>Feature sequence01 124 1044 gene locus_tag LOCUS_00010 124 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1617 1051 gene locus_tag LOCUS_00020 1617 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2282 1635 gene locus_tag LOCUS_00030 2282 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2817 2275 gene locus_tag LOCUS_00040 2817 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3156 2881 gene locus_tag LOCUS_00050 3156 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3303 3527 gene locus_tag LOCUS_00060 3303 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3540 4040 gene locus_tag LOCUS_00070 3540 4040 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268610.1 protein_id gnl|my_center|LOCUS_00070 4040 4450 gene locus_tag LOCUS_00080 4040 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4605 5870 gene locus_tag LOCUS_00090 4605 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5875 6129 gene locus_tag LOCUS_00100 gene imm 5875 6129 CDS product colicin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212003.1 protein_id gnl|my_center|LOCUS_00100 6167 6424 gene locus_tag LOCUS_00110 6167 6424 CDS product colicin immunity protein E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768134.1 protein_id gnl|my_center|LOCUS_00110 6438 6716 gene locus_tag LOCUS_00120 gene imm 6438 6716 CDS product colicin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212003.1 protein_id gnl|my_center|LOCUS_00120 6746 7051 gene locus_tag LOCUS_00130 6746 7051 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_00130 7131 7337 gene locus_tag LOCUS_00140 7131 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00140 7601 7888 gene locus_tag LOCUS_00150 7601 7888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_00150 7927 8097 gene locus_tag LOCUS_00160 7927 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8234 8158 gene locus_tag LOCUS_t00010 8234 8158 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8906 8370 gene locus_tag LOCUS_00170 8906 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071180.1 protein_id gnl|my_center|LOCUS_00170 9157 9366 gene locus_tag LOCUS_00180 9157 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 9472 9636 gene locus_tag LOCUS_00190 9472 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 9662 10108 gene locus_tag LOCUS_00200 9662 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 11242 10328 gene locus_tag LOCUS_00210 11242 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_00210 13365 11449 gene locus_tag LOCUS_00220 13365 11449 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_00220 13538 13702 gene locus_tag LOCUS_00230 13538 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 14355 13906 gene locus_tag LOCUS_00240 gene moaE 14355 13906 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_00240 14712 14470 gene locus_tag LOCUS_00250 gene moaD 14712 14470 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX96 protein_id gnl|my_center|LOCUS_00250 15185 14709 gene locus_tag LOCUS_00260 gene moaC 15185 14709 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P4 protein_id gnl|my_center|LOCUS_00260 16963 15572 gene locus_tag LOCUS_00270 16963 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_00270 17496 18275 gene locus_tag LOCUS_00280 17496 18275 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 protein_id gnl|my_center|LOCUS_00280 18983 20293 gene locus_tag LOCUS_00290 gene algD 18983 20293 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11759 protein_id gnl|my_center|LOCUS_00290 20345 21826 gene locus_tag LOCUS_00300 gene alg8 20345 21826 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52463 protein_id gnl|my_center|LOCUS_00300 21853 23016 gene locus_tag LOCUS_00310 gene alg44 21853 23016 CDS product alginate biosynthesis protein Alg44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q0 protein_id gnl|my_center|LOCUS_00310 23029 24405 gene locus_tag LOCUS_00320 gene algK 23029 24405 CDS product alginate biosynthesis protein AlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96956 protein_id gnl|my_center|LOCUS_00320 24402 25859 gene locus_tag LOCUS_00330 gene algE 24402 25859 CDS product alginate production protein AlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18895 protein_id gnl|my_center|LOCUS_00330 25871 27406 gene locus_tag LOCUS_00340 gene algG 25871 27406 CDS product poly(beta-D-mannuronate) C5 epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51371 protein_id gnl|my_center|LOCUS_00340 27418 28839 gene locus_tag LOCUS_00350 27418 28839 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408874.1 protein_id gnl|my_center|LOCUS_00350 28850 29923 gene locus_tag LOCUS_00360 gene algL 28850 29923 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06749 protein_id gnl|my_center|LOCUS_00360 30057 31508 gene locus_tag LOCUS_00370 gene algI 30057 31508 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51392 protein_id gnl|my_center|LOCUS_00370 31522 32655 gene locus_tag LOCUS_00380 31522 32655 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266794.1 protein_id gnl|my_center|LOCUS_00380 32681 33328 gene locus_tag LOCUS_00390 gene algF 32681 33328 CDS product alginate biosynthesis protein AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06062 protein_id gnl|my_center|LOCUS_00390 33426 34856 gene locus_tag LOCUS_00400 gene algA 33426 34856 CDS product alginate biosynthesis protein AlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07874 protein_id gnl|my_center|LOCUS_00400 35042 35506 gene locus_tag LOCUS_00410 35042 35506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092973.1 protein_id gnl|my_center|LOCUS_00410 35706 36536 gene locus_tag LOCUS_00420 35706 36536 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266791.1 protein_id gnl|my_center|LOCUS_00420 36533 36901 gene locus_tag LOCUS_00430 36533 36901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113771.1 protein_id gnl|my_center|LOCUS_00430 36926 38086 gene locus_tag LOCUS_00440 36926 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_00440 39121 38174 gene locus_tag LOCUS_00450 gene trxB2 39121 38174 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I592 protein_id gnl|my_center|LOCUS_00450 39554 40318 gene locus_tag LOCUS_00460 gene cysZ 39554 40318 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_00460 41401 40292 gene locus_tag LOCUS_00470 41401 40292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895600.1 protein_id gnl|my_center|LOCUS_00470 41481 42383 gene locus_tag LOCUS_00480 41481 42383 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205322.1 protein_id gnl|my_center|LOCUS_00480 42418 43641 gene locus_tag LOCUS_00490 42418 43641 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_00490 44874 43765 gene locus_tag LOCUS_00500 44874 43765 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 protein_id gnl|my_center|LOCUS_00500 45504 44902 gene locus_tag LOCUS_00510 45504 44902 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085819.1 protein_id gnl|my_center|LOCUS_00510 46390 45659 gene locus_tag LOCUS_00520 46390 45659 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 protein_id gnl|my_center|LOCUS_00520 47361 46387 gene locus_tag LOCUS_00530 gene rluD 47361 46387 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI4 protein_id gnl|my_center|LOCUS_00530 47643 48635 gene locus_tag LOCUS_00540 gene bamD 47643 48635 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_00540 48961 49203 gene locus_tag LOCUS_00550 48961 49203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00550 49193 50785 gene locus_tag LOCUS_00560 gene pilS 49193 50785 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_00560 50788 52128 gene locus_tag LOCUS_00570 gene pilR 50788 52128 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_00570 53322 52228 gene locus_tag LOCUS_00580 53322 52228 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_00580 53399 53893 gene locus_tag LOCUS_00590 53399 53893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 53987 54523 gene locus_tag LOCUS_00600 53987 54523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 54532 55113 gene locus_tag LOCUS_00610 gene pilV 54532 55113 CDS product type 4 fimbrial biogenesis protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119423.1 protein_id gnl|my_center|LOCUS_00610 55124 55861 gene locus_tag LOCUS_00620 gene pilW 55124 55861 CDS product type 4 fimbrial biogenesis protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119422.1 protein_id gnl|my_center|LOCUS_00620 55858 56412 gene locus_tag LOCUS_00630 gene pilX 55858 56412 CDS product type 4 fimbrial biogenesis protein PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112826.1 protein_id gnl|my_center|LOCUS_00630 56428 59928 gene locus_tag LOCUS_00640 gene pilY1 56428 59928 CDS product type IV pilus biogenesis factor PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM8 protein_id gnl|my_center|LOCUS_00640 59931 60260 gene locus_tag LOCUS_00650 59931 60260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60253 60660 gene locus_tag LOCUS_00660 gene pilE 60253 60660 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_00660 61686 60742 gene locus_tag LOCUS_00670 gene ispH 61686 60742 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_00670 62262 61825 gene locus_tag LOCUS_00680 62262 61825 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ2 protein_id gnl|my_center|LOCUS_00680 62768 62259 gene locus_tag LOCUS_00690 gene lspA 62768 62259 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_00690 65592 62761 gene locus_tag LOCUS_00700 gene ileS 65592 62761 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM4 protein_id gnl|my_center|LOCUS_00700 66557 65589 gene locus_tag LOCUS_00710 66557 65589 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ5 protein_id gnl|my_center|LOCUS_00710 68178 66637 gene locus_tag LOCUS_00720 68178 66637 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ6 protein_id gnl|my_center|LOCUS_00720 68370 68648 gene locus_tag LOCUS_00730 gene rpsT 68370 68648 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_00730 69141 68854 gene locus_tag LOCUS_00740 69141 68854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_00740 69314 71041 gene locus_tag LOCUS_00750 69314 71041 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706363.1 protein_id gnl|my_center|LOCUS_00750 71740 71183 gene locus_tag LOCUS_00760 71740 71183 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_00760 71980 72618 gene locus_tag LOCUS_00770 gene upp 71980 72618 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU7 protein_id gnl|my_center|LOCUS_00770 72620 73891 gene locus_tag LOCUS_00780 72620 73891 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266747.1 protein_id gnl|my_center|LOCUS_00780 75031 74018 gene locus_tag LOCUS_00790 75031 74018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_00790 76168 75176 gene locus_tag LOCUS_00800 76168 75176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120893.1 protein_id gnl|my_center|LOCUS_00800 76185 76559 gene locus_tag LOCUS_00810 76185 76559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112757.1 protein_id gnl|my_center|LOCUS_00810 76603 78390 gene locus_tag LOCUS_00820 76603 78390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 79975 79148 gene locus_tag LOCUS_00830 79975 79148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_00830 80557 80078 gene locus_tag LOCUS_00840 80557 80078 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_00840 80696 81658 gene locus_tag LOCUS_00850 80696 81658 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_00850 81655 82566 gene locus_tag LOCUS_00860 gene panE 81655 82566 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW09 protein_id gnl|my_center|LOCUS_00860 82692 84710 gene locus_tag LOCUS_00870 82692 84710 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 protein_id gnl|my_center|LOCUS_00870 84714 85289 gene locus_tag LOCUS_00880 84714 85289 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_00880 85850 85395 gene locus_tag LOCUS_00890 85850 85395 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_00890 86904 85954 gene locus_tag LOCUS_00900 86904 85954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_00900 87533 86901 gene locus_tag LOCUS_00910 87533 86901 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_00910 88882 87665 gene locus_tag LOCUS_00920 gene argJ 88882 87665 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_00920 91777 89042 gene locus_tag LOCUS_00930 gene secA 91777 89042 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ3 protein_id gnl|my_center|LOCUS_00930 92936 92016 gene locus_tag LOCUS_00940 92936 92016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_00940 93015 93470 gene locus_tag LOCUS_00950 93015 93470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105002.1 protein_id gnl|my_center|LOCUS_00950 94536 93625 gene locus_tag LOCUS_00960 gene lpxC 94536 93625 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_00960 95841 94648 gene locus_tag LOCUS_00970 gene ftsZ 95841 94648 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_00970 97131 95884 gene locus_tag LOCUS_00980 gene ftsA 97131 95884 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47203 protein_id gnl|my_center|LOCUS_00980 98013 97147 gene locus_tag LOCUS_00990 gene ftsQ 98013 97147 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY8 protein_id gnl|my_center|LOCUS_00990 98958 98017 gene locus_tag LOCUS_01000 gene ddl 98958 98017 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_01000 100397 98955 gene locus_tag LOCUS_01010 gene murC 100397 98955 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_01010 101460 100390 gene locus_tag LOCUS_01020 gene murG 101460 100390 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_01020 102658 101450 gene locus_tag LOCUS_01030 gene ftsW 102658 101450 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_01030 103998 102658 gene locus_tag LOCUS_01040 gene murD 103998 102658 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 protein_id gnl|my_center|LOCUS_01040 105093 104011 gene locus_tag LOCUS_01050 gene mraY 105093 104011 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_01050 106464 105094 gene locus_tag LOCUS_01060 gene murF 106464 105094 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_01060 107920 106457 gene locus_tag LOCUS_01070 gene murE 107920 106457 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_01070 109647 107920 gene locus_tag LOCUS_01080 gene ftsI 109647 107920 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_01080 109937 109644 gene locus_tag LOCUS_01090 gene ftsL 109937 109644 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX8 protein_id gnl|my_center|LOCUS_01090 110875 109934 gene locus_tag LOCUS_01100 gene rsmH 110875 109934 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_01100 111228 110878 gene locus_tag LOCUS_01110 gene mraZ 111228 110878 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY1 protein_id gnl|my_center|LOCUS_01110 113111 112245 gene locus_tag LOCUS_01120 gene rsmI 113111 112245 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ3 protein_id gnl|my_center|LOCUS_01120 113234 115042 gene locus_tag LOCUS_01130 113234 115042 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_01130 115039 115398 gene locus_tag LOCUS_01140 115039 115398 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_01140 115424 116017 gene locus_tag LOCUS_01150 gene gmhA 115424 116017 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_01150 116014 116547 gene locus_tag LOCUS_01160 116014 116547 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_01160 117009 116596 gene locus_tag LOCUS_01170 gene sspB 117009 116596 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_01170 117640 117023 gene locus_tag LOCUS_01180 gene sspA 117640 117023 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766548.1 protein_id gnl|my_center|LOCUS_01180 118587 117808 gene locus_tag LOCUS_01190 118587 117808 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_01190 119798 118587 gene locus_tag LOCUS_01200 119798 118587 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_01200 120391 119798 gene locus_tag LOCUS_01210 120391 119798 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_01210 121038 120646 gene locus_tag LOCUS_01220 gene rpsI 121038 120646 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_01220 121481 121053 gene locus_tag LOCUS_01230 gene rplM 121481 121053 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_01230 121729 122766 gene locus_tag LOCUS_01240 121729 122766 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_01240 123281 122763 gene locus_tag LOCUS_01250 123281 122763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 124669 123530 gene locus_tag LOCUS_01260 124669 123530 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_01260 124815 125816 gene locus_tag LOCUS_01270 124815 125816 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 protein_id gnl|my_center|LOCUS_01270 126033 127067 gene locus_tag LOCUS_01280 126033 127067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_01280 127120 128118 gene locus_tag LOCUS_01290 127120 128118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_01290 128175 130352 gene locus_tag LOCUS_01300 128175 130352 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_01300 131486 130392 gene locus_tag LOCUS_01310 gene zapE 131486 130392 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX0 protein_id gnl|my_center|LOCUS_01310 133108 131762 gene locus_tag LOCUS_01320 gene trpS 133108 131762 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX6 protein_id gnl|my_center|LOCUS_01320 133770 133138 gene locus_tag LOCUS_01330 133770 133138 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268854.1 protein_id gnl|my_center|LOCUS_01330 133889 134320 gene locus_tag LOCUS_01340 133889 134320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_01340 136598 134703 gene locus_tag LOCUS_01350 gene cysNC 136598 134703 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_01350 137528 136611 gene locus_tag LOCUS_01360 gene cysD 137528 136611 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50273 protein_id gnl|my_center|LOCUS_01360 138419 137661 gene locus_tag LOCUS_01370 138419 137661 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV9 protein_id gnl|my_center|LOCUS_01370 138530 139672 gene locus_tag LOCUS_01380 gene algW 138530 139672 CDS product AlgW protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_01380 139761 141842 gene locus_tag LOCUS_01390 139761 141842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267526.1 protein_id gnl|my_center|LOCUS_01390 141856 142575 gene locus_tag LOCUS_01400 141856 142575 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 protein_id gnl|my_center|LOCUS_01400 143697 142645 gene locus_tag LOCUS_01410 gene hisC1 143697 142645 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_01410 145120 143810 gene locus_tag LOCUS_01420 gene hisD 145120 143810 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_01420 146037 145402 gene locus_tag LOCUS_01430 gene hisG 146037 145402 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_01430 147366 146101 gene locus_tag LOCUS_01440 gene murA 147366 146101 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_01440 147628 147389 gene locus_tag LOCUS_01450 147628 147389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094334.1 protein_id gnl|my_center|LOCUS_01450 148054 147746 gene locus_tag LOCUS_01460 148054 147746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112744.1 protein_id gnl|my_center|LOCUS_01460 148683 148051 gene locus_tag LOCUS_01470 148683 148051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_01470 149168 148698 gene locus_tag LOCUS_01480 149168 148698 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_01480 149965 149168 gene locus_tag LOCUS_01490 149965 149168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_01490 150774 149965 gene locus_tag LOCUS_01500 150774 149965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_01500 151021 151995 gene locus_tag LOCUS_01510 151021 151995 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV0 protein_id gnl|my_center|LOCUS_01510 151995 152516 gene locus_tag LOCUS_01520 151995 152516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_01520 152525 153091 gene locus_tag LOCUS_01530 gene lptC 152525 153091 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU3 protein_id gnl|my_center|LOCUS_01530 153078 153617 gene locus_tag LOCUS_01540 gene lptA 153078 153617 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV7 protein_id gnl|my_center|LOCUS_01540 153617 154342 gene locus_tag LOCUS_01550 153617 154342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_01550 154663 156114 gene locus_tag LOCUS_01560 gene rpoN 154663 156114 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_01560 156214 156522 gene locus_tag LOCUS_01570 156214 156522 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_01570 156535 156999 gene locus_tag LOCUS_01580 gene ptsN 156535 156999 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_01580 157002 157859 gene locus_tag LOCUS_01590 157002 157859 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_01590 157874 158146 gene locus_tag LOCUS_01600 gene ptsH 157874 158146 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_01600 159548 158202 gene locus_tag LOCUS_01610 gene pmbA 159548 158202 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 protein_id gnl|my_center|LOCUS_01610 159582 160196 gene locus_tag LOCUS_01620 159582 160196 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_01620 161642 160209 gene locus_tag LOCUS_01630 gene tldD 161642 160209 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105013.1 protein_id gnl|my_center|LOCUS_01630 162502 161654 gene locus_tag LOCUS_01640 162502 161654 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268866.1 protein_id gnl|my_center|LOCUS_01640 166373 162552 gene locus_tag LOCUS_01650 166373 162552 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_01650 167848 166391 gene locus_tag LOCUS_01660 167848 166391 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364105.1 protein_id gnl|my_center|LOCUS_01660 168555 167953 gene locus_tag LOCUS_01670 168555 167953 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_01670 169092 168604 gene locus_tag LOCUS_01680 169092 168604 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT1 protein_id gnl|my_center|LOCUS_01680 170066 169092 gene locus_tag LOCUS_01690 gene mreC 170066 169092 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_01690 171235 170198 gene locus_tag LOCUS_01700 171235 170198 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_01700 171475 171762 gene locus_tag LOCUS_01710 gene gatC 171475 171762 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 protein_id gnl|my_center|LOCUS_01710 171778 173229 gene locus_tag LOCUS_01720 gene gatA 171778 173229 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_01720 173350 174798 gene locus_tag LOCUS_01730 gene gatB 173350 174798 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_01730 174871 175293 gene locus_tag LOCUS_01740 174871 175293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_01740 175385 176479 gene locus_tag LOCUS_01750 175385 176479 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_01750 176482 176865 gene locus_tag LOCUS_01760 176482 176865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094405.1 protein_id gnl|my_center|LOCUS_01760 178043 177102 gene locus_tag LOCUS_01770 178043 177102 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268873.1 protein_id gnl|my_center|LOCUS_01770 178844 178284 gene locus_tag LOCUS_01780 gene roxR 178844 178284 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_01780 180113 178860 gene locus_tag LOCUS_01790 gene roxS 180113 178860 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_01790 180433 181161 gene locus_tag LOCUS_01800 180433 181161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769371.1 protein_id gnl|my_center|LOCUS_01800 181388 182986 gene locus_tag LOCUS_01810 181388 182986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112863.1 protein_id gnl|my_center|LOCUS_01810 183049 184638 gene locus_tag LOCUS_01820 183049 184638 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112859.1 protein_id gnl|my_center|LOCUS_01820 184817 185827 gene locus_tag LOCUS_01830 184817 185827 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769384.1 protein_id gnl|my_center|LOCUS_01830 185945 186847 gene locus_tag LOCUS_01840 gene dppC 185945 186847 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243753.1 protein_id gnl|my_center|LOCUS_01840 186950 187924 gene locus_tag LOCUS_01850 186950 187924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112857.1 protein_id gnl|my_center|LOCUS_01850 187924 188895 gene locus_tag LOCUS_01860 187924 188895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094452.1 protein_id gnl|my_center|LOCUS_01860 190163 188991 gene locus_tag LOCUS_01870 190163 188991 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102241.1 protein_id gnl|my_center|LOCUS_01870 190335 191363 gene locus_tag LOCUS_01880 190335 191363 CDS product bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706139.1 protein_id gnl|my_center|LOCUS_01880 192071 191520 gene locus_tag LOCUS_01890 gene thiJ 192071 191520 CDS product oxidative-stress-resistance chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816903.1 protein_id gnl|my_center|LOCUS_01890 192271 193563 gene locus_tag LOCUS_01900 192271 193563 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_01900 193891 194979 gene locus_tag LOCUS_01910 gene trmA 193891 194979 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV78 protein_id gnl|my_center|LOCUS_01910 195423 195040 gene locus_tag LOCUS_01920 195423 195040 CDS