tag LOCUS_05420 164325 163951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_05420 164541 166424 gene locus_tag LOCUS_05430 gene pepN 164541 166424 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_05430 166448 167362 gene locus_tag LOCUS_05440 166448 167362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 168563 167415 gene locus_tag LOCUS_05450 168563 167415 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_05450 169962 168568 gene locus_tag LOCUS_05460 169962 168568 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_05460 170174 171085 gene locus_tag LOCUS_05470 170174 171085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 171159 171494 gene locus_tag LOCUS_05480 171159 171494 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_05480 171562 172038 gene locus_tag LOCUS_05490 171562 172038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_05490 172269 172883 gene locus_tag LOCUS_05500 gene arsC 172269 172883 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_05500 172880 173917 gene locus_tag LOCUS_05510 172880 173917 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405175.1 protein_id gnl|my_center|LOCUS_05510 173981 175039 gene locus_tag LOCUS_05520 173981 175039 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_05520 175247 177145 gene locus_tag LOCUS_05530 175247 177145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence04 867 226 gene locus_tag LOCUS_05540 867 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6170 1161 gene locus_tag LOCUS_05550 6170 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7233 6157 gene locus_tag LOCUS_05560 7233 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_05560 7777 7343 gene locus_tag LOCUS_05570 7777 7343 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262312.1 protein_id gnl|my_center|LOCUS_05570 8039 9292 gene locus_tag LOCUS_05580 gene yxaH 8039 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42107 protein_id gnl|my_center|LOCUS_05580 9425 10747 gene locus_tag LOCUS_05590 9425 10747 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947976.1 protein_id gnl|my_center|LOCUS_05590 11182 10829 gene locus_tag LOCUS_05600 11182 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 14395 11933 gene locus_tag LOCUS_05610 14395 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 15393 14764 gene locus_tag LOCUS_05620 15393 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17468 15480 gene locus_tag LOCUS_05630 gene glgB 17468 15480 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L3 protein_id gnl|my_center|LOCUS_05630 17607 18011 gene locus_tag LOCUS_05640 17607 18011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19152 18775 gene locus_tag LOCUS_05650 19152 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_05650 19680 19171 gene locus_tag LOCUS_05660 19680 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 20553 19690 gene locus_tag LOCUS_05670 20553 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 21314 20607 gene locus_tag LOCUS_05680 21314 20607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 22787 21372 gene locus_tag LOCUS_05690 22787 21372 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_05690 23884 23261 gene locus_tag LOCUS_05700 23884 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_05700 24850 23894 gene locus_tag LOCUS_05710 gene etfA 24850 23894 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_05710 25636 24899 gene locus_tag LOCUS_05720 gene etfB 25636 24899 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_05720 25770 26090 gene locus_tag LOCUS_05730 25770 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 26575 27783 gene locus_tag LOCUS_05740 26575 27783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706362.1 protein_id gnl|my_center|LOCUS_05740 30388 27854 gene locus_tag LOCUS_05750 30388 27854 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCK3 protein_id gnl|my_center|LOCUS_05750 31886 30471 gene locus_tag LOCUS_05760 31886 30471 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_05760 32350 32063 gene locus_tag LOCUS_05770 32350 32063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 32540 33352 gene locus_tag LOCUS_05780 32540 33352 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_05780 34039 33389 gene locus_tag LOCUS_05790 34039 33389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 34427 36316 gene locus_tag LOCUS_05800 34427 36316 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_05800 36318 37364 gene locus_tag LOCUS_05810 36318 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 37361 37750 gene locus_tag LOCUS_05820 37361 37750 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_05820 37747 37905 gene locus_tag LOCUS_05830 37747 37905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 38346 39041 gene locus_tag LOCUS_05840 38346 39041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 39045 39752 gene locus_tag LOCUS_05850 39045 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_05850 41778 39802 gene locus_tag LOCUS_05860 41778 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 42773 41775 gene locus_tag LOCUS_05870 42773 41775 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_05870 42910 44187 gene locus_tag LOCUS_05880 42910 44187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 44198 45124 gene locus_tag LOCUS_05890 44198 45124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 45762 45178 gene locus_tag LOCUS_05900 45762 45178 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256448.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05900 46003 46536 gene locus_tag LOCUS_05910 46003 46536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_05910 46560 47225 gene locus_tag LOCUS_05920 46560 47225 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_05920 47337 47798 gene locus_tag LOCUS_05930 47337 47798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 48208 47801 gene locus_tag LOCUS_05940 48208 47801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 48875 48258 gene locus_tag LOCUS_05950 48875 48258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 50052 49021 gene locus_tag LOCUS_05960 gene recA 50052 49021 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_05960 50156 51286 gene locus_tag LOCUS_05970 50156 51286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 51403 52317 gene locus_tag LOCUS_05980 51403 52317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 52429 53118 gene locus_tag LOCUS_05990 gene phoP 52429 53118 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_05990 53127 54206 gene locus_tag LOCUS_06000 gene phoR 53127 54206 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_06000 54224 54937 gene locus_tag LOCUS_06010 54224 54937 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_06010 55245 55688 gene locus_tag LOCUS_06020 gene rplM 55245 55688 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_06020 55700 56086 gene locus_tag LOCUS_06030 gene rpsI 55700 56086 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSE4 protein_id gnl|my_center|LOCUS_06030 56117 56911 gene locus_tag LOCUS_06040 gene rpsB 56117 56911 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_06040 57029 57859 gene locus_tag LOCUS_06050 gene tsf 57029 57859 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_06050 58555 57932 gene locus_tag LOCUS_06060 58555 57932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_06060 59057 58548 gene locus_tag LOCUS_06070 59057 58548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 60312 59050 gene locus_tag LOCUS_06080 60312 59050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 61831 60350 gene locus_tag LOCUS_06090 61831 60350 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_06090 62517 61828 gene locus_tag LOCUS_06100 62517 61828 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_06100 62944 63336 gene locus_tag LOCUS_06110 62944 63336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 64230 63844 gene locus_tag LOCUS_06120 64230 63844 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64880 protein_id gnl|my_center|LOCUS_06120 64433 64227 gene locus_tag LOCUS_06130 64433 64227 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_06130 64815 65702 gene locus_tag LOCUS_06140 64815 65702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 65751 66533 gene locus_tag LOCUS_06150 65751 66533 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_06150 66731 67348 gene locus_tag LOCUS_06160 66731 67348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 67423 68079 gene locus_tag LOCUS_06170 67423 68079 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_06170 68137 68721 gene locus_tag LOCUS_06180 68137 68721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_06180 68721 70868 gene locus_tag LOCUS_06190 68721 70868 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_06190 70865 72181 gene locus_tag LOCUS_06200 70865 72181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_06200 72242 73303 gene locus_tag LOCUS_06210 72242 73303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_06210 73434 73865 gene locus_tag LOCUS_06220 73434 73865 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_06220 73884 74888 gene locus_tag LOCUS_06230 gene cas1 73884 74888 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_06230 74954 75217 gene locus_tag LOCUS_06240 gene cas2 74954 75217 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_06240 75432 78230 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgcaccatactggaattgaaat 83048 78747 gene locus_tag LOCUS_06250 gene dnaE 83048 78747 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_06250 84743 83526 gene locus_tag LOCUS_06260 84743 83526 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_06260 84766 85950 gene locus_tag LOCUS_06270 84766 85950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_06270 86216 86821 gene locus_tag LOCUS_06280 86216 86821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 87345 88412 gene locus_tag LOCUS_06290 87345 88412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 89413 88475 gene locus_tag LOCUS_06300 gene queG 89413 88475 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_06300 90441 89413 gene locus_tag LOCUS_06310 gene ruvB 90441 89413 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_06310 90831 91559 gene locus_tag LOCUS_06320 90831 91559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_06320 91567 91860 gene locus_tag LOCUS_06330 91567 91860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 92920 91874 gene locus_tag LOCUS_06340 92920 91874 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_06340 93348 95525 gene locus_tag LOCUS_06350 93348 95525 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_06350 95624 96913 gene locus_tag LOCUS_06360 gene purD 95624 96913 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_06360 97201 98328 gene locus_tag LOCUS_06370 97201 98328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 98328 98795 gene locus_tag LOCUS_06380 98328 98795 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_06380 99682 98903 gene locus_tag LOCUS_06390 99682 98903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 100519 99776 gene locus_tag LOCUS_06400 100519 99776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 101878 100550 gene locus_tag LOCUS_06410 gene rmuC 101878 100550 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_06410 102697 102020 gene locus_tag LOCUS_06420 102697 102020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 103155 102784 gene locus_tag LOCUS_06430 103155 102784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 103538 103158 gene locus_tag LOCUS_06440 gene gcvH 103538 103158 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_06440 110665 103613 gene locus_tag LOCUS_06450 gene sprA 110665 103613 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_06450 111380 110787 gene locus_tag LOCUS_06460 gene ruvA 111380 110787 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_06460 113656 111377 gene locus_tag LOCUS_06470 gene maeB 113656 111377 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_06470 114896 113769 gene locus_tag LOCUS_06480 114896 113769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 116391 114907 gene locus_tag LOCUS_06490 116391 114907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 117826 116402 gene locus_tag LOCUS_06500 gene gatA 117826 116402 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_06500 118071 117829 gene locus_tag LOCUS_06510 118071 117829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 118705 118241 gene locus_tag LOCUS_06520 118705 118241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 118916 118689 gene locus_tag LOCUS_06530 118916 118689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 120275 119070 gene locus_tag LOCUS_06540 120275 119070 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_06540 121011 120265 gene locus_tag LOCUS_06550 121011 120265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_06550 122701 120995 gene locus_tag LOCUS_06560 122701 120995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_06560 123782 122772 gene locus_tag LOCUS_06570 123782 122772 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_06570 124405 123977 gene locus_tag LOCUS_06580 gene dut 124405 123977 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_06580 125909 124431 gene locus_tag LOCUS_06590 125909 124431 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_06590 126885 126100 gene locus_tag LOCUS_06600 gene crt 126885 126100 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_06600 127163 128185 gene locus_tag LOCUS_06610 127163 128185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 130580 128535 gene locus_tag LOCUS_06620 130580 128535 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_06620 131129 130635 gene locus_tag LOCUS_06630 131129 130635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_06630 131666 134026 gene locus_tag LOCUS_06640 131666 134026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 134980 134228 gene locus_tag LOCUS_06650 134980 134228 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_06650 136396 137787 gene locus_tag LOCUS_06660 gene lpdA2 136396 137787 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_06660 138170 138544 gene locus_tag LOCUS_06670 138170 138544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 138541 139368 gene locus_tag LOCUS_06680 138541 139368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 protein_id gnl|my_center|LOCUS_06680 140709 139792 gene locus_tag LOCUS_06690 140709 139792 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_06690 141506 140715 gene locus_tag LOCUS_06700 141506 140715 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_06700 143400 141553 gene locus_tag LOCUS_06710 gene mutL 143400 141553 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_06710 143836 143507 gene locus_tag LOCUS_06720 143836 143507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 144023 146974 gene locus_tag LOCUS_06730 144023 146974 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_06730 147061 148203 gene locus_tag LOCUS_06740 147061 148203 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_06740 148295 148918 gene locus_tag LOCUS_06750 148295 148918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 148922 149728 gene locus_tag LOCUS_06760 gene yeeZ 148922 149728 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_06760 149788 150537 gene locus_tag LOCUS_06770 149788 150537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_06770 150664 151761 gene locus_tag LOCUS_06780 150664 151761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_06780 151724 153295 gene locus_tag LOCUS_06790 151724 153295 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_06790 153335 155098 gene locus_tag LOCUS_06800 153335 155098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 155144 155896 gene locus_tag LOCUS_06810 155144 155896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258110.1 protein_id gnl|my_center|LOCUS_06810 156029 156634 gene locus_tag LOCUS_06820 gene pnuT 156029 156634 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_06820 156631 157137 gene locus_tag LOCUS_06830 156631 157137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 165060 157174 gene locus_tag LOCUS_06840 165060 157174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 165516 167807 gene locus_tag LOCUS_06850 165516 167807 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_06850 167872 168927 gene locus_tag LOCUS_06860 167872 168927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 169423 168992 gene locus_tag LOCUS_06870 169423 168992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence05 345 1418 gene locus_tag LOCUS_06880 345 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1503 2381 gene locus_tag LOCUS_06890 1503 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6031 2648 gene locus_tag LOCUS_06900 6031 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6317 6129 gene locus_tag LOCUS_06910 6317 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6651 7787 gene locus_tag LOCUS_06920 6651 7787 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_06920 7784 8377 gene locus_tag LOCUS_06930 7784 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 9388 8387 gene locus_tag LOCUS_06940 9388 8387 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_06940 9719 9381 gene locus_tag LOCUS_06950 9719 9381 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE85 protein_id gnl|my_center|LOCUS_06950 11602 9722 gene locus_tag LOCUS_06960 11602 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13137 11647 gene locus_tag LOCUS_06970 gene hutH1 13137 11647 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_06970 14518 13130 gene locus_tag LOCUS_06980 gene hisS 14518 13130 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_06980 16098 14800 gene locus_tag LOCUS_06990 16098 14800 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_06990 16293 18044 gene locus_tag LOCUS_07000 16293 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18061 18909 gene locus_tag LOCUS_07010 18061 18909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 19598 18963 gene locus_tag LOCUS_07020 19598 18963 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_07020 20013 20993 gene locus_tag LOCUS_07030 20013 20993 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_07030 20993 21610 gene locus_tag LOCUS_07040 20993 21610 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_07040 21999 24110 gene locus_tag LOCUS_07050 gene pepX1 21999 24110 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_07050 24392 24156 gene locus_tag LOCUS_07060 24392 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 24814 24395 gene locus_tag LOCUS_07070 gene blrA 24814 24395 CDS product blue-light sensor BLUF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331343.1 protein_id gnl|my_center|LOCUS_07070 26057 25212 gene locus_tag LOCUS_07080 26057 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 26851 26054 gene locus_tag LOCUS_07090 26851 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_07090 27031 27636 gene locus_tag LOCUS_07100 27031 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 27710 28498 gene locus_tag LOCUS_07110 27710 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 28568 29125 gene locus_tag LOCUS_07120 28568 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 29913 29449 gene locus_tag LOCUS_07130 29913 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 30909 30121 gene locus_tag LOCUS_07140 30909 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31332 33731 gene locus_tag LOCUS_07150 31332 33731 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_07150 33731 34567 gene locus_tag LOCUS_07160 33731 34567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 34564 36000 gene locus_tag LOCUS_07170 gene hsdM 34564 36000 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939429.1 protein_id gnl|my_center|LOCUS_07170 36005 37726 gene locus_tag LOCUS_07180 36005 37726 CDS product HsdS polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105648.1 protein_id gnl|my_center|LOCUS_07180 37948 42282 gene locus_tag LOCUS_07190 37948 42282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 44069 42735 gene locus_tag LOCUS_07200 44069 42735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 44763 44053 gene locus_tag LOCUS_07210 44763 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 45053 44760 gene locus_tag LOCUS_07220 45053 44760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 45902 45207 gene locus_tag LOCUS_07230 45902 45207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 47018 45903 gene locus_tag LOCUS_07240 47018 45903 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_07240 47368 47015 gene locus_tag LOCUS_07250 47368 47015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 48973 47600 gene locus_tag LOCUS_07260 gene mnmE 48973 47600 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_07260 50229 49384 gene locus_tag LOCUS_07270 50229 49384 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_07270 50494 51429 gene locus_tag LOCUS_07280 gene tqsA 50494 51429 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118294.1 protein_id gnl|my_center|LOCUS_07280 51560 53245 gene locus_tag LOCUS_07290 51560 53245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 53238 54275 gene locus_tag LOCUS_07300 53238 54275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_07300 54288 55394 gene locus_tag LOCUS_07310 54288 55394 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_07310 56584 55739 gene locus_tag LOCUS_07320 gene prmC 56584 55739 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_07320 56636 57694 gene locus_tag LOCUS_07330 gene ribD 56636 57694 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_07330 57721 58203 gene locus_tag LOCUS_07340 57721 58203 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_07340 58315 59232 gene locus_tag LOCUS_07350 gene hemF 58315 59232 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_07350 59287 59865 gene locus_tag LOCUS_07360 59287 59865 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_07360 60537 59839 gene locus_tag LOCUS_07370 60537 59839 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_07370 61136 60549 gene locus_tag LOCUS_07380 gene ribE 61136 60549 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_07380 62165 61260 gene locus_tag LOCUS_07390 62165 61260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_07390 62302 62604 gene locus_tag LOCUS_07400 62302 62604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 62880 63920 gene locus_tag LOCUS_07410 gene pyrD 62880 63920 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_07410 63986 64882 gene locus_tag LOCUS_07420 63986 64882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_07420 64900 66384 gene locus_tag LOCUS_07430 64900 66384 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_07430 66766 66425 gene locus_tag LOCUS_07440 66766 66425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 66912 67223 gene locus_tag LOCUS_07450 66912 67223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 67233 67433 gene locus_tag LOCUS_07460 67233 67433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 67436 67735 gene locus_tag LOCUS_07470 67436 67735 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_07470 67737 67967 gene locus_tag LOCUS_07480 67737 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 68317 68015 gene locus_tag LOCUS_07490 68317 68015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_07490 68481 69416 gene locus_tag LOCUS_07500 68481 69416 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_07500 69776 70279 gene locus_tag LOCUS_07510 69776 70279 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_07510 70292 71773 gene locus_tag LOCUS_07520 gene crtI 70292 71773 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_07520 71778 72620 gene locus_tag LOCUS_07530 gene crtB 71778 72620 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_07530 72631 73476 gene locus_tag LOCUS_07540 gene ispH 72631 73476 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_07540 73501 73980 gene locus_tag LOCUS_07550 gene crtZ 73501 73980 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_07550 74630 73977 gene locus_tag LOCUS_07560 74630 73977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 74724 77111 gene locus_tag LOCUS_07570 74724 77111 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_07570 77244 78542 gene locus_tag LOCUS_07580 77244 78542 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_07580 78548 79540 gene locus_tag LOCUS_07590 78548 79540 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_07590 79540 80562 gene locus_tag LOCUS_07600 79540 80562 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_07600 81433 80663 gene locus_tag LOCUS_07610 81433 80663 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_07610 83355 81430 gene locus_tag LOCUS_07620 gene dxs 83355 81430 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_07620 83625 84371 gene locus_tag LOCUS_07630 gene scpA 83625 84371 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_07630 84368 85417 gene locus_tag LOCUS_07640 84368 85417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_07640 85475 85870 gene locus_tag LOCUS_07650 85475 85870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 86886 86095 gene locus_tag LOCUS_07660 gene map 86886 86095 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_07660 87284 86883 gene locus_tag LOCUS_07670 87284 86883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_07670 87689 87387 gene locus_tag LOCUS_07680 87689 87387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 87959 87732 gene locus_tag LOCUS_07690 87959 87732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 88139 89296 gene locus_tag LOCUS_07700 88139 89296 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_07700 89827 89291 gene locus_tag LOCUS_07710 89827 89291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 90898 89867 gene locus_tag LOCUS_07720 90898 89867 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_07720 90936 91889 gene locus_tag LOCUS_07730 90936 91889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 91886 93046 gene locus_tag LOCUS_07740 91886 93046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 93084 93572 gene locus_tag LOCUS_07750 93084 93572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 93613 94176 gene locus_tag LOCUS_07760 93613 94176 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_07760 94348 94956 gene locus_tag LOCUS_07770 94348 94956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 96515 95013 gene locus_tag LOCUS_07780 96515 95013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_07780 97310 96540 gene locus_tag LOCUS_07790 gene lptB 97310 96540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_07790 99047 97338 gene locus_tag LOCUS_07800 gene recJ 99047 97338 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_07800 102171 99115 gene locus_tag LOCUS_07810 102171 99115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_07810 102337 109950 gene locus_tag LOCUS_07820 102337 109950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 110076 111371 gene locus_tag LOCUS_07830 110076 111371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 111441 112073 gene locus_tag LOCUS_07840 111441 112073 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_07840 112070 113200 gene locus_tag LOCUS_07850 112070 113200 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_07850 113476 114384 gene locus_tag LOCUS_07860 gene gldA 113476 114384 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_07860 114389 115123 gene locus_tag LOCUS_07870 gene gldF 114389 115123 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_07870 115195 116802 gene locus_tag LOCUS_07880 115195 116802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51693 protein_id gnl|my_center|LOCUS_07880 116795 117724 gene locus_tag LOCUS_07890 116795 117724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 117779 118165 gene locus_tag LOCUS_07900 117779 118165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 118633 119184 gene locus_tag LOCUS_07910 118633 119184 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_07910 119620 120669 gene locus_tag LOCUS_07920 gene dnaN 119620 120669 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_07920 120837 122021 gene locus_tag LOCUS_07930 120837 122021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 122059 122958 gene locus_tag LOCUS_07940 122059 122958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 123227 123964 gene locus_tag LOCUS_07950 gene phhA 123227 123964 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_07950 124182 124832 gene locus_tag LOCUS_07960 gene pcm 124182 124832 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_07960 125520 124888 gene locus_tag LOCUS_07970 125520 124888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07970 127104 125527 gene locus_tag LOCUS_07980 gene sulP 127104 125527 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_07980 127501 127202 gene locus_tag LOCUS_07990 127501 127202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 127768 128793 gene locus_tag LOCUS_08000 127768 128793 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_08000 130226 128757 gene locus_tag LOCUS_08010 130226 128757 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_08010 130347 130850 gene locus_tag LOCUS_08020 130347 130850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 132099 130843 gene locus_tag LOCUS_08030 132099 130843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 132121 132768 gene locus_tag LOCUS_08040 132121 132768 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_08040 133277 132771 gene locus_tag LOCUS_08050 133277 132771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 133743 133348 gene locus_tag LOCUS_08060 133743 133348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 133840 134313 gene locus_tag LOCUS_08070 133840 134313 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_08070 138058 134360 gene locus_tag LOCUS_08080 138058 134360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 140071 138092 gene locus_tag LOCUS_08090 140071 138092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 140958 140245 gene locus_tag LOCUS_08100 gene ftsE 140958 140245 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_08100 141208 141005 gene locus_tag LOCUS_08110 141208 141005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 142088 141432 gene locus_tag LOCUS_08120 gene tal 142088 141432 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_08120 142902 143210 gene locus_tag LOCUS_08130 142902 143210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 143211 143564 gene locus_tag LOCUS_08140 143211 143564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 143763 144137 gene locus_tag LOCUS_08150 143763 144137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 144220 144582 gene locus_tag LOCUS_08160 144220 144582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 145158 144758 gene locus_tag LOCUS_tm00010 145158 144758 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 146450 145341 gene locus_tag LOCUS_08170 146450 145341 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_08170 146920 146465 gene locus_tag LOCUS_08180 146920 146465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 147877 146996 gene locus_tag LOCUS_08190 147877 146996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691887.1 protein_id gnl|my_center|LOCUS_08190 148521 147949 gene locus_tag LOCUS_08200 148521 147949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_08200 148953 148780 gene locus_tag LOCUS_08210 148953 148780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 149017 149550 gene locus_tag LOCUS_08220 149017 149550 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_08220 149513 150040 gene locus_tag LOCUS_08230 149513 150040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 150172 150702 gene locus_tag LOCUS_08240 150172 150702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 150780 151364 gene locus_tag LOCUS_08250 150780 151364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 151370 152272 gene locus_tag LOCUS_08260 151370 152272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_08260 152269 153084 gene locus_tag LOCUS_08270 152269 153084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_08270 153322 153834 gene locus_tag LOCUS_08280 153322 153834 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_08280 154993 153851 gene locus_tag LOCUS_08290 154993 153851 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_08290 156589 155519 gene locus_tag LOCUS_08300 gene ansA 156589 155519 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_08300 156816 161465 gene locus_tag LOCUS_08310 156816 161465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 161502 162050 gene locus_tag LOCUS_08320 161502 162050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 162352 164646 gene locus_tag LOCUS_08330 162352 164646 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence06 3050 90 gene locus_tag LOCUS_08340 3050 90 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_08340 3191 4984 gene locus_tag LOCUS_08350 3191 4984 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08350 6182 4989 gene locus_tag LOCUS_08360 gene dinP 6182 4989 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_08360 6309 6575 gene locus_tag LOCUS_08370 6309 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7030 7800 gene locus_tag LOCUS_08380 7030 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 9035 7848 gene locus_tag LOCUS_08390 gene pgk 9035 7848 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_08390 10014 9061 gene locus_tag LOCUS_08400 10014 9061 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_08400 11028 10318 gene locus_tag LOCUS_08410 11028 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 12266 11211 gene locus_tag LOCUS_08420 gene lysl 12266 11211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_08420 12792 12256 gene locus_tag LOCUS_08430 12792 12256 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_08430 13308 12865 gene locus_tag LOCUS_08440 13308 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 14022 13405 gene locus_tag LOCUS_08450 14022 13405 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_08450 14879 14100 gene locus_tag LOCUS_08460 gene lpxA 14879 14100 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_08460 16324 14930 gene locus_tag LOCUS_08470 gene fabZ 16324 14930 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_08470 17374 16325 gene locus_tag LOCUS_08480 gene lpxD 17374 16325 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_08480 18503 17400 gene locus_tag LOCUS_08490 18503 17400 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_08490 18653 20215 gene locus_tag LOCUS_08500 gene porX 18653 20215 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_08500 20205 20654 gene locus_tag LOCUS_08510 20205 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 20647 21876 gene locus_tag LOCUS_08520 gene ald 20647 21876 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_08520 23867 21873 gene locus_tag LOCUS_08530 23867 21873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 25998 24064 gene locus_tag LOCUS_08540 25998 24064 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_08540 26477 27283 gene locus_tag LOCUS_08550 gene proC 26477 27283 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_08550 27299 28093 gene locus_tag LOCUS_08560 27299 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 28145 29344 gene locus_tag LOCUS_08570 gene proA 28145 29344 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC9 protein_id gnl|my_center|LOCUS_08570 30096 29392 gene locus_tag LOCUS_08580 30096 29392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 30862 30089 gene locus_tag LOCUS_08590 30862 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 31426 30887 gene locus_tag LOCUS_08600 31426 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 31679 33604 gene locus_tag LOCUS_08610 31679 33604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 36609 33877 gene locus_tag LOCUS_08620 36609 33877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 37807 36734 gene locus_tag LOCUS_08630 gene speB 37807 36734 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_08630 38311 37814 gene locus_tag LOCUS_08640 gene sixA 38311 37814 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_08640 38448 40805 gene locus_tag LOCUS_08650 gene topA 38448 40805 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_08650 41215 40934 gene locus_tag LOCUS_08660 41215 40934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 41313 42155 gene locus_tag LOCUS_08670 41313 42155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_08670 42326 43852 gene locus_tag LOCUS_08680 42326 43852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 43861 44679 gene locus_tag LOCUS_08690 gene panB 43861 44679 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_08690 45293 47524 gene locus_tag LOCUS_08700 45293 47524 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_08700 48704 47598 gene locus_tag LOCUS_08710 48704 47598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_08710 49704 48883 gene locus_tag LOCUS_08720 49704 48883 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_08720 50736 49783 gene locus_tag LOCUS_08730 gene hldD 50736 49783 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_08730 50828 51244 gene locus_tag LOCUS_08740 50828 51244 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_08740 51345 52454 gene locus_tag LOCUS_08750 51345 52454 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_08750 52700 53026 gene locus_tag LOCUS_08760 52700 53026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 53957 53061 gene locus_tag LOCUS_08770 53957 53061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_08770 54405 53989 gene locus_tag LOCUS_08780 54405 53989 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_08780 56617 54575 gene locus_tag LOCUS_08790 56617 54575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 57258 56614 gene locus_tag LOCUS_08800 57258 56614 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_08800 58499 57261 gene locus_tag LOCUS_08810 58499 57261 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_08810 58621 59754 gene locus_tag LOCUS_08820 58621 59754 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_08820 60122 59829 gene locus_tag LOCUS_08830 60122 59829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 60339 60112 gene locus_tag LOCUS_08840 60339 60112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 61563 60568 gene locus_tag LOCUS_08850 61563 60568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 62773 61556 gene locus_tag LOCUS_08860 62773 61556 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_08860 65216 62793 gene locus_tag LOCUS_08870 65216 62793 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_08870 65444 67267 gene locus_tag LOCUS_08880 65444 67267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 67286 68791 gene locus_tag LOCUS_08890 67286 68791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_08890 69663 68872 gene locus_tag LOCUS_08900 69663 68872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_08900 70765 69668 gene locus_tag LOCUS_08910 70765 69668 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_08910 70849 71868 gene locus_tag LOCUS_08920 gene lpxK 70849 71868 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_08920 71876 73744 gene locus_tag LOCUS_08930 71876 73744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_08930 73768 74367 gene locus_tag LOCUS_08940 gene miaE 73768 74367 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_08940 74740 74462 gene locus_tag LOCUS_08950 74740 74462 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_08950 76032 74872 gene locus_tag LOCUS_08960 76032 74872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_08960 76263 77543 gene locus_tag LOCUS_08970 76263 77543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_08970 77543 78790 gene locus_tag LOCUS_08980 77543 78790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 78851 79492 gene locus_tag LOCUS_08990 78851 79492 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_08990 79539 80516 gene locus_tag LOCUS_09000 79539 80516 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XXF0 protein_id gnl|my_center|LOCUS_09000 80519 81388 gene locus_tag LOCUS_09010 gene udp 80519 81388 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_09010 81497 84892 gene locus_tag LOCUS_09020 81497 84892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 85964 84930 gene locus_tag LOCUS_09030 85964 84930 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097684.1 protein_id gnl|my_center|LOCUS_09030 87159 86008 gene locus_tag LOCUS_09040 gene rlmL 87159 86008 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_09040 87270 87728 gene locus_tag LOCUS_09050 87270 87728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 88602 87781 gene locus_tag LOCUS_09060 88602 87781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 88645 89976 gene locus_tag LOCUS_09070 88645 89976 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_09070 89986 91779 gene locus_tag LOCUS_09080 89986 91779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 91855 92097 gene locus_tag LOCUS_09090 91855 92097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 92094 92426 gene locus_tag LOCUS_09100 92094 92426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 93430 92423 gene locus_tag LOCUS_09110 93430 92423 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_09110 94647 93421 gene locus_tag LOCUS_09120 gene hutI 94647 93421 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_09120 95044 94691 gene locus_tag LOCUS_09130 95044 94691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 96685 95234 gene locus_tag LOCUS_09140 gene asnS 96685 95234 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_09140 96854 98284 gene locus_tag LOCUS_09150 96854 98284 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_09150 98389 98901 gene locus_tag LOCUS_09160 98389 98901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 98915 99694 gene locus_tag LOCUS_09170 98915 99694 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_09170 100556 99792 gene locus_tag LOCUS_09180 100556 99792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 100733 100807 gene locus_tag LOCUS_t00060 100733 100807 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 102324 100840 gene locus_tag LOCUS_09190 102324 100840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 102454 103689 gene locus_tag LOCUS_09200 gene pepP 102454 103689 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_09200 104788 103715 gene locus_tag LOCUS_09210 104788 103715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 105484 105080 gene locus_tag LOCUS_09220 gene vapC 105484 105080 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME0 protein_id gnl|my_center|LOCUS_09220 105723 105484 gene locus_tag LOCUS_09230 105723 105484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 105845 106663 gene locus_tag LOCUS_09240 105845 106663 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_09240 106721 107281 gene locus_tag LOCUS_09250 106721 107281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 107281 107703 gene locus_tag LOCUS_09260 107281 107703 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_09260 107763 110123 gene locus_tag LOCUS_09270 107763 110123 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_09270 115350 110185 gene locus_tag LOCUS_09280 115350 110185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 116737 115604 gene locus_tag LOCUS_09290 116737 115604 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_09290 117066 119480 gene locus_tag LOCUS_09300 117066 119480 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_09300 120306 119629 gene locus_tag LOCUS_09310 120306 119629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 121525 120380 gene locus_tag LOCUS_09320 121525 120380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 122512 121559 gene locus_tag LOCUS_09330 122512 121559 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_09330 126700 122573 gene locus_tag LOCUS_09340 126700 122573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 127482 126985 gene locus_tag LOCUS_09350 127482 126985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 127700 127515 gene locus_tag LOCUS_09360 127700 127515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 127866 128543 gene locus_tag LOCUS_09370 127866 128543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 128715 128527 gene locus_tag LOCUS_09380 128715 128527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 128888 129142 gene locus_tag LOCUS_09390 128888 129142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_09390 129132 129548 gene locus_tag LOCUS_09400 129132 129548 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_09400 130732 129596 gene locus_tag LOCUS_09410 130732 129596 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_09410 130884 132926 gene locus_tag LOCUS_09420 130884 132926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 133083 134612 gene locus_tag LOCUS_09430 gene guaA 133083 134612 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_09430 134759 136570 gene locus_tag LOCUS_09440 134759 136570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 136684 137979 gene locus_tag LOCUS_09450 gene hemL 136684 137979 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_09450 138216 139166 gene locus_tag LOCUS_09460 138216 139166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 139433 140680 gene locus_tag LOCUS_09470 139433 140680 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_09470 141293 140721 gene locus_tag LOCUS_09480 141293 140721 CDS product pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_09480 141531 142106 gene locus_tag LOCUS_09490 141531 142106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_09490 142226 142639 gene locus_tag LOCUS_09500 142226 142639 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_09500 142820 143830 gene locus_tag LOCUS_09510 142820 143830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 143831 145171 gene locus_tag LOCUS_09520 143831 145171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 146778 145504 gene locus_tag LOCUS_09530 gene aceA 146778 145504 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 protein_id gnl|my_center|LOCUS_09530 148405 146813 gene locus_tag LOCUS_09540 148405 146813 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY7 protein_id gnl|my_center|LOCUS_09540 148931 150418 gene locus_tag LOCUS_09550 gene ramB 148931 150418 CDS product HTH-type transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMI1 protein_id gnl|my_center|LOCUS_09550 150544 150750 gene locus_tag LOCUS_09560 150544 150750 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_09560 150852 151295 gene locus_tag LOCUS_09570 150852 151295 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_09570 154527 151330 gene locus_tag LOCUS_09580 154527 151330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203078.1 protein_id gnl|my_center|LOCUS_09580 155339 154833 gene locus_tag LOCUS_09590 155339 154833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence07 2416 1433 gene locus_tag LOCUS_09600 2416 1433 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_09600 3552 2419 gene locus_tag LOCUS_09610 3552 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4220 3624 gene locus_tag LOCUS_09620 4220 3624 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_09620 4619 5371 gene locus_tag LOCUS_09630 4619 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6293 5436 gene locus_tag LOCUS_09640 6293 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7903 6290 gene locus_tag LOCUS_09650 7903 6290 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606001.1 protein_id gnl|my_center|LOCUS_09650 9148 7919 gene locus_tag LOCUS_09660 9148 7919 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073176.1 protein_id gnl|my_center|LOCUS_09660 9390 10034 gene locus_tag LOCUS_09670 9390 10034 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 protein_id gnl|my_center|LOCUS_09670 10097 10717 gene locus_tag LOCUS_09680 10097 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_09680 10800 11438 gene locus_tag LOCUS_09690 10800 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11473 12129 gene locus_tag LOCUS_09700 11473 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 12397 15714 gene locus_tag LOCUS_09710 12397 15714 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_09710 15727 17223 gene locus_tag LOCUS_09720 15727 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_09720 17346 17771 gene locus_tag LOCUS_09730 17346 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 19191 17791 gene locus_tag LOCUS_09740 19191 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 19723 19175 gene locus_tag LOCUS_09750 19723 19175 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_09750 19845 21092 gene locus_tag LOCUS_09760 19845 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 21849 21070 gene locus_tag LOCUS_09770 21849 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 23008 21911 gene locus_tag LOCUS_09780 gene ychF 23008 21911 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_09780 23836 23021 gene locus_tag LOCUS_09790 23836 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 24691 24194 gene locus_tag LOCUS_09800 24691 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 26913 24688 gene locus_tag LOCUS_09810 26913 24688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 28765 26996 gene locus_tag LOCUS_09820 28765 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 29766 28780 gene locus_tag LOCUS_09830 29766 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 31113 29779 gene locus_tag LOCUS_09840 31113 29779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_09840 34079 31128 gene locus_tag LOCUS_09850 34079 31128 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_09850 35612 34923 gene locus_tag LOCUS_09860 35612 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 36524 35682 gene locus_tag LOCUS_09870 36524 35682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 37909 36527 gene locus_tag LOCUS_09880 37909 36527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_09880 41105 37923 gene locus_tag LOCUS_09890 41105 37923 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_09890 43220 41364 gene locus_tag LOCUS_09900 43220 41364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 43973 43392 gene locus_tag LOCUS_09910 gene queE 43973 43392 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_09910 44892 43996 gene locus_tag LOCUS_09920 gene folD 44892 43996 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_09920 46722 44932 gene locus_tag LOCUS_09930 gene lepA 46722 44932 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_09930 47491 48987 gene locus_tag LOCUS_09940 47491 48987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_09940 49011 50168 gene locus_tag LOCUS_09950 gene dxr 49011 50168 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_09950 50168 51484 gene locus_tag LOCUS_09960 50168 51484 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_09960 51486 52103 gene locus_tag LOCUS_09970 51486 52103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_09970 52489 54906 gene locus_tag LOCUS_09980 gene pheT 52489 54906 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_09980 54908 55204 gene locus_tag LOCUS_09990 54908 55204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 55219 55503 gene locus_tag LOCUS_10000 55219 55503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 55663 57225 gene locus_tag LOCUS_10010 gene rny 55663 57225 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_10010 58618 57341 gene locus_tag LOCUS_10020 58618 57341 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_10020 59547 58615 gene locus_tag LOCUS_10030 gene thrB 59547 58615 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_10030 62311 59855 gene locus_tag LOCUS_10040 gene thrA 62311 59855 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_10040 63371 62949 gene locus_tag LOCUS_10050 63371 62949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 70972 63377 gene locus_tag LOCUS_10060 70972 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 71682 70993 gene locus_tag LOCUS_10070 71682 70993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 72513 75623 gene locus_tag LOCUS_10080 72513 75623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10080 75752 77191 gene locus_tag LOCUS_10090 75752 77191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 77293 78357 gene locus_tag LOCUS_10100 77293 78357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 80274 78589 gene locus_tag LOCUS_10110 80274 78589 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_10110 80387 81673 gene locus_tag LOCUS_10120 80387 81673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 81784 82005 gene locus_tag LOCUS_10130 81784 82005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_10130 82797 82129 gene locus_tag LOCUS_10140 gene ispD 82797 82129 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U8 protein_id gnl|my_center|LOCUS_10140 84902 82878 gene locus_tag LOCUS_10150 84902 82878 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_10150 85285 85896 gene locus_tag LOCUS_10160 gene engB 85285 85896 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_10160 86878 85898 gene locus_tag LOCUS_10170 gene fbp 86878 85898 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_10170 86877 88214 gene locus_tag LOCUS_10180 gene lysC 86877 88214 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_10180 90129 88546 gene locus_tag LOCUS_10190 gene prfC 90129 88546 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WR5 protein_id gnl|my_center|LOCUS_10190 91162 90269 gene locus_tag LOCUS_10200 91162 90269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 91848 91195 gene locus_tag LOCUS_10210 91848 91195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 94526 92145 gene locus_tag LOCUS_10220 94526 92145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_10220 95276 94794 gene locus_tag LOCUS_10230 95276 94794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 95526 95957 gene locus_tag LOCUS_10240 95526 95957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 96678 95995 gene locus_tag LOCUS_10250 96678 95995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 97853 96771 gene locus_tag LOCUS_10260 gene rlmN 97853 96771 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_10260 98588 97932 gene locus_tag LOCUS_10270 98588 97932 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_10270 98800 99018 gene locus_tag LOCUS_10280 98800 99018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 99734 99066 gene locus_tag LOCUS_10290 99734 99066 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_10290 100554 99889 gene locus_tag LOCUS_10300 100554 99889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 101957 100620 gene locus_tag LOCUS_10310 gene kmo 101957 100620 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_10310 103275 101965 gene locus_tag LOCUS_10320 gene kynU 103275 101965 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_10320 103825 103343 gene locus_tag LOCUS_10330 103825 103343 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N93 protein_id gnl|my_center|LOCUS_10330 104861 103812 gene locus_tag LOCUS_10340 104861 103812 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_10340 105391 104861 gene locus_tag LOCUS_10350 gene haaO 105391 104861 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_10350 105537 106319 gene locus_tag LOCUS_10360 105537 106319 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_10360 106321 107760 gene locus_tag LOCUS_10370 106321 107760 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 protein_id gnl|my_center|LOCUS_10370 108596 107832 gene locus_tag LOCUS_10380 108596 107832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 109013 109960 gene locus_tag LOCUS_10390 109013 109960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 110526 110026 gene locus_tag LOCUS_10400 gene tpx 110526 110026 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_10400 110607 111152 gene locus_tag LOCUS_10410 110607 111152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 protein_id gnl|my_center|LOCUS_10410 112821 111313 gene locus_tag LOCUS_10420 112821 111313 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_10420 113431 112988 gene locus_tag LOCUS_10430 113431 112988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 114162 113428 gene locus_tag LOCUS_10440 114162 113428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_10440 115342 114185 gene locus_tag LOCUS_10450 gene fjo29 115342 114185 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_10450 115884 115411 gene locus_tag LOCUS_10460 115884 115411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 116077 115877 gene locus_tag LOCUS_10470 116077 115877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 116790 116110 gene locus_tag LOCUS_10480 116790 116110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_10480 117296 116793 gene locus_tag LOCUS_10490 gene ispF 117296 116793 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_10490 118531 117293 gene locus_tag LOCUS_10500 118531 117293 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_10500 118702 120681 gene locus_tag LOCUS_10510 gene bfmBA 118702 120681 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_10510 120807 122288 gene locus_tag LOCUS_10520 120807 122288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 122301 122642 gene locus_tag LOCUS_10530 gene ytxJ 122301 122642 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_10530 123055 122651 gene locus_tag LOCUS_10540 123055 122651 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_10540 123161 123838 gene locus_tag LOCUS_10550 123161 123838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 123864 124751 gene locus_tag LOCUS_10560 gene lipA 123864 124751 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_10560 124944 126461 gene locus_tag LOCUS_10570 124944 126461 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_10570 126466 126726 gene locus_tag LOCUS_10580 126466 126726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 126862 127878 gene locus_tag LOCUS_10590 gene ltaE 126862 127878 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_10590 127899 128429 gene locus_tag LOCUS_10600 gene apt 127899 128429 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_10600 128544 129527 gene locus_tag LOCUS_10610 128544 129527 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_10610 129891 131093 gene locus_tag LOCUS_10620 129891 131093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 131186 134170 gene locus_tag LOCUS_10630 131186 134170 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_10630 135179 134298 gene locus_tag LOCUS_10640 135179 134298 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_10640 136345 135455 gene locus_tag LOCUS_10650 136345 135455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 136435 136980 gene locus_tag LOCUS_10660 gene ppa 136435 136980 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_10660 137386 137066 gene locus_tag LOCUS_10670 137386 137066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 138135 137464 gene locus_tag LOCUS_10680 138135 137464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 139103 138315 gene locus_tag LOCUS_10690 139103 138315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 139432 139211 gene locus_tag LOCUS_10700 139432 139211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 139662 140462 gene locus_tag LOCUS_10710 139662 140462 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_10710 140863 142164 gene locus_tag LOCUS_10720 140863 142164 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_10720 142773 142249 gene locus_tag LOCUS_10730 142773 142249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 144184 142928 gene locus_tag LOCUS_10740 gene metK 144184 142928 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_10740 144977 144267 gene locus_tag LOCUS_10750 144977 144267 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_10750 146163 145021 gene locus_tag LOCUS_10760 gene corA 146163 145021 CDS product cobalt/magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ31 protein_id gnl|my_center|LOCUS_10760 147757 146156 gene locus_tag LOCUS_10770 147757 146156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 148011 149285 gene locus_tag LOCUS_10780 gene serS 148011 149285 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence08 683 291 gene locus_tag LOCUS_10790 gene cumB 683 291 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHC4 protein_id gnl|my_center|LOCUS_10790 789 2258 gene locus_tag LOCUS_10800 789 2258 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_10800 2321 3310 gene locus_tag LOCUS_10810 2321 3310 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_10810 3338 4279 gene locus_tag LOCUS_10820 3338 4279 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_10820 4667 4413 gene locus_tag LOCUS_10830 4667 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4987 4739 gene locus_tag LOCUS_10840 4987 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5436 4996 gene locus_tag LOCUS_10850 5436 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6233 5523 gene locus_tag LOCUS_10860 6233 5523 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_10860 7143 6445 gene locus_tag LOCUS_10870 gene folE2 7143 6445 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_10870 7531 7121 gene locus_tag LOCUS_10880 gene ygcM 7531 7121 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_10880 7725 8249 gene locus_tag LOCUS_10890 7725 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9065 8331 gene locus_tag LOCUS_10900 9065 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 9296 10129 gene locus_tag LOCUS_10910 9296 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_10910 10225 11613 gene locus_tag LOCUS_10920 10225 11613 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_10920 13032 11881 gene locus_tag LOCUS_10930 13032 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 13114 13500 gene locus_tag LOCUS_10940 13114 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_10940 13502 14470 gene locus_tag LOCUS_10950 gene trpS 13502 14470 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_10950 14556 14834 gene locus_tag LOCUS_10960 14556 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 14831 15208 gene locus_tag LOCUS_10970 14831 15208 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846680.1 protein_id gnl|my_center|LOCUS_10970 15272 17518 gene locus_tag LOCUS_10980 15272 17518 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_10980 19052 17574 gene locus_tag LOCUS_10990 19052 17574 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_10990 19334 20533 gene locus_tag LOCUS_11000 19334 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 20754 22748 gene locus_tag LOCUS_11010 20754 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 22742 23899 gene locus_tag LOCUS_11020 gene alr 22742 23899 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_11020 23919 24686 gene locus_tag LOCUS_11030 23919 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 24769 25032 gene locus_tag LOCUS_11040 24769 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 26518 25154 gene locus_tag LOCUS_11050 26518 25154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 26895 26524 gene locus_tag LOCUS_11060 26895 26524 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_11060 27107 26892 gene locus_tag LOCUS_11070 27107 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 29497 27176 gene locus_tag LOCUS_11080 29497 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 29909 29532 gene locus_tag LOCUS_11090 29909 29532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 31150 29906 gene locus_tag LOCUS_11100 gene erg3 31150 29906 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_11100 31283 31744 gene locus_tag LOCUS_11110 31283 31744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 31969 33828 gene locus_tag LOCUS_11120 gene parE 31969 33828 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_11120 33935 36538 gene locus_tag LOCUS_11130 gene parC 33935 36538 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_11130 36544 37236 gene locus_tag LOCUS_11140 gene trmH 36544 37236 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51081 protein_id gnl|my_center|LOCUS_11140 37236 37874 gene locus_tag LOCUS_11150 37236 37874 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_11150 40410 37933 gene locus_tag LOCUS_11160 40410 37933 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_11160 41883 40534 gene locus_tag LOCUS_11170 41883 40534 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_11170 42339 41926 gene locus_tag LOCUS_11180 42339 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 42493 43335 gene locus_tag LOCUS_11190 42493 43335 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 protein_id gnl|my_center|LOCUS_11190 43685 43284 gene locus_tag LOCUS_11200 43685 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 44055 43657 gene locus_tag LOCUS_11210 44055 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 44197 44784 gene locus_tag LOCUS_11220 44197 44784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 44864 45787 gene locus_tag LOCUS_11230 44864 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 45784 46908 gene locus_tag LOCUS_11240 45784 46908 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_11240 46889 47143 gene locus_tag LOCUS_11250 46889 47143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 47163 47495 gene locus_tag LOCUS_11260 47163 47495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_11260 47928 47503 gene locus_tag LOCUS_11270 47928 47503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 50451 48007 gene locus_tag LOCUS_11280 50451 48007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_11280 50624 51856 gene locus_tag LOCUS_11290 50624 51856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 51849 52487 gene locus_tag LOCUS_11300 51849 52487 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_11300 52484 53593 gene locus_tag LOCUS_11310 52484 53593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 53590 54348 gene locus_tag LOCUS_11320 gene tatD 53590 54348 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_11320 54349 55416 gene locus_tag LOCUS_11330 gene ansA 54349 55416 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_11330 55608 55695 gene locus_tag LOCUS_t00070 55608 55695 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55870 56721 gene locus_tag LOCUS_11340 55870 56721 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_11340 56746 57069 gene locus_tag LOCUS_11350 56746 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 57069 57644 gene locus_tag LOCUS_11360 57069 57644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 57648 58130 gene locus_tag LOCUS_11370 57648 58130 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_11370 58256 59518 gene locus_tag LOCUS_11380 58256 59518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_11380 61001 59529 gene locus_tag LOCUS_11390 61001 59529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 61350 64373 gene locus_tag LOCUS_11400 61350 64373 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_11400 64380 65681 gene locus_tag LOCUS_11410 64380 65681 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_11410 66298 67389 gene locus_tag LOCUS_11420 66298 67389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 67911 68363 gene locus_tag LOCUS_11430 67911 68363 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_11430 69923 68568 gene locus_tag LOCUS_11440 gene gabD 69923 68568 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123021.1 protein_id gnl|my_center|LOCUS_11440 70706 69951 gene locus_tag LOCUS_11450 70706 69951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 71017 70703 gene locus_tag LOCUS_11460 71017 70703 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_11460 71989 72720 gene locus_tag LOCUS_11470 71989 72720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 72727 75156 gene locus_tag LOCUS_11480 gene wzc 72727 75156 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_11480 75652 76839 gene locus_tag LOCUS_11490 75652 76839 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228406.1 protein_id gnl|my_center|LOCUS_11490 77942 78469 gene locus_tag LOCUS_11500 77942 78469 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_11500 79158 79403 gene locus_tag LOCUS_11510 79158 79403 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_11510 79394 79717 gene locus_tag LOCUS_11520 79394 79717 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_11520 80047 80256 gene locus_tag LOCUS_11530 80047 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 80263 80688 gene locus_tag LOCUS_11540 80263 80688 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_11540 81515 81733 gene locus_tag LOCUS_11550 81515 81733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 81755 82039 gene locus_tag LOCUS_11560 81755 82039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 82036 82272 gene locus_tag LOCUS_11570 82036 82272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 82495 83154 gene locus_tag LOCUS_11580 82495 83154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11580 83155 83358 gene locus_tag LOCUS_11590 83155 83358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11590 84152 85183 gene locus_tag LOCUS_11600 84152 85183 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402973.1 protein_id gnl|my_center|LOCUS_11600 85655 86728 gene locus_tag LOCUS_11610 85655 86728 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_11610 86839 87849 gene locus_tag LOCUS_11620 gene rkpL 86839 87849 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887050.1 protein_id gnl|my_center|LOCUS_11620 87846 89030 gene locus_tag LOCUS_11630 87846 89030 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_11630 89027 89710 gene locus_tag LOCUS_11640 gene rkpN 89027 89710 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 protein_id gnl|my_center|LOCUS_11640 89697 90269 gene locus_tag LOCUS_11650 89697 90269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 90266 90850 gene locus_tag LOCUS_11660 90266 90850 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_11660 90822 91847 gene locus_tag LOCUS_11670 gene spsE 90822 91847 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_11670 92034 92888 gene locus_tag LOCUS_11680 92034 92888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 92939 94363 gene locus_tag LOCUS_11690 92939 94363 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107921.1 protein_id gnl|my_center|LOCUS_11690 94684 95799 gene locus_tag LOCUS_11700 94684 95799 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462240.1 protein_id gnl|my_center|LOCUS_11700 95800 97305 gene locus_tag LOCUS_11710 95800 97305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 97311 98483 gene locus_tag LOCUS_11720 97311 98483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 98476 99351 gene locus_tag LOCUS_11730 98476 99351 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597670.1 protein_id gnl|my_center|LOCUS_11730 99476 100417 gene locus_tag LOCUS_11740 99476 100417 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_11740 100414 101496 gene locus_tag LOCUS_11750 100414 101496 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706686.1 protein_id gnl|my_center|LOCUS_11750 101493 102551 gene locus_tag LOCUS_11760 101493 102551 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_11760 102554 103756 gene locus_tag LOCUS_11770 102554 103756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 103867 104934 gene locus_tag LOCUS_11780 gene wbtD 103867 104934 CDS product galacturonosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014978.1 protein_id gnl|my_center|LOCUS_11780 105227 108157 gene locus_tag LOCUS_11790 105227 108157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 108154 109260 gene locus_tag LOCUS_11800 108154 109260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 109902 109342 gene locus_tag LOCUS_11810 gene pth 109902 109342 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_11810 111316 110594 gene locus_tag LOCUS_11820 111316 110594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_11820 112037 111306 gene locus_tag LOCUS_11830 112037 111306 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_11830 112817 112185 gene locus_tag LOCUS_11840 gene rplY 112817 112185 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_11840 113777 112851 gene locus_tag LOCUS_11850 gene prsA 113777 112851 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_11850 113912 113839 gene locus_tag LOCUS_t00080 113912 113839 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 117834 114136 gene locus_tag LOCUS_11860 gene purL 117834 114136 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_11860 118025 119137 gene locus_tag LOCUS_11870 