product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095105.1 protein_id gnl|my_center|LOCUS_01920 195553 195987 gene locus_tag LOCUS_01930 195553 195987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_01930 196041 196901 gene locus_tag LOCUS_01940 196041 196901 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_01940 198080 196911 gene locus_tag LOCUS_01950 198080 196911 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_01950 201308 198171 gene locus_tag LOCUS_01960 201308 198171 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_01960 202465 201314 gene locus_tag LOCUS_01970 202465 201314 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_01970 202590 203210 gene locus_tag LOCUS_01980 gene nalD 202590 203210 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_01980 203420 203223 gene locus_tag LOCUS_01990 203420 203223 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719768.1 protein_id gnl|my_center|LOCUS_01990 203534 203926 gene locus_tag LOCUS_02000 203534 203926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770079.1 protein_id gnl|my_center|LOCUS_02000 203991 206363 gene locus_tag LOCUS_02010 203991 206363 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_02010 206472 208508 gene locus_tag LOCUS_02020 206472 208508 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105496.1 protein_id gnl|my_center|LOCUS_02020 208505 209365 gene locus_tag LOCUS_02030 208505 209365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104750.1 protein_id gnl|my_center|LOCUS_02030 209362 212625 gene locus_tag LOCUS_02040 209362 212625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104751.1 protein_id gnl|my_center|LOCUS_02040 212622 213545 gene locus_tag LOCUS_02050 212622 213545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104752.1 protein_id gnl|my_center|LOCUS_02050 213954 214487 gene locus_tag LOCUS_02060 213954 214487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 214487 214831 gene locus_tag LOCUS_02070 214487 214831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 214844 215188 gene locus_tag LOCUS_02080 214844 215188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 215225 215656 gene locus_tag LOCUS_02090 215225 215656 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_02090 216696 215809 gene locus_tag LOCUS_02100 216696 215809 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_02100 217671 216784 gene locus_tag LOCUS_02110 217671 216784 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 protein_id gnl|my_center|LOCUS_02110 217772 218413 gene locus_tag LOCUS_02120 217772 218413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_02120 218476 218766 gene locus_tag LOCUS_02130 218476 218766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 protein_id gnl|my_center|LOCUS_02130 219514 218771 gene locus_tag LOCUS_02140 219514 218771 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVR0 protein_id gnl|my_center|LOCUS_02140 219743 221971 gene locus_tag LOCUS_02150 219743 221971 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223350.1 protein_id gnl|my_center|LOCUS_02150 223438 222326 gene locus_tag LOCUS_02160 223438 222326 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_02160 224169 223501 gene locus_tag LOCUS_02170 gene piuC 224169 223501 CDS product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 protein_id gnl|my_center|LOCUS_02170 226607 224313 gene locus_tag LOCUS_02180 226607 224313 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_02180 228003 226840 gene locus_tag LOCUS_02190 gene speC 228003 226840 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 protein_id gnl|my_center|LOCUS_02190 231026 228423 gene locus_tag LOCUS_02200 231026 228423 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112851.1 protein_id gnl|my_center|LOCUS_02200 231188 232771 gene locus_tag LOCUS_02210 gene prfC 231188 232771 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI9 protein_id gnl|my_center|LOCUS_02210 232872 233339 gene locus_tag LOCUS_02220 232872 233339 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_02220 234444 233410 gene locus_tag LOCUS_02230 gene amiB 234444 233410 CDS product ATP-dependent protease ATP-binding subunit-like protein AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51416 protein_id gnl|my_center|LOCUS_02230 235574 234531 gene locus_tag LOCUS_02240 gene amiE 235574 234531 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 protein_id gnl|my_center|LOCUS_02240 236018 235671 gene locus_tag LOCUS_02250 236018 235671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_02250 237344 236115 gene locus_tag LOCUS_02260 gene fmdA 237344 236115 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_02260 238310 237621 gene locus_tag LOCUS_02270 238310 237621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_02270 239136 238375 gene locus_tag LOCUS_02280 239136 238375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_02280 240302 239133 gene locus_tag LOCUS_02290 240302 239133 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_02290 241338 240421 gene locus_tag LOCUS_02300 241338 240421 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104864.1 protein_id gnl|my_center|LOCUS_02300 242669 241437 gene locus_tag LOCUS_02310 242669 241437 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_02310 243027 246422 gene locus_tag LOCUS_02320 243027 246422 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104865.1 protein_id gnl|my_center|LOCUS_02320 246397 247104 gene locus_tag LOCUS_02330 246397 247104 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_02330 247352 248059 gene locus_tag LOCUS_02340 gene cobB 247352 248059 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRF3 protein_id gnl|my_center|LOCUS_02340 250783 248603 gene locus_tag LOCUS_02350 250783 248603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_02350 252658 250931 gene locus_tag LOCUS_02360 252658 250931 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103366.1 protein_id gnl|my_center|LOCUS_02360 253591 252671 gene locus_tag LOCUS_02370 gene fruK 253591 252671 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888R1 protein_id gnl|my_center|LOCUS_02370 256452 253591 gene locus_tag LOCUS_02380 gene fruI 256452 253591 CDS product PTS fructose transporter subunit FruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_02380 256691 257677 gene locus_tag LOCUS_02390 gene fruR 256691 257677 CDS product FruR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_02390 259788 257731 gene locus_tag LOCUS_02400 259788 257731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112310.1 protein_id gnl|my_center|LOCUS_02400 259925 260704 gene locus_tag LOCUS_02410 259925 260704 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_02410 262984 260954 gene locus_tag LOCUS_02420 262984 260954 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_02420 264209 263376 gene locus_tag LOCUS_02430 264209 263376 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 protein_id gnl|my_center|LOCUS_02430 264763 264212 gene locus_tag LOCUS_02440 264763 264212 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_02440 264712 264927 gene locus_tag LOCUS_02450 264712 264927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 267371 265152 gene locus_tag LOCUS_02460 267371 265152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_02460 267856 268704 gene locus_tag LOCUS_02470 267856 268704 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_02470 269602 269273 gene locus_tag LOCUS_02480 269602 269273 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_02480 270018 269599 gene locus_tag LOCUS_02490 270018 269599 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_02490 270093 270524 gene locus_tag LOCUS_02500 270093 270524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 270841 271098 gene locus_tag LOCUS_02510 270841 271098 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UIL0 protein_id gnl|my_center|LOCUS_02510 271095 271484 gene locus_tag LOCUS_02520 271095 271484 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_02520 272160 271738 gene locus_tag LOCUS_02530 272160 271738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_02530 272548 272150 gene locus_tag LOCUS_02540 272548 272150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 272576 272938 gene locus_tag LOCUS_02550 272576 272938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 273635 273198 gene locus_tag LOCUS_02560 gene pilA 273635 273198 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_02560 274294 273827 gene locus_tag LOCUS_02570 gene pilA 274294 273827 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_02570 274519 276222 gene locus_tag LOCUS_02580 gene pilB 274519 276222 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_02580 276225 277442 gene locus_tag LOCUS_02590 gene pilC 276225 277442 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_02590 277443 278312 gene locus_tag LOCUS_02600 gene pilD 277443 278312 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 protein_id gnl|my_center|LOCUS_02600 278509 279117 gene locus_tag LOCUS_02610 gene coaE 278509 279117 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_02610 279114 279308 gene locus_tag LOCUS_02620 gene yacG 279114 279308 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_02620 279636 279277 gene locus_tag LOCUS_02630 279636 279277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 279896 279681 gene locus_tag LOCUS_02640 279896 279681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094660.1 protein_id gnl|my_center|LOCUS_02640 280693 280004 gene locus_tag LOCUS_02650 280693 280004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_02650 280891 281520 gene locus_tag LOCUS_02660 280891 281520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266631.1 protein_id gnl|my_center|LOCUS_02660 281517 282065 gene locus_tag LOCUS_02670 281517 282065 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406554.1 protein_id gnl|my_center|LOCUS_02670 282090 282263 gene locus_tag LOCUS_02680 282090 282263 CDS product DUF3094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094672.1 protein_id gnl|my_center|LOCUS_02680 282327 283628 gene locus_tag LOCUS_02690 gene ndh 282327 283628 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_02690 284128 284053 gene locus_tag LOCUS_t00020 284128 284053 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 284210 284134 gene locus_tag LOCUS_t00030 284210 284134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 284295 284220 gene locus_tag LOCUS_t00040 284295 284220 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 284502 286823 gene locus_tag LOCUS_02700 284502 286823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638601.2 protein_id gnl|my_center|LOCUS_02700 286833 287165 gene locus_tag LOCUS_02710 286833 287165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 289437 287773 gene locus_tag LOCUS_02720 289437 287773 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_02720 289943 294094 gene locus_tag LOCUS_02730 gene morA 289943 294094 CDS product motility regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_02730 294230 295483 gene locus_tag LOCUS_02740 gene glyA2 294230 295483 CDS product serine hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI7 protein_id gnl|my_center|LOCUS_02740 296051 295545 gene locus_tag LOCUS_02750 296051 295545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094862.1 protein_id gnl|my_center|LOCUS_02750 296217 296588 gene locus_tag LOCUS_02760 296217 296588 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI1 protein_id gnl|my_center|LOCUS_02760 296738 296592 gene locus_tag LOCUS_02770 296738 296592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 298344 296986 gene locus_tag LOCUS_02780 gene radA 298344 296986 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG7 protein_id gnl|my_center|LOCUS_02780 298437 298913 gene locus_tag LOCUS_02790 298437 298913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 299453 299175 gene locus_tag LOCUS_02800 299453 299175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_02800 299770 299522 gene locus_tag LOCUS_02810 299770 299522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_02810 299967 300992 gene locus_tag LOCUS_02820 299967 300992 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479230.1 protein_id gnl|my_center|LOCUS_02820 301769 300993 gene locus_tag LOCUS_02830 301769 300993 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110878.1 protein_id gnl|my_center|LOCUS_02830 301839 302963 gene locus_tag LOCUS_02840 gene rlmG 301839 302963 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH4 protein_id gnl|my_center|LOCUS_02840 303032 303289 gene locus_tag LOCUS_02850 303032 303289 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM93 protein_id gnl|my_center|LOCUS_02850 303277 303573 gene locus_tag LOCUS_02860 303277 303573 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_02860 304896 303577 gene locus_tag LOCUS_02870 304896 303577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113322.1 protein_id gnl|my_center|LOCUS_02870 306338 304896 gene locus_tag LOCUS_02880 306338 304896 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763601.1 protein_id gnl|my_center|LOCUS_02880 306585 306409 gene locus_tag LOCUS_02890 306585 306409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 307576 306569 gene locus_tag LOCUS_02900 gene cioB 307576 306569 CDS product cyanide insensitive terminal oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093053.1 protein_id gnl|my_center|LOCUS_02900 309018 307579 gene locus_tag LOCUS_02910 309018 307579 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 protein_id gnl|my_center|LOCUS_02910 310715 309438 gene locus_tag LOCUS_02920 310715 309438 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_02920 310947 312302 gene locus_tag LOCUS_02930 310947 312302 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112919.1 protein_id gnl|my_center|LOCUS_02930 313418 312426 gene locus_tag LOCUS_02940 313418 312426 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095270.1 protein_id gnl|my_center|LOCUS_02940 313800 314657 gene locus_tag LOCUS_02950 313800 314657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095272.1 protein_id gnl|my_center|LOCUS_02950 314894 315199 gene locus_tag LOCUS_02960 314894 315199 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407969.1 protein_id gnl|my_center|LOCUS_02960 315196 315945 gene locus_tag LOCUS_02970 gene cmoM 315196 315945 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV18 protein_id gnl|my_center|LOCUS_02970 316021 316602 gene locus_tag LOCUS_02980 316021 316602 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103259.1 protein_id gnl|my_center|LOCUS_02980 316624 317178 gene locus_tag LOCUS_02990 316624 317178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095282.1 protein_id gnl|my_center|LOCUS_02990 317195 317680 gene locus_tag LOCUS_03000 317195 317680 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111411.1 protein_id gnl|my_center|LOCUS_03000 317719 318168 gene locus_tag LOCUS_03010 317719 318168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095321.1 protein_id gnl|my_center|LOCUS_03010 318327 319454 gene locus_tag LOCUS_03020 318327 319454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 321401 319470 gene locus_tag LOCUS_03030 321401 319470 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707558.1 protein_id gnl|my_center|LOCUS_03030 323922 321601 gene locus_tag LOCUS_03040 323922 321601 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105204.1 protein_id gnl|my_center|LOCUS_03040 324348 324004 gene locus_tag LOCUS_03050 324348 324004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 329362 324491 gene locus_tag LOCUS_03060 329362 324491 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_03060 329552 330901 gene locus_tag LOCUS_03070 329552 330901 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 protein_id gnl|my_center|LOCUS_03070 330936 331391 gene locus_tag LOCUS_03080 330936 331391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_03080 333441 331528 gene locus_tag LOCUS_03090 gene speA 333441 331528 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN61 protein_id gnl|my_center|LOCUS_03090 333934 333563 gene locus_tag LOCUS_03100 333934 333563 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_03100 334877 334341 gene locus_tag LOCUS_03110 334877 334341 CDS product putative Nudix hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW9 protein_id gnl|my_center|LOCUS_03110 335938 334877 gene locus_tag LOCUS_03120 335938 334877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_03120 336196 337809 gene locus_tag LOCUS_03130 336196 337809 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_03130 337906 339870 gene locus_tag LOCUS_03140 gene ctpL 337906 339870 CDS product methyl-accepting chemotaxis protein CtpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW6 protein_id gnl|my_center|LOCUS_03140 340038 341822 gene locus_tag LOCUS_03150 gene dsbD 340038 341822 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_03150 341991 342437 gene locus_tag LOCUS_03160 gene aroQ1 341991 342437 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_03160 342488 342949 gene locus_tag LOCUS_03170 gene accB 342488 342949 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_03170 342967 344322 gene locus_tag LOCUS_03180 gene accC 342967 344322 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_03180 344627 345505 gene locus_tag LOCUS_03190 gene prmA 344627 345505 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_03190 345538 346836 gene locus_tag LOCUS_03200 345538 346836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_03200 347208 348206 gene locus_tag LOCUS_03210 gene dusB 347208 348206 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_03210 348203 348523 gene locus_tag LOCUS_03220 348203 348523 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN37 protein_id gnl|my_center|LOCUS_03220 348598 350205 gene locus_tag LOCUS_03230 gene purH 348598 350205 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_03230 350452 351741 gene locus_tag LOCUS_03240 gene purD 350452 351741 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV8 protein_id gnl|my_center|LOCUS_03240 351852 354632 gene locus_tag LOCUS_03250 gene retS 351852 354632 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_03250 354762 355355 gene locus_tag LOCUS_03260 354762 355355 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VR6 protein_id gnl|my_center|LOCUS_03260 355580 357379 gene locus_tag LOCUS_03270 355580 357379 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_03270 357388 358092 gene locus_tag LOCUS_03280 357388 358092 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_03280 358166 359431 gene locus_tag LOCUS_03290 358166 359431 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105219.1 protein_id gnl|my_center|LOCUS_03290 359533 361101 gene locus_tag LOCUS_03300 359533 361101 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_03300 361235 362323 gene locus_tag LOCUS_03310 361235 362323 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 protein_id gnl|my_center|LOCUS_03310 362320 363162 gene locus_tag LOCUS_03320 362320 363162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_03320 363286 363984 gene locus_tag LOCUS_03330 363286 363984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763108.1 protein_id gnl|my_center|LOCUS_03330 365014 364229 gene locus_tag LOCUS_03340 365014 364229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_03340 365197 366516 gene locus_tag LOCUS_03350 365197 366516 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705071.1 protein_id gnl|my_center|LOCUS_03350 368254 366758 gene locus_tag LOCUS_03360 368254 366758 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_03360 368431 369312 gene locus_tag LOCUS_03370 368431 369312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_03370 369501 370142 gene locus_tag LOCUS_03380 369501 370142 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 protein_id gnl|my_center|LOCUS_03380 370153 370815 gene locus_tag LOCUS_03390 370153 370815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167359.1 protein_id gnl|my_center|LOCUS_03390 370808 371566 gene locus_tag LOCUS_03400 370808 371566 CDS product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_03400 371622 372380 gene locus_tag LOCUS_03410 371622 372380 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_03410 373160 372447 gene locus_tag LOCUS_03420 373160 372447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 373340 374176 gene locus_tag LOCUS_03430 gene ureD2 373340 374176 CDS product urease accessory protein UreD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP5 protein_id gnl|my_center|LOCUS_03430 374361 374663 gene locus_tag LOCUS_03440 gene ureA 374361 374663 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP4 protein_id gnl|my_center|LOCUS_03440 374667 375167 gene locus_tag LOCUS_03450 gene pitA 374667 375167 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU7 protein_id gnl|my_center|LOCUS_03450 375175 375483 gene locus_tag LOCUS_03460 gene ureB 375175 375483 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN07 protein_id gnl|my_center|LOCUS_03460 375607 377307 gene locus_tag LOCUS_03470 gene ureC 375607 377307 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP0 protein_id gnl|my_center|LOCUS_03470 378068 377466 gene locus_tag LOCUS_03480 378068 377466 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_03480 378557 378114 gene locus_tag LOCUS_03490 378557 378114 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004417824.1 protein_id gnl|my_center|LOCUS_03490 378898 378632 gene locus_tag LOCUS_03500 378898 378632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_03500 379840 378968 gene locus_tag LOCUS_03510 379840 378968 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU1 protein_id gnl|my_center|LOCUS_03510 380970 379969 gene locus_tag LOCUS_03520 380970 379969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 381779 381024 gene locus_tag LOCUS_03530 381779 381024 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071376.1 protein_id gnl|my_center|LOCUS_03530 382603 381833 gene locus_tag LOCUS_03540 382603 381833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704580.1 protein_id gnl|my_center|LOCUS_03540 383606 382683 gene locus_tag LOCUS_03550 383606 382683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 383772 384500 gene locus_tag LOCUS_03560 383772 384500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_03560 384535 384972 gene locus_tag LOCUS_03570 384535 384972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_03570 385184 386161 gene locus_tag LOCUS_03580 385184 386161 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388243.1 protein_id gnl|my_center|LOCUS_03580 386224 387489 gene locus_tag LOCUS_03590 386224 387489 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099398.1 protein_id gnl|my_center|LOCUS_03590 387584 387940 gene locus_tag LOCUS_03600 387584 387940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808351.1 protein_id gnl|my_center|LOCUS_03600 387941 388423 gene locus_tag LOCUS_03610 387941 388423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931296.1 protein_id gnl|my_center|LOCUS_03610 388695 389228 gene locus_tag LOCUS_03620 388695 389228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114836.1 protein_id gnl|my_center|LOCUS_03620 390511 389342 gene locus_tag LOCUS_03630 390511 389342 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_03630 391908 390520 gene locus_tag LOCUS_03640 391908 390520 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_03640 393377 392004 gene locus_tag LOCUS_03650 393377 392004 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_03650 394429 393635 gene locus_tag LOCUS_03660 394429 393635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence02 718 3459 gene locus_tag LOCUS_03670 gene acnA 718 3459 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F5 protein_id gnl|my_center|LOCUS_03670 3639 5204 gene locus_tag LOCUS_03680 gene aer 3639 5204 CDS product aerotaxis receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_03680 5416 5625 gene locus_tag LOCUS_03690 5416 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6564 5857 gene locus_tag LOCUS_03700 6564 5857 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_03700 7031 6687 gene locus_tag LOCUS_03710 7031 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617305.1 protein_id gnl|my_center|LOCUS_03710 7000 7335 gene locus_tag LOCUS_03720 7000 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8112 7351 gene locus_tag LOCUS_03730 8112 7351 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_03730 9041 8112 gene locus_tag LOCUS_03740 9041 8112 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142502.1 protein_id gnl|my_center|LOCUS_03740 10500 9025 gene locus_tag LOCUS_03750 10500 9025 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_03750 10838 10602 gene locus_tag LOCUS_03760 10838 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10722 11618 gene locus_tag LOCUS_03770 10722 11618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_03770 11870 12748 gene locus_tag LOCUS_03780 gene alkA 11870 12748 CDS product 3-methyladenine DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_03780 12752 13249 gene locus_tag LOCUS_03790 12752 13249 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG04 protein_id gnl|my_center|LOCUS_03790 13808 13251 gene locus_tag LOCUS_03800 13808 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 13996 13805 gene locus_tag LOCUS_03810 13996 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_03810 14597 14058 gene locus_tag LOCUS_03820 gene mtnD 14597 14058 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB9 protein_id gnl|my_center|LOCUS_03820 15774 14614 gene locus_tag LOCUS_03830 15774 14614 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_03830 16862 15771 gene locus_tag LOCUS_03840 gene aroC 16862 15771 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P5 protein_id gnl|my_center|LOCUS_03840 17035 17979 gene locus_tag LOCUS_03850 17035 17979 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 protein_id gnl|my_center|LOCUS_03850 18016 18816 gene locus_tag LOCUS_03860 18016 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087649.1 protein_id gnl|my_center|LOCUS_03860 19811 18891 gene locus_tag LOCUS_03870 gene prmB 19811 18891 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_03870 20174 20770 gene locus_tag LOCUS_03880 20174 20770 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103179.1 protein_id gnl|my_center|LOCUS_03880 20851 21171 gene locus_tag LOCUS_03890 20851 21171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087644.1 protein_id gnl|my_center|LOCUS_03890 21323 21880 gene locus_tag LOCUS_03900 21323 21880 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 protein_id gnl|my_center|LOCUS_03900 21958 22503 gene locus_tag LOCUS_03910 gene folE 21958 22503 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVD0 protein_id gnl|my_center|LOCUS_03910 22695 23063 gene locus_tag LOCUS_03920 22695 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_03920 25665 23305 gene locus_tag LOCUS_03930 gene ligA 25665 23305 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YY6 protein_id gnl|my_center|LOCUS_03930 26547 25726 gene locus_tag LOCUS_03940 gene zipA 26547 25726 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVF7 protein_id gnl|my_center|LOCUS_03940 30249 26761 gene locus_tag LOCUS_03950 gene smc 30249 26761 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_03950 30915 30256 gene locus_tag LOCUS_03960 30915 30256 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_03960 31148 32281 gene locus_tag LOCUS_03970 gene alkB2 31148 32281 CDS product alkane 1-monooxygenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6H941 protein_id gnl|my_center|LOCUS_03970 32669 34108 gene locus_tag LOCUS_03980 gene xdhA 32669 34108 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_03980 34133 36529 gene locus_tag LOCUS_03990 gene xdhB 34133 36529 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_03990 36755 37585 gene locus_tag LOCUS_04000 36755 37585 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_04000 37703 39007 gene locus_tag LOCUS_04010 37703 39007 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_04010 39937 39170 gene locus_tag LOCUS_04020 39937 39170 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_04020 40531 41871 gene locus_tag LOCUS_04030 40531 41871 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_04030 42885 42532 gene locus_tag LOCUS_04040 42885 42532 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J5 protein_id gnl|my_center|LOCUS_04040 43288 44229 gene locus_tag LOCUS_04050 43288 44229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_04050 44226 44741 gene locus_tag LOCUS_04060 44226 44741 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_04060 44783 45286 gene locus_tag LOCUS_04070 gene allA 44783 45286 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J9 protein_id gnl|my_center|LOCUS_04070 45334 46671 gene locus_tag LOCUS_04080 45334 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_04080 47051 48586 gene locus_tag LOCUS_04090 47051 48586 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_04090 48651 49511 gene locus_tag LOCUS_04100 48651 49511 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_04100 49762 50136 gene locus_tag LOCUS_04110 49762 50136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 51339 50344 gene locus_tag LOCUS_04120 gene moaA2 51339 50344 CDS product GTP 3',8-cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3K7 protein_id gnl|my_center|LOCUS_04120 51552 52196 gene locus_tag LOCUS_04130 51552 52196 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376205.1 protein_id gnl|my_center|LOCUS_04130 52847 52311 gene locus_tag LOCUS_04140 52847 52311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 53500 52847 gene locus_tag LOCUS_04150 53500 52847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 53815 54108 gene locus_tag LOCUS_04160 53815 54108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 54564 54130 gene locus_tag LOCUS_04170 54564 54130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_04170 54900 56675 gene locus_tag LOCUS_04180 gene gcl 54900 56675 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 protein_id gnl|my_center|LOCUS_04180 56818 57600 gene locus_tag LOCUS_04190 56818 57600 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L1 protein_id gnl|my_center|LOCUS_04190 57746 58636 gene locus_tag LOCUS_04200 57746 58636 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_04200 58995 60299 gene locus_tag LOCUS_04210 58995 60299 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_04210 60373 61806 gene locus_tag LOCUS_04220 gene pykF 60373 61806 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L4 protein_id gnl|my_center|LOCUS_04220 62052 62966 gene locus_tag LOCUS_04230 62052 62966 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114298.1 protein_id gnl|my_center|LOCUS_04230 63112 63387 gene locus_tag LOCUS_04240 63112 63387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 63475 64341 gene locus_tag LOCUS_04250 63475 64341 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_04250 64426 65883 gene locus_tag LOCUS_04260 64426 65883 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_04260 66307 65981 gene locus_tag LOCUS_04270 66307 65981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719744.1 protein_id gnl|my_center|LOCUS_04270 67515 66304 gene locus_tag LOCUS_04280 gene cycH 67515 66304 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_04280 67958 67512 gene locus_tag LOCUS_04290 gene cycL 67958 67512 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104639.1 protein_id gnl|my_center|LOCUS_04290 68671 68129 gene locus_tag LOCUS_04300 gene dsbE 68671 68129 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_04300 70641 68668 gene locus_tag LOCUS_04310 gene ccmF 70641 68668 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_04310 71126 70638 gene locus_tag LOCUS_04320 gene ccmE 71126 70638 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_04320 71299 71123 gene locus_tag LOCUS_04330 gene ccmD 71299 71123 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N4 protein_id gnl|my_center|LOCUS_04330 72051 71296 gene locus_tag LOCUS_04340 gene ccmC 72051 71296 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_04340 72817 72146 gene locus_tag LOCUS_04350 gene ccmB 72817 72146 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 protein_id gnl|my_center|LOCUS_04350 73458 72814 gene locus_tag LOCUS_04360 gene ccmA 73458 72814 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_04360 73663 75192 gene locus_tag LOCUS_04370 73663 75192 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_04370 75189 75530 gene locus_tag LOCUS_04380 75189 75530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_04380 75939 75511 gene locus_tag LOCUS_04390 75939 75511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 75826 76062 gene locus_tag LOCUS_04400 75826 76062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 76521 76099 gene locus_tag LOCUS_04410 76521 76099 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412376.1 protein_id gnl|my_center|LOCUS_04410 77004 76525 gene locus_tag LOCUS_04420 gene cheW-2 77004 76525 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_04420 77903 77100 gene locus_tag LOCUS_04430 77903 77100 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_04430 78778 77990 gene locus_tag LOCUS_04440 78778 77990 CDS product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_04440 79670 78861 gene locus_tag LOCUS_04450 gene motD 79670 78861 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_04450 80429 79683 gene locus_tag LOCUS_04460 gene motC 80429 79683 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_04460 81585 80449 gene locus_tag LOCUS_04470 gene cheB1 81585 80449 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_04470 83850 81631 gene locus_tag LOCUS_04480 83850 81631 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_04480 84651 83863 gene locus_tag LOCUS_04490 84651 83863 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_04490 85012 84671 gene locus_tag LOCUS_04500 gene cheY 85012 84671 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51455 protein_id gnl|my_center|LOCUS_04500 85868 85146 gene locus_tag LOCUS_04510 gene fliA 85868 85146 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V7 protein_id gnl|my_center|LOCUS_04510 86719 85889 gene locus_tag LOCUS_04520 gene fleN 86719 85889 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 protein_id gnl|my_center|LOCUS_04520 88143 86833 gene locus_tag LOCUS_04530 gene flhF 88143 86833 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_04530 90290 88155 gene locus_tag LOCUS_04540 gene flhA 90290 88155 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_04540 91657 90521 gene locus_tag LOCUS_04550 gene flhB 91657 90521 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_04550 92436 91660 gene locus_tag LOCUS_04560 gene fliR 92436 91660 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_04560 92719 92450 gene locus_tag LOCUS_04570 gene fliQ 92719 92450 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_04570 93517 92732 gene locus_tag LOCUS_04580 gene fliP 93517 92732 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_04580 93948 93517 gene locus_tag LOCUS_04590 gene fliO 93948 93517 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W5 protein_id gnl|my_center|LOCUS_04590 94421 93951 gene locus_tag LOCUS_04600 gene fliN 94421 93951 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51466 protein_id gnl|my_center|LOCUS_04600 95463 94492 gene locus_tag LOCUS_04610 gene fliM 95463 94492 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_04610 95997 95476 gene locus_tag LOCUS_04620 95997 95476 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_04620 97463 96237 gene locus_tag LOCUS_04630 97463 96237 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_04630 97884 97531 gene locus_tag LOCUS_04640 97884 97531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_04640 99602 97914 gene locus_tag LOCUS_04650 99602 97914 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_04650 99910 99605 gene locus_tag LOCUS_04660 99910 99605 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_04660 100445 99996 gene locus_tag LOCUS_04670 gene fliJ 100445 99996 CDS product flagellar protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_04670 101838 100492 gene locus_tag LOCUS_04680 gene fliI 101838 100492 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_04680 102616 101828 gene locus_tag LOCUS_04690 102616 101828 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_04690 103636 102620 gene locus_tag LOCUS_04700 gene fliG 103636 102620 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_04700 105413 103629 gene locus_tag LOCUS_04710 gene fliF 105413 103629 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51463 protein_id gnl|my_center|LOCUS_04710 105894 105565 gene locus_tag LOCUS_04720 gene fliE 105894 105565 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51462 protein_id gnl|my_center|LOCUS_04720 107524 106109 gene locus_tag LOCUS_04730 gene fleR 107524 106109 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_04730 108742 107528 gene locus_tag LOCUS_04740 gene fleS 108742 107528 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_04740 110498 109023 gene locus_tag LOCUS_04750 gene fleQ 110498 109023 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_04750 111051 110758 gene locus_tag LOCUS_04760 111051 110758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082194.1 protein_id gnl|my_center|LOCUS_04760 111457 111077 gene locus_tag LOCUS_04770 gene fliS 111457 111077 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_04770 112061 111672 gene locus_tag LOCUS_04780 gene fliS 112061 111672 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3P3 protein_id gnl|my_center|LOCUS_04780 113513 112068 gene locus_tag LOCUS_04790 gene fliD 113513 112068 CDS product B-type flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C5 protein_id gnl|my_center|LOCUS_04790 114095 113736 gene locus_tag LOCUS_04800 114095 113736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_04800 115680 114172 gene locus_tag LOCUS_04810 gene fliC 115680 114172 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_04810 117445 116186 gene locus_tag LOCUS_04820 gene flgL 117445 116186 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_04820 119560 117548 gene locus_tag LOCUS_04830 gene flgK 119560 117548 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_04830 120748 119570 gene locus_tag LOCUS_04840 gene flgJ 120748 119570 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P4 protein_id gnl|my_center|LOCUS_04840 121938 120763 gene locus_tag LOCUS_04850 gene flgI 121938 120763 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_04850 122777 122055 gene locus_tag LOCUS_04860 gene flgH 122777 122055 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_04860 123600 122815 gene locus_tag LOCUS_04870 gene flgG 123600 122815 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_04870 124387 123647 gene locus_tag LOCUS_04880 gene flgF 124387 123647 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_04880 125922 124600 gene locus_tag LOCUS_04890 gene flgE 125922 124600 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P9 protein_id gnl|my_center|LOCUS_04890 126624 125959 gene locus_tag LOCUS_04900 gene flgD 126624 125959 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_04900 127089 126646 gene locus_tag LOCUS_04910 gene flgC 127089 126646 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_04910 127508 127101 gene locus_tag LOCUS_04920 gene flgB 127508 127101 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_04920 128661 127813 gene locus_tag LOCUS_04930 128661 127813 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268461.1 protein_id gnl|my_center|LOCUS_04930 129616 128684 gene locus_tag LOCUS_04940 129616 128684 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_04940 129766 130452 gene locus_tag LOCUS_04950 129766 130452 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYP6 protein_id gnl|my_center|LOCUS_04950 130588 130923 gene locus_tag LOCUS_04960 gene flgM 130588 130923 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_04960 130974 131441 gene locus_tag LOCUS_04970 130974 131441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113135.1 protein_id gnl|my_center|LOCUS_04970 131533 132282 gene locus_tag LOCUS_04980 131533 132282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_04980 133690 132383 gene locus_tag LOCUS_04990 133690 132383 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098737.1 protein_id gnl|my_center|LOCUS_04990 135072 133729 gene locus_tag LOCUS_05000 135072 133729 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103772.1 protein_id gnl|my_center|LOCUS_05000 135352 136575 gene locus_tag LOCUS_05010 gene sstT 135352 136575 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I273 protein_id gnl|my_center|LOCUS_05010 136739 137488 gene locus_tag LOCUS_05020 gene alcD 136739 137488 CDS product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814016.1 protein_id gnl|my_center|LOCUS_05020 137552 139546 gene locus_tag LOCUS_05030 137552 139546 CDS product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263606.1 protein_id gnl|my_center|LOCUS_05030 139558 140409 gene locus_tag LOCUS_05040 139558 140409 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263607.1 protein_id gnl|my_center|LOCUS_05040 142564 140447 gene locus_tag LOCUS_05050 gene fpvA1 142564 140447 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_05050 143920 142736 gene locus_tag LOCUS_05060 gene alcE 143920 142736 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005013753.1 protein_id gnl|my_center|LOCUS_05060 145951 144089 gene locus_tag LOCUS_05070 gene alcC 145951 144089 CDS product alcaligin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930939.1 protein_id gnl|my_center|LOCUS_05070 146532 145948 gene locus_tag LOCUS_05080 gene alcB 146532 145948 CDS product alcaligin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814014.1 protein_id gnl|my_center|LOCUS_05080 147721 146522 gene locus_tag LOCUS_05090 147721 146522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 149055 147718 gene locus_tag LOCUS_05100 gene alcA 149055 147718 CDS product alcaligin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65199 protein_id gnl|my_center|LOCUS_05100 149485 149411 gene locus_tag LOCUS_t00050 149485 149411 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 151029 149632 gene locus_tag LOCUS_05110 151029 149632 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_05110 152176 151118 gene locus_tag LOCUS_05120 gene ldh 152176 151118 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_05120 155725 152258 gene locus_tag LOCUS_05130 155725 152258 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268160.1 protein_id gnl|my_center|LOCUS_05130 155923 156390 gene locus_tag LOCUS_05140 155923 156390 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_05140 157337 156387 gene locus_tag LOCUS_05150 157337 156387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 protein_id gnl|my_center|LOCUS_05150 157616 157876 gene locus_tag LOCUS_05160 157616 157876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 158876 157887 gene locus_tag LOCUS_05170 158876 157887 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_05170 161377 159074 gene locus_tag LOCUS_05180 gene metE 161377 159074 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_05180 161546 162463 gene locus_tag LOCUS_05190 161546 162463 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_05190 162777 163433 gene locus_tag LOCUS_05200 162777 163433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 163440 164522 gene locus_tag LOCUS_05210 163440 164522 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_05210 164524 167679 gene locus_tag LOCUS_05220 164524 167679 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_05220 168481 169791 gene locus_tag LOCUS_05230 gene algD 168481 169791 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11759 protein_id gnl|my_center|LOCUS_05230 169906 171330 gene locus_tag LOCUS_05240 gene algA 169906 171330 CDS product alginate biosynthesis protein AlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07874 protein_id gnl|my_center|LOCUS_05240 171392 172912 gene locus_tag LOCUS_05250 gene alg8 171392 172912 CDS product glycosyltransferase alg8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P9 protein_id gnl|my_center|LOCUS_05250 172930 174075 gene locus_tag LOCUS_05260 gene alg44 172930 174075 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY69 protein_id gnl|my_center|LOCUS_05260 174083 175558 gene locus_tag LOCUS_05270 174083 175558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 175555 176946 gene locus_tag LOCUS_05280 175555 176946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 176964 178397 gene locus_tag LOCUS_05290 gene algI 176964 178397 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q6 protein_id gnl|my_center|LOCUS_05290 178408 179511 gene locus_tag LOCUS_05300 gene algJ 178408 179511 CDS product putative alginate O-acetylase AlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q7 protein_id gnl|my_center|LOCUS_05300 179527 180168 gene locus_tag LOCUS_05310 179527 180168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 180218 181621 gene locus_tag LOCUS_05320 gene algX 180218 181621 CDS product alginate biosynthesis protein AlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q4 protein_id gnl|my_center|LOCUS_05320 181612 182727 gene locus_tag LOCUS_05330 181612 182727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 182742 184223 gene locus_tag LOCUS_05340 182742 184223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 185154 184474 gene locus_tag LOCUS_05350 185154 184474 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268396.1 protein_id gnl|my_center|LOCUS_05350 185840 186607 gene locus_tag LOCUS_05360 185840 186607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 186801 187487 gene locus_tag LOCUS_05370 186801 187487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 187484 187933 gene locus_tag LOCUS_05380 187484 187933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 188129 188392 gene locus_tag LOCUS_05390 188129 188392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 188478 188744 gene locus_tag LOCUS_05400 188478 188744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 188797 188952 gene locus_tag LOCUS_05410 188797 188952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 189448 189359 gene locus_tag LOCUS_t00060 189448 189359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 190436 189567 gene locus_tag LOCUS_05420 gene purC 190436 189567 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_05420 191802 190681 gene locus_tag LOCUS_05430 191802 190681 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245782.1 protein_id gnl|my_center|LOCUS_05430 192697 191819 gene locus_tag LOCUS_05440 gene dapA 192697 191819 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_05440 192945 193502 gene locus_tag LOCUS_05450 192945 193502 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379024.1 protein_id gnl|my_center|LOCUS_05450 193525 193998 gene locus_tag LOCUS_05460 193525 193998 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_05460 195289 194225 gene locus_tag LOCUS_05470 195289 194225 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 protein_id gnl|my_center|LOCUS_05470 195643 195404 gene locus_tag LOCUS_05480 195643 195404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_05480 195752 197185 gene locus_tag LOCUS_05490 195752 197185 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_05490 202347 197506 gene locus_tag LOCUS_05500 gene gdhB 202347 197506 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_05500 203932 202628 gene locus_tag LOCUS_05510 203932 202628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_05510 204497 203991 gene locus_tag LOCUS_05520 204497 203991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_05520 205541 204564 gene locus_tag LOCUS_05530 205541 204564 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_05530 206694 205750 gene locus_tag LOCUS_05540 206694 205750 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102114.1 protein_id gnl|my_center|LOCUS_05540 206966 208189 gene locus_tag LOCUS_05550 gene opdO 206966 208189 CDS product pyroglutatmate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113624.1 protein_id gnl|my_center|LOCUS_05550 208328 210211 gene locus_tag LOCUS_05560 208328 210211 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383592.1 protein_id gnl|my_center|LOCUS_05560 210364 211116 gene locus_tag LOCUS_05570 210364 211116 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I203 protein_id gnl|my_center|LOCUS_05570 211113 211826 gene locus_tag LOCUS_05580 211113 211826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_05580 211823 212752 gene locus_tag LOCUS_05590 211823 212752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_05590 212947 213906 gene locus_tag LOCUS_05600 212947 213906 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_05600 213980 214954 gene locus_tag LOCUS_05610 213980 214954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_05610 214951 215445 gene locus_tag LOCUS_05620 214951 215445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_05620 215438 216442 gene locus_tag LOCUS_05630 215438 216442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_05630 216439 218196 gene locus_tag LOCUS_05640 216439 218196 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267198.1 protein_id gnl|my_center|LOCUS_05640 218193 219833 gene locus_tag LOCUS_05650 218193 219833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_05650 222784 220430 gene locus_tag LOCUS_05660 222784 220430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_05660 223897 222803 gene locus_tag LOCUS_05670 223897 222803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_05670 225607 224237 gene locus_tag LOCUS_05680 225607 224237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_05680 227852 225816 gene locus_tag LOCUS_05690 gene gbt 227852 225816 CDS product glycine/betaine transmethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_05690 231124 228467 gene locus_tag LOCUS_05700 gene pepN 231124 228467 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_05700 232012 231176 gene locus_tag LOCUS_05710 232012 231176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245163.1 protein_id gnl|my_center|LOCUS_05710 232275 232012 gene locus_tag LOCUS_05720 232275 232012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554502.1 protein_id gnl|my_center|LOCUS_05720 233226 232366 gene locus_tag LOCUS_05730 233226 232366 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_05730 234197 233223 gene locus_tag LOCUS_05740 234197 233223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_05740 235085 234198 gene locus_tag LOCUS_05750 gene nadK 235085 234198 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 protein_id gnl|my_center|LOCUS_05750 235171 236115 gene locus_tag LOCUS_05760 235171 236115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_05760 237315 236206 gene locus_tag LOCUS_05770 237315 236206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 238279 237338 gene locus_tag LOCUS_05780 238279 237338 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267167.1 