118025 119137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 119130 119861 gene locus_tag LOCUS_11880 119130 119861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 120714 119902 gene locus_tag LOCUS_11890 120714 119902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 120934 121548 gene locus_tag LOCUS_11900 120934 121548 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_11900 121541 122899 gene locus_tag LOCUS_11910 121541 122899 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_11910 122910 124064 gene locus_tag LOCUS_11920 122910 124064 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_11920 124083 127487 gene locus_tag LOCUS_11930 124083 127487 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_11930 127797 128816 gene locus_tag LOCUS_11940 127797 128816 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_11940 129240 129650 gene locus_tag LOCUS_11950 129240 129650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 129655 129861 gene locus_tag LOCUS_11960 129655 129861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_11960 130031 133774 gene locus_tag LOCUS_11970 130031 133774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 133803 141773 gene locus_tag LOCUS_11980 133803 141773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 141780 142202 gene locus_tag LOCUS_11990 141780 142202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 142208 142594 gene locus_tag LOCUS_12000 142208 142594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence09 314 240 gene locus_tag LOCUS_t00090 314 240 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 554 1021 gene locus_tag LOCUS_12010 554 1021 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_12010 1142 2620 gene locus_tag LOCUS_12020 1142 2620 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_12020 2814 4364 gene locus_tag LOCUS_12030 gene pcd 2814 4364 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_12030 4493 4879 gene locus_tag LOCUS_12040 4493 4879 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_12040 6392 4950 gene locus_tag LOCUS_12050 6392 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6751 9099 gene locus_tag LOCUS_12060 6751 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9143 10291 gene locus_tag LOCUS_12070 9143 10291 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_12070 10387 10860 gene locus_tag LOCUS_12080 gene recX 10387 10860 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_12080 11949 10933 gene locus_tag LOCUS_12090 11949 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 13626 12334 gene locus_tag LOCUS_12100 gene cysN 13626 12334 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_12100 14586 13681 gene locus_tag LOCUS_12110 gene cysD 14586 13681 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_12110 15234 14644 gene locus_tag LOCUS_12120 gene cysC 15234 14644 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_12120 15418 16185 gene locus_tag LOCUS_12130 gene cysQ 15418 16185 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_12130 16549 16322 gene locus_tag LOCUS_12140 16549 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12140 16829 16617 gene locus_tag LOCUS_12150 16829 16617 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 protein_id gnl|my_center|LOCUS_12150 17318 16833 gene locus_tag LOCUS_12160 17318 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 17997 17410 gene locus_tag LOCUS_12170 17997 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 19358 18087 gene locus_tag LOCUS_12180 19358 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 19940 19428 gene locus_tag LOCUS_12190 19940 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 20548 21477 gene locus_tag LOCUS_12200 gene natA 20548 21477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_12200 21496 22821 gene locus_tag LOCUS_12210 gene natB 21496 22821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_12210 23020 24033 gene locus_tag LOCUS_12220 23020 24033 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12220 24379 24041 gene locus_tag LOCUS_12230 24379 24041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 27170 24705 gene locus_tag LOCUS_12240 gene mur/alr 27170 24705 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_12240 27916 27311 gene locus_tag LOCUS_12250 27916 27311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 29436 28036 gene locus_tag LOCUS_12260 gene fumC 29436 28036 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_12260 30098 31198 gene locus_tag LOCUS_12270 30098 31198 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_12270 31205 32320 gene locus_tag LOCUS_12280 gene irpA 31205 32320 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_12280 32307 33644 gene locus_tag LOCUS_12290 32307 33644 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_12290 33641 36073 gene locus_tag LOCUS_12300 gene fecA 33641 36073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_12300 37269 36070 gene locus_tag LOCUS_12310 37269 36070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 38508 37408 gene locus_tag LOCUS_12320 38508 37408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 39052 38753 gene locus_tag LOCUS_12330 39052 38753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_12330 39958 39077 gene locus_tag LOCUS_12340 gene xerC 39958 39077 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_12340 40230 40039 gene locus_tag LOCUS_12350 gene rpsU 40230 40039 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_12350 41582 40440 gene locus_tag LOCUS_12360 41582 40440 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_12360 42183 41713 gene locus_tag LOCUS_12370 42183 41713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 43614 42229 gene locus_tag LOCUS_12380 43614 42229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_12380 44668 43598 gene locus_tag LOCUS_12390 gene prfA 44668 43598 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_12390 44925 45443 gene locus_tag LOCUS_12400 44925 45443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 45540 47459 gene locus_tag LOCUS_12410 45540 47459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 47461 48120 gene locus_tag LOCUS_12420 47461 48120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 48544 48131 gene locus_tag LOCUS_12430 48544 48131 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_12430 49821 48604 gene locus_tag LOCUS_12440 49821 48604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 49956 50909 gene locus_tag LOCUS_12450 49956 50909 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_12450 51030 51608 gene locus_tag LOCUS_12460 51030 51608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 51605 52054 gene locus_tag LOCUS_12470 51605 52054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 52015 53019 gene locus_tag LOCUS_12480 52015 53019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_12480 54376 53021 gene locus_tag LOCUS_12490 gene dgt 54376 53021 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_12490 55196 54648 gene locus_tag LOCUS_12500 55196 54648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 55956 55099 gene locus_tag LOCUS_12510 55956 55099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 57001 55976 gene locus_tag LOCUS_12520 gene pheS 57001 55976 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_12520 57954 57364 gene locus_tag LOCUS_12530 57954 57364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 58116 58661 gene locus_tag LOCUS_12540 58116 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 58672 59037 gene locus_tag LOCUS_12550 58672 59037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 59398 60255 gene locus_tag LOCUS_12560 59398 60255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 60842 60285 gene locus_tag LOCUS_12570 60842 60285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 61045 61395 gene locus_tag LOCUS_12580 61045 61395 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_12580 61388 61741 gene locus_tag LOCUS_12590 61388 61741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_12590 61765 62532 gene locus_tag LOCUS_12600 61765 62532 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_12600 62584 65970 gene locus_tag LOCUS_12610 62584 65970 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_12610 65967 66368 gene locus_tag LOCUS_12620 gene spoIIAB 65967 66368 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_12620 66368 66796 gene locus_tag LOCUS_12630 gene ybeY 66368 66796 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_12630 66888 68753 gene locus_tag LOCUS_12640 gene mnmG 66888 68753 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_12640 68859 69641 gene locus_tag LOCUS_12650 68859 69641 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_12650 69638 71536 gene locus_tag LOCUS_12660 69638 71536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 71890 73701 gene locus_tag LOCUS_12670 71890 73701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_12670 75336 73708 gene locus_tag LOCUS_12680 gene cstA 75336 73708 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_12680 75448 76920 gene locus_tag LOCUS_12690 gene guaB 75448 76920 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_12690 77243 78352 gene locus_tag LOCUS_12700 77243 78352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 78410 78676 gene locus_tag LOCUS_12710 78410 78676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 78745 79074 gene locus_tag LOCUS_12720 gene vapC 78745 79074 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_12720 79230 81272 gene locus_tag LOCUS_12730 gene dcp1 79230 81272 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_12730 81504 82196 gene locus_tag LOCUS_12740 81504 82196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 83562 82384 gene locus_tag LOCUS_12750 83562 82384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12750 83976 83581 gene locus_tag LOCUS_12760 83976 83581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12760 84494 85789 gene locus_tag LOCUS_12770 84494 85789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 86936 86328 gene locus_tag LOCUS_12780 gene purN 86936 86328 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV6 protein_id gnl|my_center|LOCUS_12780 87553 87080 gene locus_tag LOCUS_12790 87553 87080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 88499 87639 gene locus_tag LOCUS_12800 88499 87639 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_12800 89635 89081 gene locus_tag LOCUS_12810 89635 89081 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_12810 89683 92286 gene locus_tag LOCUS_12820 gene mutS 89683 92286 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_12820 92453 94303 gene locus_tag LOCUS_12830 92453 94303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 95676 94492 gene locus_tag LOCUS_12840 95676 94492 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_12840 95864 96109 gene locus_tag LOCUS_12850 95864 96109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 96106 96405 gene locus_tag LOCUS_12860 96106 96405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 96531 101471 gene locus_tag LOCUS_12870 96531 101471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 101546 103777 gene locus_tag LOCUS_12880 101546 103777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_12880 103967 104941 gene locus_tag LOCUS_12890 103967 104941 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_12890 105840 105220 gene locus_tag LOCUS_12900 105840 105220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 107916 105925 gene locus_tag LOCUS_12910 gene tetP/tetQ 107916 105925 CDS product tetracycline resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_12910 108795 108028 gene locus_tag LOCUS_12920 108795 108028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 109525 108833 gene locus_tag LOCUS_12930 109525 108833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203322.1 protein_id gnl|my_center|LOCUS_12930 110044 109580 gene locus_tag LOCUS_12940 110044 109580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 110892 110044 gene locus_tag LOCUS_12950 110892 110044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 111456 110992 gene locus_tag LOCUS_12960 111456 110992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 112019 111453 gene locus_tag LOCUS_12970 112019 111453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 112918 112070 gene locus_tag LOCUS_12980 112918 112070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 113110 112922 gene locus_tag LOCUS_12990 113110 112922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 114344 113448 gene locus_tag LOCUS_13000 114344 113448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 115447 114569 gene locus_tag LOCUS_13010 115447 114569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 116030 115476 gene locus_tag LOCUS_13020 116030 115476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 116373 116035 gene locus_tag LOCUS_13030 116373 116035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 117014 116802 gene locus_tag LOCUS_13040 117014 116802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_13040 117718 117092 gene locus_tag LOCUS_13050 117718 117092 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_13050 118963 118145 gene locus_tag LOCUS_13060 118963 118145 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_13060 119920 119036 gene locus_tag LOCUS_13070 119920 119036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_13070 121036 120071 gene locus_tag LOCUS_13080 121036 120071 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_13080 121336 121539 gene locus_tag LOCUS_13090 121336 121539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_13090 122176 121589 gene locus_tag LOCUS_13100 122176 121589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 122702 122343 gene locus_tag LOCUS_13110 122702 122343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 123200 123907 gene locus_tag LOCUS_13120 123200 123907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 123904 124581 gene locus_tag LOCUS_13130 123904 124581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_13130 126346 124661 gene locus_tag LOCUS_13140 gene fhs 126346 124661 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 protein_id gnl|my_center|LOCUS_13140 127462 126386 gene locus_tag LOCUS_13150 127462 126386 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_13150 127576 128394 gene locus_tag LOCUS_13160 127576 128394 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_13160 128969 130078 gene locus_tag LOCUS_13170 128969 130078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_13170 131232 130075 gene locus_tag LOCUS_13180 131232 130075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 131384 132112 gene locus_tag LOCUS_13190 131384 132112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_13190 132752 132189 gene locus_tag LOCUS_13200 132752 132189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_13200 132932 133960 gene locus_tag LOCUS_13210 132932 133960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 133980 134165 gene locus_tag LOCUS_13220 133980 134165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 134294 135754 gene locus_tag LOCUS_13230 134294 135754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 135751 136551 gene locus_tag LOCUS_13240 135751 136551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 136556 137299 gene locus_tag LOCUS_13250 136556 137299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 137416 138348 gene locus_tag LOCUS_13260 137416 138348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 138423 138496 gene locus_tag LOCUS_t00100 138423 138496 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 138559 138643 gene locus_tag LOCUS_t00110 138559 138643 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 1193 1591 gene locus_tag LOCUS_13270 1193 1591 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_13270 1624 2112 gene locus_tag LOCUS_13280 1624 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_13280 2288 3430 gene locus_tag LOCUS_13290 2288 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3913 3518 gene locus_tag LOCUS_13300 3913 3518 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_13300 4438 3965 gene locus_tag LOCUS_13310 gene greA 4438 3965 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_13310 5413 4571 gene locus_tag LOCUS_13320 5413 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6426 5488 gene locus_tag LOCUS_13330 6426 5488 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_13330 7911 6535 gene locus_tag LOCUS_13340 gene mgtE 7911 6535 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_13340 8680 7898 gene locus_tag LOCUS_13350 gene rsmA 8680 7898 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_13350 8767 9777 gene locus_tag LOCUS_13360 gene pdxA 8767 9777 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_13360 9834 10364 gene locus_tag LOCUS_13370 9834 10364 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_13370 10385 10576 gene locus_tag LOCUS_13380 gene rpmF 10385 10576 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_13380 10809 11807 gene locus_tag LOCUS_13390 gene fabH3 10809 11807 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_13390 11838 12404 gene locus_tag LOCUS_13400 gene efp 11838 12404 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_13400 12447 12932 gene locus_tag LOCUS_13410 gene accB 12447 12932 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_13410 12985 14340 gene locus_tag LOCUS_13420 gene accC 12985 14340 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_13420 14357 15040 gene locus_tag LOCUS_13430 14357 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 15030 15515 gene locus_tag LOCUS_13440 15030 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764401.1 protein_id gnl|my_center|LOCUS_13440 16404 15517 gene locus_tag LOCUS_13450 gene ppx 16404 15517 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13450 16565 17509 gene locus_tag LOCUS_13460 16565 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 18067 18651 gene locus_tag LOCUS_13470 gene hisH 18067 18651 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_13470 18656 19372 gene locus_tag LOCUS_13480 gene hisA 18656 19372 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_13480 19374 20129 gene locus_tag LOCUS_13490 gene hisF 19374 20129 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_13490 20155 20751 gene locus_tag LOCUS_13500 gene hisIE 20155 20751 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_13500 20771 21193 gene locus_tag LOCUS_13510 20771 21193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 21229 21618 gene locus_tag LOCUS_13520 21229 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 22292 21615 gene locus_tag LOCUS_13530 22292 21615 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_13530 23032 22292 gene locus_tag LOCUS_13540 gene kdsB 23032 22292 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_13540 24385 23039 gene locus_tag LOCUS_13550 gene yqeZ 24385 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_13550 24840 26303 gene locus_tag LOCUS_13560 24840 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 26306 27088 gene locus_tag LOCUS_13570 26306 27088 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_13570 28360 27089 gene locus_tag LOCUS_13580 gene xseA 28360 27089 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_13580 28536 28360 gene locus_tag LOCUS_13590 28536 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 29459 28536 gene locus_tag LOCUS_13600 29459 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 29880 29533 gene locus_tag LOCUS_13610 29880 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 30009 32849 gene locus_tag LOCUS_13620 30009 32849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_13620 33216 33842 gene locus_tag LOCUS_13630 33216 33842 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_13630 34075 34719 gene locus_tag LOCUS_13640 34075 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787535.1 protein_id gnl|my_center|LOCUS_13640 34819 36153 gene locus_tag LOCUS_13650 34819 36153 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_13650 37577 36264 gene locus_tag LOCUS_13660 gene dbpA 37577 36264 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_13660 37708 38850 gene locus_tag LOCUS_13670 37708 38850 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_13670 38921 39154 gene locus_tag LOCUS_13680 38921 39154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 39231 40169 gene locus_tag LOCUS_13690 39231 40169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 41005 40232 gene locus_tag LOCUS_13700 41005 40232 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_13700 41384 41064 gene locus_tag LOCUS_13710 41384 41064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_13710 41608 41381 gene locus_tag LOCUS_13720 41608 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 42064 41687 gene locus_tag LOCUS_13730 42064 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_13730 42970 42422 gene locus_tag LOCUS_13740 gene ruvC 42970 42422 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_13740 46082 43275 gene locus_tag LOCUS_13750 gene polA 46082 43275 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_13750 46328 47128 gene locus_tag LOCUS_13760 gene pip 46328 47128 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMT1 protein_id gnl|my_center|LOCUS_13760 47182 48156 gene locus_tag LOCUS_13770 47182 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 48201 48503 gene locus_tag LOCUS_13780 48201 48503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 48567 49379 gene locus_tag LOCUS_13790 48567 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 50300 49455 gene locus_tag LOCUS_13800 gene uspA 50300 49455 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_13800 51279 50383 gene locus_tag LOCUS_13810 gene menA 51279 50383 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T22 protein_id gnl|my_center|LOCUS_13810 51728 51282 gene locus_tag LOCUS_13820 gene bsaA 51728 51282 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IS0 protein_id gnl|my_center|LOCUS_13820 53872 52082 gene locus_tag LOCUS_13830 gene argS 53872 52082 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_13830 54853 53909 gene locus_tag LOCUS_13840 54853 53909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_13840 55805 54888 gene locus_tag LOCUS_13850 55805 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_13850 55926 57314 gene locus_tag LOCUS_13860 gene speA 55926 57314 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_13860 58525 57317 gene locus_tag LOCUS_13870 58525 57317 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_13870 59482 58604 gene locus_tag LOCUS_13880 gene fabD 59482 58604 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_13880 60070 59666 gene locus_tag LOCUS_13890 gene yuxK 60070 59666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_13890 62833 60071 gene locus_tag LOCUS_13900 62833 60071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 63133 63753 gene locus_tag LOCUS_13910 63133 63753 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_13910 63770 65704 gene locus_tag LOCUS_13920 gene sdhA 63770 65704 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_13920 65732 66481 gene locus_tag LOCUS_13930 gene sdhB 65732 66481 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_13930 67609 70497 gene locus_tag LOCUS_13940 67609 70497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 70472 71692 gene locus_tag LOCUS_13950 70472 71692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 71747 71962 gene locus_tag LOCUS_13960 71747 71962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 71949 72809 gene locus_tag LOCUS_13970 71949 72809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 73061 73978 gene locus_tag LOCUS_13980 73061 73978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 74710 76311 gene locus_tag LOCUS_13990 gene putP 74710 76311 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_13990 76315 76752 gene locus_tag LOCUS_14000 76315 76752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 76755 77825 gene locus_tag LOCUS_14010 76755 77825 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_14010 77925 79073 gene locus_tag LOCUS_14020 gene celE 77925 79073 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_14020 79172 80359 gene locus_tag LOCUS_14030 gene alr 79172 80359 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_14030 80419 81117 gene locus_tag LOCUS_14040 80419 81117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 81098 81523 gene locus_tag LOCUS_14050 81098 81523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 81507 82364 gene locus_tag LOCUS_14060 81507 82364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 82291 83145 gene locus_tag LOCUS_14070 82291 83145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 83583 83176 gene locus_tag LOCUS_14080 83583 83176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 83898 84344 gene locus_tag LOCUS_14090 83898 84344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 84450 85082 gene locus_tag LOCUS_14100 84450 85082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 85099 85464 gene locus_tag LOCUS_14110 85099 85464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 85461 86285 gene locus_tag LOCUS_14120 85461 86285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 86332 87096 gene locus_tag LOCUS_14130 86332 87096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 87126 88196 gene locus_tag LOCUS_14140 87126 88196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 88912 88184 gene locus_tag LOCUS_14150 88912 88184 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_14150 89384 90706 gene locus_tag LOCUS_14160 89384 90706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 90712 91059 gene locus_tag LOCUS_14170 90712 91059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 91334 93469 gene locus_tag LOCUS_14180 91334 93469 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_14180 93689 94261 gene locus_tag LOCUS_14190 93689 94261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 94362 94811 gene locus_tag LOCUS_14200 94362 94811 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_14200 95053 94862 gene locus_tag LOCUS_14210 95053 94862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 95257 95730 gene locus_tag LOCUS_14220 95257 95730 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_14220 95825 96544 gene locus_tag LOCUS_14230 95825 96544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 96753 97448 gene locus_tag LOCUS_14240 96753 97448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 98111 97452 gene locus_tag LOCUS_14250 98111 97452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 100090 98183 gene locus_tag LOCUS_14260 100090 98183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 100370 101128 gene locus_tag LOCUS_14270 100370 101128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 103289 101229 gene locus_tag LOCUS_14280 103289 101229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 104606 103317 gene locus_tag LOCUS_14290 104606 103317 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_14290 105987 104983 gene locus_tag LOCUS_14300 105987 104983 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 protein_id gnl|my_center|LOCUS_14300 107030 106167 gene locus_tag LOCUS_14310 gene glpQ 107030 106167 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_14310 107149 108546 gene locus_tag LOCUS_14320 107149 108546 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868530.1 protein_id gnl|my_center|LOCUS_14320 108824 109012 gene locus_tag LOCUS_14330 108824 109012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 109284 110420 gene locus_tag LOCUS_14340 109284 110420 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405054.1 protein_id gnl|my_center|LOCUS_14340 110783 111229 gene locus_tag LOCUS_14350 gene mraZ 110783 111229 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55343 protein_id gnl|my_center|LOCUS_14350 111235 112140 gene locus_tag LOCUS_14360 gene rsmH 111235 112140 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_14360 112137 112520 gene locus_tag LOCUS_14370 112137 112520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 112531 114606 gene locus_tag LOCUS_14380 gene ftsI 112531 114606 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_14380 114606 116072 gene locus_tag LOCUS_14390 gene murE 114606 116072 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_14390 116086 117303 gene locus_tag LOCUS_14400 gene mraY 116086 117303 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_14400 117546 118895 gene locus_tag LOCUS_14410 gene murD 117546 118895 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_14410 118892 120073 gene locus_tag LOCUS_14420 gene ftsW 118892 120073 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_14420 120074 121180 gene locus_tag LOCUS_14430 gene murG 120074 121180 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_14430 121177 122574 gene locus_tag LOCUS_14440 gene murC 121177 122574 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_14440 122564 123328 gene locus_tag LOCUS_14450 122564 123328 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_14450 123347 124669 gene locus_tag LOCUS_14460 gene ftsA 123347 124669 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_14460 124697 126265 gene locus_tag LOCUS_14470 124697 126265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence11 1407 1096 gene locus_tag LOCUS_14480 1407 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1876 4149 gene locus_tag LOCUS_14490 gene acnA 1876 4149 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_14490 4313 4876 gene locus_tag LOCUS_14500 gene ftnA 4313 4876 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_14500 5754 4930 gene locus_tag LOCUS_14510 5754 4930 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_14510 6656 5925 gene locus_tag LOCUS_14520 gene glpF 6656 5925 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_14520 8162 6663 gene locus_tag LOCUS_14530 gene glpK 8162 6663 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X50 protein_id gnl|my_center|LOCUS_14530 10057 8492 gene locus_tag LOCUS_14540 gene glpA 10057 8492 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_14540 10153 10941 gene locus_tag LOCUS_14550 10153 10941 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_14550 11019 13760 gene locus_tag LOCUS_14560 11019 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13760 15376 gene locus_tag LOCUS_14570 13760 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 15413 16570 gene locus_tag LOCUS_14580 15413 16570 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_14580 16577 18262 gene locus_tag LOCUS_14590 16577 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 18240 19295 gene locus_tag LOCUS_14600 gene gpsA 18240 19295 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_14600 19477 20250 gene locus_tag LOCUS_14610 19477 20250 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_14610 20254 21168 gene locus_tag LOCUS_14620 20254 21168 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_14620 21170 21772 gene locus_tag LOCUS_14630 21170 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 21775 22485 gene locus_tag LOCUS_14640 gene dapB 21775 22485 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_14640 22489 23610 gene locus_tag LOCUS_14650 22489 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 23752 24654 gene locus_tag LOCUS_14660 23752 24654 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA23 protein_id gnl|my_center|LOCUS_14660 24664 25596 gene locus_tag LOCUS_14670 24664 25596 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_14670 26216 25830 gene locus_tag LOCUS_14680 26216 25830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_14680 26360 26641 gene locus_tag LOCUS_14690 gene ydzA 26360 26641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_14690 26713 28056 gene locus_tag LOCUS_14700 gene purB 26713 28056 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_14700 28590 28072 gene locus_tag LOCUS_14710 28590 28072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 28659 29429 gene locus_tag LOCUS_14720 28659 29429 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_14720 30057 29416 gene locus_tag LOCUS_14730 30057 29416 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_14730 30545 30117 gene locus_tag LOCUS_14740 30545 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 31474 30554 gene locus_tag LOCUS_14750 31474 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 34673 31587 gene locus_tag LOCUS_14760 34673 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 35122 34760 gene locus_tag LOCUS_14770 35122 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_14770 35713 35171 gene locus_tag LOCUS_14780 35713 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_14780 39256 35807 gene locus_tag LOCUS_14790 39256 35807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 40108 39284 gene locus_tag LOCUS_14800 40108 39284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 41006 40413 gene locus_tag LOCUS_14810 gene cheB2 41006 40413 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_14810 41736 41029 gene locus_tag LOCUS_14820 gene cheR 41736 41029 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_14820 42169 43509 gene locus_tag LOCUS_14830 42169 43509 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_14830 44222 43506 gene locus_tag LOCUS_14840 44222 43506 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7Q6 protein_id gnl|my_center|LOCUS_14840 46831 44222 gene locus_tag LOCUS_14850 46831 44222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 48808 46838 gene locus_tag LOCUS_14860 48808 46838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 50072 49086 gene locus_tag LOCUS_14870 50072 49086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 50173 50757 gene locus_tag LOCUS_14880 50173 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 50757 51479 gene locus_tag LOCUS_14890 50757 51479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 51971 51492 gene locus_tag LOCUS_14900 51971 51492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 52479 52006 gene locus_tag LOCUS_14910 gene rnhA 52479 52006 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_14910 53042 52479 gene locus_tag LOCUS_14920 53042 52479 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_14920 54149 53085 gene locus_tag LOCUS_14930 54149 53085 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_14930 54928 54155 gene locus_tag LOCUS_14940 gene echA8 54928 54155 CDS product putative enoyl-CoA hydratase echA8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNN9 protein_id gnl|my_center|LOCUS_14940 56033 55179 gene locus_tag LOCUS_14950 56033 55179 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_14950 56827 56030 gene locus_tag LOCUS_14960 gene folP 56827 56030 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_14960 56926 57462 gene locus_tag LOCUS_14970 56926 57462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_14970 57475 58569 gene locus_tag LOCUS_14980 57475 58569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_14980 58569 59069 gene locus_tag LOCUS_14990 gene aroK 58569 59069 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 protein_id gnl|my_center|LOCUS_14990 60682 59114 gene locus_tag LOCUS_15000 60682 59114 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_15000 62264 60810 gene locus_tag LOCUS_15010 62264 60810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 62390 63865 gene locus_tag LOCUS_15020 gene proS 62390 63865 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_15020 63897 64358 gene locus_tag LOCUS_15030 63897 64358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 64360 65370 gene locus_tag LOCUS_15040 64360 65370 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_15040 65595 66500 gene locus_tag LOCUS_15050 65595 66500 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_15050 66501 67571 gene locus_tag LOCUS_15060 66501 67571 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_15060 67645 68679 gene locus_tag LOCUS_15070 67645 68679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 68824 69420 gene locus_tag LOCUS_15080 68824 69420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 70859 69474 gene locus_tag LOCUS_15090 70859 69474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 71245 72432 gene locus_tag LOCUS_15100 gene kbl 71245 72432 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_15100 72974 72552 gene locus_tag LOCUS_15110 72974 72552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 73640 73212 gene locus_tag LOCUS_15120 73640 73212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 75284 73647 gene locus_tag LOCUS_15130 75284 73647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 76552 75476 gene locus_tag LOCUS_15140 76552 75476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 77235 77378 gene locus_tag LOCUS_15150 77235 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 77433 79226 gene locus_tag LOCUS_15160 77433 79226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 79515 79246 gene locus_tag LOCUS_15170 79515 79246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 80297 79710 gene locus_tag LOCUS_15180 gene yozB 80297 79710 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_15180 80924 80298 gene locus_tag LOCUS_15190 80924 80298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 81312 80986 gene locus_tag LOCUS_15200 81312 80986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 82068 81325 gene locus_tag LOCUS_15210 gene coxP 82068 81325 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_15210 82682 82092 gene locus_tag LOCUS_15220 gene ctaE 82682 82092 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_15220 83587 82685 gene locus_tag LOCUS_15230 gene ctaB 83587 82685 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_15230 84674 83574 gene locus_tag LOCUS_15240 gene ctaA 84674 83574 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_15240 86523 84655 gene locus_tag LOCUS_15250 gene ctaD 86523 84655 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_15250 87588 86542 gene locus_tag LOCUS_15260 gene ctaC 87588 86542 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_15260 88929 87613 gene locus_tag LOCUS_15270 gene actF 88929 87613 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_15270 89599 88955 gene locus_tag LOCUS_15280 89599 88955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 90137 89613 gene locus_tag LOCUS_15290 gene actD 90137 89613 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_15290 91513 90140 gene locus_tag LOCUS_15300 gene actC 91513 90140 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_15300 94633 91532 gene locus_tag LOCUS_15310 gene actB 94633 91532 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_15310 95956 94667 gene locus_tag LOCUS_15320 gene actA 95956 94667 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_15320 96482 97435 gene locus_tag LOCUS_15330 96482 97435 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_15330 97924 98574 gene locus_tag LOCUS_15340 97924 98574 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_15340 98608 98820 gene locus_tag LOCUS_15350 98608 98820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 99715 99296 gene locus_tag LOCUS_15360 99715 99296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 99809 100075 gene locus_tag LOCUS_15370 99809 100075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 100078 100548 gene locus_tag LOCUS_15380 100078 100548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 100774 100538 gene locus_tag LOCUS_15390 100774 100538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 101103 100777 gene locus_tag LOCUS_15400 101103 100777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 101432 101863 gene locus_tag LOCUS_15410 101432 101863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 102410 102021 gene locus_tag LOCUS_15420 102410 102021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_15420 103001 102450 gene locus_tag LOCUS_15430 103001 102450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 103440 103018 gene locus_tag LOCUS_15440 103440 103018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 106119 103636 gene locus_tag LOCUS_15450 106119 103636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 108121 106313 gene locus_tag LOCUS_15460 108121 106313 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_15460 110042 108498 gene locus_tag LOCUS_15470 110042 108498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 111223 110447 gene locus_tag LOCUS_15480 111223 110447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 112478 111240 gene locus_tag LOCUS_15490 112478 111240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_15490 112695 113882 gene locus_tag LOCUS_15500 112695 113882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence12 483 409 gene locus_tag LOCUS_t00120 483 409 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 614 523 gene locus_tag LOCUS_t00130 614 523 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1147 2115 gene locus_tag LOCUS_15510 gene batB 1147 2115 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_15510 2112 3020 gene locus_tag LOCUS_15520 2112 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3091 4269 gene locus_tag LOCUS_15530 3091 4269 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_15530 4412 5752 gene locus_tag LOCUS_15540 4412 5752 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015644.1 protein_id gnl|my_center|LOCUS_15540 6163 5786 gene locus_tag LOCUS_15550 6163 5786 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_15550 7051 6365 gene locus_tag LOCUS_15560 7051 6365 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_15560 7239 8795 gene locus_tag LOCUS_15570 7239 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_15570 8799 9422 gene locus_tag LOCUS_15580 8799 9422 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_15580 9459 10052 gene locus_tag LOCUS_15590 9459 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10409 10173 gene locus_tag LOCUS_15600 10409 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 13314 10582 gene locus_tag LOCUS_15610 gene leuS 13314 10582 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_15610 13659 13480 gene locus_tag LOCUS_15620 13659 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13779 14291 gene locus_tag LOCUS_15630 13779 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 16609 14435 gene locus_tag LOCUS_15640 16609 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 16819 17916 gene locus_tag LOCUS_15650 gene hisB 16819 17916 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_15650 18010 18267 gene locus_tag LOCUS_15660 18010 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18264 18677 gene locus_tag LOCUS_15670 18264 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 20860 18680 gene locus_tag LOCUS_15680 20860 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 21382 21014 gene locus_tag LOCUS_15690 21382 21014 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_15690 22953 21379 gene locus_tag LOCUS_15700 22953 21379 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_15700 24873 23038 gene locus_tag LOCUS_15710 24873 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 25870 24875 gene locus_tag LOCUS_15720 25870 24875 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_15720 25993 27180 gene locus_tag LOCUS_15730 gene gcdH 25993 27180 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_15730 27206 27493 gene locus_tag LOCUS_15740 27206 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 27665 28744 gene locus_tag LOCUS_15750 27665 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 30993 28717 gene locus_tag LOCUS_15760 30993 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 31671 31024 gene locus_tag LOCUS_15770 31671 31024 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_15770 31716 33155 gene locus_tag LOCUS_15780 31716 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 33233 33520 gene locus_tag LOCUS_15790 33233 33520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 35055 33619 gene locus_tag LOCUS_15800 gene pykA 35055 33619 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_15800 35591 35166 gene locus_tag LOCUS_15810 35591 35166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 35747 35983 gene locus_tag LOCUS_15820 gene acpP 35747 35983 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_15820 36006 37256 gene locus_tag LOCUS_15830 36006 37256 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E7 protein_id gnl|my_center|LOCUS_15830 37266 37997 gene locus_tag LOCUS_15840 gene rnc 37266 37997 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_15840 38097 39947 gene locus_tag LOCUS_15850 gene nadE 38097 39947 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_15850 40000 41082 gene locus_tag LOCUS_15860 40000 41082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 41447 42916 gene locus_tag LOCUS_15870 41447 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 43556 42918 gene locus_tag LOCUS_15880 43556 42918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 43713 44432 gene locus_tag LOCUS_15890 43713 44432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 44429 46501 gene locus_tag LOCUS_15900 44429 46501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_15900 46704 47351 gene locus_tag LOCUS_15910 46704 47351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 47447 50212 gene locus_tag LOCUS_15920 47447 50212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 51068 51409 gene locus_tag LOCUS_15930 51068 51409 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_15930 52023 51541 gene locus_tag LOCUS_15940 gene sixA 52023 51541 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121948.1 protein_id gnl|my_center|LOCUS_15940 52119 52310 gene locus_tag LOCUS_15950 52119 52310 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_15950 53012 54067 gene locus_tag LOCUS_15960 53012 54067 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_15960 54078 54695 gene locus_tag LOCUS_15970 54078 54695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 59124 54904 gene locus_tag LOCUS_15980 59124 54904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 59501 60850 gene locus_tag LOCUS_15990 gene norM 59501 60850 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_15990 61102 61920 gene locus_tag LOCUS_16000 61102 61920 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_16000 62082 63419 gene locus_tag LOCUS_16010 62082 63419 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_16010 64047 63583 gene locus_tag LOCUS_16020 64047 63583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251731.1 protein_id gnl|my_center|LOCUS_16020 65056 64181 gene locus_tag LOCUS_16030 gene sucD 65056 64181 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_16030 65402 66895 gene locus_tag LOCUS_16040 65402 66895 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XD8 protein_id gnl|my_center|LOCUS_16040 66934 67302 gene locus_tag LOCUS_16050 66934 67302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 67396 68067 gene locus_tag LOCUS_16060 67396 68067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_16060 68675 70003 gene locus_tag LOCUS_16070 gene cysD 68675 70003 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_16070 69990 71006 gene locus_tag LOCUS_16080 gene metX 69990 71006 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_16080 70993 72192 gene locus_tag LOCUS_16090 70993 72192 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814M4 protein_id gnl|my_center|LOCUS_16090 72243 73154 gene locus_tag LOCUS_16100 gene rimK 72243 73154 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_16100 74682 73444 gene locus_tag LOCUS_16110 gene clpX 74682 73444 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_16110 75352 74684 gene locus_tag LOCUS_16120 gene clpP 75352 74684 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_16120 76778 75435 gene locus_tag LOCUS_16130 76778 75435 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_16130 76946 76864 gene locus_tag LOCUS_t00140 76946 76864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77049 79259 gene locus_tag LOCUS_16140 gene relA 77049 79259 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_16140 79307 79780 gene locus_tag LOCUS_16150 gene fur 79307 79780 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_16150 79801 80139 gene locus_tag LOCUS_16160 79801 80139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 80229 81497 gene locus_tag LOCUS_16170 gene purA 80229 81497 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_16170 82222 81557 gene locus_tag LOCUS_16180 82222 81557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 82824 82234 gene locus_tag LOCUS_16190 82824 82234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 83911 82907 gene locus_tag LOCUS_16200 83911 82907 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_16200 84281 83931 gene locus_tag LOCUS_16210 84281 83931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 85669 84449 gene locus_tag LOCUS_16220 85669 84449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 86097 85672 gene locus_tag LOCUS_16230 86097 85672 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406128.1 protein_id gnl|my_center|LOCUS_16230 86202 86822 gene locus_tag LOCUS_16240 gene gpm 86202 86822 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_16240 88487 87147 gene locus_tag LOCUS_16250 gene atoE 88487 87147 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_16250 89723 88719 gene locus_tag LOCUS_16260 89723 88719 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_16260 90644 89973 gene locus_tag LOCUS_16270 90644 89973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 91556 90723 gene locus_tag LOCUS_16280 gene aroE2 91556 90723 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020141.1 protein_id gnl|my_center|LOCUS_16280 92379 91567 gene locus_tag LOCUS_16290 92379 91567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978134.1 protein_id gnl|my_center|LOCUS_16290 93714 92470 gene locus_tag LOCUS_16300 93714 92470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 94748 93975 gene locus_tag LOCUS_16310 94748 93975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 95349 94738 gene locus_tag LOCUS_16320 95349 94738 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_16320 95929 95459 gene locus_tag LOCUS_16330 95929 95459 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_16330 96443 96177 gene locus_tag LOCUS_16340 96443 96177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_16340 96563 97126 gene locus_tag LOCUS_16350 96563 97126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 97267 97854 gene locus_tag LOCUS_16360 97267 97854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 98240 97812 gene locus_tag LOCUS_16370 98240 97812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 98592 98260 gene locus_tag LOCUS_16380 98592 98260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_16380 100872 98716 gene locus_tag LOCUS_16390 100872 98716 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_16390 101976 102326 gene locus_tag LOCUS_16400 gene fdx1 101976 102326 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_16400 103973 102390 gene locus_tag LOCUS_16410 103973 102390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 104411 104713 gene locus_tag LOCUS_16420 104411 104713 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_16420 106282 105278 gene locus_tag LOCUS_16430 gene bioB 106282 105278 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_16430 108097 106346 gene locus_tag LOCUS_16440 108097 106346 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_16440 108231 108719 gene locus_tag LOCUS_16450 108231 108719 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_16450 108835 108996 gene locus_tag LOCUS_16460 108835 108996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 109059 109649 gene locus_tag LOCUS_16470 109059 109649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 109757 110353 gene locus_tag LOCUS_16480 109757 110353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence13 1370 393 gene locus_tag LOCUS_16490 1370 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3606 1363 gene locus_tag LOCUS_16500 3606 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5172 3610 gene locus_tag LOCUS_16510 5172 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6535 5156 gene locus_tag LOCUS_16520 6535 5156 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T4 protein_id gnl|my_center|LOCUS_16520 8689 7064 gene locus_tag LOCUS_16530 8689 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9358 9642 gene locus_tag LOCUS_16540 9358 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 12954 9901 gene locus_tag LOCUS_16550 12954 9901 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107392.1 protein_id gnl|my_center|LOCUS_16550 14170 13139 gene locus_tag LOCUS_16560 14170 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_16560 14530 14351 gene locus_tag LOCUS_16570 14530 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 16713 15187 gene locus_tag LOCUS_16580 16713 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 17914 16805 gene locus_tag LOCUS_16590 17914 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 19322 18171 gene locus_tag LOCUS_16600 19322 18171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 19432 20493 gene locus_tag LOCUS_16610 19432 20493 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_16610 20493 23531 gene locus_tag LOCUS_16620 20493 23531 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_16620 24042 23650 gene locus_tag LOCUS_16630 24042 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_16630 25907 24384 gene locus_tag LOCUS_16640 gene aldA 25907 24384 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_16640 26055 27074 gene locus_tag LOCUS_16650 26055 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 27692 27198 gene locus_tag LOCUS_16660 27692 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 28624 27665 gene locus_tag LOCUS_16670 28624 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 29105 28656 gene locus_tag LOCUS_16680 29105 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 29661 29191 gene locus_tag LOCUS_16690 29661 29191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 30814 29654 gene locus_tag LOCUS_16700 30814 29654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_16700 31172 30963 gene locus_tag LOCUS_16710 31172 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 31667 32584 gene locus_tag LOCUS_16720 gene glsA 31667 32584 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_16720 34206 32908 gene locus_tag LOCUS_16730 34206 32908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_16730 34226 34486 gene locus_tag LOCUS_16740 34226 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 35204 34551 gene locus_tag LOCUS_16750 35204 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 36366 35254 gene locus_tag LOCUS_16760 36366 35254 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_16760 36570 38048 gene locus_tag LOCUS_16770 gene pepP 36570 38048 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 protein_id gnl|my_center|LOCUS_16770 38235 38885 gene locus_tag LOCUS_16780 38235 38885 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_16780 45208 38912 gene locus_tag LOCUS_16790 45208 38912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 45156 45320 gene locus_tag LOCUS_16800 45156 45320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 46518 45328 gene locus_tag LOCUS_16810 46518 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 47685 46585 gene locus_tag LOCUS_16820 47685 46585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 47850 48956 gene locus_tag LOCUS_16830 47850 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 49122 50018 gene locus_tag LOCUS_16840 49122 50018 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_16840 50643 50422 gene locus_tag LOCUS_16850 50643 50422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 51650 50730 gene locus_tag LOCUS_16860 gene mdh 51650 50730 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_16860 52167 51766 gene locus_tag LOCUS_16870 52167 51766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 53596 52271 gene locus_tag LOCUS_16880 gene tilS 53596 52271 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_16880 53705 55252 gene locus_tag LOCUS_16890 53705 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_16890 55388 56086 gene locus_tag LOCUS_16900 55388 56086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 56170 56994 gene locus_tag LOCUS_16910 56170 56994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 57001 57309 gene locus_tag LOCUS_16920 57001 57309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_16920 57318 58520 gene locus_tag LOCUS_16930 gene coaBC 57318 58520 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_16930 58520 59419 gene locus_tag LOCUS_16940 58520 59419 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_16940 59552 61204 gene locus_tag LOCUS_16950 gene recN 59552 61204 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_16950 62393 61386 gene locus_tag LOCUS_16960 62393 61386 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_16960 62516 63145 gene locus_tag LOCUS_16970 62516 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 64105 63245 gene locus_tag LOCUS_16980 64105 63245 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_16980 64290 64901 gene locus_tag LOCUS_16990 64290 64901 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_16990 65020 66786 gene locus_tag LOCUS_17000 65020 66786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 66792 67244 gene locus_tag LOCUS_17010 66792 67244 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_17010 67248 68099 gene locus_tag LOCUS_17020 gene tktA 67248 68099 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_17020 68150 69535 gene locus_tag LOCUS_17030 68150 69535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 69546 70505 gene locus_tag LOCUS_17040 gene tktC 69546 70505 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_17040 70554 70850 gene locus_tag LOCUS_17050 70554 70850 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_17050 71826 70852 gene locus_tag LOCUS_17060 71826 70852 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_17060 71879 72736 gene locus_tag LOCUS_17070 71879 72736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 73171 72746 gene locus_tag LOCUS_17080 73171 72746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 76923 73171 gene locus_tag LOCUS_17090 76923 73171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 77663 76956 gene locus_tag LOCUS_17100 77663 76956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 78730 77744 gene locus_tag LOCUS_17110 78730 77744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 79594 78749 gene locus_tag LOCUS_17120 79594 78749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 81028 79616 gene locus_tag LOCUS_17130 81028 79616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_17130 84147 81040 gene locus_tag LOCUS_17140 84147 81040 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_17140 84697 84380 gene locus_tag LOCUS_17150 84697 84380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 84817 85338 gene locus_tag LOCUS_17160 84817 85338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_17160 85863 85375 gene locus_tag LOCUS_17170 85863 85375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_17170 86783 85893 gene locus_tag LOCUS_17180 86783 85893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 86973 87194 gene locus_tag LOCUS_17190 86973 87194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 87187 87585 gene locus_tag LOCUS_17200 87187 87585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 87591 88202 gene locus_tag LOCUS_17210 87591 88202 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_17210 88202 88864 gene locus_tag LOCUS_17220 88202 88864 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_17220 88861 89313 gene locus_tag LOCUS_17230 gene dtd 88861 89313 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_17230 91687 89318 gene locus_tag LOCUS_17240 91687 89318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 92796 91675 gene locus_tag LOCUS_17250 92796 91675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 95393 92796 gene locus_tag LOCUS_17260 95393 92796 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_17260 97602 95425 gene locus_tag LOCUS_17270 97602 95425 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_17270 99217 97730 gene locus_tag LOCUS_17280 gene phrB2 99217 97730 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_17280 102227 99348 gene locus_tag LOCUS_17290 gene acnA 102227 99348 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_17290 105669 102220 gene locus_tag LOCUS_17300 gene pyc 105669 102220 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_17300 106324 107091 gene locus_tag LOCUS_17310 106324 107091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 107163 108542 gene locus_tag LOCUS_17320 107163 108542 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence14 1669 344 gene locus_tag LOCUS_17330 1669 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2593 1688 gene locus_tag LOCUS_17340 2593 1688 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_17340 3848 2712 gene locus_tag LOCUS_17350 3848 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4118 3942 gene locus_tag LOCUS_17360 4118 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4527 4369 gene locus_tag LOCUS_17370 4527 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4493 6526 gene locus_tag LOCUS_17380 4493 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7245 6532 gene locus_tag LOCUS_17390 7245 6532 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_17390 8269 7238 gene locus_tag LOCUS_17400 8269 7238 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_17400 8481 9362 gene locus_tag LOCUS_17410 8481 9362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_17410 9568 9870 gene locus_tag LOCUS_17420 9568 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 11390 9960 gene locus_tag LOCUS_17430 11390 9960 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_17430 12967 11525 gene locus_tag LOCUS_17440 12967 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 14133 12967 gene locus_tag LOCUS_17450 14133 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 14801 14130 gene locus_tag LOCUS_17460 14801 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 16068 14806 gene locus_tag LOCUS_17470 16068 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 16631 16188 gene locus_tag LOCUS_17480 16631 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 17293 17102 gene locus_tag LOCUS_17490 17293 17102 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_17490 17697 17290 gene locus_tag LOCUS_17500 17697 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 17814 18350 gene locus_tag LOCUS_17510 17814 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 20349 18322 gene locus_tag LOCUS_17520 20349 18322 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_17520 20562 21338 gene locus_tag LOCUS_17530 20562 21338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_17530 21465 22094 gene locus_tag LOCUS_17540 21465 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 23159 22134 gene locus_tag LOCUS_17550 23159 22134 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646402.1 protein_id gnl|my_center|LOCUS_17550 24606 23212 gene locus_tag LOCUS_17560 24606 23212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_17560 26072 24786 gene locus_tag LOCUS_17570 26072 24786 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_17570 26318 27013 gene locus_tag LOCUS_17580 26318 27013 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_17580 28310 27018 gene locus_tag LOCUS_17590 28310 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 28489 30942 gene locus_tag LOCUS_17600 28489 30942 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_17600 31048 31677 gene locus_tag LOCUS_17610 31048 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 33065 32220 gene locus_tag LOCUS_17620 33065 32220 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815393.1 protein_id gnl|my_center|LOCUS_17620 33451 33092 gene locus_tag LOCUS_17630 33451 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 35297 33933 gene locus_tag LOCUS_17640 35297 33933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 35527 36930 gene locus_tag LOCUS_17650 35527 36930 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_17650 38229 36994 gene locus_tag LOCUS_17660 38229 36994 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_17660 38482 38231 gene locus_tag LOCUS_17670 38482 38231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 39365 38664 gene locus_tag LOCUS_17680 39365 38664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 protein_id gnl|my_center|LOCUS_17680 39560 39925 gene locus_tag LOCUS_17690 39560 39925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 41668 40646 gene locus_tag LOCUS_17700 gene adhP 41668 40646 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_17700 42417 41740 gene locus_tag LOCUS_17710 42417 41740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 43528 42422 gene locus_tag LOCUS_17720 gene mnmA 43528 42422 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_17720 43731 44315 gene locus_tag LOCUS_17730 43731 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 44631 45842 gene locus_tag LOCUS_17740 gene mntH 44631 45842 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_17740 45851 46606 gene locus_tag LOCUS_17750 45851 46606 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJK6 protein_id gnl|my_center|LOCUS_17750 46603 47277 gene locus_tag LOCUS_17760 gene kipI 46603 47277 CDS product kinase A inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60495 protein_id gnl|my_center|LOCUS_17760 47264 48142 gene locus_tag LOCUS_17770 47264 48142 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 protein_id gnl|my_center|LOCUS_17770 49086 48250 gene locus_tag LOCUS_17780 49086 48250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 49777 49298 gene locus_tag LOCUS_17790 49777 49298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 49894 50247 gene locus_tag LOCUS_17800 49894 50247 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_17800 50742 50254 gene locus_tag LOCUS_17810 50742 50254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 53098 50747 gene locus_tag LOCUS_17820 53098 50747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_17820 53772 53116 gene locus_tag LOCUS_17830 gene rpe 53772 53116 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_17830 54719 53808 gene locus_tag LOCUS_17840 54719 53808 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_17840 55885 54770 gene locus_tag LOCUS_17850 55885 54770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 57120 55903 gene locus_tag LOCUS_17860 57120 55903 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_17860 59036 57213 gene locus_tag LOCUS_17870 59036 57213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 60474 59158 gene locus_tag LOCUS_17880 gene tldD 60474 59158 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_17880 62177 60537 gene locus_tag LOCUS_17890 62177 60537 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_17890 62333 63373 gene locus_tag LOCUS_17900 gene dinB 62333 63373 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_17900 63911 63378 gene locus_tag LOCUS_17910 gene msrA 63911 63378 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_17910 65367 64045 gene locus_tag LOCUS_17920 65367 64045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880520.1 protein_id gnl|my_center|LOCUS_17920 67974 65458 gene locus_tag LOCUS_17930 gene gyrA 67974 65458 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_17930 69041 68049 gene locus_tag LOCUS_17940 69041 68049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 69775 69179 gene locus_tag LOCUS_17950 69775 69179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 70535 69867 gene locus_tag LOCUS_17960 70535 69867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 71152 70532 gene locus_tag LOCUS_17970 71152 70532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 71260 72423 gene locus_tag LOCUS_17980 71260 72423 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_17980 73300 72503 gene locus_tag LOCUS_17990 73300 72503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 73717 74487 gene locus_tag LOCUS_18000 73717 74487 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_18000 75031 74687 gene locus_tag LOCUS_18010 gene rplT 75031 74687 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_18010 75334 75140 gene locus_tag LOCUS_18020 gene rpmI 75334 75140 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_18020 75908 75360 gene locus_tag LOCUS_18030 gene infC 75908 75360 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_18030 77970 76006 gene locus_tag LOCUS_18040 gene thrS 77970 76006 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_18040 79823 78084 gene locus_tag LOCUS_18050 79823 78084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 80386 79880 gene locus_tag LOCUS_18060 gene pyrR2 80386 79880 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_18060 80870 80391 gene locus_tag LOCUS_18070 80870 80391 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_18070 81080 82189 gene locus_tag LOCUS_18080 81080 82189 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109390.1 protein_id gnl|my_center|LOCUS_18080 82195 83151 gene locus_tag LOCUS_18090 82195 83151 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_18090 84441 83173 gene locus_tag LOCUS_18100 84441 83173 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_18100 84855 84670 gene locus_tag LOCUS_18110 84855 84670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 84812 85564 gene locus_tag LOCUS_18120 84812 85564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 85765 86679 gene locus_tag LOCUS_18130 gene ilvE2 85765 86679 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_18130 86676 87404 gene locus_tag LOCUS_18140 86676 87404 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_18140 89879 87420 gene locus_tag LOCUS_18150 89879 87420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 90651 89866 gene locus_tag LOCUS_18160 90651 89866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 91277 90693 gene locus_tag LOCUS_18170 91277 90693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 91810 91307 gene locus_tag LOCUS_18180 91810 91307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 91989 92681 gene locus_tag LOCUS_18190 gene npdA 91989 92681 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_18190 94174 92840 gene locus_tag LOCUS_18200 gene bfmBB 94174 92840 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_18200 95722 94472 gene locus_tag LOCUS_18210 95722 94472 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_18210 99920 95736 gene locus_tag LOCUS_18220 99920 95736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 100067 101728 gene locus_tag LOCUS_18230 gene paaZ 100067 101728 CDS product phenylacetic acid degradation oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549951.1 protein_id gnl|my_center|LOCUS_18230 102214 102654 gene locus_tag LOCUS_18240 102214 102654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 102911 103684 gene locus_tag LOCUS_18250 102911 103684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 103941 105578 gene locus_tag LOCUS_18260 103941 105578 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_18260 106851 105754 gene locus_tag LOCUS_18270 106851 105754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 107359 107814 gene locus_tag LOCUS_18280 107359 107814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence15 527 93 gene locus_tag LOCUS_18290 527 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1498 527 gene locus_tag LOCUS_18300 1498 527 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_18300 2010 1618 gene locus_tag LOCUS_18310 2010 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2902 2225 gene locus_tag LOCUS_18320 2902 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3426 2992 gene locus_tag LOCUS_18330 3426 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3550 3629 gene locus_tag LOCUS_t00150 3550 3629 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3667 3741 gene locus_tag LOCUS_t00160 3667 3741 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3793 4050 gene locus_tag LOCUS_18340 3793 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4839 4246 gene locus_tag LOCUS_18350 4839 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5774 4920 gene locus_tag LOCUS_18360 5774 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_18360 6634 5819 gene locus_tag LOCUS_18370 gene dapD 6634 5819 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_18370 6657 7808 gene locus_tag LOCUS_18380 6657 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7917 8579 gene locus_tag LOCUS_18390 gene sirR 7917 8579 