protein_id gnl|my_center|LOCUS_05780 239649 238282 gene locus_tag LOCUS_05790 239649 238282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_05790 240234 241190 gene locus_tag LOCUS_05800 240234 241190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_05800 241630 241199 gene locus_tag LOCUS_05810 241630 241199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_05810 244046 241917 gene locus_tag LOCUS_05820 gene fadH1 244046 241917 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_05820 244152 245174 gene locus_tag LOCUS_05830 244152 245174 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267165.1 protein_id gnl|my_center|LOCUS_05830 245165 246208 gene locus_tag LOCUS_05840 245165 246208 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_05840 246332 247528 gene locus_tag LOCUS_05850 246332 247528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106912.1 protein_id gnl|my_center|LOCUS_05850 247525 248061 gene locus_tag LOCUS_05860 247525 248061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111932.1 protein_id gnl|my_center|LOCUS_05860 248058 248378 gene locus_tag LOCUS_05870 248058 248378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_05870 248375 248941 gene locus_tag LOCUS_05880 248375 248941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770688.1 protein_id gnl|my_center|LOCUS_05880 248960 249886 gene locus_tag LOCUS_05890 248960 249886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103867.1 protein_id gnl|my_center|LOCUS_05890 249883 250635 gene locus_tag LOCUS_05900 249883 250635 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267339.1 protein_id gnl|my_center|LOCUS_05900 250632 251531 gene locus_tag LOCUS_05910 250632 251531 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406943.1 protein_id gnl|my_center|LOCUS_05910 251528 252415 gene locus_tag LOCUS_05920 251528 252415 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770697.1 protein_id gnl|my_center|LOCUS_05920 253025 252949 gene locus_tag LOCUS_t00070 253025 252949 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 253210 253134 gene locus_tag LOCUS_t00080 253210 253134 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 253321 253246 gene locus_tag LOCUS_t00090 253321 253246 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 254003 253575 gene locus_tag LOCUS_05930 254003 253575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_05930 254157 255926 gene locus_tag LOCUS_05940 gene asnB 254157 255926 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103637.1 protein_id gnl|my_center|LOCUS_05940 256059 257798 gene locus_tag LOCUS_05950 256059 257798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268627.1 protein_id gnl|my_center|LOCUS_05950 257862 259061 gene locus_tag LOCUS_05960 257862 259061 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402538.1 protein_id gnl|my_center|LOCUS_05960 259220 261970 gene locus_tag LOCUS_05970 259220 261970 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 protein_id gnl|my_center|LOCUS_05970 262034 262285 gene locus_tag LOCUS_05980 262034 262285 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPZ1 protein_id gnl|my_center|LOCUS_05980 263027 262275 gene locus_tag LOCUS_05990 263027 262275 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314590.1 protein_id gnl|my_center|LOCUS_05990 264222 263158 gene locus_tag LOCUS_06000 264222 263158 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ4 protein_id gnl|my_center|LOCUS_06000 265560 264736 gene locus_tag LOCUS_06010 gene ttcA 265560 264736 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_06010 265660 266253 gene locus_tag LOCUS_06020 265660 266253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_06020 266422 267021 gene locus_tag LOCUS_06030 266422 267021 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_06030 267154 267816 gene locus_tag LOCUS_06040 267154 267816 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_06040 267878 268372 gene locus_tag LOCUS_06050 gene sprT 267878 268372 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ34 protein_id gnl|my_center|LOCUS_06050 269663 268482 gene locus_tag LOCUS_06060 269663 268482 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_06060 271390 269744 gene locus_tag LOCUS_06070 271390 269744 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_06070 272295 271474 gene locus_tag LOCUS_06080 272295 271474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_06080 273458 272319 gene locus_tag LOCUS_06090 273458 272319 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_06090 273621 274619 gene locus_tag LOCUS_06100 273621 274619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_06100 274626 274886 gene locus_tag LOCUS_06110 274626 274886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 274895 275428 gene locus_tag LOCUS_06120 274895 275428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 275626 275417 gene locus_tag LOCUS_06130 275626 275417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 277751 276369 gene locus_tag LOCUS_06140 gene phoQ 277751 276369 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082438.1 protein_id gnl|my_center|LOCUS_06140 278425 277748 gene locus_tag LOCUS_06150 gene phoP 278425 277748 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_06150 279240 278635 gene locus_tag LOCUS_06160 gene oprH 279240 278635 CDS product PhoP/Q and low Mg2+ inducible outer membrane protein H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 protein_id gnl|my_center|LOCUS_06160 280525 279353 gene locus_tag LOCUS_06170 280525 279353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_06170 280761 280928 gene locus_tag LOCUS_06180 gene napE 280761 280928 CDS product nitrate reductase NapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082429.1 protein_id gnl|my_center|LOCUS_06180 280957 281217 gene locus_tag LOCUS_06190 gene napD 280957 281217 CDS product nitrate reductase biosynthesis protein NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082422.1 protein_id gnl|my_center|LOCUS_06190 281214 283718 gene locus_tag LOCUS_06200 gene napA 281214 283718 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G3 protein_id gnl|my_center|LOCUS_06200 283730 284215 gene locus_tag LOCUS_06210 gene napB 283730 284215 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G4 protein_id gnl|my_center|LOCUS_06210 284226 284822 gene locus_tag LOCUS_06220 gene napC 284226 284822 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_06220 285347 284871 gene locus_tag LOCUS_06230 285347 284871 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_06230 285378 286784 gene locus_tag LOCUS_06240 285378 286784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 286899 287291 gene locus_tag LOCUS_06250 286899 287291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109947.1 protein_id gnl|my_center|LOCUS_06250 288977 287763 gene locus_tag LOCUS_06260 288977 287763 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_06260 289120 289473 gene locus_tag LOCUS_06270 289120 289473 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_06270 289470 290066 gene locus_tag LOCUS_06280 289470 290066 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_06280 290069 290476 gene locus_tag LOCUS_06290 290069 290476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_06290 291277 290573 gene locus_tag LOCUS_06300 291277 290573 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268586.1 protein_id gnl|my_center|LOCUS_06300 292631 291546 gene locus_tag LOCUS_06310 292631 291546 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_06310 293745 292705 gene locus_tag LOCUS_06320 293745 292705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 protein_id gnl|my_center|LOCUS_06320 293993 295051 gene locus_tag LOCUS_06330 gene purM 293993 295051 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ51 protein_id gnl|my_center|LOCUS_06330 295051 295695 gene locus_tag LOCUS_06340 gene purN 295051 295695 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_06340 295704 296420 gene locus_tag LOCUS_06350 295704 296420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_06350 297986 296778 gene locus_tag LOCUS_06360 297986 296778 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_06360 298359 298676 gene locus_tag LOCUS_06370 298359 298676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091262.1 protein_id gnl|my_center|LOCUS_06370 298685 299044 gene locus_tag LOCUS_06380 298685 299044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553117.1 protein_id gnl|my_center|LOCUS_06380 299041 299358 gene locus_tag LOCUS_06390 299041 299358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103249.1 protein_id gnl|my_center|LOCUS_06390 299443 300606 gene locus_tag LOCUS_06400 gene rtn 299443 300606 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 protein_id gnl|my_center|LOCUS_06400 300762 301664 gene locus_tag LOCUS_06410 300762 301664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 302312 301650 gene locus_tag LOCUS_06420 302312 301650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 304088 302331 gene locus_tag LOCUS_06430 304088 302331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 304404 304075 gene locus_tag LOCUS_06440 304404 304075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 304700 306031 gene locus_tag LOCUS_06450 gene dgt2 304700 306031 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG5 protein_id gnl|my_center|LOCUS_06450 306044 307108 gene locus_tag LOCUS_06460 306044 307108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 307179 310130 gene locus_tag LOCUS_06470 307179 310130 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816594.1 protein_id gnl|my_center|LOCUS_06470 310608 310267 gene locus_tag LOCUS_06480 310608 310267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 protein_id gnl|my_center|LOCUS_06480 310857 312293 gene locus_tag LOCUS_06490 gene dacB 310857 312293 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765687.1 protein_id gnl|my_center|LOCUS_06490 314545 312365 gene locus_tag LOCUS_06500 gene rlmL 314545 312365 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883N9 protein_id gnl|my_center|LOCUS_06500 316293 315271 gene locus_tag LOCUS_06510 gene pyrD 316293 315271 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_06510 316601 316380 gene locus_tag LOCUS_06520 316601 316380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_06520 316746 317627 gene locus_tag LOCUS_06530 316746 317627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122457.1 protein_id gnl|my_center|LOCUS_06530 318057 317641 gene locus_tag LOCUS_06540 gene recX 318057 317641 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_06540 319157 318114 gene locus_tag LOCUS_06550 gene recA 319157 318114 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_06550 319745 319245 gene locus_tag LOCUS_06560 319745 319245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_06560 319856 320164 gene locus_tag LOCUS_06570 319856 320164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 320115 320309 gene locus_tag LOCUS_06580 320115 320309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06580 320306 320881 gene locus_tag LOCUS_06590 320306 320881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06590 321795 321196 gene locus_tag LOCUS_06600 321795 321196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 323122 321845 gene locus_tag LOCUS_06610 323122 321845 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267005.1 protein_id gnl|my_center|LOCUS_06610 323552 323115 gene locus_tag LOCUS_06620 gene rulA 323552 323115 CDS product ultraviolet light resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010209623.1 protein_id gnl|my_center|LOCUS_06620 323652 324338 gene locus_tag LOCUS_06630 323652 324338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267950.1 protein_id gnl|my_center|LOCUS_06630 324382 325716 gene locus_tag LOCUS_06640 324382 325716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence03 1399 185 gene locus_tag LOCUS_06650 1399 185 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_06650 1574 3106 gene locus_tag LOCUS_06660 1574 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102052.1 protein_id gnl|my_center|LOCUS_06660 4080 3172 gene locus_tag LOCUS_06670 4080 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114542.1 protein_id gnl|my_center|LOCUS_06670 5035 4226 gene locus_tag LOCUS_06680 5035 4226 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_06680 6207 5032 gene locus_tag LOCUS_06690 6207 5032 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_06690 6603 6271 gene locus_tag LOCUS_06700 6603 6271 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 protein_id gnl|my_center|LOCUS_06700 6693 7580 gene locus_tag LOCUS_06710 6693 7580 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 protein_id gnl|my_center|LOCUS_06710 7624 8889 gene locus_tag LOCUS_06720 gene waaA 7624 8889 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_06720 10523 9081 gene locus_tag LOCUS_06730 10523 9081 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_06730 10951 12834 gene locus_tag LOCUS_06740 gene thiC 10951 12834 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ08 protein_id gnl|my_center|LOCUS_06740 12933 13532 gene locus_tag LOCUS_06750 gene aspP 12933 13532 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_06750 13529 13975 gene locus_tag LOCUS_06760 13529 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_06760 14175 14990 gene locus_tag LOCUS_06770 gene cpdA 14175 14990 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_06770 15100 15711 gene locus_tag LOCUS_06780 15100 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_06780 15727 17625 gene locus_tag LOCUS_06790 gene parE 15727 17625 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_06790 17625 18608 gene locus_tag LOCUS_06800 17625 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095689.1 protein_id gnl|my_center|LOCUS_06800 18644 19129 gene locus_tag LOCUS_06810 18644 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_06810 19137 21386 gene locus_tag LOCUS_06820 gene parC 19137 21386 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_06820 21563 22282 gene locus_tag LOCUS_06830 21563 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402882.1 protein_id gnl|my_center|LOCUS_06830 22318 23463 gene locus_tag LOCUS_06840 22318 23463 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_06840 24637 23609 gene locus_tag LOCUS_06850 24637 23609 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_06850 24930 24634 gene locus_tag LOCUS_06860 24930 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06860 25382 24927 gene locus_tag LOCUS_06870 25382 24927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06870 25739 25449 gene locus_tag LOCUS_06880 25739 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 26492 25845 gene locus_tag LOCUS_06890 26492 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 27926 26502 gene locus_tag LOCUS_06900 gene hldE 27926 26502 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 protein_id gnl|my_center|LOCUS_06900 29863 28025 gene locus_tag LOCUS_06910 gene msbA 29863 28025 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_06910 29975 31153 gene locus_tag LOCUS_06920 29975 31153 CDS product putative lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG6 protein_id gnl|my_center|LOCUS_06920 31150 31836 gene locus_tag LOCUS_06930 31150 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_06930 31833 32246 gene locus_tag LOCUS_06940 31833 32246 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_06940 32230 32715 gene locus_tag LOCUS_06950 32230 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 32693 33796 gene locus_tag LOCUS_06960 32693 33796 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_06960 33807 34409 gene locus_tag LOCUS_06970 33807 34409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 35297 34413 gene locus_tag LOCUS_06980 gene wapR 35297 34413 CDS product alpha-1,3-rhamnosyltransferase WapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_06980 36432 35290 gene locus_tag LOCUS_06990 36432 35290 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266467.1 protein_id gnl|my_center|LOCUS_06990 37346 36429 gene locus_tag LOCUS_07000 37346 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 39093 37336 gene locus_tag LOCUS_07010 39093 37336 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_07010 40638 39193 gene locus_tag LOCUS_07020 40638 39193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_07020 41384 40635 gene locus_tag LOCUS_07030 41384 40635 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762965.1 protein_id gnl|my_center|LOCUS_07030 42118 41381 gene locus_tag LOCUS_07040 42118 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_07040 42944 42111 gene locus_tag LOCUS_07050 gene rfaP 42944 42111 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 protein_id gnl|my_center|LOCUS_07050 44065 42941 gene locus_tag LOCUS_07060 gene waaG 44065 42941 CDS product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_07060 45079 44075 gene locus_tag LOCUS_07070 45079 44075 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_07070 46079 45081 gene locus_tag LOCUS_07080 gene waaF 46079 45081 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_07080 47108 46185 gene locus_tag LOCUS_07090 gene ilvE 47108 46185 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_07090 50115 47158 gene locus_tag LOCUS_07100 gene glnE 50115 47158 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_07100 50387 53032 gene locus_tag LOCUS_07110 50387 53032 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ34 protein_id gnl|my_center|LOCUS_07110 53044 54690 gene locus_tag LOCUS_07120 gene aceF 53044 54690 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VD3 protein_id gnl|my_center|LOCUS_07120 55214 54780 gene locus_tag LOCUS_07130 55214 54780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 55414 58155 gene locus_tag LOCUS_07140 55414 58155 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114559.1 protein_id gnl|my_center|LOCUS_07140 58206 58859 gene locus_tag LOCUS_07150 gene msrA 58206 58859 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 protein_id gnl|my_center|LOCUS_07150 58876 59073 gene locus_tag LOCUS_07160 58876 59073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 59144 60397 gene locus_tag LOCUS_07170 59144 60397 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 protein_id gnl|my_center|LOCUS_07170 61322 60468 gene locus_tag LOCUS_07180 gene rlmJ 61322 60468 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF0 protein_id gnl|my_center|LOCUS_07180 62236 61367 gene locus_tag LOCUS_07190 62236 61367 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366517.1 protein_id gnl|my_center|LOCUS_07190 62330 63538 gene locus_tag LOCUS_07200 gene yjiJ 62330 63538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141224.1 protein_id gnl|my_center|LOCUS_07200 63510 64559 gene locus_tag LOCUS_07210 63510 64559 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_07210 64798 66603 gene locus_tag LOCUS_07220 64798 66603 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_07220 66765 68510 gene locus_tag LOCUS_07230 gene nhaP2 66765 68510 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE8 protein_id gnl|my_center|LOCUS_07230 68639 71989 gene locus_tag LOCUS_07240 68639 71989 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266444.1 protein_id gnl|my_center|LOCUS_07240 72006 73469 gene locus_tag LOCUS_07250 72006 73469 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE6 protein_id gnl|my_center|LOCUS_07250 73751 75541 gene locus_tag LOCUS_07260 73751 75541 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_07260 75600 76034 gene locus_tag LOCUS_07270 gene trxC 75600 76034 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_07270 76170 76613 gene locus_tag LOCUS_07280 76170 76613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_07280 76736 77533 gene locus_tag LOCUS_07290 76736 77533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_07290 78517 77747 gene locus_tag LOCUS_07300 78517 77747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_07300 79697 78630 gene locus_tag LOCUS_07310 gene hemE 79697 78630 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_07310 80241 79801 gene locus_tag LOCUS_07320 gene cynS 80241 79801 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R365 protein_id gnl|my_center|LOCUS_07320 81142 80234 gene locus_tag LOCUS_07330 gene nrtC 81142 80234 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_07330 81983 81147 gene locus_tag LOCUS_07340 gene nrtB 81983 81147 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 protein_id gnl|my_center|LOCUS_07340 83230 81983 gene locus_tag LOCUS_07350 gene nrtA 83230 81983 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_07350 83180 83497 gene locus_tag LOCUS_07360 83180 83497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 83619 85550 gene locus_tag LOCUS_07370 83619 85550 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088479.1 protein_id gnl|my_center|LOCUS_07370 86953 85535 gene locus_tag LOCUS_07380 gene gltD 86953 85535 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_07380 91436 86988 gene locus_tag LOCUS_07390 gene gltB 91436 86988 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_07390 93212 91677 gene locus_tag LOCUS_07400 93212 91677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148292.1 protein_id gnl|my_center|LOCUS_07400 94326 93223 gene locus_tag LOCUS_07410 gene aroB 94326 93223 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZE3 protein_id gnl|my_center|LOCUS_07410 94839 94378 gene locus_tag LOCUS_07420 gene aroK 94839 94378 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_07420 97022 94902 gene locus_tag LOCUS_07430 gene pilQ 97022 94902 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_07430 97602 97078 gene locus_tag LOCUS_07440 gene pilP 97602 97078 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_07440 98222 97602 gene locus_tag LOCUS_07450 gene pilO 98222 97602 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_07450 98791 98219 gene locus_tag LOCUS_07460 gene pilN 98791 98219 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_07460 99855 98791 gene locus_tag LOCUS_07470 gene pilM 99855 98791 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_07470 100037 102448 gene locus_tag LOCUS_07480 100037 102448 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105330.1 protein_id gnl|my_center|LOCUS_07480 103806 102538 gene locus_tag LOCUS_07490 103806 102538 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_07490 105346 103910 gene locus_tag LOCUS_07500 105346 103910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_07500 106143 105343 gene locus_tag LOCUS_07510 106143 105343 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_07510 106382 106170 gene locus_tag LOCUS_07520 gene rpmE 106382 106170 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_07520 106541 108760 gene locus_tag LOCUS_07530 gene priA 106541 108760 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_07530 109003 110742 gene locus_tag LOCUS_07540 gene argS 109003 110742 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC8 protein_id gnl|my_center|LOCUS_07540 110743 111417 gene locus_tag LOCUS_07550 110743 111417 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_07550 111466 112044 gene locus_tag LOCUS_07560 gene hslV 111466 112044 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF7 protein_id gnl|my_center|LOCUS_07560 112226 113566 gene locus_tag LOCUS_07570 gene hslU 112226 113566 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_07570 113728 114099 gene locus_tag LOCUS_07580 113728 114099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_07580 114396 116075 gene locus_tag LOCUS_07590 gene phaC1 114396 116075 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_07590 116217 117074 gene locus_tag LOCUS_07600 gene phaD 116217 117074 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_07600 117279 118961 gene locus_tag LOCUS_07610 gene phaC2 117279 118961 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115652.1 protein_id gnl|my_center|LOCUS_07610 119151 119765 gene locus_tag LOCUS_07620 119151 119765 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103292.1 protein_id gnl|my_center|LOCUS_07620 120820 119954 gene locus_tag LOCUS_07630 120820 119954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07630 121277 120831 gene locus_tag LOCUS_07640 121277 120831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103463.1 protein_id gnl|my_center|LOCUS_07640 121724 121449 gene locus_tag LOCUS_07650 121724 121449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_07650 121872 122642 gene locus_tag LOCUS_07660 gene ubiE 121872 122642 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UZ2 protein_id gnl|my_center|LOCUS_07660 122642 123259 gene locus_tag LOCUS_07670 122642 123259 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115043.1 protein_id gnl|my_center|LOCUS_07670 123256 124839 gene locus_tag LOCUS_07680 gene ubiB 123256 124839 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_07680 124913 125311 gene locus_tag LOCUS_07690 gene hisI 124913 125311 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_07690 125304 125639 gene locus_tag LOCUS_07700 gene hisE 125304 125639 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_07700 125663 125896 gene locus_tag LOCUS_07710 gene tatA 125663 125896 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB5 protein_id gnl|my_center|LOCUS_07710 125900 126244 gene locus_tag LOCUS_07720 gene tatB 125900 126244 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB4 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07720 126241 127035 gene locus_tag LOCUS_07730 gene tatC 126241 127035 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH0 