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_18390 8560 9498 gene locus_tag LOCUS_18400 gene troA 8560 9498 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_18400 9495 10280 gene locus_tag LOCUS_18410 gene mntB 9495 10280 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_18410 10282 11574 gene locus_tag LOCUS_18420 gene mntC 10282 11574 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_18420 11653 12219 gene locus_tag LOCUS_18430 11653 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688275.1 protein_id gnl|my_center|LOCUS_18430 12269 13150 gene locus_tag LOCUS_18440 gene mntD 12269 13150 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_18440 13182 13643 gene locus_tag LOCUS_18450 13182 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 13998 13735 gene locus_tag LOCUS_18460 13998 13735 CDS product RelE/StbE family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_18460 14192 13998 gene locus_tag LOCUS_18470 14192 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 16273 14249 gene locus_tag LOCUS_18480 16273 14249 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 protein_id gnl|my_center|LOCUS_18480 16382 16735 gene locus_tag LOCUS_18490 16382 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 16972 16814 gene locus_tag LOCUS_18500 16972 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 18069 16996 gene locus_tag LOCUS_18510 18069 16996 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 protein_id gnl|my_center|LOCUS_18510 18223 19443 gene locus_tag LOCUS_18520 gene queA 18223 19443 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_18520 19461 20351 gene locus_tag LOCUS_18530 19461 20351 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_18530 20476 22362 gene locus_tag LOCUS_18540 20476 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 22594 23376 gene locus_tag LOCUS_18550 22594 23376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_18550 23603 24187 gene locus_tag LOCUS_18560 23603 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 24993 24250 gene locus_tag LOCUS_18570 24993 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 26191 25001 gene locus_tag LOCUS_18580 26191 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 34230 26194 gene locus_tag LOCUS_18590 34230 26194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 34561 34779 gene locus_tag LOCUS_18600 34561 34779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 34874 34800 gene locus_tag LOCUS_t00170 34874 34800 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36121 34910 gene locus_tag LOCUS_18610 gene sucC 36121 34910 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_18610 36392 37057 gene locus_tag LOCUS_18620 gene lolD 36392 37057 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1M1 protein_id gnl|my_center|LOCUS_18620 37264 38241 gene locus_tag LOCUS_18630 37264 38241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 38534 39742 gene locus_tag LOCUS_18640 gene pcaF 38534 39742 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083747.1 protein_id gnl|my_center|LOCUS_18640 39729 39992 gene locus_tag LOCUS_18650 39729 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 40053 40847 gene locus_tag LOCUS_18660 gene thyA 40053 40847 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_18660 40860 41945 gene locus_tag LOCUS_18670 40860 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 41933 42688 gene locus_tag LOCUS_18680 41933 42688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 42690 43787 gene locus_tag LOCUS_18690 42690 43787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601810.1 protein_id gnl|my_center|LOCUS_18690 45133 43832 gene locus_tag LOCUS_18700 gene amaA 45133 43832 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_18700 46029 45262 gene locus_tag LOCUS_18710 46029 45262 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPL2 protein_id gnl|my_center|LOCUS_18710 46536 46123 gene locus_tag LOCUS_18720 46536 46123 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_18720 48119 46533 gene locus_tag LOCUS_18730 48119 46533 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_18730 48221 48460 gene locus_tag LOCUS_18740 48221 48460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 48444 48725 gene locus_tag LOCUS_18750 48444 48725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 49881 48820 gene locus_tag LOCUS_18760 gene fbaA 49881 48820 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_18760 51662 50106 gene locus_tag LOCUS_18770 51662 50106 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403138.1 protein_id gnl|my_center|LOCUS_18770 54669 51673 gene locus_tag LOCUS_18780 54669 51673 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_18780 57427 54689 gene locus_tag LOCUS_18790 57427 54689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 59047 57491 gene locus_tag LOCUS_18800 59047 57491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 59393 60421 gene locus_tag LOCUS_18810 59393 60421 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_18810 61805 60864 gene locus_tag LOCUS_18820 gene kpsF 61805 60864 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H2 protein_id gnl|my_center|LOCUS_18820 62590 61805 gene locus_tag LOCUS_18830 gene kdsA 62590 61805 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 protein_id gnl|my_center|LOCUS_18830 63043 65475 gene locus_tag LOCUS_18840 63043 65475 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_18840 65529 66914 gene locus_tag LOCUS_18850 65529 66914 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_18850 66914 68248 gene locus_tag LOCUS_18860 66914 68248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 68555 72214 gene locus_tag LOCUS_18870 68555 72214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 72825 72283 gene locus_tag LOCUS_18880 gene hslV 72825 72283 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD62 protein_id gnl|my_center|LOCUS_18880 72888 73043 gene locus_tag LOCUS_18890 72888 73043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 74945 73266 gene locus_tag LOCUS_18900 gene pdhC 74945 73266 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_18900 75730 75119 gene locus_tag LOCUS_18910 75730 75119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 76534 75815 gene locus_tag LOCUS_18920 76534 75815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 77477 76575 gene locus_tag LOCUS_18930 77477 76575 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_18930 78108 77542 gene locus_tag LOCUS_18940 78108 77542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 78519 78175 gene locus_tag LOCUS_18950 78519 78175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_18950 79029 78535 gene locus_tag LOCUS_18960 79029 78535 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_18960 79207 79040 gene locus_tag LOCUS_18970 79207 79040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 79838 79242 gene locus_tag LOCUS_18980 79838 79242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 80146 79892 gene locus_tag LOCUS_18990 80146 79892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 81179 80178 gene locus_tag LOCUS_19000 gene fabH2 81179 80178 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_19000 81832 81320 gene locus_tag LOCUS_19010 81832 81320 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_19010 81957 82718 gene locus_tag LOCUS_19020 81957 82718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 82761 84107 gene locus_tag LOCUS_19030 gene pabB 82761 84107 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_19030 84213 85553 gene locus_tag LOCUS_19040 gene miaB 84213 85553 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_19040 85769 86959 gene locus_tag LOCUS_19050 85769 86959 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_19050 86949 87476 gene locus_tag LOCUS_19060 86949 87476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_19060 87512 88642 gene locus_tag LOCUS_19070 87512 88642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 88647 89081 gene locus_tag LOCUS_19080 88647 89081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 89184 89903 gene locus_tag LOCUS_19090 89184 89903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 90474 89977 gene locus_tag LOCUS_19100 90474 89977 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_19100 92268 90547 gene locus_tag LOCUS_19110 92268 90547 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_19110 93777 92683 gene locus_tag LOCUS_19120 gene hppD 93777 92683 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404122.1 protein_id gnl|my_center|LOCUS_19120 93937 94344 gene locus_tag LOCUS_19130 93937 94344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 94722 96875 gene locus_tag LOCUS_19140 gene hppA1 94722 96875 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_19140 97177 97524 gene locus_tag LOCUS_19150 97177 97524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 97514 98824 gene locus_tag LOCUS_19160 97514 98824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 98793 99257 gene locus_tag LOCUS_19170 98793 99257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 99323 99802 gene locus_tag LOCUS_19180 99323 99802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence16 965 177 gene locus_tag LOCUS_19190 gene fjo14 965 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_19190 1058 2029 gene locus_tag LOCUS_19200 1058 2029 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_19200 2026 2466 gene locus_tag LOCUS_19210 2026 2466 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 protein_id gnl|my_center|LOCUS_19210 2552 4669 gene locus_tag LOCUS_19220 2552 4669 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_19220 4673 5446 gene locus_tag LOCUS_19230 4673 5446 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_19230 5473 7380 gene locus_tag LOCUS_19240 5473 7380 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_19240 7590 7787 gene locus_tag LOCUS_19250 7590 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7891 8094 gene locus_tag LOCUS_19260 7891 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 8164 8814 gene locus_tag LOCUS_19270 gene pyrE 8164 8814 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_19270 9830 8931 gene locus_tag LOCUS_19280 9830 8931 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410518.1 protein_id gnl|my_center|LOCUS_19280 11065 10136 gene locus_tag LOCUS_19290 11065 10136 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_19290 11692 11078 gene locus_tag LOCUS_19300 gene rnhB 11692 11078 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_19300 12465 11689 gene locus_tag LOCUS_19310 12465 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 12640 14889 gene locus_tag LOCUS_19320 12640 14889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_19320 14973 16877 gene locus_tag LOCUS_19330 14973 16877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_19330 17812 17078 gene locus_tag LOCUS_19340 17812 17078 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_19340 18755 17919 gene locus_tag LOCUS_19350 18755 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 19889 19149 gene locus_tag LOCUS_19360 19889 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 23335 20084 gene locus_tag LOCUS_19370 23335 20084 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_19370 23539 23763 gene locus_tag LOCUS_19380 23539 23763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_19380 24017 25441 gene locus_tag LOCUS_19390 24017 25441 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_19390 25506 25748 gene locus_tag LOCUS_19400 25506 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 25837 26556 gene locus_tag LOCUS_19410 25837 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123114.1 protein_id gnl|my_center|LOCUS_19410 26619 26864 gene locus_tag LOCUS_19420 26619 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 27126 27704 gene locus_tag LOCUS_19430 27126 27704 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19430 27691 28350 gene locus_tag LOCUS_19440 27691 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 28395 29531 gene locus_tag LOCUS_19450 28395 29531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 30074 30430 gene locus_tag LOCUS_19460 30074 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 30430 32349 gene locus_tag LOCUS_19470 30430 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 33858 32449 gene locus_tag LOCUS_19480 33858 32449 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_19480 35566 34187 gene locus_tag LOCUS_19490 35566 34187 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947965.1 protein_id gnl|my_center|LOCUS_19490 35640 36608 gene locus_tag LOCUS_19500 35640 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 39142 36653 gene locus_tag LOCUS_19510 39142 36653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 39567 39196 gene locus_tag LOCUS_19520 39567 39196 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_19520 39983 40789 gene locus_tag LOCUS_19530 39983 40789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 41063 42064 gene locus_tag LOCUS_19540 41063 42064 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_19540 42126 42452 gene locus_tag LOCUS_19550 42126 42452 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_19550 44721 42634 gene locus_tag LOCUS_19560 44721 42634 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_19560 45201 46340 gene locus_tag LOCUS_19570 45201 46340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 47482 46358 gene locus_tag LOCUS_19580 47482 46358 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_19580 47723 49060 gene locus_tag LOCUS_19590 47723 49060 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_19590 49103 49363 gene locus_tag LOCUS_19600 49103 49363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 50665 49859 gene locus_tag LOCUS_19610 50665 49859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 52014 50662 gene locus_tag LOCUS_19620 52014 50662 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_19620 53501 52062 gene locus_tag LOCUS_19630 53501 52062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_19630 56692 53513 gene locus_tag LOCUS_19640 56692 53513 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_19640 57485 56796 gene locus_tag LOCUS_19650 57485 56796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 57792 58130 gene locus_tag LOCUS_19660 57792 58130 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK3 protein_id gnl|my_center|LOCUS_19660 58135 59190 gene locus_tag LOCUS_19670 58135 59190 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_19670 59511 60587 gene locus_tag LOCUS_19680 59511 60587 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_19680 60687 61607 gene locus_tag LOCUS_19690 60687 61607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 61604 62281 gene locus_tag LOCUS_19700 61604 62281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 62330 62704 gene locus_tag LOCUS_19710 62330 62704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 63418 62834 gene locus_tag LOCUS_19720 63418 62834 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_19720 63498 63938 gene locus_tag LOCUS_19730 63498 63938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 63998 65251 gene locus_tag LOCUS_19740 63998 65251 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 protein_id gnl|my_center|LOCUS_19740 65818 66894 gene locus_tag LOCUS_19750 65818 66894 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_19750 67034 67513 gene locus_tag LOCUS_19760 67034 67513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 67728 68252 gene locus_tag LOCUS_19770 67728 68252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 68333 69121 gene locus_tag LOCUS_19780 68333 69121 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_19780 70342 69092 gene locus_tag LOCUS_19790 gene aroA 70342 69092 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_19790 70417 70650 gene locus_tag LOCUS_19800 70417 70650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 71661 70645 gene locus_tag LOCUS_19810 gene aroB 71661 70645 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_19810 72761 71658 gene locus_tag LOCUS_19820 72761 71658 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_19820 73369 73692 gene locus_tag LOCUS_19830 73369 73692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_19830 74248 73706 gene locus_tag LOCUS_19840 74248 73706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19840 75311 74238 gene locus_tag LOCUS_19850 75311 74238 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_19850 75401 76594 gene locus_tag LOCUS_19860 gene putA 75401 76594 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_19860 76947 78677 gene locus_tag LOCUS_19870 gene lysS 76947 78677 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_19870 78915 79295 gene locus_tag LOCUS_19880 78915 79295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 79330 79800 gene locus_tag LOCUS_19890 79330 79800 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY55 protein_id gnl|my_center|LOCUS_19890 79910 80488 gene locus_tag LOCUS_19900 79910 80488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_19900 80494 81105 gene locus_tag LOCUS_19910 80494 81105 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_19910 81582 81121 gene locus_tag LOCUS_19920 81582 81121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_19920 82223 82026 gene locus_tag LOCUS_19930 82223 82026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964413.1 protein_id gnl|my_center|LOCUS_19930 82416 83177 gene locus_tag LOCUS_19940 82416 83177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_19940 83186 83764 gene locus_tag LOCUS_19950 83186 83764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 84645 83761 gene locus_tag LOCUS_19960 84645 83761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 84926 84642 gene locus_tag LOCUS_19970 84926 84642 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393115.1 protein_id gnl|my_center|LOCUS_19970 85510 84983 gene locus_tag LOCUS_19980 85510 84983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 85879 85586 gene locus_tag LOCUS_19990 85879 85586 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_19990 86652 88379 gene locus_tag LOCUS_20000 86652 88379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 88390 89412 gene locus_tag LOCUS_20010 88390 89412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence17 214 1086 gene locus_tag LOCUS_20020 214 1086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_20020 2291 1098 gene locus_tag LOCUS_20030 2291 1098 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_20030 2761 2414 gene locus_tag LOCUS_20040 2761 2414 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_20040 2978 2739 gene locus_tag LOCUS_20050 2978 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4474 3173 gene locus_tag LOCUS_20060 gene tyrS 4474 3173 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_20060 4805 5620 gene locus_tag LOCUS_20070 4805 5620 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_20070 5635 6129 gene locus_tag LOCUS_20080 5635 6129 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_20080 6382 7404 gene locus_tag LOCUS_20090 gene holA 6382 7404 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_20090 7581 10649 gene locus_tag LOCUS_20100 7581 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404331.1 protein_id gnl|my_center|LOCUS_20100 10651 12339 gene locus_tag LOCUS_20110 10651 12339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_20110 12495 13247 gene locus_tag LOCUS_20120 12495 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 13258 13935 gene locus_tag LOCUS_20130 13258 13935 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_20130 13942 14337 gene locus_tag LOCUS_20140 13942 14337 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_20140 14330 15178 gene locus_tag LOCUS_20150 14330 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 15197 16498 gene locus_tag LOCUS_20160 gene folC 15197 16498 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_20160 16500 17165 gene locus_tag LOCUS_20170 gene trmB 16500 17165 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_20170 17153 17815 gene locus_tag LOCUS_20180 17153 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 17812 18747 gene locus_tag LOCUS_20190 17812 18747 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_20190 18749 19351 gene locus_tag LOCUS_20200 gene pglC 18749 19351 CDS product undecaprenyl phosphate N,N'-diacetylbacillosamine 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9D0 protein_id gnl|my_center|LOCUS_20200 19523 20227 gene locus_tag LOCUS_20210 gene drrA 19523 20227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405016.1 protein_id gnl|my_center|LOCUS_20210 20296 21018 gene locus_tag LOCUS_20220 20296 21018 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_20220 21946 21092 gene locus_tag LOCUS_20230 21946 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 22022 24988 gene locus_tag LOCUS_20240 22022 24988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 25084 25701 gene locus_tag LOCUS_20250 25084 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 26036 27004 gene locus_tag LOCUS_20260 gene moxR 26036 27004 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_20260 27015 27878 gene locus_tag LOCUS_20270 27015 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 27869 28888 gene locus_tag LOCUS_20280 27869 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 28881 31049 gene locus_tag LOCUS_20290 28881 31049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 31042 32751 gene locus_tag LOCUS_20300 31042 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 32771 34219 gene locus_tag LOCUS_20310 32771 34219 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_20310 34216 34398 gene locus_tag LOCUS_20320 34216 34398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 34517 34981 gene locus_tag LOCUS_20330 34517 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 35746 35129 gene locus_tag LOCUS_20340 35746 35129 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_20340 36539 35739 gene locus_tag LOCUS_20350 36539 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 37798 37199 gene locus_tag LOCUS_20360 37798 37199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 38137 38817 gene locus_tag LOCUS_20370 38137 38817 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 protein_id gnl|my_center|LOCUS_20370 39362 38946 gene locus_tag LOCUS_20380 39362 38946 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_20380 39886 39389 gene locus_tag LOCUS_20390 gene greB 39886 39389 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZD6 protein_id gnl|my_center|LOCUS_20390 40287 39946 gene locus_tag LOCUS_20400 gene phnA 40287 39946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061583.1 protein_id gnl|my_center|LOCUS_20400 40419 40889 gene locus_tag LOCUS_20410 40419 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 40990 41337 gene locus_tag LOCUS_20420 40990 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 43582 41558 gene locus_tag LOCUS_20430 gene glnS 43582 41558 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_20430 44671 44120 gene locus_tag LOCUS_20440 44671 44120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 46785 44767 gene locus_tag LOCUS_20450 46785 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 47538 49745 gene locus_tag LOCUS_20460 47538 49745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 50695 49751 gene locus_tag LOCUS_20470 50695 49751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 51023 51175 gene locus_tag LOCUS_20480 51023 51175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261681.1 protein_id gnl|my_center|LOCUS_20480 51302 54442 gene locus_tag LOCUS_20490 51302 54442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 55194 54661 gene locus_tag LOCUS_20500 gene greB 55194 54661 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMH2 protein_id gnl|my_center|LOCUS_20500 55846 56292 gene locus_tag LOCUS_20510 55846 56292 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013970.1 protein_id gnl|my_center|LOCUS_20510 56462 57418 gene locus_tag LOCUS_20520 56462 57418 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_20520 57503 57844 gene locus_tag LOCUS_20530 57503 57844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_20530 60039 58006 gene locus_tag LOCUS_20540 gene prc 60039 58006 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_20540 61488 60112 gene locus_tag LOCUS_20550 61488 60112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 61633 62829 gene locus_tag LOCUS_20560 gene crtY 61633 62829 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_20560 63114 63602 gene locus_tag LOCUS_20570 63114 63602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 65133 63907 gene locus_tag LOCUS_20580 65133 63907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 66873 65542 gene locus_tag LOCUS_20590 gene ffh 66873 65542 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_20590 68357 67317 gene locus_tag LOCUS_20600 68357 67317 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_20600 70901 68457 gene locus_tag LOCUS_20610 70901 68457 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_20610 72435 71182 gene locus_tag LOCUS_20620 72435 71182 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_20620 73114 72437 gene locus_tag LOCUS_20630 73114 72437 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_20630 73368 77258 gene locus_tag LOCUS_20640 73368 77258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 78395 77358 gene locus_tag LOCUS_20650 78395 77358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_20650 79176 78385 gene locus_tag LOCUS_20660 79176 78385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 80150 79272 gene locus_tag LOCUS_20670 80150 79272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_20670 80286 80645 gene locus_tag LOCUS_20680 80286 80645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 80661 83057 gene locus_tag LOCUS_20690 gene mutS2 80661 83057 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_20690 83320 83394 gene locus_tag LOCUS_t00180 83320 83394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 1282 176 gene locus_tag LOCUS_20700 gene smf 1282 176 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_20700 1645 1310 gene locus_tag LOCUS_20710 1645 1310 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_20710 2935 1742 gene locus_tag LOCUS_20720 2935 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3979 3002 gene locus_tag LOCUS_20730 3979 3002 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_20730 4225 6777 gene locus_tag LOCUS_20740 gene alaS 4225 6777 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_20740 6781 8244 gene locus_tag LOCUS_20750 gene gatB 6781 8244 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_20750 8248 9372 gene locus_tag LOCUS_20760 8248 9372 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_20760 10782 9706 gene locus_tag LOCUS_20770 10782 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10965 11822 gene locus_tag LOCUS_20780 10965 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 15707 12279 gene locus_tag LOCUS_20790 15707 12279 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_20790 15843 16004 gene locus_tag LOCUS_20800 15843 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 16546 16277 gene locus_tag LOCUS_20810 16546 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 17376 16981 gene locus_tag LOCUS_20820 17376 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 19904 17601 gene locus_tag LOCUS_20830 19904 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 protein_id gnl|my_center|LOCUS_20830 21227 20634 gene locus_tag LOCUS_20840 21227 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 22357 21320 gene locus_tag LOCUS_20850 22357 21320 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701083.1 protein_id gnl|my_center|LOCUS_20850 23489 22440 gene locus_tag LOCUS_20860 23489 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_20860 24011 23793 gene locus_tag LOCUS_20870 24011 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 24861 24121 gene locus_tag LOCUS_20880 24861 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 26374 25022 gene locus_tag LOCUS_20890 26374 25022 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_20890 27866 27174 gene locus_tag LOCUS_20900 27866 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 28479 27847 gene locus_tag LOCUS_20910 28479 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 29718 28483 gene locus_tag LOCUS_20920 29718 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 31505 29811 gene locus_tag LOCUS_20930 31505 29811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 33968 31719 gene locus_tag LOCUS_20940 33968 31719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 34016 34351 gene locus_tag LOCUS_20950 gene ogt2 34016 34351 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_20950 34813 34403 gene locus_tag LOCUS_20960 34813 34403 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_20960 35039 34794 gene locus_tag LOCUS_20970 35039 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 36482 35079 gene locus_tag LOCUS_20980 36482 35079 CDS product sodium/iodide co-transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_20980 36715 37011 gene locus_tag LOCUS_20990 36715 37011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 37013 37621 gene locus_tag LOCUS_21000 gene recR 37013 37621 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_21000 37759 38556 gene locus_tag LOCUS_21010 37759 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 38731 41223 gene locus_tag LOCUS_21020 38731 41223 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_21020 42418 41465 gene locus_tag LOCUS_21030 gene ltd 42418 41465 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_21030 42611 43879 gene locus_tag LOCUS_21040 gene hemA 42611 43879 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_21040 43919 44077 gene locus_tag LOCUS_21050 43919 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 44105 44779 gene locus_tag LOCUS_21060 44105 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_21060 45029 46162 gene locus_tag LOCUS_21070 45029 46162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 46213 46863 gene locus_tag LOCUS_21080 46213 46863 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882721.1 protein_id gnl|my_center|LOCUS_21080 47023 48768 gene locus_tag LOCUS_21090 gene aspS 47023 48768 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_21090 48869 49564 gene locus_tag LOCUS_21100 48869 49564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 50255 49512 gene locus_tag LOCUS_21110 50255 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_21110 50992 50252 gene locus_tag LOCUS_21120 50992 50252 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_21120 52032 50995 gene locus_tag LOCUS_21130 52032 50995 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_21130 52330 52145 gene locus_tag LOCUS_21140 52330 52145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 52480 53940 gene locus_tag LOCUS_21150 52480 53940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 53964 55040 gene locus_tag LOCUS_21160 gene aroC 53964 55040 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A602 protein_id gnl|my_center|LOCUS_21160 55040 56491 gene locus_tag LOCUS_21170 gene gltP 55040 56491 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_21170 56515 57111 gene locus_tag LOCUS_21180 56515 57111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 57202 57624 gene locus_tag LOCUS_21190 57202 57624 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_21190 57698 58360 gene locus_tag LOCUS_21200 57698 58360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 59156 58416 gene locus_tag LOCUS_21210 59156 58416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 59827 59105 gene locus_tag LOCUS_21220 gene menG 59827 59105 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_21220 60999 59953 gene locus_tag LOCUS_21230 gene queA 60999 59953 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_21230 61165 62349 gene locus_tag LOCUS_21240 61165 62349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_21240 62379 62912 gene locus_tag LOCUS_21250 62379 62912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 62920 63378 gene locus_tag LOCUS_21260 gene tadA 62920 63378 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_21260 63418 64023 gene locus_tag LOCUS_21270 gene sodA 63418 64023 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_21270 64720 65352 gene locus_tag LOCUS_21280 64720 65352 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_21280 65352 66599 gene locus_tag LOCUS_21290 65352 66599 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_21290 68673 66811 gene locus_tag LOCUS_21300 68673 66811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765626.1 protein_id gnl|my_center|LOCUS_21300 69953 68952 gene locus_tag LOCUS_21310 69953 68952 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_21310 70915 69953 gene locus_tag LOCUS_21320 70915 69953 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_21320 71373 70912 gene locus_tag LOCUS_21330 71373 70912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 72721 71438 gene locus_tag LOCUS_21340 gene pyrC2 72721 71438 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_21340 74433 72724 gene locus_tag LOCUS_21350 74433 72724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence19 497 2923 gene locus_tag LOCUS_21360 497 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2898 3959 gene locus_tag LOCUS_21370 2898 3959 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118968.1 protein_id gnl|my_center|LOCUS_21370 5493 4183 gene locus_tag LOCUS_21380 gene murF 5493 4183 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_21380 5583 7760 gene locus_tag LOCUS_21390 5583 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 8755 7961 gene locus_tag LOCUS_21400 8755 7961 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_21400 9891 8743 gene locus_tag LOCUS_21410 9891 8743 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_21410 10172 9996 gene locus_tag LOCUS_21420 10172 9996 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_21420 11525 10275 gene locus_tag LOCUS_21430 11525 10275 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_21430 11700 13193 gene locus_tag LOCUS_21440 gene accC 11700 13193 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_21440 13451 14755 gene locus_tag LOCUS_21450 13451 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_21450 14721 15302 gene locus_tag LOCUS_21460 14721 15302 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_21460 16601 15567 gene locus_tag LOCUS_21470 gene thiL 16601 15567 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_21470 17189 16785 gene locus_tag LOCUS_21480 17189 16785 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_21480 17322 17729 gene locus_tag LOCUS_21490 17322 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 17746 18072 gene locus_tag LOCUS_21500 gene sufA 17746 18072 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_21500 18163 18618 gene locus_tag LOCUS_21510 18163 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 18670 19482 gene locus_tag LOCUS_21520 gene murI 18670 19482 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_21520 21445 19469 gene locus_tag LOCUS_21530 21445 19469 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767054.1 protein_id gnl|my_center|LOCUS_21530 21675 23549 gene locus_tag LOCUS_21540 gene purF 21675 23549 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_21540 23861 25180 gene locus_tag LOCUS_21550 gene xylE 23861 25180 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_21550 25285 25944 gene locus_tag LOCUS_21560 25285 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_21560 25947 27287 gene locus_tag LOCUS_21570 25947 27287 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_21570 27430 28611 gene locus_tag LOCUS_21580 27430 28611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 29093 29710 gene locus_tag LOCUS_21590 29093 29710 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_21590 29768 30307 gene locus_tag LOCUS_21600 29768 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 31164 30427 gene locus_tag LOCUS_21610 31164 30427 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_21610 31245 33611 gene locus_tag LOCUS_21620 31245 33611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_21620 33877 33599 gene locus_tag LOCUS_21630 33877 33599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 34324 34052 gene locus_tag LOCUS_21640 