protein_id gnl|my_center|LOCUS_07730 127032 127742 gene locus_tag LOCUS_07740 127032 127742 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_07740 128359 127805 gene locus_tag LOCUS_07750 128359 127805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 128830 128393 gene locus_tag LOCUS_07760 gene dtd 128830 128393 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_07760 129798 128827 gene locus_tag LOCUS_07770 129798 128827 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_07770 129877 130314 gene locus_tag LOCUS_07780 129877 130314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 131007 130465 gene locus_tag LOCUS_07790 gene blc 131007 130465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114468.1 protein_id gnl|my_center|LOCUS_07790 131271 131020 gene locus_tag LOCUS_07800 131271 131020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095983.1 protein_id gnl|my_center|LOCUS_07800 131940 131341 gene locus_tag LOCUS_07810 131940 131341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_07810 132947 131940 gene locus_tag LOCUS_07820 gene fbp 132947 131940 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU73 protein_id gnl|my_center|LOCUS_07820 134683 132983 gene locus_tag LOCUS_07830 134683 132983 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140374.1 protein_id gnl|my_center|LOCUS_07830 136214 134871 gene locus_tag LOCUS_07840 136214 134871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 protein_id gnl|my_center|LOCUS_07840 139810 136211 gene locus_tag LOCUS_07850 139810 136211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 protein_id gnl|my_center|LOCUS_07850 140177 140467 gene locus_tag LOCUS_07860 140177 140467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 141073 140597 gene locus_tag LOCUS_07870 gene cdhB 141073 140597 CDS product carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_07870 142271 141273 gene locus_tag LOCUS_07880 gene lcdH 142271 141273 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH8 protein_id gnl|my_center|LOCUS_07880 143272 142385 gene locus_tag LOCUS_07890 gene cdhC 143272 142385 CDS product carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096716.1 protein_id gnl|my_center|LOCUS_07890 144303 143371 gene locus_tag LOCUS_07900 144303 143371 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268082.1 protein_id gnl|my_center|LOCUS_07900 144603 145547 gene locus_tag LOCUS_07910 gene cdhR 144603 145547 CDS product HTH-type transcriptional regulator CdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH5 protein_id gnl|my_center|LOCUS_07910 145921 146898 gene locus_tag LOCUS_07920 145921 146898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_07920 147020 147550 gene locus_tag LOCUS_07930 147020 147550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 protein_id gnl|my_center|LOCUS_07930 147656 149716 gene locus_tag LOCUS_07940 gene dgcA 147656 149716 CDS product dimethylglycine catabolism protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_07940 149881 151842 gene locus_tag LOCUS_07950 gene dgcB 149881 151842 CDS product dimethylglycine catabolism protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 protein_id gnl|my_center|LOCUS_07950 151949 153181 gene locus_tag LOCUS_07960 151949 153181 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_254087.2 protein_id gnl|my_center|LOCUS_07960 153277 154050 gene locus_tag LOCUS_07970 153277 154050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 protein_id gnl|my_center|LOCUS_07970 154106 154363 gene locus_tag LOCUS_07980 154106 154363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 155797 154703 gene locus_tag LOCUS_07990 gene gbdR 155797 154703 CDS product protein GbdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_07990 156493 157437 gene locus_tag LOCUS_08000 156493 157437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_08000 158412 159617 gene locus_tag LOCUS_08010 gene proV 158412 159617 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533427.1 protein_id gnl|my_center|LOCUS_08010 159610 160488 gene locus_tag LOCUS_08020 159610 160488 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_08020 160518 161462 gene locus_tag LOCUS_08030 160518 161462 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533171.1 protein_id gnl|my_center|LOCUS_08030 161671 162522 gene locus_tag LOCUS_08040 161671 162522 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114808.1 protein_id gnl|my_center|LOCUS_08040 162737 163327 gene locus_tag LOCUS_08050 gene betI 162737 163327 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ0 protein_id gnl|my_center|LOCUS_08050 163517 164989 gene locus_tag LOCUS_08060 gene betB 163517 164989 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ1 protein_id gnl|my_center|LOCUS_08060 165153 166859 gene locus_tag LOCUS_08070 gene betA 165153 166859 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 protein_id gnl|my_center|LOCUS_08070 167867 166848 gene locus_tag LOCUS_08080 167867 166848 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706195.1 protein_id gnl|my_center|LOCUS_08080 168012 169433 gene locus_tag LOCUS_08090 168012 169433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269218.1 protein_id gnl|my_center|LOCUS_08090 169482 170858 gene locus_tag LOCUS_08100 gene dbpA 169482 170858 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_08100 171053 172288 gene locus_tag LOCUS_08110 171053 172288 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 protein_id gnl|my_center|LOCUS_08110 173020 172289 gene locus_tag LOCUS_08120 173020 172289 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719733.1 protein_id gnl|my_center|LOCUS_08120 173227 174411 gene locus_tag LOCUS_08130 173227 174411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_08130 174522 176333 gene locus_tag LOCUS_08140 174522 176333 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_08140 176977 176342 gene locus_tag LOCUS_08150 gene pcxB 176977 176342 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_08150 178145 177021 gene locus_tag LOCUS_08160 gene ald 178145 177021 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_08160 178921 178238 gene locus_tag LOCUS_08170 178921 178238 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_08170 179619 178918 gene locus_tag LOCUS_08180 gene ligE 179619 178918 CDS product beta-aryl ether-cleaving enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971409.1 protein_id gnl|my_center|LOCUS_08180 180279 179683 gene locus_tag LOCUS_08190 180279 179683 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931155.1 protein_id gnl|my_center|LOCUS_08190 181072 180311 gene locus_tag LOCUS_08200 181072 180311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_08200 182457 181072 gene locus_tag LOCUS_08210 182457 181072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_08210 182718 184889 gene locus_tag LOCUS_08220 182718 184889 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_08220 184947 186752 gene locus_tag LOCUS_08230 184947 186752 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_08230 186952 187434 gene locus_tag LOCUS_08240 186952 187434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_08240 187500 187733 gene locus_tag LOCUS_08250 187500 187733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_08250 188250 187759 gene locus_tag LOCUS_08260 188250 187759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_08260 189399 188299 gene locus_tag LOCUS_08270 189399 188299 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_08270 189889 189413 gene locus_tag LOCUS_08280 189889 189413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 190248 190931 gene locus_tag LOCUS_08290 190248 190931 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378216.1 protein_id gnl|my_center|LOCUS_08290 192058 191018 gene locus_tag LOCUS_08300 gene fba 192058 191018 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_08300 192532 192206 gene locus_tag LOCUS_08310 192532 192206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113229.1 protein_id gnl|my_center|LOCUS_08310 192730 192545 gene locus_tag LOCUS_08320 192730 192545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 193994 192834 gene locus_tag LOCUS_08330 gene pgk 193994 192834 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM05 protein_id gnl|my_center|LOCUS_08330 195068 193998 gene locus_tag LOCUS_08340 gene epd 195068 193998 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_08340 197171 195171 gene locus_tag LOCUS_08350 gene tktA 197171 195171 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_08350 198435 197281 gene locus_tag LOCUS_08360 198435 197281 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038490.1 protein_id gnl|my_center|LOCUS_08360 198546 199427 gene locus_tag LOCUS_08370 198546 199427 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259051.1 protein_id gnl|my_center|LOCUS_08370 199501 200502 gene locus_tag LOCUS_08380 199501 200502 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_08380 200503 201693 gene locus_tag LOCUS_08390 gene metK 200503 201693 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_08390 202071 201760 gene locus_tag LOCUS_08400 202071 201760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 202289 203980 gene locus_tag LOCUS_08410 gene ligB 202289 203980 CDS product DNA ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLZ9 protein_id gnl|my_center|LOCUS_08410 204065 204460 gene locus_tag LOCUS_08420 204065 204460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 204903 204454 gene locus_tag LOCUS_08430 204903 204454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 protein_id gnl|my_center|LOCUS_08430 206604 205015 gene locus_tag LOCUS_08440 206604 205015 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114783.1 protein_id gnl|my_center|LOCUS_08440 207169 206783 gene locus_tag LOCUS_08450 207169 206783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_08450 208550 207267 gene locus_tag LOCUS_08460 208550 207267 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_08460 210114 208627 gene locus_tag LOCUS_08470 210114 208627 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084674.1 protein_id gnl|my_center|LOCUS_08470 210691 212130 gene locus_tag LOCUS_08480 gene dht 210691 212130 CDS product D-hydantoinase/dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I676 protein_id gnl|my_center|LOCUS_08480 212342 213709 gene locus_tag LOCUS_08490 212342 213709 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114904.1 protein_id gnl|my_center|LOCUS_08490 213710 214984 gene locus_tag LOCUS_08500 213710 214984 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895509.1 protein_id gnl|my_center|LOCUS_08500 215778 215158 gene locus_tag LOCUS_08510 215778 215158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084655.1 protein_id gnl|my_center|LOCUS_08510 216025 217413 gene locus_tag LOCUS_08520 gene ahcY 216025 217413 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 protein_id gnl|my_center|LOCUS_08520 217468 218358 gene locus_tag LOCUS_08530 gene metF 217468 218358 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 protein_id gnl|my_center|LOCUS_08530 218445 219818 gene locus_tag LOCUS_08540 218445 219818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_08540 219871 220629 gene locus_tag LOCUS_08550 219871 220629 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 protein_id gnl|my_center|LOCUS_08550 220811 222691 gene locus_tag LOCUS_08560 gene rhlE 220811 222691 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V71 protein_id gnl|my_center|LOCUS_08560 223397 222822 gene locus_tag LOCUS_08570 223397 222822 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_08570 224003 223458 gene locus_tag LOCUS_08580 224003 223458 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105296.1 protein_id gnl|my_center|LOCUS_08580 224261 225664 gene locus_tag LOCUS_08590 gene bioA 224261 225664 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ98 protein_id gnl|my_center|LOCUS_08590 225794 226519 gene locus_tag LOCUS_08600 225794 226519 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_08600 226727 228208 gene locus_tag LOCUS_08610 226727 228208 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 protein_id gnl|my_center|LOCUS_08610 228757 228287 gene locus_tag LOCUS_08620 gene chpC 228757 228287 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_08620 229787 228768 gene locus_tag LOCUS_08630 gene chpB 229787 228768 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_08630 237040 229784 gene locus_tag LOCUS_08640 237040 229784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 237944 237066 gene locus_tag LOCUS_08650 gene pilK 237944 237066 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_08650 240023 237987 gene locus_tag LOCUS_08660 gene pilJ 240023 237987 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_08660 240641 240105 gene locus_tag LOCUS_08670 gene pilI 240641 240105 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_08670 241052 240687 gene locus_tag LOCUS_08680 gene pilH 241052 240687 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_08680 241506 241099 gene locus_tag LOCUS_08690 gene pilG 241506 241099 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_08690 241748 242704 gene locus_tag LOCUS_08700 gene gshB 241748 242704 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_08700 242793 243689 gene locus_tag LOCUS_08710 242793 243689 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_08710 243811 244380 gene locus_tag LOCUS_08720 gene algH 243811 244380 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_08720 244380 244814 gene locus_tag LOCUS_08730 244380 244814 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_08730 244845 245348 gene locus_tag LOCUS_08740 gene pyrR 244845 245348 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_08740 245360 246367 gene locus_tag LOCUS_08750 gene pyrB 245360 246367 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59653 protein_id gnl|my_center|LOCUS_08750 246367 247638 gene locus_tag LOCUS_08760 gene pyrC 246367 247638 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ71 protein_id gnl|my_center|LOCUS_08760 248003 249910 gene locus_tag LOCUS_08770 gene fabY 248003 249910 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_08770 250794 249976 gene locus_tag LOCUS_08780 gene cysQ 250794 249976 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_08780 251357 250791 gene locus_tag LOCUS_08790 251357 250791 CDS product ADP-ribose diphosphatase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_08790 251624 252304 gene locus_tag LOCUS_08800 251624 252304 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_08800 252819 252382 gene locus_tag LOCUS_08810 252819 252382 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_08810 252939 253826 gene locus_tag LOCUS_08820 252939 253826 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100042.1 protein_id gnl|my_center|LOCUS_08820 253924 254739 gene locus_tag LOCUS_08830 gene fdhD 253924 254739 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU09 protein_id gnl|my_center|LOCUS_08830 254736 257075 gene locus_tag LOCUS_08840 254736 257075 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114064.1 protein_id gnl|my_center|LOCUS_08840 257162 257608 gene locus_tag LOCUS_08850 257162 257608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 258369 257602 gene locus_tag LOCUS_08860 258369 257602 CDS product DUF4824 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114161.1 protein_id gnl|my_center|LOCUS_08860 259430 258366 gene locus_tag LOCUS_08870 259430 258366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 protein_id gnl|my_center|LOCUS_08870 259943 259509 gene locus_tag LOCUS_08880 259943 259509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_08880 261192 260029 gene locus_tag LOCUS_08890 261192 260029 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_08890 263139 261349 gene locus_tag LOCUS_08900 263139 261349 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114060.1 protein_id gnl|my_center|LOCUS_08900 264377 263136 gene locus_tag LOCUS_08910 264377 263136 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114059.1 protein_id gnl|my_center|LOCUS_08910 264476 265378 gene locus_tag LOCUS_08920 264476 265378 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_08920 266745 265462 gene locus_tag LOCUS_08930 266745 265462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_08930 267667 266747 gene locus_tag LOCUS_08940 267667 266747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_08940 268071 267904 gene locus_tag LOCUS_08950 268071 267904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 269704 268217 gene locus_tag LOCUS_08960 269704 268217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_08960 269813 270289 gene locus_tag LOCUS_08970 269813 270289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 270336 271475 gene locus_tag LOCUS_08980 270336 271475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 protein_id gnl|my_center|LOCUS_08980 271472 272257 gene locus_tag LOCUS_08990 271472 272257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_08990 272258 273175 gene locus_tag LOCUS_09000 272258 273175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_09000 273172 273771 gene locus_tag LOCUS_09010 273172 273771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_09010 275884 273962 gene locus_tag LOCUS_09020 275884 273962 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269325.1 protein_id gnl|my_center|LOCUS_09020 277762 276221 gene locus_tag LOCUS_09030 gene pckA 277762 276221 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_09030 278807 277920 gene locus_tag LOCUS_09040 gene hslO 278807 277920 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_09040 279025 279819 gene locus_tag LOCUS_09050 279025 279819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114057.1 protein_id gnl|my_center|LOCUS_09050 280343 279915 gene locus_tag LOCUS_09060 280343 279915 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_09060 280457 280927 gene locus_tag LOCUS_09070 280457 280927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401758.1 protein_id gnl|my_center|LOCUS_09070 280924 281829 gene locus_tag LOCUS_09080 gene rimK 280924 281829 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_09080 281826 282722 gene locus_tag LOCUS_09090 281826 282722 CDS product murein tetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ1 protein_id gnl|my_center|LOCUS_09090 283046 282729 gene locus_tag LOCUS_09100 283046 282729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 283575 283309 gene locus_tag LOCUS_09110 283575 283309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 285101 283785 gene locus_tag LOCUS_09120 285101 283785 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266281.1 protein_id gnl|my_center|LOCUS_09120 285915 285178 gene locus_tag LOCUS_09130 gene amgR 285915 285178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 protein_id gnl|my_center|LOCUS_09130 286117 288444 gene locus_tag LOCUS_09140 286117 288444 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_09140 288441 288827 gene locus_tag LOCUS_09150 288441 288827 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 protein_id gnl|my_center|LOCUS_09150 288930 290510 gene locus_tag LOCUS_09160 gene gshA 288930 290510 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_09160 290636 290827 gene locus_tag LOCUS_09170 290636 290827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 292313 291015 gene locus_tag LOCUS_09180 gene argA 292313 291015 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU5 protein_id gnl|my_center|LOCUS_09180 293543 292377 gene locus_tag LOCUS_09190 293543 292377 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_09190 294883 293612 gene locus_tag LOCUS_09200 294883 293612 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_09200 295600 294923 gene locus_tag LOCUS_09210 295600 294923 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_09210 295713 297077 gene locus_tag LOCUS_09220 295713 297077 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103097.1 protein_id gnl|my_center|LOCUS_09220 298084 297197 gene locus_tag LOCUS_09230 gene potI 298084 297197 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767071.1 protein_id gnl|my_center|LOCUS_09230 299075 298167 gene locus_tag LOCUS_09240 gene potH 299075 298167 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707794.1 protein_id gnl|my_center|LOCUS_09240 300226 299072 gene locus_tag LOCUS_09250 300226 299072 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQK8 protein_id gnl|my_center|LOCUS_09250 301371 300280 gene locus_tag LOCUS_09260 301371 300280 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_09260 302533 301439 gene locus_tag LOCUS_09270 gene potF 302533 301439 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHF3 protein_id gnl|my_center|LOCUS_09270 303698 302601 gene locus_tag LOCUS_09280 gene spuD 303698 302601 CDS product putrescine-binding periplasmic protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence04 419 78 gene locus_tag LOCUS_09290 419 78 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G2 protein_id gnl|my_center|LOCUS_09290 926 474 gene locus_tag LOCUS_09300 gene cadR 926 474 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_09300 1093 3225 gene locus_tag LOCUS_09310 1093 3225 CDS product metal-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_09310 3321 3572 gene locus_tag LOCUS_09320 3321 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4428 3757 gene locus_tag LOCUS_09330 gene rpiA 4428 3757 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK7 protein_id gnl|my_center|LOCUS_09330 4588 6102 gene locus_tag LOCUS_09340 gene ilvA1 4588 6102 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_09340 6201 6641 gene locus_tag LOCUS_09350 6201 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7467 6814 gene locus_tag LOCUS_09360 7467 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_09360 7612 8091 gene locus_tag LOCUS_09370 gene rppH 7612 8091 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_09370 8110 10389 gene locus_tag LOCUS_09380 gene ptsP 8110 10389 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_09380 11196 10453 gene locus_tag LOCUS_09390 11196 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_09390 11325 12107 gene locus_tag LOCUS_09400 11325 12107 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_09400 12118 12918 gene locus_tag LOCUS_09410 gene lgt 12118 12918 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL3 protein_id gnl|my_center|LOCUS_09410 12918 13712 gene locus_tag LOCUS_09420 gene thyA 12918 13712 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_09420 13910 14437 gene locus_tag LOCUS_09430 13910 14437 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_09430 15898 14516 gene locus_tag LOCUS_09440 15898 14516 CDS product GTPase SAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103141.1 protein_id gnl|my_center|LOCUS_09440 17428 16037 gene locus_tag LOCUS_09450 17428 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_09450 18631 17489 gene locus_tag LOCUS_09460 gene glpQ 18631 17489 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_09460 18747 19277 gene locus_tag LOCUS_09470 gene folA 18747 19277 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E3 protein_id gnl|my_center|LOCUS_09470 19392 20039 gene locus_tag LOCUS_09480 19392 20039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710111.1 protein_id gnl|my_center|LOCUS_09480 20639 20112 gene locus_tag LOCUS_09490 20639 20112 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS65 protein_id gnl|my_center|LOCUS_09490 21336 20878 gene locus_tag LOCUS_09500 21336 20878 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_09500 23299 21461 gene locus_tag LOCUS_09510 gene ilvD 23299 21461 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 protein_id gnl|my_center|LOCUS_09510 24389 23535 gene locus_tag LOCUS_09520 24389 23535 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_09520 25758 24523 gene locus_tag LOCUS_09530 25758 24523 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 protein_id gnl|my_center|LOCUS_09530 26953 25880 gene locus_tag LOCUS_09540 26953 25880 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 protein_id gnl|my_center|LOCUS_09540 28106 26988 gene locus_tag LOCUS_09550 28106 26988 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 protein_id gnl|my_center|LOCUS_09550 29575 28376 gene locus_tag LOCUS_09560 29575 28376 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_09560 29714 30580 gene locus_tag LOCUS_09570 29714 30580 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_09570 30692 31504 gene locus_tag LOCUS_09580 gene mutM 30692 31504 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_09580 31622 32200 gene locus_tag LOCUS_09590 31622 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_09590 32277 32615 gene locus_tag LOCUS_09600 32277 32615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_09600 32702 34543 gene locus_tag LOCUS_09610 32702 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 36293 34635 gene locus_tag LOCUS_09620 36293 34635 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_09620 36655 36404 gene locus_tag LOCUS_09630 gene fdx1 36655 36404 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_09630 37335 36853 gene locus_tag LOCUS_09640 gene coaD 37335 36853 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_09640 39038 37440 gene locus_tag LOCUS_09650 39038 37440 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_09650 39675 39130 gene locus_tag LOCUS_09660 39675 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_09660 41148 39718 gene locus_tag LOCUS_09670 gene calB 41148 39718 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 protein_id gnl|my_center|LOCUS_09670 41363 