34324 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 34786 35475 gene locus_tag LOCUS_21650 gene cmk 34786 35475 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_21650 35465 36385 gene locus_tag LOCUS_21660 gene ispH 35465 36385 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_21660 36491 37870 gene locus_tag LOCUS_21670 gene nqrA 36491 37870 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_21670 37924 39117 gene locus_tag LOCUS_21680 gene nqrB 37924 39117 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_21680 39104 39850 gene locus_tag LOCUS_21690 gene nqrC 39104 39850 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_21690 39869 40555 gene locus_tag LOCUS_21700 gene nqrD 39869 40555 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_21700 40574 41185 gene locus_tag LOCUS_21710 gene nqrE 40574 41185 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_21710 41273 41839 gene locus_tag LOCUS_21720 41273 41839 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926725.1 protein_id gnl|my_center|LOCUS_21720 42187 45432 gene locus_tag LOCUS_21730 42187 45432 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UE7 protein_id gnl|my_center|LOCUS_21730 45851 48676 gene locus_tag LOCUS_21740 45851 48676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_21740 48811 49251 gene locus_tag LOCUS_21750 48811 49251 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_21750 49327 49758 gene locus_tag LOCUS_21760 49327 49758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 49839 50027 gene locus_tag LOCUS_21770 49839 50027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21770 50091 53768 gene locus_tag LOCUS_21780 50091 53768 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_21780 54190 54573 gene locus_tag LOCUS_21790 54190 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 54649 55860 gene locus_tag LOCUS_21800 54649 55860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 55936 57606 gene locus_tag LOCUS_21810 55936 57606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 57672 58979 gene locus_tag LOCUS_21820 57672 58979 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_21820 58981 59682 gene locus_tag LOCUS_21830 58981 59682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 59723 60250 gene locus_tag LOCUS_21840 59723 60250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 60536 60859 gene locus_tag LOCUS_21850 gene trx2 60536 60859 CDS product thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE49 protein_id gnl|my_center|LOCUS_21850 60953 61888 gene locus_tag LOCUS_21860 gene purC 60953 61888 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_21860 61941 62324 gene locus_tag LOCUS_21870 61941 62324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 62331 63245 gene locus_tag LOCUS_21880 gene rnz 62331 63245 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_21880 63247 64050 gene locus_tag LOCUS_21890 63247 64050 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_21890 64146 64661 gene locus_tag LOCUS_21900 64146 64661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence20 1240 329 gene locus_tag LOCUS_21910 1240 329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_21910 2314 1604 gene locus_tag LOCUS_21920 2314 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_21920 3549 2314 gene locus_tag LOCUS_21930 3549 2314 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946127.1 protein_id gnl|my_center|LOCUS_21930 5014 3551 gene locus_tag LOCUS_21940 5014 3551 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_21940 5712 5011 gene locus_tag LOCUS_21950 5712 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946129.1 protein_id gnl|my_center|LOCUS_21950 6804 5833 gene locus_tag LOCUS_21960 6804 5833 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_21960 6944 7168 gene locus_tag LOCUS_21970 6944 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7592 9004 gene locus_tag LOCUS_21980 gene trpE 7592 9004 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_21980 9014 9619 gene locus_tag LOCUS_21990 9014 9619 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_21990 9801 10787 gene locus_tag LOCUS_22000 gene trpD 9801 10787 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_22000 10934 11752 gene locus_tag LOCUS_22010 gene trpC 10934 11752 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_22010 11785 12426 gene locus_tag LOCUS_22020 gene trpF 11785 12426 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_22020 12481 13716 gene locus_tag LOCUS_22030 gene trpB 12481 13716 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_22030 13814 14608 gene locus_tag LOCUS_22040 gene trpA 13814 14608 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_22040 14756 15769 gene locus_tag LOCUS_22050 14756 15769 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_22050 16723 16007 gene locus_tag LOCUS_22060 16723 16007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_22060 17319 16720 gene locus_tag LOCUS_22070 17319 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 18350 17493 gene locus_tag LOCUS_22080 18350 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 19527 18415 gene locus_tag LOCUS_22090 19527 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 19628 20836 gene locus_tag LOCUS_22100 19628 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 22229 20889 gene locus_tag LOCUS_22110 22229 20889 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_22110 23662 22232 gene locus_tag LOCUS_22120 23662 22232 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_22120 24356 23679 gene locus_tag LOCUS_22130 gene sdhB 24356 23679 CDS product putative L-serine dehydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_270097.1 protein_id gnl|my_center|LOCUS_22130 24417 25274 gene locus_tag LOCUS_22140 24417 25274 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_22140 25719 25276 gene locus_tag LOCUS_22150 25719 25276 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_22150 25787 26581 gene locus_tag LOCUS_22160 25787 26581 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22160 26625 28262 gene locus_tag LOCUS_22170 26625 28262 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_22170 28348 28686 gene locus_tag LOCUS_22180 28348 28686 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_22180 28693 29472 gene locus_tag LOCUS_22190 28693 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 29518 30099 gene locus_tag LOCUS_22200 29518 30099 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_22200 30205 31179 gene locus_tag LOCUS_22210 30205 31179 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533099.1 protein_id gnl|my_center|LOCUS_22210 31681 31325 gene locus_tag LOCUS_22220 31681 31325 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_22220 31905 31678 gene locus_tag LOCUS_22230 31905 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 33347 32004 gene locus_tag LOCUS_22240 33347 32004 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889313.1 protein_id gnl|my_center|LOCUS_22240 33446 34222 gene locus_tag LOCUS_22250 gene pcaR 33446 34222 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_22250 34226 35278 gene locus_tag LOCUS_22260 34226 35278 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731480.1 protein_id gnl|my_center|LOCUS_22260 35340 35534 gene locus_tag LOCUS_22270 35340 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 35531 35920 gene locus_tag LOCUS_22280 gene vapC 35531 35920 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_22280 36150 36470 gene locus_tag LOCUS_22290 36150 36470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_22290 36467 36853 gene locus_tag LOCUS_22300 36467 36853 CDS product UPF0332 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X095 protein_id gnl|my_center|LOCUS_22300 36978 37616 gene locus_tag LOCUS_22310 36978 37616 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_22310 37628 38575 gene locus_tag LOCUS_22320 37628 38575 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969705.1 protein_id gnl|my_center|LOCUS_22320 38595 39047 gene locus_tag LOCUS_22330 38595 39047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_22330 40501 39116 gene locus_tag LOCUS_22340 40501 39116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 41351 40725 gene locus_tag LOCUS_22350 41351 40725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 41595 42251 gene locus_tag LOCUS_22360 41595 42251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_22360 42257 44056 gene locus_tag LOCUS_22370 42257 44056 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_22370 44771 44127 gene locus_tag LOCUS_22380 44771 44127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 46564 44927 gene locus_tag LOCUS_22390 46564 44927 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_22390 46717 50790 gene locus_tag LOCUS_22400 46717 50790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 50790 52898 gene locus_tag LOCUS_22410 50790 52898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 53006 55168 gene locus_tag LOCUS_22420 53006 55168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 55818 55225 gene locus_tag LOCUS_22430 55818 55225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 55857 57017 gene locus_tag LOCUS_22440 gene bioF 55857 57017 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_22440 57014 57622 gene locus_tag LOCUS_22450 gene bioD 57014 57622 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_22450 57619 58893 gene locus_tag LOCUS_22460 gene bioA 57619 58893 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_22460 59454 62975 gene locus_tag LOCUS_22470 59454 62975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 62956 63510 gene locus_tag LOCUS_22480 62956 63510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 63587 64504 gene locus_tag LOCUS_22490 63587 64504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence21 167 475 gene locus_tag LOCUS_22500 167 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 608 1627 gene locus_tag LOCUS_22510 608 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1684 3969 gene locus_tag LOCUS_22520 1684 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4570 4031 gene locus_tag LOCUS_22530 4570 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4745 5494 gene locus_tag LOCUS_22540 gene ste14 4745 5494 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_22540 6192 5569 gene locus_tag LOCUS_22550 6192 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 6911 6225 gene locus_tag LOCUS_22560 6911 6225 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_22560 7328 7173 gene locus_tag LOCUS_22570 7328 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 7318 8754 gene locus_tag LOCUS_22580 7318 8754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_22580 9098 8742 gene locus_tag LOCUS_22590 9098 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_22590 9361 9131 gene locus_tag LOCUS_22600 9361 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 11346 9391 gene locus_tag LOCUS_22610 gene ispG 11346 9391 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4T0 protein_id gnl|my_center|LOCUS_22610 12055 11471 gene locus_tag LOCUS_22620 12055 11471 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_22620 13494 12052 gene locus_tag LOCUS_22630 13494 12052 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_22630 14680 13550 gene locus_tag LOCUS_22640 14680 13550 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_22640 14883 15311 gene locus_tag LOCUS_22650 14883 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 16025 15372 gene locus_tag LOCUS_22660 16025 15372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 16724 16167 gene locus_tag LOCUS_22670 gene def 16724 16167 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_22670 17141 16728 gene locus_tag LOCUS_22680 17141 16728 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_22680 17893 17144 gene locus_tag LOCUS_22690 gene dnrN 17893 17144 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_22690 18089 19624 gene locus_tag LOCUS_22700 18089 19624 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_22700 19646 20806 gene locus_tag LOCUS_22710 gene hmgA 19646 20806 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_22710 20808 21074 gene locus_tag LOCUS_22720 20808 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 21056 21457 gene locus_tag LOCUS_22730 21056 21457 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_22730 21474 22871 gene locus_tag LOCUS_22740 21474 22871 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_22740 23306 23064 gene locus_tag LOCUS_22750 23306 23064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 25026 23611 gene locus_tag LOCUS_22760 gene dnaA 25026 23611 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_22760 25344 27149 gene locus_tag LOCUS_22770 25344 27149 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_22770 27146 29287 gene locus_tag LOCUS_22780 gene mcm3 27146 29287 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_22780 29330 30013 gene locus_tag LOCUS_22790 29330 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 30019 30225 gene locus_tag LOCUS_22800 30019 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 30344 31480 gene locus_tag LOCUS_22810 30344 31480 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_22810 32264 31680 gene locus_tag LOCUS_22820 32264 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 32424 34865 gene locus_tag LOCUS_22830 32424 34865 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_22830 34862 35758 gene locus_tag LOCUS_22840 34862 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 35765 36649 gene locus_tag LOCUS_22850 35765 36649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 36687 37736 gene locus_tag LOCUS_22860 36687 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 38782 37721 gene locus_tag LOCUS_22870 38782 37721 CDS product acetylneuraminic acid synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937656.1 protein_id gnl|my_center|LOCUS_22870 40415 38784 gene locus_tag LOCUS_22880 40415 38784 CDS product cytidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_22880 41371 40424 gene locus_tag LOCUS_22890 41371 40424 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383748.1 protein_id gnl|my_center|LOCUS_22890 41455 41940 gene locus_tag LOCUS_22900 41455 41940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 41937 43514 gene locus_tag LOCUS_22910 41937 43514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 44842 43688 gene locus_tag LOCUS_22920 44842 43688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 46280 44925 gene locus_tag LOCUS_22930 46280 44925 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_22930 46565 48901 gene locus_tag LOCUS_22940 46565 48901 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_22940 48995 50140 gene locus_tag LOCUS_22950 48995 50140 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_22950 50245 50955 gene locus_tag LOCUS_22960 50245 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 50991 51812 gene locus_tag LOCUS_22970 50991 51812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108780.1 protein_id gnl|my_center|LOCUS_22970 51827 53509 gene locus_tag LOCUS_22980 gene menD 51827 53509 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_22980 53652 54350 gene locus_tag LOCUS_22990 gene menB 53652 54350 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22990 54428 54670 gene locus_tag LOCUS_23000 54428 54670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 54667 55017 gene locus_tag LOCUS_23010 54667 55017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 56629 55262 gene locus_tag LOCUS_23020 56629 55262 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_23020 56980 56684 gene locus_tag LOCUS_23030 56980 56684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_23030 57594 56977 gene locus_tag LOCUS_23040 57594 56977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_23040 58420 57671 gene locus_tag LOCUS_23050 58420 57671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 58741 58532 gene locus_tag LOCUS_23060 58741 58532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence22 3773 99 gene locus_tag LOCUS_23070 3773 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23070 5960 3777 gene locus_tag LOCUS_23080 5960 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 6557 6066 gene locus_tag LOCUS_23090 gene folA 6557 6066 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHY1 protein_id gnl|my_center|LOCUS_23090 7100 7960 gene locus_tag LOCUS_23100 7100 7960 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_23100 8134 8499 gene locus_tag LOCUS_23110 8134 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 10323 8596 gene locus_tag LOCUS_23120 10323 8596 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_23120 10566 11426 gene locus_tag LOCUS_23130 10566 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 11429 11851 gene locus_tag LOCUS_23140 11429 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11956 12426 gene locus_tag LOCUS_23150 11956 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 12433 13218 gene locus_tag LOCUS_23160 gene truA 12433 13218 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE4 protein_id gnl|my_center|LOCUS_23160 13388 14974 gene locus_tag LOCUS_23170 13388 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 14984 15217 gene locus_tag LOCUS_23180 14984 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 15630 15301 gene locus_tag LOCUS_23190 15630 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 16097 16327 gene locus_tag LOCUS_23200 16097 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 16324 16611 gene locus_tag LOCUS_23210 16324 16611 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_23210 17836 16955 gene locus_tag LOCUS_23220 gene cysM 17836 16955 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_23220 18650 17838 gene locus_tag LOCUS_23230 18650 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 19673 18654 gene locus_tag LOCUS_23240 19673 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_23240 20554 19724 gene locus_tag LOCUS_23250 20554 19724 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_23250 20690 22711 gene locus_tag LOCUS_23260 20690 22711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 24849 22852 gene locus_tag LOCUS_23270 24849 22852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 25097 25270 gene locus_tag LOCUS_23280 25097 25270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 26435 25281 gene locus_tag LOCUS_23290 26435 25281 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_23290 27357 26959 gene locus_tag LOCUS_23300 27357 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 28457 27468 gene locus_tag LOCUS_23310 28457 27468 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_23310 29349 28471 gene locus_tag LOCUS_23320 29349 28471 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_23320 30677 29376 gene locus_tag LOCUS_23330 gene phrB1 30677 29376 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_23330 35351 30732 gene locus_tag LOCUS_23340 35351 30732 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_23340 35357 36379 gene locus_tag LOCUS_23350 gene tsaD 35357 36379 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_23350 36376 36771 gene locus_tag LOCUS_23360 36376 36771 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228335.1 protein_id gnl|my_center|LOCUS_23360 36801 37265 gene locus_tag LOCUS_23370 gene smpB 36801 37265 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_23370 37269 38060 gene locus_tag LOCUS_23380 37269 38060 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_23380 38104 38625 gene locus_tag LOCUS_23390 38104 38625 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_23390 40855 38693 gene locus_tag LOCUS_23400 gene glnA 40855 38693 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_23400 41266 42516 gene locus_tag LOCUS_23410 41266 42516 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_23410 43656 42661 gene locus_tag LOCUS_23420 gene gapA 43656 42661 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_23420 43831 43903 gene locus_tag LOCUS_t00190 43831 43903 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44143 44215 gene locus_tag LOCUS_t00200 44143 44215 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44230 44535 gene locus_tag LOCUS_23430 44230 44535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 44956 44762 gene locus_tag LOCUS_23440 44956 44762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 48526 44978 gene locus_tag LOCUS_23450 gene smc 48526 44978 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_23450 48825 50945 gene locus_tag LOCUS_23460 48825 50945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 51007 51321 gene locus_tag LOCUS_23470 51007 51321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 51326 52531 gene locus_tag LOCUS_23480 51326 52531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 52600 53133 gene locus_tag LOCUS_23490 52600 53133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 53590 53117 gene locus_tag LOCUS_23500 53590 53117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 54960 53692 gene locus_tag LOCUS_23510 54960 53692 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_23510 55326 54970 gene locus_tag LOCUS_23520 55326 54970 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_23520 57473 55638 gene locus_tag LOCUS_23530 57473 55638 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence23 552 1811 gene locus_tag LOCUS_23540 552 1811 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_23540 1811 3154 gene locus_tag LOCUS_23550 1811 3154 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_23550 3147 4604 gene locus_tag LOCUS_23560 3147 4604 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_23560 4652 5053 gene locus_tag LOCUS_23570 4652 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5219 5518 gene locus_tag LOCUS_23580 5219 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 6195 5671 gene locus_tag LOCUS_23590 6195 5671 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403323.1 protein_id gnl|my_center|LOCUS_23590 7412 6279 gene locus_tag LOCUS_23600 7412 6279 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_23600 8497 7679 gene locus_tag LOCUS_23610 8497 7679 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K0 protein_id gnl|my_center|LOCUS_23610 8631 9221 gene locus_tag LOCUS_23620 gene yceI 8631 9221 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_23620 9296 9820 gene locus_tag LOCUS_23630 9296 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 12356 10134 gene locus_tag LOCUS_23640 12356 10134 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_23640 12589 12897 gene locus_tag LOCUS_23650 12589 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 12894 13523 gene locus_tag LOCUS_23660 12894 13523 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_23660 13646 15061 gene locus_tag LOCUS_23670 13646 15061 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_23670 15179 16477 gene locus_tag LOCUS_23680 15179 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 18401 16479 gene locus_tag LOCUS_23690 18401 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 19148 18657 gene locus_tag LOCUS_23700 19148 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 19672 19148 gene locus_tag LOCUS_23710 19672 19148 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_23710 19861 21060 gene locus_tag LOCUS_23720 19861 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 21446 21045 gene locus_tag LOCUS_23730 21446 21045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 22134 21430 gene locus_tag LOCUS_23740 gene radC 22134 21430 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_23740 22596 22342 gene locus_tag LOCUS_23750 gene rpsT 22596 22342 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A276 protein_id gnl|my_center|LOCUS_23750 23005 23847 gene locus_tag LOCUS_23760 23005 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 24057 24836 gene locus_tag LOCUS_23770 24057 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 26352 24910 gene locus_tag LOCUS_23780 26352 24910 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_23780 28957 26519 gene locus_tag LOCUS_23790 28957 26519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_23790 30664 29378 gene locus_tag LOCUS_23800 30664 29378 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KM3 protein_id gnl|my_center|LOCUS_23800 31453 30833 gene locus_tag LOCUS_23810 31453 30833 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882764.1 protein_id gnl|my_center|LOCUS_23810 31635 32396 gene locus_tag LOCUS_23820 31635 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 33379 32399 gene locus_tag LOCUS_23830 33379 32399 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_23830 34286 33429 gene locus_tag LOCUS_23840 34286 33429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_23840 35270 34290 gene locus_tag LOCUS_23850 gene pfkA 35270 34290 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_23850 35364 36092 gene locus_tag LOCUS_23860 35364 36092 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_23860 36304 38130 gene locus_tag LOCUS_23870 gene wbtH 36304 38130 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_23870 38602 38763 gene locus_tag LOCUS_23880 38602 38763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23880 38881 39465 gene locus_tag LOCUS_23890 38881 39465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23890 39858 39472 gene locus_tag LOCUS_23900 39858 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 40005 40415 gene locus_tag LOCUS_23910 40005 40415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 41013 40456 gene locus_tag LOCUS_23920 41013 40456 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_23920 42331 41090 gene locus_tag LOCUS_23930 42331 41090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 42879 42466 gene locus_tag LOCUS_23940 42879 42466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 43415 42954 gene locus_tag LOCUS_23950 43415 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 44119 43676 gene locus_tag LOCUS_23960 44119 43676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 45026 44658 gene locus_tag LOCUS_23970 45026 44658 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_23970 45333 45037 gene locus_tag LOCUS_23980 45333 45037 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_23980 46075 45737 gene locus_tag LOCUS_23990 46075 45737 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_23990 46373 46065 gene locus_tag LOCUS_24000 46373 46065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_24000 48222 46615 gene locus_tag LOCUS_24010 gene pafA 48222 46615 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_24010 50960 48498 gene locus_tag LOCUS_24020 50960 48498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 51245 52180 gene locus_tag LOCUS_24030 51245 52180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 52180 53295 gene locus_tag LOCUS_24040 52180 53295 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_24040 53868 53419 gene locus_tag LOCUS_24050 53868 53419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 55181 54039 gene locus_tag LOCUS_24060 55181 54039 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence24 3648 4889 gene locus_tag LOCUS_24070 3648 4889 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_24070 5229 6971 gene locus_tag LOCUS_24080 5229 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_24080 6968 7123 gene locus_tag LOCUS_24090 6968 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7116 7931 gene locus_tag LOCUS_24100 7116 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 7942 8178 gene locus_tag LOCUS_24110 7942 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 9728 8715 gene locus_tag LOCUS_24120 9728 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10422 11678 gene locus_tag LOCUS_24130 10422 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14282 11769 gene locus_tag LOCUS_24140 14282 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 15165 14473 gene locus_tag LOCUS_24150 15165 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 15339 16244 gene locus_tag LOCUS_24160 15339 16244 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_24160 16329 16610 gene locus_tag LOCUS_24170 16329 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_24170 16610 16894 gene locus_tag LOCUS_24180 16610 16894 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_24180 17603 17019 gene locus_tag LOCUS_24190 17603 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 17895 19421 gene locus_tag LOCUS_24200 gene purH 17895 19421 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_24200 19534 20562 gene locus_tag LOCUS_24210 gene mreB 19534 20562 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_24210 20726 21502 gene locus_tag LOCUS_24220 20726 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 21495 22016 gene locus_tag LOCUS_24230 21495 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 22013 23824 gene locus_tag LOCUS_24240 22013 23824 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_24240 23821 25089 gene locus_tag LOCUS_24250 gene rodA 23821 25089 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_24250 26142 25090 gene locus_tag LOCUS_24260 26142 25090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 27532 26144 gene locus_tag LOCUS_24270 27532 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_24270 28707 27547 gene locus_tag LOCUS_24280 28707 27547 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_24280 29749 28793 gene locus_tag LOCUS_24290 29749 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 29782 30105 gene locus_tag LOCUS_24300 29782 30105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 30324 30902 gene locus_tag LOCUS_24310 gene tdk 30324 30902 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_24310 31215 33308 gene locus_tag LOCUS_24320 31215 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 33312 34001 gene locus_tag LOCUS_24330 gene recO 33312 34001 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_24330 34696 34052 gene locus_tag LOCUS_24340 34696 34052 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_24340 35548 34781 gene locus_tag LOCUS_24350 35548 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 35645 36811 gene locus_tag LOCUS_24360 35645 36811 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_24360 36808 37509 gene locus_tag LOCUS_24370 36808 37509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 37915 37499 gene locus_tag LOCUS_24380 37915 37499 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_24380 38127 37912 gene locus_tag LOCUS_24390 38127 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 40445 38316 gene locus_tag LOCUS_24400 40445 38316 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_24400 40630 42210 gene locus_tag LOCUS_24410 40630 42210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 43672 42272 gene locus_tag LOCUS_24420 43672 42272 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_24420 44543 44139 gene locus_tag LOCUS_24430 gene rnk-2 44543 44139 CDS product RNA polymerase-binding protein Rnk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941503.1 protein_id gnl|my_center|LOCUS_24430 45866 44568 gene locus_tag LOCUS_24440 45866 44568 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 protein_id gnl|my_center|LOCUS_24440 46119 45859 gene locus_tag LOCUS_24450 46119 45859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 47488 47084 gene locus_tag LOCUS_24460 47488 47084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 49152 47809 gene locus_tag LOCUS_24470 gene zraR 49152 47809 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148547.1 protein_id gnl|my_center|LOCUS_24470 50248 49157 gene locus_tag LOCUS_24480 50248 49157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24480 >Feature sequence25 5117 633 gene locus_tag LOCUS_24490 5117 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5256 5831 gene locus_tag LOCUS_24500 5256 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_24500 6028 6783 gene locus_tag LOCUS_24510 6028 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6794 7570 gene locus_tag LOCUS_24520 6794 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 10427 7983 gene locus_tag LOCUS_24530 10427 7983 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_24530 11205 10513 gene locus_tag LOCUS_24540 11205 10513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_24540 11377 13287 gene locus_tag LOCUS_24550 gene gaa 11377 13287 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_24550 13414 14289 gene locus_tag LOCUS_24560 gene czcD 13414 14289 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_24560 16447 14552 gene locus_tag LOCUS_24570 gene asnB 16447 14552 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_24570 17143 16601 gene locus_tag LOCUS_24580 17143 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 17466 17143 gene locus_tag LOCUS_24590 17466 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 18196 17471 gene locus_tag LOCUS_24600 18196 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 19752 18328 gene locus_tag LOCUS_24610 19752 18328 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_24610 21125 19749 gene locus_tag LOCUS_24620 21125 19749 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_24620 22851 21118 gene locus_tag LOCUS_24630 22851 21118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_24630 23533 22853 gene locus_tag LOCUS_24640 23533 22853 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_24640 25022 23607 gene locus_tag LOCUS_24650 gene glcD 25022 23607 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_24650 25050 25547 gene locus_tag LOCUS_24660 25050 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 25742 25816 gene locus_tag LOCUS_t00210 25742 25816 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25905 26312 gene locus_tag LOCUS_24670 25905 26312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 26608 33210 gene locus_tag LOCUS_24680 26608 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 33197 34210 gene locus_tag LOCUS_24690 33197 34210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 34207 35676 gene locus_tag LOCUS_24700 34207 35676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 35712 36080 gene locus_tag LOCUS_24710 35712 36080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 36150 38210 gene locus_tag LOCUS_24720 36150 38210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 38558 38992 gene locus_tag LOCUS_24730 38558 38992 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_24730 39000 40022 gene locus_tag LOCUS_24740 39000 40022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 40019 40405 gene locus_tag LOCUS_24750 40019 40405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_24750 42873 40459 gene locus_tag LOCUS_24760 42873 40459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_24760 43191 44099 gene locus_tag LOCUS_24770 43191 44099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 44096 44848 gene locus_tag LOCUS_24780 44096 44848 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_24780 46078 45092 gene locus_tag LOCUS_24790 46078 45092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_24790 <48325 46094 gene locus_tag LOCUS_24800 <48325 46094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence26 768 262 gene locus_tag LOCUS_24810 768 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3230 960 gene locus_tag LOCUS_24820 gene uvrD 3230 960 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_24820 4157 3453 gene locus_tag LOCUS_24830 4157 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5451 4378 gene locus_tag LOCUS_24840 5451 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_24840 5615 5878 gene locus_tag LOCUS_24850 5615 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_24850 6710 6321 gene locus_tag LOCUS_24860 6710 6321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_24860 8405 6717 gene locus_tag LOCUS_24870 8405 6717 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_24870 8992 8408 gene locus_tag LOCUS_24880 8992 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_24880 9294 10418 gene locus_tag LOCUS_24890 9294 10418 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_24890 10860 11312 gene locus_tag LOCUS_24900 10860 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 11390 12028 gene locus_tag LOCUS_24910 gene mrsA 11390 12028 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_24910 12417 12079 gene locus_tag LOCUS_24920 gene arsC 12417 12079 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_24920 13395 12496 gene