42019 gene locus_tag LOCUS_09680 41363 42019 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_09680 42638 42162 gene locus_tag LOCUS_09690 42638 42162 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382984.1 protein_id gnl|my_center|LOCUS_09690 44998 42641 gene locus_tag LOCUS_09700 44998 42641 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267333.1 protein_id gnl|my_center|LOCUS_09700 45657 44995 gene locus_tag LOCUS_09710 45657 44995 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617102.1 protein_id gnl|my_center|LOCUS_09710 46823 45654 gene locus_tag LOCUS_09720 46823 45654 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267335.1 protein_id gnl|my_center|LOCUS_09720 46988 47494 gene locus_tag LOCUS_09730 46988 47494 CDS product cag pathogenicity island protein Cag5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 protein_id gnl|my_center|LOCUS_09730 48479 47496 gene locus_tag LOCUS_09740 48479 47496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_09740 48933 48715 gene locus_tag LOCUS_09750 48933 48715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 49529 48930 gene locus_tag LOCUS_09760 49529 48930 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_09760 50989 49529 gene locus_tag LOCUS_09770 50989 49529 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_09770 52353 50986 gene locus_tag LOCUS_09780 52353 50986 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 protein_id gnl|my_center|LOCUS_09780 52933 52499 gene locus_tag LOCUS_09790 52933 52499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 53272 54588 gene locus_tag LOCUS_09800 53272 54588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 54585 55253 gene locus_tag LOCUS_09810 54585 55253 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 protein_id gnl|my_center|LOCUS_09810 55268 56269 gene locus_tag LOCUS_09820 55268 56269 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_09820 56473 57267 gene locus_tag LOCUS_09830 gene rpoH 56473 57267 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_09830 57330 57941 gene locus_tag LOCUS_09840 57330 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084511.1 protein_id gnl|my_center|LOCUS_09840 58671 57943 gene locus_tag LOCUS_09850 gene mtgA 58671 57943 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF9 protein_id gnl|my_center|LOCUS_09850 58906 59277 gene locus_tag LOCUS_09860 58906 59277 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_09860 59380 59580 gene locus_tag LOCUS_09870 59380 59580 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_09870 59599 60393 gene locus_tag LOCUS_09880 gene thiG 59599 60393 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF6 protein_id gnl|my_center|LOCUS_09880 60482 61198 gene locus_tag LOCUS_09890 gene trmB 60482 61198 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B3 protein_id gnl|my_center|LOCUS_09890 61365 62708 gene locus_tag LOCUS_09900 61365 62708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_09900 63077 62754 gene locus_tag LOCUS_09910 63077 62754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_09910 64325 63165 gene locus_tag LOCUS_09920 64325 63165 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_09920 64918 64322 gene locus_tag LOCUS_09930 64918 64322 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6A8 protein_id gnl|my_center|LOCUS_09930 65475 65059 gene locus_tag LOCUS_09940 65475 65059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100965.1 protein_id gnl|my_center|LOCUS_09940 66110 65490 gene locus_tag LOCUS_09950 66110 65490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_09950 67252 66113 gene locus_tag LOCUS_09960 gene metX 67252 66113 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_09960 67944 67327 gene locus_tag LOCUS_09970 67944 67327 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_09970 68131 67937 gene locus_tag LOCUS_09980 68131 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 70179 68191 gene locus_tag LOCUS_09990 70179 68191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_09990 70651 70361 gene locus_tag LOCUS_10000 70651 70361 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ3 protein_id gnl|my_center|LOCUS_10000 71247 70654 gene locus_tag LOCUS_10010 71247 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_10010 72077 71259 gene locus_tag LOCUS_10020 gene proC 72077 71259 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_10020 72787 72095 gene locus_tag LOCUS_10030 72787 72095 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_10030 72859 73893 gene locus_tag LOCUS_10040 gene pilT 72859 73893 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_10040 74059 75204 gene locus_tag LOCUS_10050 gene pilU 74059 75204 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_10050 76057 75170 gene locus_tag LOCUS_10060 76057 75170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267625.1 protein_id gnl|my_center|LOCUS_10060 77268 76057 gene locus_tag LOCUS_10070 77268 76057 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 protein_id gnl|my_center|LOCUS_10070 77416 77814 gene locus_tag LOCUS_10080 77416 77814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 79360 77927 gene locus_tag LOCUS_10090 gene ntrC 79360 77927 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 protein_id gnl|my_center|LOCUS_10090 80445 79357 gene locus_tag LOCUS_10100 80445 79357 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_10100 81251 80634 gene locus_tag LOCUS_10110 81251 80634 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_10110 81823 81257 gene locus_tag LOCUS_10120 81823 81257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103114.1 protein_id gnl|my_center|LOCUS_10120 83507 82101 gene locus_tag LOCUS_10130 gene glnA 83507 82101 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_10130 83836 85290 gene locus_tag LOCUS_10140 gene thiI 83836 85290 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_10140 85563 87386 gene locus_tag LOCUS_10150 85563 87386 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405222.1 protein_id gnl|my_center|LOCUS_10150 88858 87566 gene locus_tag LOCUS_10160 gene gbcA 88858 87566 CDS product protein GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096766.1 protein_id gnl|my_center|LOCUS_10160 89172 90275 gene locus_tag LOCUS_10170 gene gbcB 89172 90275 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_10170 91425 90385 gene locus_tag LOCUS_10180 gene ltaE 91425 90385 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTF1 protein_id gnl|my_center|LOCUS_10180 91664 91963 gene locus_tag LOCUS_10190 91664 91963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 92604 93998 gene locus_tag LOCUS_10200 gene sdaB 92604 93998 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 protein_id gnl|my_center|LOCUS_10200 94035 95024 gene locus_tag LOCUS_10210 gene gbdR 94035 95024 CDS product protein GbdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_10210 95259 96470 gene locus_tag LOCUS_10220 95259 96470 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_10220 96551 97336 gene locus_tag LOCUS_10230 96551 97336 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_10230 97478 99046 gene locus_tag LOCUS_10240 97478 99046 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_10240 99252 100709 gene locus_tag LOCUS_10250 gene opuE 99252 100709 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181816.1 protein_id gnl|my_center|LOCUS_10250 100816 102699 gene locus_tag LOCUS_10260 100816 102699 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233308.2 protein_id gnl|my_center|LOCUS_10260 103796 102798 gene locus_tag LOCUS_10270 103796 102798 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402189.1 protein_id gnl|my_center|LOCUS_10270 104154 105407 gene locus_tag LOCUS_10280 gene glyA1 104154 105407 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTE9 protein_id gnl|my_center|LOCUS_10280 105530 106780 gene locus_tag LOCUS_10290 gene soxB 105530 106780 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_10290 107097 107423 gene locus_tag LOCUS_10300 gene soxD 107097 107423 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 protein_id gnl|my_center|LOCUS_10300 107420 110443 gene locus_tag LOCUS_10310 107420 110443 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269189.1 protein_id gnl|my_center|LOCUS_10310 110436 111065 gene locus_tag LOCUS_10320 gene soxG 110436 111065 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096784.1 protein_id gnl|my_center|LOCUS_10320 111212 112075 gene locus_tag LOCUS_10330 gene purU2 111212 112075 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTE4 protein_id gnl|my_center|LOCUS_10330 112399 113598 gene locus_tag LOCUS_10340 112399 113598 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316157.1 protein_id gnl|my_center|LOCUS_10340 115172 113850 gene locus_tag LOCUS_10350 115172 113850 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268730.1 protein_id gnl|my_center|LOCUS_10350 117049 115169 gene locus_tag LOCUS_10360 117049 115169 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115580.1 protein_id gnl|my_center|LOCUS_10360 117895 117161 gene locus_tag LOCUS_10370 117895 117161 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_10370 118557 117892 gene locus_tag LOCUS_10380 118557 117892 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_10380 119303 118557 gene locus_tag LOCUS_10390 119303 118557 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_10390 120428 119520 gene locus_tag LOCUS_10400 120428 119520 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_10400 121578 120685 gene locus_tag LOCUS_10410 121578 120685 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 protein_id gnl|my_center|LOCUS_10410 121629 122978 gene locus_tag LOCUS_10420 121629 122978 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_10420 123217 123726 gene locus_tag LOCUS_10430 123217 123726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613972.1 protein_id gnl|my_center|LOCUS_10430 124045 126075 gene locus_tag LOCUS_10440 124045 126075 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266712.1 protein_id gnl|my_center|LOCUS_10440 126134 126574 gene locus_tag LOCUS_10450 126134 126574 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112686.1 protein_id gnl|my_center|LOCUS_10450 126829 127509 gene locus_tag LOCUS_10460 gene creB 126829 127509 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_10460 127513 128934 gene locus_tag LOCUS_10470 gene creC 127513 128934 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_10470 129508 130080 gene locus_tag LOCUS_10480 129508 130080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 130059 131435 gene locus_tag LOCUS_10490 130059 131435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 133854 131554 gene locus_tag LOCUS_10500 133854 131554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_10500 135482 133851 gene locus_tag LOCUS_10510 gene fan1 135482 133851 CDS product Fanconi-associated nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N0 protein_id gnl|my_center|LOCUS_10510 135729 136265 gene locus_tag LOCUS_10520 135729 136265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 136444 137787 gene locus_tag LOCUS_10530 gene creD 136444 137787 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_10530 137978 138280 gene locus_tag LOCUS_10540 137978 138280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084737.1 protein_id gnl|my_center|LOCUS_10540 138425 139213 gene locus_tag LOCUS_10550 138425 139213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 139498 139758 gene locus_tag LOCUS_10560 139498 139758 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_10560 139765 141534 gene locus_tag LOCUS_10570 139765 141534 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_10570 141626 142132 gene locus_tag LOCUS_10580 141626 142132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 142355 143662 gene locus_tag LOCUS_10590 142355 143662 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_10590 144528 143827 gene locus_tag LOCUS_10600 144528 143827 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103148.1 protein_id gnl|my_center|LOCUS_10600 146456 144525 gene locus_tag LOCUS_10610 146456 144525 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_10610 148993 146816 gene locus_tag LOCUS_10620 gene glcB 148993 146816 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_10620 149297 149746 gene locus_tag LOCUS_10630 149297 149746 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_10630 149780 150298 gene locus_tag LOCUS_10640 149780 150298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_10640 151510 150617 gene locus_tag LOCUS_10650 gene rarD-1 151510 150617 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763735.1 protein_id gnl|my_center|LOCUS_10650 152834 151860 gene locus_tag LOCUS_10660 gene srkA 152834 151860 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_10660 153792 153028 gene locus_tag LOCUS_10670 153792 153028 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084796.1 protein_id gnl|my_center|LOCUS_10670 154594 153854 gene locus_tag LOCUS_10680 154594 153854 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_10680 154931 154638 gene locus_tag LOCUS_10690 154931 154638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113255.1 protein_id gnl|my_center|LOCUS_10690 155128 156186 gene locus_tag LOCUS_10700 gene bioB 155128 156186 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 protein_id gnl|my_center|LOCUS_10700 156274 157443 gene locus_tag LOCUS_10710 gene bioF 156274 157443 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_10710 157436 158152 gene locus_tag LOCUS_10720 157436 158152 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402140.1 protein_id gnl|my_center|LOCUS_10720 158145 159005 gene locus_tag LOCUS_10730 gene bioC 158145 159005 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I615 protein_id gnl|my_center|LOCUS_10730 159066 159752 gene locus_tag LOCUS_10740 gene bioD 159066 159752 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_10740 159852 160151 gene locus_tag LOCUS_10750 159852 160151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113246.1 protein_id gnl|my_center|LOCUS_10750 160206 160943 gene locus_tag LOCUS_10760 160206 160943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 161113 162918 gene locus_tag LOCUS_10770 161113 162918 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_10770 163049 164368 gene locus_tag LOCUS_10780 163049 164368 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 protein_id gnl|my_center|LOCUS_10780 164533 166311 gene locus_tag LOCUS_10790 164533 166311 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_10790 167675 166371 gene locus_tag LOCUS_10800 gene oprD 167675 166371 CDS product porin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32722 protein_id gnl|my_center|LOCUS_10800 168534 167944 gene locus_tag LOCUS_10810 168534 167944 CDS product HutD-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527522.1 protein_id gnl|my_center|LOCUS_10810 168755 169966 gene locus_tag LOCUS_10820 gene hutI 168755 169966 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_10820 169956 170891 gene locus_tag LOCUS_10830 gene hutG 169956 170891 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF85 protein_id gnl|my_center|LOCUS_10830 170906 172579 gene locus_tag LOCUS_10840 gene hutU 170906 172579 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU83 protein_id gnl|my_center|LOCUS_10840 172693 174228 gene locus_tag LOCUS_10850 gene hutH 172693 174228 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU85 protein_id gnl|my_center|LOCUS_10850 174361 174540 gene locus_tag LOCUS_10860 174361 174540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 174537 175250 gene locus_tag LOCUS_10870 gene hutC 174537 175250 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263318.1 protein_id gnl|my_center|LOCUS_10870 175994 175335 gene locus_tag LOCUS_10880 175994 175335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 177257 176379 gene locus_tag LOCUS_10890 177257 176379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086717.1 protein_id gnl|my_center|LOCUS_10890 177835 177254 gene locus_tag LOCUS_10900 177835 177254 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 protein_id gnl|my_center|LOCUS_10900 178495 177941 gene locus_tag LOCUS_10910 178495 177941 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_234853.2 protein_id gnl|my_center|LOCUS_10910 179447 178551 gene locus_tag LOCUS_10920 179447 178551 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 protein_id gnl|my_center|LOCUS_10920 179731 180804 gene locus_tag LOCUS_10930 179731 180804 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM6 protein_id gnl|my_center|LOCUS_10930 180862 181827 gene locus_tag LOCUS_10940 gene speB 180862 181827 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_10940 183609 182050 gene locus_tag LOCUS_10950 183609 182050 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_10950 185138 183753 gene locus_tag LOCUS_10960 185138 183753 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_10960 187165 185705 gene locus_tag LOCUS_10970 187165 185705 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529357.1 protein_id gnl|my_center|LOCUS_10970 187514 187975 gene locus_tag LOCUS_10980 187514 187975 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 protein_id gnl|my_center|LOCUS_10980 188782 187982 gene locus_tag LOCUS_10990 gene murI 188782 187982 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_10990 189996 188779 gene locus_tag LOCUS_11000 gene benE 189996 188779 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_11000 190662 190057 gene locus_tag LOCUS_11010 190662 190057 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 protein_id gnl|my_center|LOCUS_11010 190921 191274 gene locus_tag LOCUS_11020 190921 191274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 192058 191279 gene locus_tag LOCUS_11030 192058 191279 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L2D4 protein_id gnl|my_center|LOCUS_11030 192272 192066 gene locus_tag LOCUS_11040 192272 192066 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_11040 192704 192297 gene locus_tag LOCUS_11050 192704 192297 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_11050 193676 192759 gene locus_tag LOCUS_11060 193676 192759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 198069 193768 gene locus_tag LOCUS_11070 198069 193768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 199079 198117 gene locus_tag LOCUS_11080 199079 198117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269373.1 protein_id gnl|my_center|LOCUS_11080 200453 199122 gene locus_tag LOCUS_11090 200453 199122 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_11090 200773 201924 gene locus_tag LOCUS_11100 200773 201924 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391138.1 protein_id gnl|my_center|LOCUS_11100 202312 201944 gene locus_tag LOCUS_11110 202312 201944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092416.1 protein_id gnl|my_center|LOCUS_11110 202512 204143 gene locus_tag LOCUS_11120 202512 204143 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082898.1 protein_id gnl|my_center|LOCUS_11120 204742 204140 gene locus_tag LOCUS_11130 204742 204140 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110901.1 protein_id gnl|my_center|LOCUS_11130 204982 205374 gene locus_tag LOCUS_11140 204982 205374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251963.2 protein_id gnl|my_center|LOCUS_11140 205923 205639 gene locus_tag LOCUS_11150 205923 205639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 208005 206527 gene locus_tag LOCUS_11160 208005 206527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104676.1 protein_id gnl|my_center|LOCUS_11160 208342 208220 gene locus_tag LOCUS_11170 208342 208220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 209151 208381 gene locus_tag LOCUS_11180 209151 208381 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_11180 210315 209311 gene locus_tag LOCUS_11190 210315 209311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_11190 212316 211177 gene locus_tag LOCUS_11200 212316 211177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55519 protein_id gnl|my_center|LOCUS_11200 212762 212313 gene locus_tag LOCUS_11210 212762 212313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 214417 212759 gene locus_tag LOCUS_11220 214417 212759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 215667 214414 gene locus_tag LOCUS_11230 215667 214414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 216519 215749 gene locus_tag LOCUS_11240 216519 215749 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_11240 217469 216783 gene locus_tag LOCUS_11250 217469 216783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 218174 217470 gene locus_tag LOCUS_11260 218174 217470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_11260 218815 218171 gene locus_tag LOCUS_11270 218815 218171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 220178 219057 gene locus_tag LOCUS_11280 220178 219057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_11280 220522 221622 gene locus_tag LOCUS_11290 220522 221622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 221692 221913 gene locus_tag LOCUS_11300 221692 221913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 222081 222005 gene locus_tag LOCUS_t00100 222081 222005 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 225832 222098 gene locus_tag LOCUS_11310 225832 222098 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113216.1 protein_id gnl|my_center|LOCUS_11310 227835 225988 gene locus_tag LOCUS_11320 gene rpoD 227835 225988 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF1 protein_id gnl|my_center|LOCUS_11320 229906 227903 gene locus_tag LOCUS_11330 gene dnaG 229906 227903 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_11330 230266 230051 gene locus_tag LOCUS_11340 gene rpsU 230266 230051 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_11340 230470 231495 gene locus_tag LOCUS_11350 gene tsaD 230470 231495 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_11350 232158 231589 gene locus_tag LOCUS_11360 gene plsY 232158 231589 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V6 protein_id gnl|my_center|LOCUS_11360 232234 232590 gene locus_tag LOCUS_11370 232234 232590 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF6 protein_id gnl|my_center|LOCUS_11370 232581 233114 gene locus_tag LOCUS_11380 gene folK-1 232581 233114 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103182.1 protein_id gnl|my_center|LOCUS_11380 234456 233224 gene locus_tag LOCUS_11390 gene cca 234456 233224 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 protein_id gnl|my_center|LOCUS_11390 236079 234514 gene locus_tag LOCUS_11400 236079 234514 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 protein_id gnl|my_center|LOCUS_11400 237361 236090 gene locus_tag LOCUS_11410 237361 236090 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A51 protein_id gnl|my_center|LOCUS_11410 239514 237592 gene locus_tag LOCUS_11420 239514 237592 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 protein_id gnl|my_center|LOCUS_11420 240127 239798 gene locus_tag LOCUS_11430 gene glpE 240127 239798 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG2 protein_id gnl|my_center|LOCUS_11430 240978 240160 gene locus_tag LOCUS_11440 gene apaH 240978 240160 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_11440 241358 240978 gene locus_tag LOCUS_11450 gene apaG 241358 240978 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_11450 242197 241388 gene locus_tag LOCUS_11460 gene rsmA 242197 241388 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG5 protein_id gnl|my_center|LOCUS_11460 243306 242311 gene locus_tag LOCUS_11470 gene pdxA1 243306 242311 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_11470 244701 243403 gene locus_tag LOCUS_11480 gene surA 244701 243403 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_11480 247459 244676 gene locus_tag LOCUS_11490 gene lptD 247459 244676 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 protein_id gnl|my_center|LOCUS_11490 247584 248609 gene locus_tag LOCUS_11500 247584 248609 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_11500 248606 249277 gene locus_tag LOCUS_11510 248606 249277 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_11510 249278 250039 gene locus_tag LOCUS_11520 249278 250039 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103191.1 protein_id gnl|my_center|LOCUS_11520 251049 250060 gene locus_tag LOCUS_11530 251049 250060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099546.1 protein_id gnl|my_center|LOCUS_11530 251208 253568 gene locus_tag LOCUS_11540 251208 253568 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113207.1 protein_id gnl|my_center|LOCUS_11540 253565 254194 gene locus_tag LOCUS_11550 253565 254194 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_11550 254456 255553 gene locus_tag LOCUS_11560 254456 255553 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T5 protein_id gnl|my_center|LOCUS_11560 255607 256638 gene locus_tag LOCUS_11570 255607 256638 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_11570 256705 257952 gene locus_tag LOCUS_11580 256705 257952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_11580 258157 258984 gene locus_tag LOCUS_11590 258157 258984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_11590 259089 260459 gene locus_tag LOCUS_11600 259089 260459 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_11600 260637 261785 gene locus_tag LOCUS_11610 260637 261785 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_11610 261863 263242 gene locus_tag LOCUS_11620 261863 263242 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_11620 263303 264763 