locus_tag LOCUS_24930 gene xerC 13395 12496 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_24930 13407 13841 gene locus_tag LOCUS_24940 gene aroQ 13407 13841 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR7 protein_id gnl|my_center|LOCUS_24940 13838 14212 gene locus_tag LOCUS_24950 gene mgsA 13838 14212 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ00 protein_id gnl|my_center|LOCUS_24950 14321 16039 gene locus_tag LOCUS_24960 gene glsF 14321 16039 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_24960 16928 16260 gene locus_tag LOCUS_24970 16928 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 17278 17207 gene locus_tag LOCUS_t00220 17278 17207 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18378 17458 gene locus_tag LOCUS_24980 18378 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 18676 18485 gene locus_tag LOCUS_24990 18676 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 20443 18722 gene locus_tag LOCUS_25000 20443 18722 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_25000 21779 20784 gene locus_tag LOCUS_25010 21779 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 22334 22014 gene locus_tag LOCUS_25020 22334 22014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 23375 22656 gene locus_tag LOCUS_25030 23375 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403968.1 protein_id gnl|my_center|LOCUS_25030 23575 23853 gene locus_tag LOCUS_25040 gene groS 23575 23853 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_25040 23884 25533 gene locus_tag LOCUS_25050 gene groL 23884 25533 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_25050 25639 26028 gene locus_tag LOCUS_25060 25639 26028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 26660 26031 gene locus_tag LOCUS_25070 gene yplQ 26660 26031 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54175 protein_id gnl|my_center|LOCUS_25070 26918 27151 gene locus_tag LOCUS_25080 26918 27151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 27603 28418 gene locus_tag LOCUS_25090 27603 28418 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356143.1 protein_id gnl|my_center|LOCUS_25090 28460 29857 gene locus_tag LOCUS_25100 28460 29857 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_25100 30316 29927 gene locus_tag LOCUS_25110 30316 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_25110 30476 33013 gene locus_tag LOCUS_25120 30476 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 33010 36219 gene locus_tag LOCUS_25130 33010 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 36216 37580 gene locus_tag LOCUS_25140 36216 37580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 37587 40688 gene locus_tag LOCUS_25150 37587 40688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 40685 41776 gene locus_tag LOCUS_25160 40685 41776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 41773 43074 gene locus_tag LOCUS_25170 41773 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence27 560 189 gene locus_tag LOCUS_25180 gene crcB 560 189 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_25180 1393 557 gene locus_tag LOCUS_25190 1393 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3529 1643 gene locus_tag LOCUS_25200 gene htpG 3529 1643 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_25200 3802 4434 gene locus_tag LOCUS_25210 3802 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 5339 4470 gene locus_tag LOCUS_25220 5339 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 6149 5346 gene locus_tag LOCUS_25230 6149 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 8113 6149 gene locus_tag LOCUS_25240 8113 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 8802 8320 gene locus_tag LOCUS_25250 8802 8320 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_25250 9015 9263 gene locus_tag LOCUS_25260 9015 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9260 9682 gene locus_tag LOCUS_25270 9260 9682 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_25270 9815 10078 gene locus_tag LOCUS_25280 9815 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 10075 10389 gene locus_tag LOCUS_25290 10075 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 10386 10592 gene locus_tag LOCUS_25300 10386 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 10660 11376 gene locus_tag LOCUS_25310 10660 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 11432 12028 gene locus_tag LOCUS_25320 11432 12028 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_25320 12198 14444 gene locus_tag LOCUS_25330 gene katG 12198 14444 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q939D2 protein_id gnl|my_center|LOCUS_25330 14533 15048 gene locus_tag LOCUS_25340 14533 15048 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E1 protein_id gnl|my_center|LOCUS_25340 15567 17777 gene locus_tag LOCUS_25350 gene katG 15567 17777 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_25350 18217 18795 gene locus_tag LOCUS_25360 18217 18795 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_25360 18796 19083 gene locus_tag LOCUS_25370 gene gatC1 18796 19083 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58251 protein_id gnl|my_center|LOCUS_25370 19502 22096 gene locus_tag LOCUS_25380 19502 22096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 22173 22892 gene locus_tag LOCUS_25390 22173 22892 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_25390 23045 23695 gene locus_tag LOCUS_25400 23045 23695 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964764.1 protein_id gnl|my_center|LOCUS_25400 23744 24841 gene locus_tag LOCUS_25410 gene lpxB 23744 24841 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_25410 25747 24854 gene locus_tag LOCUS_25420 gene fmt 25747 24854 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_25420 26129 29779 gene locus_tag LOCUS_25430 26129 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 29782 33210 gene locus_tag LOCUS_25440 29782 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_25440 34060 33308 gene locus_tag LOCUS_25450 34060 33308 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_25450 34795 34064 gene locus_tag LOCUS_25460 34795 34064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_25460 35022 35726 gene locus_tag LOCUS_25470 35022 35726 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_25470 35731 36852 gene locus_tag LOCUS_25480 35731 36852 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_25480 36975 38855 gene locus_tag LOCUS_25490 gene wbpM 36975 38855 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_25490 40027 39338 gene locus_tag LOCUS_25500 40027 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 40181 42055 gene locus_tag LOCUS_25510 40181 42055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_25510 42231 42315 gene locus_tag LOCUS_t00230 42231 42315 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 164 928 gene locus_tag LOCUS_25520 gene rlmF 164 928 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YP0 protein_id gnl|my_center|LOCUS_25520 2387 1290 gene locus_tag LOCUS_25530 2387 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 6613 2384 gene locus_tag LOCUS_25540 6613 2384 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_25540 7150 6749 gene locus_tag LOCUS_25550 7150 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 10131 7504 gene locus_tag LOCUS_25560 gene valS 10131 7504 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_25560 11752 10478 gene locus_tag LOCUS_25570 gene fahA 11752 10478 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_25570 14279 12117 gene locus_tag LOCUS_25580 gene pepX1 14279 12117 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_25580 14861 14559 gene locus_tag LOCUS_25590 14861 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 15103 14858 gene locus_tag LOCUS_25600 15103 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 15542 17557 gene locus_tag LOCUS_25610 gene ligA 15542 17557 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_25610 17562 18092 gene locus_tag LOCUS_25620 17562 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 18064 18963 gene locus_tag LOCUS_25630 gene dapA 18064 18963 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_25630 21107 19068 gene locus_tag LOCUS_25640 21107 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 22964 21201 gene locus_tag LOCUS_25650 gene fbh1 22964 21201 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_25650 27234 23128 gene locus_tag LOCUS_25660 27234 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 28104 27376 gene locus_tag LOCUS_25670 gene yueD 28104 27376 CDS product benzil reductase ((S)-benzoin forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32099 protein_id gnl|my_center|LOCUS_25670 29618 28230 gene locus_tag LOCUS_25680 gene hslU 29618 28230 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_25680 30664 29615 gene locus_tag LOCUS_25690 30664 29615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 33156 30661 gene locus_tag LOCUS_25700 gene lon 33156 30661 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_25700 33435 35306 gene locus_tag LOCUS_25710 33435 35306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 36707 35307 gene locus_tag LOCUS_25720 36707 35307 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_25720 37876 37151 gene locus_tag LOCUS_25730 37876 37151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 38110 38183 gene locus_tag LOCUS_t00240 38110 38183 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38374 38447 gene locus_tag LOCUS_t00250 38374 38447 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38521 38605 gene locus_tag LOCUS_t00260 38521 38605 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 914 303 gene locus_tag LOCUS_25740 914 303 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_25740 976 2112 gene locus_tag LOCUS_25750 976 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_25750 2774 2214 gene locus_tag LOCUS_25760 gene frr 2774 2214 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_25760 3494 2781 gene locus_tag LOCUS_25770 gene pyrH 3494 2781 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_25770 4067 3567 gene locus_tag LOCUS_25780 gene pycA 4067 3567 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_25780 4411 4494 gene locus_tag LOCUS_t00270 4411 4494 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4572 4645 gene locus_tag LOCUS_t00280 4572 4645 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4742 4814 gene locus_tag LOCUS_t00290 4742 4814 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4874 6061 gene locus_tag LOCUS_25790 gene tuf 4874 6061 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_25790 6177 6250 gene locus_tag LOCUS_t00300 6177 6250 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6271 6462 gene locus_tag LOCUS_25800 6271 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 6485 7036 gene locus_tag LOCUS_25810 gene nusG 6485 7036 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_25810 7041 7484 gene locus_tag LOCUS_25820 gene rplK 7041 7484 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_25820 7497 8195 gene locus_tag LOCUS_25830 gene rplA 7497 8195 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_25830 8197 8727 gene locus_tag LOCUS_25840 8197 8727 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_25840 8775 9152 gene locus_tag LOCUS_25850 gene rplL 8775 9152 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_25850 9325 13197 gene locus_tag LOCUS_25860 gene rpoB 9325 13197 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_25860 13249 17547 gene locus_tag LOCUS_25870 gene rpoC 13249 17547 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_25870 17582 17908 gene locus_tag LOCUS_25880 17582 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_25880 18035 18409 gene locus_tag LOCUS_25890 gene rpsL 18035 18409 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK4 protein_id gnl|my_center|LOCUS_25890 18416 18883 gene locus_tag LOCUS_25900 gene rpsG 18416 18883 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_25900 18895 21012 gene locus_tag LOCUS_25910 gene fusA 18895 21012 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_25910 21022 21327 gene locus_tag LOCUS_25920 gene rpsJ 21022 21327 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_25920 21506 22144 gene locus_tag LOCUS_25930 gene rplC 21506 22144 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_25930 22147 22773 gene locus_tag LOCUS_25940 gene rplD 22147 22773 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_25940 22779 23066 gene locus_tag LOCUS_25950 gene rplW 22779 23066 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_25950 23078 23899 gene locus_tag LOCUS_25960 gene rplB 23078 23899 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_25960 23903 24181 gene locus_tag LOCUS_25970 gene rpsS 23903 24181 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_25970 24181 24567 gene locus_tag LOCUS_25980 gene rplV 24181 24567 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_25980 24570 25304 gene locus_tag LOCUS_25990 gene rpsC 24570 25304 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL4 protein_id gnl|my_center|LOCUS_25990 25334 25765 gene locus_tag LOCUS_26000 gene rplP 25334 25765 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_26000 25762 25956 gene locus_tag LOCUS_26010 gene rpmC 25762 25956 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL6 protein_id gnl|my_center|LOCUS_26010 25965 26219 gene locus_tag LOCUS_26020 gene rpsQ 25965 26219 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_26020 26222 26590 gene locus_tag LOCUS_26030 gene rplN 26222 26590 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_26030 26595 26942 gene locus_tag LOCUS_26040 gene rplX 26595 26942 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_26040 26935 27492 gene locus_tag LOCUS_26050 gene rplE 26935 27492 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927L9 protein_id gnl|my_center|LOCUS_26050 27495 27764 gene locus_tag LOCUS_26060 gene rpsN 27495 27764 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_26060 27856 28254 gene locus_tag LOCUS_26070 gene rpsH 27856 28254 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_26070 28264 28818 gene locus_tag LOCUS_26080 gene rplF 28264 28818 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_26080 28827 29177 gene locus_tag LOCUS_26090 gene rplR 28827 29177 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A492 protein_id gnl|my_center|LOCUS_26090 29182 29700 gene locus_tag LOCUS_26100 gene rpsE 29182 29700 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_26100 29706 29888 gene locus_tag LOCUS_26110 gene rpmD 29706 29888 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J24 protein_id gnl|my_center|LOCUS_26110 29890 30336 gene locus_tag LOCUS_26120 gene rplO 29890 30336 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_26120 30338 31657 gene locus_tag LOCUS_26130 gene secY 30338 31657 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_26130 31667 31885 gene locus_tag LOCUS_26140 gene infA 31667 31885 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_26140 32012 32389 gene locus_tag LOCUS_26150 gene rpsM 32012 32389 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_26150 32400 32792 gene locus_tag LOCUS_26160 gene rpsK 32400 32792 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_26160 32818 33423 gene locus_tag LOCUS_26170 gene rpsD 32818 33423 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN4 protein_id gnl|my_center|LOCUS_26170 33451 34440 gene locus_tag LOCUS_26180 gene rpoA 33451 34440 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_26180 34446 35078 gene locus_tag LOCUS_26190 34446 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 35200 36294 gene locus_tag LOCUS_26200 gene carA 35200 36294 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_26200 36302 37576 gene locus_tag LOCUS_26210 gene eno2 36302 37576 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_26210 37755 37994 gene locus_tag LOCUS_26220 37755 37994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence30 969 1556 gene locus_tag LOCUS_26230 969 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4710 2188 gene locus_tag LOCUS_26240 gene priA 4710 2188 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_26240 6734 4707 gene locus_tag LOCUS_26250 gene yyaL 6734 4707 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_26250 7707 6721 gene locus_tag LOCUS_26260 7707 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_26260 8788 7817 gene locus_tag LOCUS_26270 gene pfkA 8788 7817 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_26270 8968 10053 gene locus_tag LOCUS_26280 8968 10053 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_26280 10840 10043 gene locus_tag LOCUS_26290 10840 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 11667 12539 gene locus_tag LOCUS_26300 gene mvaB 11667 12539 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_26300 12882 12646 gene locus_tag LOCUS_26310 12882 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 13663 13202 gene locus_tag LOCUS_26320 gene coaD 13663 13202 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_26320 14554 13667 gene locus_tag LOCUS_26330 14554 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 15131 14559 gene locus_tag LOCUS_26340 15131 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 15678 15172 gene locus_tag LOCUS_26350 15678 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 15719 16180 gene locus_tag LOCUS_26360 15719 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 16173 17576 gene locus_tag LOCUS_26370 16173 17576 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_26370 17685 18083 gene locus_tag LOCUS_26380 17685 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 19215 18145 gene locus_tag LOCUS_26390 19215 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 19744 19190 gene locus_tag LOCUS_26400 19744 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 20180 19701 gene locus_tag LOCUS_26410 20180 19701 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202433.1 protein_id gnl|my_center|LOCUS_26410 21553 20573 gene locus_tag LOCUS_26420 gene pdhB 21553 20573 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_26420 23536 21731 gene locus_tag LOCUS_26430 23536 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 protein_id gnl|my_center|LOCUS_26430 23944 25101 gene locus_tag LOCUS_26440 23944 25101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_26440 26258 25113 gene locus_tag LOCUS_26450 26258 25113 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_26450 26863 26294 gene locus_tag LOCUS_26460 26863 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 27533 26856 gene locus_tag LOCUS_26470 27533 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 28762 27569 gene locus_tag LOCUS_26480 gene argD 28762 27569 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_26480 29033 28773 gene locus_tag LOCUS_26490 29033 28773 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_26490 30405 29119 gene locus_tag LOCUS_26500 gene gltA 30405 29119 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_26500 <37666 30598 gene locus_tag LOCUS_26510 <37666 30598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence31 403 753 gene locus_tag LOCUS_26520 403 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 919 3888 gene locus_tag LOCUS_26530 919 3888 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_26530 7096 4184 gene locus_tag LOCUS_26540 gene gcvP 7096 4184 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_26540 7262 8704 gene locus_tag LOCUS_26550 7262 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 8716 8919 gene locus_tag LOCUS_26560 8716 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 9146 9943 gene locus_tag LOCUS_26570 gene noeI 9146 9943 CDS product nodulation protein noeI- methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122208.1 protein_id gnl|my_center|LOCUS_26570 10485 9976 gene locus_tag LOCUS_26580 10485 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 11267 10467 gene locus_tag LOCUS_26590 gene suhB 11267 10467 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_26590 12430 11267 gene locus_tag LOCUS_26600 12430 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_26600 13110 12427 gene locus_tag LOCUS_26610 gene rsmI 13110 12427 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_26610 13361 13131 gene locus_tag LOCUS_26620 13361 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 13686 13420 gene locus_tag LOCUS_26630 13686 13420 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_26630 15864 13753 gene locus_tag LOCUS_26640 15864 13753 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_26640 17216 15942 gene locus_tag LOCUS_26650 17216 15942 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_26650 17437 17216 gene locus_tag LOCUS_26660 17437 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 18054 17452 gene locus_tag LOCUS_26670 18054 17452 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_26670 19620 18316 gene locus_tag LOCUS_26680 19620 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_26680 20853 19633 gene locus_tag LOCUS_26690 20853 19633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_26690 21631 20915 gene locus_tag LOCUS_26700 gene coaX 21631 20915 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_26700 21668 22750 gene locus_tag LOCUS_26710 21668 22750 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_26710 22837 24063 gene locus_tag LOCUS_26720 22837 24063 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_26720 24248 25630 gene locus_tag LOCUS_26730 24248 25630 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_26730 25764 26072 gene locus_tag LOCUS_26740 25764 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 27060 26101 gene locus_tag LOCUS_26750 gene ftsY 27060 26101 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_26750 27363 27214 gene locus_tag LOCUS_26760 27363 27214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 27548 27366 gene locus_tag LOCUS_26770 gene rpmG 27548 27366 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_26770 27817 27578 gene locus_tag LOCUS_26780 gene rpmB 27817 27578 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_26780 28004 29284 gene locus_tag LOCUS_26790 gene rocD 28004 29284 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_26790 29672 29364 gene locus_tag LOCUS_26800 29672 29364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 29842 30015 gene locus_tag LOCUS_26810 29842 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 30037 31200 gene locus_tag LOCUS_26820 gene purM 30037 31200 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_26820 32327 31203 gene locus_tag LOCUS_26830 32327 31203 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_26830 32653 32447 gene locus_tag LOCUS_26840 32653 32447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 34151 32667 gene locus_tag LOCUS_26850 34151 32667 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_26850 34684 34322 gene locus_tag LOCUS_26860 34684 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_26860 35452 34763 gene locus_tag LOCUS_26870 35452 34763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907640.1 protein_id gnl|my_center|LOCUS_26870 36093 35509 gene locus_tag LOCUS_26880 36093 35509 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence32 358 98 gene locus_tag LOCUS_26890 358 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1135 2097 gene locus_tag LOCUS_26900 1135 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2103 2726 gene locus_tag LOCUS_26910 2103 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2726 3460 gene locus_tag LOCUS_26920 2726 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 4136 3486 gene locus_tag LOCUS_26930 4136 3486 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_26930 5541 4129 gene locus_tag LOCUS_26940 5541 4129 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7B2 protein_id gnl|my_center|LOCUS_26940 5811 7739 gene locus_tag LOCUS_26950 5811 7739 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067106.1 protein_id gnl|my_center|LOCUS_26950 7741 8256 gene locus_tag LOCUS_26960 7741 8256 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_26960 8249 8701 gene locus_tag LOCUS_26970 gene cheD 8249 8701 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X005 protein_id gnl|my_center|LOCUS_26970 8714 9070 gene locus_tag LOCUS_26980 8714 9070 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_26980 9070 10107 gene locus_tag LOCUS_26990 gene cheB 9070 10107 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN9 protein_id gnl|my_center|LOCUS_26990 10120 11943 gene locus_tag LOCUS_27000 gene cheA64H 10120 11943 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_27000 11975 12583 gene locus_tag LOCUS_27010 11975 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 12573 15488 gene locus_tag LOCUS_27020 12573 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15478 16323 gene locus_tag LOCUS_27030 gene cheR 15478 16323 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT5 protein_id gnl|my_center|LOCUS_27030 16540 16343 gene locus_tag LOCUS_27040 16540 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 17117 16509 gene locus_tag LOCUS_27050 17117 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 17330 17124 gene locus_tag LOCUS_27060 17330 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 18634 17408 gene locus_tag LOCUS_27070 18634 17408 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088659.1 protein_id gnl|my_center|LOCUS_27070 19046 18846 gene locus_tag LOCUS_27080 19046 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 20906 19254 gene locus_tag LOCUS_27090 gene pgi 20906 19254 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_27090 21176 21877 gene locus_tag LOCUS_27100 21176 21877 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_27100 21938 24103 gene locus_tag LOCUS_27110 gene rnr 21938 24103 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_27110 24498 24710 gene locus_tag LOCUS_27120 24498 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 27379 24995 gene locus_tag LOCUS_27130 27379 24995 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_27130 28831 27668 gene locus_tag LOCUS_27140 28831 27668 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_27140 29366 29013 gene locus_tag LOCUS_27150 29366 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_27150 29642 30091 gene locus_tag LOCUS_27160 29642 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 30327 30659 gene locus_tag LOCUS_27170 30327 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 30860 31246 gene locus_tag LOCUS_27180 30860 31246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27180 31575 31910 gene locus_tag LOCUS_27190 31575 31910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 32064 33815 gene locus_tag LOCUS_27200 32064 33815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 34025 35674 gene locus_tag LOCUS_27210 34025 35674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence33 202 399 gene locus_tag LOCUS_27220 202 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1370 405 gene locus_tag LOCUS_27230 1370 405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_27230 2222 1650 gene locus_tag LOCUS_27240 2222 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4444 2696 gene locus_tag LOCUS_27250 gene ygaD 4444 2696 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_27250 5368 4499 gene locus_tag LOCUS_27260 5368 4499 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y837 protein_id gnl|my_center|LOCUS_27260 6506 5451 gene locus_tag LOCUS_27270 gene rmlB 6506 5451 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_27270 6627 7706 gene locus_tag LOCUS_27280 6627 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 8225 7674 gene locus_tag LOCUS_27290 8225 7674 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_27290 8446 8970 gene locus_tag LOCUS_27300 8446 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 9067 9732 gene locus_tag LOCUS_27310 9067 9732 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_27310 9761 9973 gene locus_tag LOCUS_27320 9761 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 10024 10425 gene locus_tag LOCUS_27330 10024 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 10441 12972 gene locus_tag LOCUS_27340 10441 12972 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_27340 12969 13754 gene locus_tag LOCUS_27350 12969 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_27350 13920 14774 gene locus_tag LOCUS_27360 13920 14774 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_27360 15831 14839 gene locus_tag LOCUS_27370 15831 14839 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_27370 16843 16379 gene locus_tag LOCUS_27380 16843 16379 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_27380 17649 16981 gene locus_tag LOCUS_27390 17649 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17752 17618 gene locus_tag LOCUS_27400 17752 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 18736 17777 gene locus_tag LOCUS_27410 18736 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 19006 19827 gene locus_tag LOCUS_27420 19006 19827 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_27420 19897 21684 gene locus_tag LOCUS_27430 19897 21684 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_27430 21697 22479 gene locus_tag LOCUS_27440 21697 22479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_27440 22564 23475 gene locus_tag LOCUS_27450 22564 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_27450 23702 24361 gene locus_tag LOCUS_27460 23702 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 25110 24514 gene locus_tag LOCUS_27470 gene lspA 25110 24514 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_27470 28475 25113 gene locus_tag LOCUS_27480 gene ileS 28475 25113 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_27480 30838 28478 gene locus_tag LOCUS_27490 30838 28478 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_27490 31250 32200 gene locus_tag LOCUS_27500 31250 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence34 12561 121 gene locus_tag LOCUS_27510 12561 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 13757 12585 gene locus_tag LOCUS_27520 13757 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 14791 13754 gene locus_tag LOCUS_27530 14791 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 17909 14778 gene locus_tag LOCUS_27540 17909 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 19371 17911 gene locus_tag LOCUS_27550 19371 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 22424 19368 gene locus_tag LOCUS_27560 22424 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 22959 22768 gene locus_tag LOCUS_27570 22959 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 24095 22965 gene locus_tag LOCUS_27580 24095 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 24251 24847 gene locus_tag LOCUS_27590 24251 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_27590 26147 24909 gene locus_tag LOCUS_27600 26147 24909 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_27600 26446 26691 gene locus_tag LOCUS_27610 26446 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 26890 27327 gene locus_tag LOCUS_27620 26890 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_27620 27775 27425 gene locus_tag LOCUS_27630 27775 27425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 protein_id gnl|my_center|LOCUS_27630 28533 27772 gene locus_tag LOCUS_27640 28533 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 29090 28605 gene locus_tag LOCUS_27650 29090 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 29470 29090 gene locus_tag LOCUS_27660 gene yjgF 29470 29090 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_27660 29520 30188 gene locus_tag LOCUS_27670 29520 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 30232 31650 gene locus_tag LOCUS_27680 30232 31650 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence35 1516 146 gene locus_tag LOCUS_27690 1516 146 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_27690 1656 1958 gene locus_tag LOCUS_27700 1656 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2015 2305 gene locus_tag LOCUS_27710 2015 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3231 2302 gene locus_tag LOCUS_27720 gene pyrB 3231 2302 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_27720 3776 3231 gene locus_tag LOCUS_27730 gene pyrR1 3776 3231 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_27730 5346 3808 gene locus_tag LOCUS_27740 5346 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5513 7177 gene locus_tag LOCUS_27750 5513 7177 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_27750 7181 8200 gene locus_tag LOCUS_27760 7181 8200 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_27760 8660 8313 gene locus_tag LOCUS_27770 8660 8313 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BD4 protein_id gnl|my_center|LOCUS_27770 8721 9716 gene locus_tag LOCUS_27780 8721 9716 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_27780 9720 10448 gene locus_tag LOCUS_27790 gene lipB 9720 10448 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_27790 10445 10846 gene locus_tag LOCUS_27800 10445 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_27800 11301 10861 gene locus_tag LOCUS_27810 11301 10861 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_27810 11642 11451 gene locus_tag LOCUS_27820 11642 11451 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_27820 11861 12922 gene locus_tag LOCUS_27830 11861 12922 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_27830 13016 13396 gene locus_tag LOCUS_27840 13016 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_27840 13760 13422 gene locus_tag LOCUS_27850 gene gldC 13760 13422 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_27850 14612 13800 gene locus_tag LOCUS_27860 14612 13800 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002093008.1 protein_id gnl|my_center|LOCUS_27860 15277 14615 gene locus_tag LOCUS_27870 gene atoA 15277 14615 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_27870 15976 15281 gene locus_tag LOCUS_27880 gene atoD 15976 15281 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_27880 16977 16027 gene locus_tag LOCUS_27890 gene ribF 16977 16027 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_27890 17659 16964 gene locus_tag LOCUS_27900 gene truB 17659 16964 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_27900 18453 17656 gene locus_tag LOCUS_27910 gene uppP 18453 17656 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_27910 18665 18456 gene locus_tag LOCUS_27920 18665 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 19670 18774 gene locus_tag LOCUS_27930 19670 18774 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_27930 20682 19789 gene locus_tag LOCUS_27940 20682 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 21233 20688 gene locus_tag LOCUS_27950 21233 20688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 22070 21423 gene locus_tag LOCUS_27960 22070 21423 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_27960 22506 22075 gene locus_tag LOCUS_27970 22506 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_27970 24979 22547 gene locus_tag LOCUS_27980 24979 22547 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104887.1 protein_id gnl|my_center|LOCUS_27980 26573 24972 gene locus_tag LOCUS_27990 gene lig2 26573 24972 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_27990 28549 26621 gene locus_tag LOCUS_28000 28549 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 29152 28760 gene locus_tag LOCUS_28010 29152 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence36 122 298 gene locus_tag LOCUS_28020 122 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 384 536 gene locus_tag LOCUS_28030 384 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1009 2277 gene locus_tag LOCUS_28040 1009 2277 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_28040 2973 2281 gene locus_tag LOCUS_28050 2973 2281 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_28050 4493 2961 gene locus_tag LOCUS_28060 4493 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 4612 5433 gene locus_tag LOCUS_28070 4612 5433 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_28070 5443 8109 gene locus_tag LOCUS_28080 5443 8109 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_28080 9028 8183 gene locus_tag LOCUS_28090 9028 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_28090 10052 9273 gene locus_tag LOCUS_28100 10052 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 10663 10046 gene locus_tag LOCUS_28110 10663 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 11847 10780 gene locus_tag LOCUS_28120 