gene locus_tag LOCUS_11630 gene davD 263303 264763 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_11630 264938 265612 gene locus_tag LOCUS_11640 gene rpe 264938 265612 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_11640 265609 266289 gene locus_tag LOCUS_11650 gene gph1 265609 266289 CDS product phosphoglycolate phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S586 protein_id gnl|my_center|LOCUS_11650 266603 268093 gene locus_tag LOCUS_11660 gene trpE 266603 268093 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20580 protein_id gnl|my_center|LOCUS_11660 268107 268703 gene locus_tag LOCUS_11670 gene trpG 268107 268703 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_11670 268700 269746 gene locus_tag LOCUS_11680 gene trpD 268700 269746 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_11680 269743 270582 gene locus_tag LOCUS_11690 gene trpC 269743 270582 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_11690 271276 270632 gene locus_tag LOCUS_11700 gene vfr 271276 270632 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_11700 271511 271933 gene locus_tag LOCUS_11710 271511 271933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_11710 272626 271979 gene locus_tag LOCUS_11720 gene coq7 272626 271979 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_11720 273717 272890 gene locus_tag LOCUS_11730 273717 272890 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_11730 273793 275322 gene locus_tag LOCUS_11740 273793 275322 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_11740 276111 275323 gene locus_tag LOCUS_11750 276111 275323 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_11750 277083 276121 gene locus_tag LOCUS_11760 277083 276121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113171.1 protein_id gnl|my_center|LOCUS_11760 278470 277208 gene locus_tag LOCUS_11770 278470 277208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_11770 279429 278467 gene locus_tag LOCUS_11780 279429 278467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_11780 280057 279629 gene locus_tag LOCUS_11790 280057 279629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_11790 280192 281226 gene locus_tag LOCUS_11800 gene argC 280192 281226 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_11800 281223 281966 gene locus_tag LOCUS_11810 281223 281966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085249.1 protein_id gnl|my_center|LOCUS_11810 281956 282366 gene locus_tag LOCUS_11820 281956 282366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_11820 282439 282789 gene locus_tag LOCUS_11830 gene erpA 282439 282789 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q6 protein_id gnl|my_center|LOCUS_11830 283931 282840 gene locus_tag LOCUS_11840 gene anmK 283931 282840 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z1 protein_id gnl|my_center|LOCUS_11840 285362 283935 gene locus_tag LOCUS_11850 285362 283935 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_11850 285544 286743 gene locus_tag LOCUS_11860 gene tyrS 285544 286743 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM7 protein_id gnl|my_center|LOCUS_11860 >Feature sequence05 324 548 gene locus_tag LOCUS_11870 324 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113662.1 protein_id gnl|my_center|LOCUS_11870 672 1001 gene locus_tag LOCUS_11880 672 1001 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_11880 3323 1185 gene locus_tag LOCUS_11890 gene katE 3323 1185 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W8 protein_id gnl|my_center|LOCUS_11890 3604 4128 gene locus_tag LOCUS_11900 3604 4128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 protein_id gnl|my_center|LOCUS_11900 4659 4177 gene locus_tag LOCUS_11910 4659 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147560.1 protein_id gnl|my_center|LOCUS_11910 4888 6423 gene locus_tag LOCUS_11920 gene glgA 4888 6423 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1V0 protein_id gnl|my_center|LOCUS_11920 6447 8177 gene locus_tag LOCUS_11930 6447 8177 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1V1 protein_id gnl|my_center|LOCUS_11930 8174 10228 gene locus_tag LOCUS_11940 8174 10228 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1V2 protein_id gnl|my_center|LOCUS_11940 10221 12965 gene locus_tag LOCUS_11950 10221 12965 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104397.1 protein_id gnl|my_center|LOCUS_11950 12982 13239 gene locus_tag LOCUS_11960 12982 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 13250 15364 gene locus_tag LOCUS_11970 13250 15364 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1V5 protein_id gnl|my_center|LOCUS_11970 15549 16817 gene locus_tag LOCUS_11980 15549 16817 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088939.1 protein_id gnl|my_center|LOCUS_11980 16834 17622 gene locus_tag LOCUS_11990 16834 17622 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268327.1 protein_id gnl|my_center|LOCUS_11990 17619 18821 gene locus_tag LOCUS_12000 gene clsB 17619 18821 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W0 protein_id gnl|my_center|LOCUS_12000 18818 19792 gene locus_tag LOCUS_12010 18818 19792 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268326.1 protein_id gnl|my_center|LOCUS_12010 19965 20186 gene locus_tag LOCUS_12020 19965 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 22656 20191 gene locus_tag LOCUS_12030 gene glgP 22656 20191 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1X1 protein_id gnl|my_center|LOCUS_12030 22845 23273 gene locus_tag LOCUS_12040 22845 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 23270 23761 gene locus_tag LOCUS_12050 23270 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 23832 24245 gene locus_tag LOCUS_12060 23832 24245 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 protein_id gnl|my_center|LOCUS_12060 26549 24387 gene locus_tag LOCUS_12070 gene glgB 26549 24387 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W2 protein_id gnl|my_center|LOCUS_12070 29860 26546 gene locus_tag LOCUS_12080 29860 26546 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088929.1 protein_id gnl|my_center|LOCUS_12080 31859 29877 gene locus_tag LOCUS_12090 gene glgE 31859 29877 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W4 protein_id gnl|my_center|LOCUS_12090 32537 32013 gene locus_tag LOCUS_12100 32537 32013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100824.1 protein_id gnl|my_center|LOCUS_12100 32684 33064 gene locus_tag LOCUS_12110 32684 33064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 protein_id gnl|my_center|LOCUS_12110 33373 33173 gene locus_tag LOCUS_12120 33373 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 33792 33370 gene locus_tag LOCUS_12130 33792 33370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120217.1 protein_id gnl|my_center|LOCUS_12130 34209 33865 gene locus_tag LOCUS_12140 34209 33865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088973.1 protein_id gnl|my_center|LOCUS_12140 35425 34289 gene locus_tag LOCUS_12150 35425 34289 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_12150 35598 36989 gene locus_tag LOCUS_12160 35598 36989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105565.1 protein_id gnl|my_center|LOCUS_12160 37014 37982 gene locus_tag LOCUS_12170 37014 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113669.1 protein_id gnl|my_center|LOCUS_12170 38729 38259 gene locus_tag LOCUS_12180 38729 38259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_12180 38978 38808 gene locus_tag LOCUS_12190 38978 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807657.1 protein_id gnl|my_center|LOCUS_12190 39925 39071 gene locus_tag LOCUS_12200 39925 39071 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113640.1 protein_id gnl|my_center|LOCUS_12200 40817 39951 gene locus_tag LOCUS_12210 gene galU 40817 39951 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_12210 41367 40987 gene locus_tag LOCUS_12220 41367 40987 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_12220 41993 41370 gene locus_tag LOCUS_12230 41993 41370 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_12230 43359 42001 gene locus_tag LOCUS_12240 gene gor 43359 42001 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_12240 43414 43854 gene locus_tag LOCUS_12250 43414 43854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_12250 44847 44008 gene locus_tag LOCUS_12260 gene galU 44847 44008 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_12260 46251 44890 gene locus_tag LOCUS_12270 gene udg 46251 44890 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86422 protein_id gnl|my_center|LOCUS_12270 46735 46583 gene locus_tag LOCUS_12280 46735 46583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 46874 47110 gene locus_tag LOCUS_12290 46874 47110 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706289.1 protein_id gnl|my_center|LOCUS_12290 47107 47436 gene locus_tag LOCUS_12300 47107 47436 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 protein_id gnl|my_center|LOCUS_12300 47509 48285 gene locus_tag LOCUS_12310 47509 48285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 49955 48306 gene locus_tag LOCUS_12320 49955 48306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 50958 50206 gene locus_tag LOCUS_12330 50958 50206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103043.1 protein_id gnl|my_center|LOCUS_12330 52116 51001 gene locus_tag LOCUS_12340 52116 51001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 52427 52753 gene locus_tag LOCUS_12350 52427 52753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 52746 52988 gene locus_tag LOCUS_12360 52746 52988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 53186 53097 gene locus_tag LOCUS_t00110 53186 53097 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 53560 53279 gene locus_tag LOCUS_12370 53560 53279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 53684 54373 gene locus_tag LOCUS_12380 53684 54373 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_12380 54900 54508 gene locus_tag LOCUS_12390 54900 54508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 55055 55369 gene locus_tag LOCUS_12400 55055 55369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086015.1 protein_id gnl|my_center|LOCUS_12400 55756 57039 gene locus_tag LOCUS_12410 55756 57039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113582.1 protein_id gnl|my_center|LOCUS_12410 57052 57903 gene locus_tag LOCUS_12420 57052 57903 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_12420 58087 58878 gene locus_tag LOCUS_12430 58087 58878 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_12430 58975 59664 gene locus_tag LOCUS_12440 58975 59664 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087865.1 protein_id gnl|my_center|LOCUS_12440 59713 60156 gene locus_tag LOCUS_12450 59713 60156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 60293 60463 gene locus_tag LOCUS_12460 60293 60463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 60857 62068 gene locus_tag LOCUS_12470 gene nasA 60857 62068 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087861.1 protein_id gnl|my_center|LOCUS_12470 62185 63852 gene locus_tag LOCUS_12480 62185 63852 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_12480 64209 66665 gene locus_tag LOCUS_12490 gene nirB 64209 66665 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113579.1 protein_id gnl|my_center|LOCUS_12490 66662 66988 gene locus_tag LOCUS_12500 gene nirD 66662 66988 CDS product assimilatory nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_12500 67099 69816 gene locus_tag LOCUS_12510 67099 69816 CDS product assimilatory nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_12510 69964 70707 gene locus_tag LOCUS_12520 69964 70707 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267433.1 protein_id gnl|my_center|LOCUS_12520 71710 70823 gene locus_tag LOCUS_12530 71710 70823 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406743.1 protein_id gnl|my_center|LOCUS_12530 72484 71912 gene locus_tag LOCUS_12540 72484 71912 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_12540 73409 72585 gene locus_tag LOCUS_12550 gene cmpX 73409 72585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087830.1 protein_id gnl|my_center|LOCUS_12550 73656 73411 gene locus_tag LOCUS_12560 73656 73411 CDS product crfX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406745.1 protein_id gnl|my_center|LOCUS_12560 74698 73712 gene locus_tag LOCUS_12570 gene cmaX 74698 73712 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_12570 75191 74703 gene locus_tag LOCUS_12580 75191 74703 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_12580 75190 75342 gene locus_tag LOCUS_12590 75190 75342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 76395 75406 gene locus_tag LOCUS_12600 76395 75406 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765719.1 protein_id gnl|my_center|LOCUS_12600 78937 76565 gene locus_tag LOCUS_12610 gene ppsA 78937 76565 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_12610 79118 79936 gene locus_tag LOCUS_12620 79118 79936 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_12620 81201 80002 gene locus_tag LOCUS_12630 81201 80002 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_12630 84027 81406 gene locus_tag LOCUS_12640 84027 81406 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_12640 85187 84030 gene locus_tag LOCUS_12650 gene prpC 85187 84030 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_12650 86263 85376 gene locus_tag LOCUS_12660 gene prpB 86263 85376 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT8 protein_id gnl|my_center|LOCUS_12660 86997 86260 gene locus_tag LOCUS_12670 86997 86260 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_12670 87258 87839 gene locus_tag LOCUS_12680 87258 87839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087811.1 protein_id gnl|my_center|LOCUS_12680 87845 89371 gene locus_tag LOCUS_12690 87845 89371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 protein_id gnl|my_center|LOCUS_12690 89376 90362 gene locus_tag LOCUS_12700 89376 90362 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_12700 93167 90444 gene locus_tag LOCUS_12710 93167 90444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113574.1 protein_id gnl|my_center|LOCUS_12710 95878 93164 gene locus_tag LOCUS_12720 95878 93164 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120314.1 protein_id gnl|my_center|LOCUS_12720 96043 97386 gene locus_tag LOCUS_12730 96043 97386 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_12730 98065 97448 gene locus_tag LOCUS_12740 gene thrH 98065 97448 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_12740 98236 98856 gene locus_tag LOCUS_12750 gene cysH 98236 98856 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P607 protein_id gnl|my_center|LOCUS_12750 99895 98921 gene locus_tag LOCUS_12760 gene cysB 99895 98921 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_12760 100501 100001 gene locus_tag LOCUS_12770 100501 100001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_12770 101536 100631 gene locus_tag LOCUS_12780 101536 100631 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_12780 102495 101539 gene locus_tag LOCUS_12790 102495 101539 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y5 protein_id gnl|my_center|LOCUS_12790 102881 102495 gene locus_tag LOCUS_12800 102881 102495 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 protein_id gnl|my_center|LOCUS_12800 102880 103293 gene locus_tag LOCUS_12810 102880 103293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 103499 104575 gene locus_tag LOCUS_12820 103499 104575 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_12820 104944 104672 gene locus_tag LOCUS_12830 104944 104672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 106469 105090 gene locus_tag LOCUS_12840 gene yxjC 106469 105090 CDS product putative transporter YxjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42314 protein_id gnl|my_center|LOCUS_12840 106735 106986 gene locus_tag LOCUS_12850 gene oprI 106735 106986 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11221 protein_id gnl|my_center|LOCUS_12850 108095 107139 gene locus_tag LOCUS_12860 108095 107139 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_12860 108447 108166 gene locus_tag LOCUS_12870 108447 108166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315714.1 protein_id gnl|my_center|LOCUS_12870 109142 108537 gene locus_tag LOCUS_12880 109142 108537 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_12880 109154 109837 gene locus_tag LOCUS_12890 109154 109837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_12890 109837 112341 gene locus_tag LOCUS_12900 109837 112341 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 protein_id gnl|my_center|LOCUS_12900 112396 112893 gene locus_tag LOCUS_12910 gene greB 112396 112893 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_12910 113297 112989 gene locus_tag LOCUS_12920 113297 112989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 113809 114762 gene locus_tag LOCUS_12930 gene lip 113809 114762 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_12930 114890 115921 gene locus_tag LOCUS_12940 gene lifO 114890 115921 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_12940 116944 115925 gene locus_tag LOCUS_12950 116944 115925 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403775.1 protein_id gnl|my_center|LOCUS_12950 118135 117122 gene locus_tag LOCUS_12960 118135 117122 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_12960 119470 118193 gene locus_tag LOCUS_12970 119470 118193 CDS product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706103.1 protein_id gnl|my_center|LOCUS_12970 120641 119520 gene locus_tag LOCUS_12980 120641 119520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 120838 122964 gene locus_tag LOCUS_12990 120838 122964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_12990 123983 123096 gene locus_tag LOCUS_13000 gene sucD 123983 123096 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_13000 125149 123983 gene locus_tag LOCUS_13010 gene sucC 125149 123983 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Z4 protein_id gnl|my_center|LOCUS_13010 126830 125394 gene locus_tag LOCUS_13020 gene lpdG 126830 125394 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_13020 128123 126897 gene locus_tag LOCUS_13030 gene sucB 128123 126897 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_13030 131020 128189 gene locus_tag LOCUS_13040 gene sucA 131020 128189 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_13040 131977 131270 gene locus_tag LOCUS_13050 gene sdhB 131977 131270 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_13050 133761 131989 gene locus_tag LOCUS_13060 gene sdhA 133761 131989 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_13060 134133 133765 gene locus_tag LOCUS_13070 134133 133765 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 protein_id gnl|my_center|LOCUS_13070 134582 134127 gene locus_tag LOCUS_13080 gene sdhC 134582 134127 CDS product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_13080 134865 136148 gene locus_tag LOCUS_13090 134865 136148 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX5 protein_id gnl|my_center|LOCUS_13090 136814 136215 gene locus_tag LOCUS_13100 136814 136215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_13100 137132 136881 gene locus_tag LOCUS_13110 137132 136881 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406159.1 protein_id gnl|my_center|LOCUS_13110 138078 137206 gene locus_tag LOCUS_13120 138078 137206 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_13120 138263 138811 gene locus_tag LOCUS_13130 138263 138811 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_13130 138933 139214 gene locus_tag LOCUS_13140 138933 139214 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_13140 139288 140139 gene locus_tag LOCUS_13150 139288 140139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 protein_id gnl|my_center|LOCUS_13150 141884 140136 gene locus_tag LOCUS_13160 141884 140136 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_13160 142309 141902 gene locus_tag LOCUS_13170 142309 141902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 142736 142302 gene locus_tag LOCUS_13180 142736 142302 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_13180 143323 142733 gene locus_tag LOCUS_13190 143323 142733 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_13190 144448 143333 gene locus_tag LOCUS_13200 144448 143333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895577.1 protein_id gnl|my_center|LOCUS_13200 144753 144926 gene locus_tag LOCUS_13210 144753 144926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 145363 144968 gene locus_tag LOCUS_13220 gene msrB 145363 144968 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_13220 145637 146848 gene locus_tag LOCUS_13230 145637 146848 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_13230 146855 147286 gene locus_tag LOCUS_13240 146855 147286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_13240 147395 148267 gene locus_tag LOCUS_13250 gene htpX 147395 148267 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I013 protein_id gnl|my_center|LOCUS_13250 148982 148326 gene locus_tag LOCUS_13260 gene tpm 148982 148326 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_13260 149117 150268 gene locus_tag LOCUS_13270 149117 150268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 150361 151128 gene locus_tag LOCUS_13280 150361 151128 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268548.1 protein_id gnl|my_center|LOCUS_13280 151709 151125 gene locus_tag LOCUS_13290 151709 151125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_13290 151813 152250 gene locus_tag LOCUS_13300 151813 152250 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 protein_id gnl|my_center|LOCUS_13300 153277 152288 gene locus_tag LOCUS_13310 153277 152288 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_13310 154333 153314 gene locus_tag LOCUS_13320 154333 153314 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_13320 154533 155231 gene locus_tag LOCUS_13330 154533 155231 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_13330 155288 155599 gene locus_tag LOCUS_13340 155288 155599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_13340 155821 156888 gene locus_tag LOCUS_13350 155821 156888 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_13350 156905 157672 gene locus_tag LOCUS_13360 156905 157672 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_13360 158626 157979 gene locus_tag LOCUS_13370 158626 157979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_13370 158728 159507 gene locus_tag LOCUS_13380 158728 159507 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S1 protein_id gnl|my_center|LOCUS_13380 160376 159555 gene locus_tag LOCUS_13390 gene nudC 160376 159555 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882A9 protein_id gnl|my_center|LOCUS_13390 162055 160376 gene locus_tag LOCUS_13400 gene fimL 162055 160376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_13400 162905 162093 gene locus_tag LOCUS_13410 162905 162093 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_13410 165350 163107 gene locus_tag LOCUS_13420 gene ldcA 165350 163107 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_13420 166230 165472 gene locus_tag LOCUS_13430 gene dnaQ 166230 165472 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_13430 166756 166304 gene locus_tag LOCUS_13440 gene rnhA 166756 166304 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S9 protein_id gnl|my_center|LOCUS_13440 167573 166815 gene locus_tag LOCUS_13450 167573 166815 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104690.1 protein_id gnl|my_center|LOCUS_13450 167646 168419 gene locus_tag LOCUS_13460 gene gloB 167646 168419 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_13460 168667 170166 gene locus_tag LOCUS_13470 gene mltD 168667 170166 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_13470 171588 170167 gene locus_tag LOCUS_13480 171588 170167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 171757 173586 gene locus_tag LOCUS_13490 171757 173586 CDS product solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113590.1 protein_id gnl|my_center|LOCUS_13490 173583 175442 gene locus_tag LOCUS_13500 173583 175442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_13500 175444 176529 gene locus_tag LOCUS_13510 175444 176529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_13510 176532 177551 gene locus_tag LOCUS_13520 176532 177551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315267.1 protein_id gnl|my_center|LOCUS_13520 177553 179166 gene locus_tag LOCUS_13530 177553 179166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770761.1 protein_id gnl|my_center|LOCUS_13530 179195 179989 gene locus_tag LOCUS_13540 179195 179989 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_13540 180211 181758 gene locus_tag LOCUS_13550 180211 181758 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 protein_id gnl|my_center|LOCUS_13550 183660 181813 gene locus_tag LOCUS_13560 183660 181813 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_13560 184127 183855 gene locus_tag LOCUS_13570 gene hupB 184127 183855 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_13570 186659 184263 gene locus_tag LOCUS_13580 gene lon 186659 184263 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM5 protein_id gnl|my_center|LOCUS_13580 188089 186809 gene locus_tag LOCUS_13590 gene clpX 188089 186809 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_13590 188838 188197 gene locus_tag LOCUS_13600 gene clpP 188838 188197 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_13600 190201 188933 gene locus_tag LOCUS_13610 gene tig 190201 188933 