11847 10780 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_28120 13495 11828 gene locus_tag LOCUS_28130 13495 11828 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_28130 14587 13499 gene locus_tag LOCUS_28140 gene idiA 14587 13499 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_28140 14683 15624 gene locus_tag LOCUS_28150 14683 15624 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_28150 15716 16006 gene locus_tag LOCUS_28160 15716 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 16079 16888 gene locus_tag LOCUS_28170 16079 16888 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_28170 16939 18462 gene locus_tag LOCUS_28180 16939 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_28180 18703 19665 gene locus_tag LOCUS_28190 18703 19665 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_28190 20276 20515 gene locus_tag LOCUS_28200 20276 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 20816 22327 gene locus_tag LOCUS_28210 gene leuB 20816 22327 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_28210 22498 23346 gene locus_tag LOCUS_28220 22498 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 23432 23815 gene locus_tag LOCUS_28230 23432 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_28230 24018 24542 gene locus_tag LOCUS_28240 24018 24542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 25490 24774 gene locus_tag LOCUS_28250 25490 24774 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24970 protein_id gnl|my_center|LOCUS_28250 25995 25576 gene locus_tag LOCUS_28260 25995 25576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 26264 27616 gene locus_tag LOCUS_28270 gene hemN 26264 27616 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_28270 >Feature sequence37 437 4783 gene locus_tag LOCUS_28280 437 4783 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_28280 4819 6021 gene locus_tag LOCUS_28290 4819 6021 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_28290 6110 6871 gene locus_tag LOCUS_28300 6110 6871 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_28300 6874 7761 gene locus_tag LOCUS_28310 6874 7761 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021142.1 protein_id gnl|my_center|LOCUS_28310 7772 8191 gene locus_tag LOCUS_28320 7772 8191 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_28320 8397 8747 gene locus_tag LOCUS_28330 8397 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9732 8845 gene locus_tag LOCUS_28340 9732 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 11958 9982 gene locus_tag LOCUS_28350 11958 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 13898 12330 gene locus_tag LOCUS_28360 13898 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14635 14438 gene locus_tag LOCUS_28370 14635 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964413.1 protein_id gnl|my_center|LOCUS_28370 14818 15588 gene locus_tag LOCUS_28380 14818 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_28380 15598 16260 gene locus_tag LOCUS_28390 15598 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 17228 16794 gene locus_tag LOCUS_28400 17228 16794 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764895.1 protein_id gnl|my_center|LOCUS_28400 18104 17235 gene locus_tag LOCUS_28410 18104 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 21653 19110 gene locus_tag LOCUS_28420 21653 19110 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_28420 22548 21643 gene locus_tag LOCUS_28430 22548 21643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 23132 22605 gene locus_tag LOCUS_28440 23132 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 23340 24377 gene locus_tag LOCUS_28450 23340 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 24818 25564 gene locus_tag LOCUS_28460 24818 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 25805 26497 gene locus_tag LOCUS_28470 25805 26497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 27187 27390 gene locus_tag LOCUS_28480 27187 27390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence38 614 132 gene locus_tag LOCUS_28490 614 132 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_28490 689 1234 gene locus_tag LOCUS_28500 689 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_28500 1310 1774 gene locus_tag LOCUS_28510 gene mscL 1310 1774 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ8 protein_id gnl|my_center|LOCUS_28510 1842 2738 gene locus_tag LOCUS_28520 1842 2738 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_28520 3610 2795 gene locus_tag LOCUS_28530 3610 2795 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_28530 5232 3796 gene locus_tag LOCUS_28540 5232 3796 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_28540 7418 5661 gene locus_tag LOCUS_28550 7418 5661 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_28550 7795 9438 gene locus_tag LOCUS_28560 gene gatA 7795 9438 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_28560 10300 9884 gene locus_tag LOCUS_28570 gene yqiW 10300 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_28570 10957 10616 gene locus_tag LOCUS_28580 10957 10616 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_28580 11412 10969 gene locus_tag LOCUS_28590 11412 10969 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_28590 12661 11423 gene locus_tag LOCUS_28600 12661 11423 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A296 protein_id gnl|my_center|LOCUS_28600 14420 13095 gene locus_tag LOCUS_28610 gene sufD 14420 13095 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_28610 15195 14440 gene locus_tag LOCUS_28620 gene sufC 15195 14440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_28620 16801 15356 gene locus_tag LOCUS_28630 gene ycf24 16801 15356 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_28630 17498 19168 gene locus_tag LOCUS_28640 17498 19168 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 protein_id gnl|my_center|LOCUS_28640 19660 25707 gene locus_tag LOCUS_28650 19660 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 25749 25937 gene locus_tag LOCUS_28660 25749 25937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence39 1231 614 gene locus_tag LOCUS_28670 gene coxO 1231 614 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969992.1 protein_id gnl|my_center|LOCUS_28670 1595 1251 gene locus_tag LOCUS_28680 gene csaA 1595 1251 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_28680 1802 5170 gene locus_tag LOCUS_28690 gene mfd 1802 5170 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_28690 5300 5596 gene locus_tag LOCUS_28700 5300 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204767.1 protein_id gnl|my_center|LOCUS_28700 5599 5883 gene locus_tag LOCUS_28710 5599 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44191 protein_id gnl|my_center|LOCUS_28710 5958 6149 gene locus_tag LOCUS_28720 5958 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 6139 6303 gene locus_tag LOCUS_28730 6139 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 6707 8227 gene locus_tag LOCUS_28740 gene gpmI 6707 8227 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_28740 8379 8957 gene locus_tag LOCUS_28750 8379 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 9432 9737 gene locus_tag LOCUS_28760 9432 9737 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_28760 14079 10396 gene locus_tag LOCUS_28770 14079 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 14181 15191 gene locus_tag LOCUS_28780 gene asd 14181 15191 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_28780 15175 16362 gene locus_tag LOCUS_28790 15175 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_28790 17294 17677 gene locus_tag LOCUS_28800 17294 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 18760 17861 gene locus_tag LOCUS_28810 gene acdS 18760 17861 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_28810 18886 19974 gene locus_tag LOCUS_28820 18886 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 20990 20223 gene locus_tag LOCUS_28830 20990 20223 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_28830 24369 21415 gene locus_tag LOCUS_28840 24369 21415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_28840 24636 25358 gene locus_tag LOCUS_28850 24636 25358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence40 124 5406 gene locus_tag LOCUS_28860 124 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 6398 5469 gene locus_tag LOCUS_28870 6398 5469 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_28870 6610 6897 gene locus_tag LOCUS_28880 6610 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 6975 7181 gene locus_tag LOCUS_28890 6975 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 7187 7378 gene locus_tag LOCUS_28900 7187 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 7448 8533 gene locus_tag LOCUS_28910 7448 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 11409 9367 gene locus_tag LOCUS_28920 11409 9367 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_28920 12482 11826 gene locus_tag LOCUS_28930 12482 11826 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKH4 protein_id gnl|my_center|LOCUS_28930 12838 12533 gene locus_tag LOCUS_28940 12838 12533 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_28940 15030 12964 gene locus_tag LOCUS_28950 gene metG 15030 12964 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_28950 15145 15945 gene locus_tag LOCUS_28960 15145 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 18396 16063 gene locus_tag LOCUS_28970 18396 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 20259 18466 gene locus_tag LOCUS_28980 20259 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 21743 20433 gene locus_tag LOCUS_28990 21743 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 22272 21853 gene locus_tag LOCUS_29000 22272 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 23293 22310 gene locus_tag LOCUS_29010 23293 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 24399 23290 gene locus_tag LOCUS_29020 24399 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 25313 24507 gene locus_tag LOCUS_29030 25313 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence41 1540 353 gene locus_tag LOCUS_29040 1540 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1989 1846 gene locus_tag LOCUS_29050 1989 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 1988 4105 gene locus_tag LOCUS_29060 1988 4105 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_29060 4144 6030 gene locus_tag LOCUS_29070 4144 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6481 6047 gene locus_tag LOCUS_29080 6481 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7203 6613 gene locus_tag LOCUS_29090 7203 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 10291 7208 gene locus_tag LOCUS_29100 10291 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 12501 10645 gene locus_tag LOCUS_29110 gene yidC 12501 10645 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_29110 14147 12513 gene locus_tag LOCUS_29120 gene pyrG 14147 12513 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_29120 15072 14320 gene locus_tag LOCUS_29130 15072 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 15705 15082 gene locus_tag LOCUS_29140 gene rsmG 15705 15082 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_29140 16322 15705 gene locus_tag LOCUS_29150 16322 15705 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_29150 17434 16313 gene locus_tag LOCUS_29160 17434 16313 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_29160 17519 18649 gene locus_tag LOCUS_29170 gene tgt 17519 18649 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_29170 18657 19730 gene locus_tag LOCUS_29180 18657 19730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_29180 19727 20638 gene locus_tag LOCUS_29190 19727 20638 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_29190 20650 22506 gene locus_tag LOCUS_29200 20650 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 23321 22530 gene locus_tag LOCUS_29210 gene ispE 23321 22530 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_29210 24240 23431 gene locus_tag LOCUS_29220 24240 23431 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_29220 25336 24419 gene locus_tag LOCUS_29230 25336 24419 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397489.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence42 1653 166 gene locus_tag LOCUS_29240 gene cysS 1653 166 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_29240 1846 2319 gene locus_tag LOCUS_29250 gene rimP 1846 2319 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N5 protein_id gnl|my_center|LOCUS_29250 2321 3562 gene locus_tag LOCUS_29260 gene nusA 2321 3562 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_29260 3613 6621 gene locus_tag LOCUS_29270 gene infB 3613 6621 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR4 protein_id gnl|my_center|LOCUS_29270 6815 7600 gene locus_tag LOCUS_29280 6815 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 7692 8177 gene locus_tag LOCUS_29290 7692 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403315.1 protein_id gnl|my_center|LOCUS_29290 8355 8891 gene locus_tag LOCUS_29300 8355 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 12261 8998 gene locus_tag LOCUS_29310 12261 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 12691 15921 gene locus_tag LOCUS_29320 12691 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_29320 16090 17256 gene locus_tag LOCUS_29330 16090 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 17448 18215 gene locus_tag LOCUS_29340 17448 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 18281 18742 gene locus_tag LOCUS_29350 18281 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 18735 18884 gene locus_tag LOCUS_29360 18735 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 19549 18998 gene locus_tag LOCUS_29370 19549 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 21868 19601 gene locus_tag LOCUS_29380 21868 19601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_29380 22115 24328 gene locus_tag LOCUS_29390 22115 24328 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence43 501 5120 gene locus_tag LOCUS_29400 501 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5128 7140 gene locus_tag LOCUS_29410 5128 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7192 16149 gene locus_tag LOCUS_29420 7192 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 16149 20522 gene locus_tag LOCUS_29430 16149 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 20526 22040 gene locus_tag LOCUS_29440 20526 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 22024 23748 gene locus_tag LOCUS_29450 22024 23748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence44 185 2113 gene locus_tag LOCUS_29460 185 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2423 2590 gene locus_tag LOCUS_29470 2423 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2795 3673 gene locus_tag LOCUS_29480 2795 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29480 3985 4533 gene locus_tag LOCUS_29490 3985 4533 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_29490 4591 5655 gene locus_tag LOCUS_29500 4591 5655 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_29500 6177 7115 gene locus_tag LOCUS_29510 gene prfB 6177 7115 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_29510 9106 7307 gene locus_tag LOCUS_29520 9106 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 10014 9226 gene locus_tag LOCUS_29530 10014 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 12695 10011 gene locus_tag LOCUS_29540 12695 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 15758 12873 gene locus_tag LOCUS_29550 15758 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 16221 15946 gene locus_tag LOCUS_29560 16221 15946 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_29560 17328 16234 gene locus_tag LOCUS_29570 17328 16234 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_29570 17468 19390 gene locus_tag LOCUS_29580 gene dnaG 17468 19390 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_29580 19490 20713 gene locus_tag LOCUS_29590 gene ribBA 19490 20713 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_29590 20652 21335 gene locus_tag LOCUS_29600 20652 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 21359 22141 gene locus_tag LOCUS_29610 gene surE 21359 22141 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_29610 22144 22347 gene locus_tag LOCUS_29620 gene xseB 22144 22347 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X290 protein_id gnl|my_center|LOCUS_29620 22393 23418 gene locus_tag LOCUS_29630 gene murB 22393 23418 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_29630 23908 23411 gene locus_tag LOCUS_29640 23908 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence45 775 458 gene locus_tag LOCUS_29650 775 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1182 817 gene locus_tag LOCUS_29660 gene folB 1182 817 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28823 protein_id gnl|my_center|LOCUS_29660 1955 1203 gene locus_tag LOCUS_29670 1955 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2978 2061 gene locus_tag LOCUS_29680 2978 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2995 3630 gene locus_tag LOCUS_29690 2995 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 4863 3997 gene locus_tag LOCUS_29700 4863 3997 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_29700 6503 4875 gene locus_tag LOCUS_29710 6503 4875 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_29710 7483 6548 gene locus_tag LOCUS_29720 7483 6548 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_29720 8396 7497 gene locus_tag LOCUS_29730 8396 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 8600 8424 gene locus_tag LOCUS_29740 8600 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 8653 11064 gene locus_tag LOCUS_29750 8653 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_29750 11561 11142 gene locus_tag LOCUS_29760 11561 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 12487 11621 gene locus_tag LOCUS_29770 12487 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 12800 12477 gene locus_tag LOCUS_29780 12800 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 14602 13697 gene locus_tag LOCUS_29790 14602 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 14707 15312 gene locus_tag LOCUS_29800 14707 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_29800 15796 15320 gene locus_tag LOCUS_29810 15796 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_29810 16144 17001 gene locus_tag LOCUS_29820 gene hisG 16144 17001 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_29820 17006 18295 gene locus_tag LOCUS_29830 gene hisD 17006 18295 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_29830 18305 19360 gene locus_tag LOCUS_29840 gene hisC 18305 19360 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_29840 19917 19375 gene locus_tag LOCUS_29850 19917 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 20171 22831 gene locus_tag LOCUS_29860 20171 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence46 2272 179 gene locus_tag LOCUS_29870 gene recG 2272 179 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_29870 2855 2274 gene locus_tag LOCUS_29880 2855 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2996 4411 gene locus_tag LOCUS_29890 2996 4411 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_29890 4502 5008 gene locus_tag LOCUS_29900 4502 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 5769 5005 gene locus_tag LOCUS_29910 5769 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 9075 6070 gene locus_tag LOCUS_29920 9075 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 10080 9202 gene locus_tag LOCUS_29930 10080 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 10251 10964 gene locus_tag LOCUS_29940 10251 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_29940 11785 11141 gene locus_tag LOCUS_29950 11785 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 13052 11943 gene locus_tag LOCUS_29960 13052 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 13970 13071 gene locus_tag LOCUS_29970 13970 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 14829 14041 gene locus_tag LOCUS_29980 14829 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 14954 16012 gene locus_tag LOCUS_29990 14954 16012 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_29990 16695 16030 gene locus_tag LOCUS_30000 16695 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 18158 16692 gene locus_tag LOCUS_30010 18158 16692 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 protein_id gnl|my_center|LOCUS_30010 18810 18511 gene locus_tag LOCUS_30020 18810 18511 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_30020 19101 18820 gene locus_tag LOCUS_30030 19101 18820 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_30030 19758 19405 gene locus_tag LOCUS_30040 19758 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 19997 19770 gene locus_tag LOCUS_30050 19997 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 21926 20250 gene locus_tag LOCUS_30060 21926 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 22577 22041 gene locus_tag LOCUS_30070 22577 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence47 2768 144 gene locus_tag LOCUS_30080 gene clpB 2768 144 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X21 protein_id gnl|my_center|LOCUS_30080 3146 5896 gene locus_tag LOCUS_30090 3146 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 5889 6311 gene locus_tag LOCUS_30100 5889 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 11467 6320 gene locus_tag LOCUS_30110 11467 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 11763 12764 gene locus_tag LOCUS_30120 11763 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 12773 14017 gene locus_tag LOCUS_30130 12773 14017 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_30130 14226 16496 gene locus_tag LOCUS_30140 14226 16496 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247314.1 protein_id gnl|my_center|LOCUS_30140 16765 18354 gene locus_tag LOCUS_30150 gene pccB 16765 18354 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_30150 18586 19458 gene locus_tag LOCUS_30160 18586 19458 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_30160 19558 19632 gene locus_tag LOCUS_t00310 19558 19632 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19905 21197 gene locus_tag LOCUS_30170 19905 21197 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence48 803 1660 gene locus_tag LOCUS_30180 803 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1657 1863 gene locus_tag LOCUS_30190 1657 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1856 2677 gene locus_tag LOCUS_30200 1856 2677 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_30200 2767 4041 gene locus_tag LOCUS_30210 gene gdhA 2767 4041 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_30210 4445 5107 gene locus_tag LOCUS_30220 gene psd 4445 5107 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_30220 5110 5562 gene locus_tag LOCUS_30230 gene rimK2 5110 5562 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_30230 5638 6570 gene locus_tag LOCUS_30240 gene hemC 5638 6570 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_30240 6570 7448 gene locus_tag LOCUS_30250 6570 7448 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_30250 7445 8341 gene locus_tag LOCUS_30260 7445 8341 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_30260 8526 8747 gene locus_tag LOCUS_30270 8526 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 9971 8763 gene locus_tag LOCUS_30280 9971 8763 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_30280 10695 10048 gene locus_tag LOCUS_30290 10695 10048 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_30290 10924 11346 gene locus_tag LOCUS_30300 10924 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 11346 11681 gene locus_tag LOCUS_30310 11346 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 12410 11739 gene locus_tag LOCUS_30320 12410 11739 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_30320 12492 13688 gene locus_tag LOCUS_30330 12492 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 13688 14917 gene locus_tag LOCUS_30340 13688 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 16141 14918 gene locus_tag LOCUS_30350 16141 14918 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_30350 17838 16264 gene locus_tag LOCUS_30360 17838 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 18856 17876 gene locus_tag LOCUS_30370 18856 17876 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_30370 >Feature sequence49 334 1746 gene locus_tag LOCUS_30380 334 1746 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_30380 2495 2112 gene locus_tag LOCUS_30390 2495 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_30390 8917 2963 gene locus_tag LOCUS_30400 8917 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 10164 8998 gene locus_tag LOCUS_30410 10164 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11002 10181 gene locus_tag LOCUS_30420 11002 10181 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_30420 12236 10977 gene locus_tag LOCUS_30430 12236 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12905 12237 gene locus_tag LOCUS_30440 12905 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 13980 12895 gene locus_tag LOCUS_30450 13980 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 15064 13964 gene locus_tag LOCUS_30460 15064 13964 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_30460 16026 15061 gene locus_tag LOCUS_30470 16026 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 16951 16007 gene locus_tag LOCUS_30480 16951 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 18183 16951 gene locus_tag LOCUS_30490 18183 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence50 507 157 gene locus_tag LOCUS_30500 507 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973809.1 protein_id gnl|my_center|LOCUS_30500 996 538 gene locus_tag LOCUS_30510 996 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1717 989 gene locus_tag LOCUS_30520 1717 989 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_30520 2287 1853 gene locus_tag LOCUS_30530 2287 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413586.1 protein_id gnl|my_center|LOCUS_30530 2679 2284 gene locus_tag LOCUS_30540 2679 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3131 2679 gene locus_tag LOCUS_30550 3131 2679 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963068.1 protein_id gnl|my_center|LOCUS_30550 3451 3179 gene locus_tag LOCUS_30560 3451 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963069.1 protein_id gnl|my_center|LOCUS_30560 3684 3448 gene locus_tag LOCUS_30570 3684 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_30570 4700 3687 gene locus_tag LOCUS_30580 4700 3687 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963070.1 protein_id gnl|my_center|LOCUS_30580 6507 4693 gene locus_tag LOCUS_30590 6507 4693 CDS product cytochrome oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963071.1 protein_id gnl|my_center|LOCUS_30590 6987 6553 gene locus_tag LOCUS_30600 6987 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 7740 7120 gene locus_tag LOCUS_30610 7740 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 9831 9676 gene locus_tag LOCUS_30620 9831 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12494 10179 gene locus_tag LOCUS_30630 12494 10179 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_30630 13402 12491 gene locus_tag LOCUS_30640 13402 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 14160 15167 gene locus_tag LOCUS_30650 14160 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 15226 15816 gene locus_tag LOCUS_30660 15226 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 16583 16314 gene locus_tag LOCUS_30670 16583 16314 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_30670 17936 16722 gene locus_tag LOCUS_30680 17936 16722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence51 359 1126 gene locus_tag LOCUS_30690 359 1126 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_30690 1605 4595 gene locus_tag LOCUS_30700 1605 4595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_30700 6111 5113 gene locus_tag LOCUS_30710 6111 5113 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_30710 6561 8225 gene locus_tag LOCUS_30720 6561 8225 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_30720 10057 8429 gene locus_tag LOCUS_30730 gene pruA 10057 8429 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_30730 13141 10505 gene locus_tag LOCUS_30740 13141 10505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_30740 13323 14858 gene locus_tag LOCUS_30750 13323 14858 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_30750 15058 15774 gene locus_tag LOCUS_30760 15058 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 15970 16989 gene locus_tag LOCUS_30770 15970 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence52 3470 324 gene locus_tag LOCUS_30780 3470 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 4846 3545 gene locus_tag LOCUS_30790 4846 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5113 5838 gene locus_tag LOCUS_30800 5113 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6111 12197 gene locus_tag LOCUS_30810 6111 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 12203 13159 gene locus_tag LOCUS_30820 12203 13159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_30820 13414 14571 gene locus_tag LOCUS_30830 13414 14571 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 protein_id gnl|my_center|LOCUS_30830 14568 15536 gene locus_tag LOCUS_30840 14568 15536 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence53 419 616 gene locus_tag LOCUS_30850 419 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 609 869 gene locus_tag LOCUS_30860 609 869 CDS product cytotoxic translational repressor of toxin-antitoxin stability system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 protein_id gnl|my_center|LOCUS_30860 4394 1005 gene locus_tag LOCUS_30870 gene icmF 4394 1005 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_30870 4943 7168 gene locus_tag LOCUS_30880 4943 7168 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_30880 8198 7419 gene locus_tag LOCUS_30890 gene miaA1 8198 7419 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_30890 8389 11667 gene locus_tag LOCUS_30900 8389 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 11669 12046 gene locus_tag LOCUS_30910 11669 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 12048 12323 gene locus_tag LOCUS_30920 12048 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 12320 13081 gene locus_tag LOCUS_30930 gene phnP 12320 13081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_30930 13083 14651 gene locus_tag LOCUS_30940 gene pavA 13083 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288890.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence54 59 1321 gene locus_tag LOCUS_30950 59 1321 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402973.1 protein_id gnl|my_center|LOCUS_30950 2306 1389 gene locus_tag LOCUS_30960 gene rsgA2 2306 1389 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_30960 3553 2303 gene locus_tag LOCUS_30970 3553 2303 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_30970 4096 3617 gene locus_tag LOCUS_30980 4096 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4982 4077 gene locus_tag LOCUS_30990 4982 4077 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_30990 5158 6435 gene locus_tag LOCUS_31000 5158 6435 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_31000 6525 7061 gene locus_tag LOCUS_31010 6525 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7238 8512 gene locus_tag LOCUS_31020 gene glyA 7238 8512 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_31020 8603 9445 gene locus_tag LOCUS_31030 gene tatC 8603 9445 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_31030 9455 10585 gene locus_tag LOCUS_31040 9455 10585 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_31040 10688 11485 gene locus_tag LOCUS_31050 10688 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence55 313 1206 gene locus_tag LOCUS_31060 gene fjo11 313 1206 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_31060 1354 1740 gene locus_tag LOCUS_31070 gene dksA 1354 1740 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_31070 1830 2303 gene locus_tag LOCUS_31080 1830 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2337 3239 gene locus_tag LOCUS_31090 2337 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4953 3532 gene locus_tag LOCUS_31100 4953 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 5263 5190 gene locus_tag LOCUS_t00320 5263 5190 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5359 6672 gene locus_tag LOCUS_31110 5359 6672 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_31110 6709 7506 gene locus_tag LOCUS_31120 6709 7506 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_31120 8796 7678 gene locus_tag LOCUS_31130 8796 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 10006 8765 gene locus_tag LOCUS_31140 10006 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence56 1044 112 gene locus_tag LOCUS_31150 1044 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1840 1229 gene locus_tag LOCUS_31160 1840 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2451 1966 gene locus_tag LOCUS_31170 2451 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2993 2697 gene locus_tag LOCUS_31180 gene parE-1 2993 2697 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_31180 3225 2986 gene locus_tag LOCUS_31190 3225 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3576 3385 gene locus_tag LOCUS_31200 3576 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4141 3566 gene locus_tag LOCUS_31210 4141 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_31210 4563 4216 gene locus_tag LOCUS_31220 4563 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 5157 4648 gene locus_tag LOCUS_31230 5157 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 5538 5311 gene locus_tag LOCUS_31240 5538 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 5862 5542 gene locus_tag LOCUS_31250 5862 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 6705 6355 gene locus_tag LOCUS_31260 6705 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 8354 6801 gene locus_tag LOCUS_31270 8354 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8634 8455 gene locus_tag LOCUS_31280 8634 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence57 586 1197 gene locus_tag LOCUS_31290 586 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1295 2425 gene locus_tag LOCUS_31300 gene dnaJ 1295 2425 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_31300 2509 3471 gene locus_tag LOCUS_31310 2509 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3919 3545 gene locus_tag LOCUS_31320 3919 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 4014 5132 gene locus_tag LOCUS_31330 4014 5132 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202397.1 protein_id gnl|my_center|LOCUS_31330 5563 5189 gene locus_tag LOCUS_31340 5563 5189 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_31340 5693 6340 gene locus_tag LOCUS_31350 5693 6340 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence58 686 264 gene locus_tag LOCUS_31360 686 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2412 949 gene locus_tag LOCUS_31370 2412 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 3379 2495 gene locus_tag LOCUS_31380 3379 2495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 protein_id gnl|my_center|LOCUS_31380 3963 3379 gene locus_tag LOCUS_31390 3963 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 4507 4199 gene locus_tag LOCUS_31400 4507 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence59 384 893 gene locus_tag LOCUS_31410 384 893 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_31410 939 1790 gene locus_tag LOCUS_31420 939 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1801 2268 gene locus_tag LOCUS_31430 1801 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2351 2830 gene locus_tag LOCUS_31440 2351 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 2959 3879 gene locus_tag LOCUS_31450 2959 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence60 200 1012 gene locus_tag LOCUS_31460 200 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1005 2087 gene locus_tag LOCUS_31470 1005 2087 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_31470 2134 2607 gene locus_tag LOCUS_31480 2134 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence61 277 1170 gene locus_tag LOCUS_31490 277 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1348 1770 gene locus_tag LOCUS_31500 1348 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500