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 protein_id gnl|my_center|LOCUS_13610 190456 190372 gene locus_tag LOCUS_t00120 190456 190372 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 190588 190513 gene locus_tag LOCUS_t00130 190588 190513 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 190704 190628 gene locus_tag LOCUS_t00140 190704 190628 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 190974 191828 gene locus_tag LOCUS_13620 gene folD1 190974 191828 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN1 protein_id gnl|my_center|LOCUS_13620 193695 191953 gene locus_tag LOCUS_13630 193695 191953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267212.1 protein_id gnl|my_center|LOCUS_13630 194019 193747 gene locus_tag LOCUS_13640 194019 193747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267211.1 protein_id gnl|my_center|LOCUS_13640 194832 194032 gene locus_tag LOCUS_13650 194832 194032 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 protein_id gnl|my_center|LOCUS_13650 195704 194841 gene locus_tag LOCUS_13660 195704 194841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 protein_id gnl|my_center|LOCUS_13660 196798 195701 gene locus_tag LOCUS_13670 196798 195701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_13670 197892 196798 gene locus_tag LOCUS_13680 197892 196798 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409725.1 protein_id gnl|my_center|LOCUS_13680 198152 199981 gene locus_tag LOCUS_13690 198152 199981 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769193.1 protein_id gnl|my_center|LOCUS_13690 200867 199971 gene locus_tag LOCUS_13700 200867 199971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102472.1 protein_id gnl|my_center|LOCUS_13700 201003 201440 gene locus_tag LOCUS_13710 201003 201440 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102469.1 protein_id gnl|my_center|LOCUS_13710 201453 202589 gene locus_tag LOCUS_13720 gene ampC 201453 202589 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24735 protein_id gnl|my_center|LOCUS_13720 203760 202633 gene locus_tag LOCUS_13730 203760 202633 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_13730 205047 203857 gene locus_tag LOCUS_13740 gene phbA-2 205047 203857 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104413.1 protein_id gnl|my_center|LOCUS_13740 205998 205231 gene locus_tag LOCUS_13750 205998 205231 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_13750 206080 206466 gene locus_tag LOCUS_13760 206080 206466 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318521.1 protein_id gnl|my_center|LOCUS_13760 206505 207668 gene locus_tag LOCUS_13770 gene liuA 206505 207668 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_13770 207808 209415 gene locus_tag LOCUS_13780 207808 209415 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762555.1 protein_id gnl|my_center|LOCUS_13780 209502 210296 gene locus_tag LOCUS_13790 209502 210296 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104164.1 protein_id gnl|my_center|LOCUS_13790 210298 212226 gene locus_tag LOCUS_13800 gene liuD 210298 212226 CDS product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 protein_id gnl|my_center|LOCUS_13800 212383 213282 gene locus_tag LOCUS_13810 gene liuE 212383 213282 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_13810 213504 215465 gene locus_tag LOCUS_13820 213504 215465 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_13820 215571 216398 gene locus_tag LOCUS_13830 gene rsbQ 215571 216398 CDS product sigma factor SigB regulation protein RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07015 protein_id gnl|my_center|LOCUS_13830 216385 217338 gene locus_tag LOCUS_13840 216385 217338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 217407 217778 gene locus_tag LOCUS_13850 217407 217778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 219123 217918 gene locus_tag LOCUS_13860 219123 217918 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_13860 219287 219565 gene locus_tag LOCUS_13870 gene ppiC-2 219287 219565 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880W6 protein_id gnl|my_center|LOCUS_13870 220484 219573 gene locus_tag LOCUS_13880 220484 219573 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_13880 221031 220552 gene locus_tag LOCUS_13890 221031 220552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103775.1 protein_id gnl|my_center|LOCUS_13890 221631 221041 gene locus_tag LOCUS_13900 221631 221041 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_13900 222734 221814 gene locus_tag LOCUS_13910 222734 221814 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101343.1 protein_id gnl|my_center|LOCUS_13910 222874 223269 gene locus_tag LOCUS_13920 222874 223269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929801.1 protein_id gnl|my_center|LOCUS_13920 224104 223454 gene locus_tag LOCUS_13930 224104 223454 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_13930 225099 224230 gene locus_tag LOCUS_13940 225099 224230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770888.1 protein_id gnl|my_center|LOCUS_13940 225202 225624 gene locus_tag LOCUS_13950 225202 225624 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_13950 225643 226656 gene locus_tag LOCUS_13960 gene hom 225643 226656 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206676.1 protein_id gnl|my_center|LOCUS_13960 226669 227370 gene locus_tag LOCUS_13970 226669 227370 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_13970 227553 228467 gene locus_tag LOCUS_13980 227553 228467 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_13980 228467 229468 gene locus_tag LOCUS_13990 gene fepD 228467 229468 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974570.1 protein_id gnl|my_center|LOCUS_13990 229470 230534 gene locus_tag LOCUS_14000 229470 230534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027976.1 protein_id gnl|my_center|LOCUS_14000 230531 231358 gene locus_tag LOCUS_14010 230531 231358 CDS product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_14010 232233 231355 gene locus_tag LOCUS_14020 gene pdxY 232233 231355 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYX0 protein_id gnl|my_center|LOCUS_14020 232503 232805 gene locus_tag LOCUS_14030 gene arsR 232503 232805 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_14030 232959 233933 gene locus_tag LOCUS_14040 232959 233933 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974446.1 protein_id gnl|my_center|LOCUS_14040 233978 234316 gene locus_tag LOCUS_14050 233978 234316 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974447.1 protein_id gnl|my_center|LOCUS_14050 234960 236852 gene locus_tag LOCUS_14060 gene suhR 234960 236852 CDS product RpoH suppressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15715 protein_id gnl|my_center|LOCUS_14060 237926 236910 gene locus_tag LOCUS_14070 237926 236910 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 protein_id gnl|my_center|LOCUS_14070 239835 238096 gene locus_tag LOCUS_14080 239835 238096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 240884 239841 gene locus_tag LOCUS_14090 240884 239841 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 protein_id gnl|my_center|LOCUS_14090 241828 240938 gene locus_tag LOCUS_14100 241828 240938 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 protein_id gnl|my_center|LOCUS_14100 242693 242211 gene locus_tag LOCUS_14110 242693 242211 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6I4 protein_id gnl|my_center|LOCUS_14110 243838 242822 gene locus_tag LOCUS_14120 243838 242822 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_14120 245208 243835 gene locus_tag LOCUS_14130 245208 243835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_14130 246716 245526 gene locus_tag LOCUS_14140 246716 245526 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391138.1 protein_id gnl|my_center|LOCUS_14140 247928 247119 gene locus_tag LOCUS_14150 247928 247119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence06 217 648 gene locus_tag LOCUS_14160 217 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 645 851 gene locus_tag LOCUS_14170 gene slyX 645 851 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL9 protein_id gnl|my_center|LOCUS_14170 1517 894 gene locus_tag LOCUS_14180 1517 894 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_249652.2 protein_id gnl|my_center|LOCUS_14180 2757 1690 gene locus_tag LOCUS_14190 gene vdcA 2757 1690 CDS product diguanylate cyclase VdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKZ4 protein_id gnl|my_center|LOCUS_14190 3324 2854 gene locus_tag LOCUS_14200 3324 2854 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_14200 4080 3523 gene locus_tag LOCUS_14210 4080 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4640 4002 gene locus_tag LOCUS_14220 4640 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4839 6614 gene locus_tag LOCUS_14230 gene aspS 4839 6614 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_14230 6718 7467 gene locus_tag LOCUS_14240 gene pmpR 6718 7467 CDS product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 protein_id gnl|my_center|LOCUS_14240 7664 8188 gene locus_tag LOCUS_14250 gene ruvC 7664 8188 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51424 protein_id gnl|my_center|LOCUS_14250 8207 8815 gene locus_tag LOCUS_14260 gene ruvA 8207 8815 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_14260 8829 9881 gene locus_tag LOCUS_14270 gene ruvB 8829 9881 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_14270 9935 10387 gene locus_tag LOCUS_14280 9935 10387 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 protein_id gnl|my_center|LOCUS_14280 10390 11085 gene locus_tag LOCUS_14290 gene tolQ 10390 11085 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_14290 11113 11565 gene locus_tag LOCUS_14300 11113 11565 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 protein_id gnl|my_center|LOCUS_14300 11565 12509 gene locus_tag LOCUS_14310 gene tolA 11565 12509 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50600 protein_id gnl|my_center|LOCUS_14310 12515 13813 gene locus_tag LOCUS_14320 gene tolB 12515 13813 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_14320 13868 14365 gene locus_tag LOCUS_14330 gene pal 13868 14365 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 protein_id gnl|my_center|LOCUS_14330 14462 15184 gene locus_tag LOCUS_14340 14462 15184 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_14340 15366 16046 gene locus_tag LOCUS_14350 gene queE 15366 16046 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_14350 16049 16723 gene locus_tag LOCUS_14360 gene queC 16049 16723 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_14360 16782 16857 gene locus_tag LOCUS_t00150 16782 16857 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16995 18053 gene locus_tag LOCUS_14370 gene nadA 16995 18053 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 protein_id gnl|my_center|LOCUS_14370 19253 18180 gene locus_tag LOCUS_14380 19253 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092255.1 protein_id gnl|my_center|LOCUS_14380 20960 19557 gene locus_tag LOCUS_14390 20960 19557 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_14390 21085 23487 gene locus_tag LOCUS_14400 21085 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_14400 23524 23718 gene locus_tag LOCUS_14410 23524 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 24133 23732 gene locus_tag LOCUS_14420 24133 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406195.1 protein_id gnl|my_center|LOCUS_14420 24424 26121 gene locus_tag LOCUS_14430 24424 26121 CDS product putative outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1M2 protein_id gnl|my_center|LOCUS_14430 26182 26904 gene locus_tag LOCUS_14440 26182 26904 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_14440 27865 26864 gene locus_tag LOCUS_14450 27865 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_14450 27994 28644 gene locus_tag LOCUS_14460 gene erdR 27994 28644 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_14460 28809 29174 gene locus_tag LOCUS_14470 28809 29174 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364775.1 protein_id gnl|my_center|LOCUS_14470 30104 29178 gene locus_tag LOCUS_14480 30104 29178 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_14480 30218 30997 gene locus_tag LOCUS_14490 30218 30997 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_14490 31869 31315 gene locus_tag LOCUS_14500 31869 31315 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT28 protein_id gnl|my_center|LOCUS_14500 32672 31875 gene locus_tag LOCUS_14510 32672 31875 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_14510 33609 32683 gene locus_tag LOCUS_14520 33609 32683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_14520 33687 34001 gene locus_tag LOCUS_14530 33687 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091533.1 protein_id gnl|my_center|LOCUS_14530 34137 34736 gene locus_tag LOCUS_14540 gene azoR3 34137 34736 CDS product FMN-dependent NADH-azoreductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ17 protein_id gnl|my_center|LOCUS_14540 34901 35773 gene locus_tag LOCUS_14550 34901 35773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764980.1 protein_id gnl|my_center|LOCUS_14550 35773 36678 gene locus_tag LOCUS_14560 gene rarD 35773 36678 CDS product chloramphenicol-sensitive protein RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68827 protein_id gnl|my_center|LOCUS_14560 37243 36665 gene locus_tag LOCUS_14570 37243 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103756.1 protein_id gnl|my_center|LOCUS_14570 37684 39009 gene locus_tag LOCUS_14580 37684 39009 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402477.1 protein_id gnl|my_center|LOCUS_14580 40936 39101 gene locus_tag LOCUS_14590 40936 39101 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_14590 42046 40982 gene locus_tag LOCUS_14600 42046 40982 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064041.1 protein_id gnl|my_center|LOCUS_14600 42172 42591 gene locus_tag LOCUS_14610 42172 42591 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_14610 43130 42666 gene locus_tag LOCUS_14620 gene mgsA 43130 42666 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLN2 protein_id gnl|my_center|LOCUS_14620 44145 43144 gene locus_tag LOCUS_14630 gene gap-1 44145 43144 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887K5 protein_id gnl|my_center|LOCUS_14630 44276 46099 gene locus_tag LOCUS_14640 44276 46099 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_14640 46801 46238 gene locus_tag LOCUS_14650 46801 46238 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762680.1 protein_id gnl|my_center|LOCUS_14650 47558 46806 gene locus_tag LOCUS_14660 47558 46806 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405525.1 protein_id gnl|my_center|LOCUS_14660 48022 47639 gene locus_tag LOCUS_14670 gene pcaC 48022 47639 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_14670 49480 48041 gene locus_tag LOCUS_14680 gene gabD 49480 48041 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_14680 50193 49708 gene locus_tag LOCUS_14690 50193 49708 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405523.1 protein_id gnl|my_center|LOCUS_14690 51687 50206 gene locus_tag LOCUS_14700 51687 50206 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_14700 52517 51684 gene locus_tag LOCUS_14710 52517 51684 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_14710 53135 52545 gene locus_tag LOCUS_14720 53135 52545 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762667.1 protein_id gnl|my_center|LOCUS_14720 53501 55081 gene locus_tag LOCUS_14730 53501 55081 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_14730 55819 55523 gene locus_tag LOCUS_14740 55819 55523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 57822 56785 gene locus_tag LOCUS_14750 57822 56785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 58052 57819 gene locus_tag LOCUS_14760 58052 57819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 59253 58087 gene locus_tag LOCUS_14770 59253 58087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 61724 59295 gene locus_tag LOCUS_14780 61724 59295 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_14780 63092 62061 gene locus_tag LOCUS_14790 gene fecR 63092 62061 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038678.1 protein_id gnl|my_center|LOCUS_14790 63634 63125 gene locus_tag LOCUS_14800 gene fecI 63634 63125 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038677.1 protein_id gnl|my_center|LOCUS_14800 64019 64363 gene locus_tag LOCUS_14810 64019 64363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 64816 66750 gene locus_tag LOCUS_14820 64816 66750 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339292.1 protein_id gnl|my_center|LOCUS_14820 67160 68533 gene locus_tag LOCUS_14830 67160 68533 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 protein_id gnl|my_center|LOCUS_14830 68590 69066 gene locus_tag LOCUS_14840 gene tadA 68590 69066 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_14840 69100 69555 gene locus_tag LOCUS_14850 69100 69555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 70960 69560 gene locus_tag LOCUS_14860 gene mltF 70960 69560 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_14860 71194 75090 gene locus_tag LOCUS_14870 gene purL 71194 75090 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_14870 75775 76092 gene locus_tag LOCUS_14880 75775 76092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_14880 76739 76236 gene locus_tag LOCUS_14890 76739 76236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092667.1 protein_id gnl|my_center|LOCUS_14890 77312 76758 gene locus_tag LOCUS_14900 77312 76758 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_14900 77606 78211 gene locus_tag LOCUS_14910 77606 78211 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_14910 78233 78757 gene locus_tag LOCUS_14920 78233 78757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_14920 78750 78950 gene locus_tag LOCUS_14930 78750 78950 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_14930 78972 80153 gene locus_tag LOCUS_14940 gene purT 78972 80153 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_14940 80150 80884 gene locus_tag LOCUS_14950 80150 80884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_14950 82142 80856 gene locus_tag LOCUS_14960 82142 80856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111904.1 protein_id gnl|my_center|LOCUS_14960 82953 82153 gene locus_tag LOCUS_14970 82953 82153 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_14970 83111 84490 gene locus_tag LOCUS_14980 gene ffh 83111 84490 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ0 protein_id gnl|my_center|LOCUS_14980 84632 84883 gene locus_tag LOCUS_14990 gene rpsP 84632 84883 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_14990 84892 85428 gene locus_tag LOCUS_15000 gene rimM 84892 85428 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_15000 85434 86177 gene locus_tag LOCUS_15010 gene trmD 85434 86177 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 protein_id gnl|my_center|LOCUS_15010 86220 86570 gene locus_tag LOCUS_15020 gene rplS 86220 86570 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_15020 86652 87065 gene locus_tag LOCUS_15030 86652 87065 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 protein_id gnl|my_center|LOCUS_15030 87157 88053 gene locus_tag LOCUS_15040 gene xerD 87157 88053 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_15040 88406 88146 gene locus_tag LOCUS_15050 88406 88146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 88891 88466 gene locus_tag LOCUS_15060 88891 88466 CDS product osmotic/stress-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_15060 89206 89934 gene locus_tag LOCUS_15070 gene dsbC 89206 89934 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_15070 90037 91341 gene locus_tag LOCUS_15080 gene hom 90037 91341 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_15080 91400 92809 gene locus_tag LOCUS_15090 gene thrC 91400 92809 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_15090 93118 92867 gene locus_tag LOCUS_15100 93118 92867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 93412 94032 gene locus_tag LOCUS_15110 93412 94032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_252421.2 protein_id gnl|my_center|LOCUS_15110 94047 94742 gene locus_tag LOCUS_15120 94047 94742 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_15120 94937 95578 gene locus_tag LOCUS_15130 94937 95578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_15130 95663 97708 gene locus_tag LOCUS_15140 95663 97708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_15140 97817 98056 gene locus_tag LOCUS_15150 97817 98056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 98238 103475 gene locus_tag LOCUS_15160 98238 103475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_15160 103472 104020 gene locus_tag LOCUS_15170 103472 104020 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245166.1 protein_id gnl|my_center|LOCUS_15170 104033 104722 gene locus_tag LOCUS_15180 104033 104722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_15180 104722 104958 gene locus_tag LOCUS_15190 104722 104958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 105132 105473 gene locus_tag LOCUS_15200 105132 105473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 105555 106994 gene locus_tag LOCUS_15210 gene gtfA 105555 106994 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_15210 107059 107598 gene locus_tag LOCUS_15220 107059 107598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_15220 107777 109486 gene locus_tag LOCUS_15230 gene recJ 107777 109486 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_15230 109653 110378 gene locus_tag LOCUS_15240 109653 110378 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 protein_id gnl|my_center|LOCUS_15240 112165 110393 gene locus_tag LOCUS_15250 112165 110393 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931031.1 protein_id gnl|my_center|LOCUS_15250 112345 114006 gene locus_tag LOCUS_15260 112345 114006 CDS product GMC-type oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113843.1 protein_id gnl|my_center|LOCUS_15260 114087 115022 gene locus_tag LOCUS_15270 114087 115022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 115382 116296 gene locus_tag LOCUS_15280 gene prfB 115382 116296 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E1JGJ8 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15280 116555 118057 gene locus_tag LOCUS_15290 gene lysS 116555 118057 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_15290 118232 118936 gene locus_tag LOCUS_15300 118232 118936 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_15300 118980 119531 gene locus_tag LOCUS_15310 118980 119531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103725.1 protein_id gnl|my_center|LOCUS_15310 119540 120829 gene locus_tag LOCUS_15320 119540 120829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_15320 120909 121655 gene locus_tag LOCUS_15330 120909 121655 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_15330 121645 122538 gene locus_tag LOCUS_15340 121645 122538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103721.1 protein_id gnl|my_center|LOCUS_15340 122535 122858 gene locus_tag LOCUS_15350 122535 122858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_15350 123703 122918 gene locus_tag LOCUS_15360 123703 122918 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 protein_id gnl|my_center|LOCUS_15360 124164 123751 gene locus_tag LOCUS_15370 124164 123751 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765928.1 protein_id gnl|my_center|LOCUS_15370 124929 124585 gene locus_tag LOCUS_15380 124929 124585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_15380 125097 127733 gene locus_tag LOCUS_15390 gene ppc 125097 127733 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWV3 protein_id gnl|my_center|LOCUS_15390 127957 128604 gene locus_tag LOCUS_15400 gene adk 127957 128604 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_15400 128785 129546 gene locus_tag LOCUS_15410 128785 129546 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096568.1 protein_id gnl|my_center|LOCUS_15410 129663 130346 gene locus_tag LOCUS_15420 129663 130346 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_15420 130460 130804 gene locus_tag LOCUS_15430 130460 130804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098661.1 protein_id gnl|my_center|LOCUS_15430 130856 131725 gene locus_tag LOCUS_15440 130856 131725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_15440 131738 132439 gene locus_tag LOCUS_15450 131738 132439 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_15450 133298 132531 gene locus_tag LOCUS_15460 133298 132531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 133405 134196 gene locus_tag LOCUS_15470 gene rsmJ 133405 134196 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_15470 134836 134201 gene locus_tag LOCUS_15480 134836 134201 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_15480 135030 136031 gene locus_tag LOCUS_15490 135030 136031 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_15490 136038 139112 gene locus_tag LOCUS_15500 136038 139112 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_15500 139702 139232 gene locus_tag LOCUS_15510 gene bfrB 139702 139232 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_15510 141501 139972 gene locus_tag LOCUS_15520 gene glpD 141501 139972 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 protein_id gnl|my_center|LOCUS_15520 142447 141689 gene locus_tag LOCUS_15530 gene glpR 142447 141689 CDS product glycerol-3-phosphate regulon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51391 protein_id gnl|my_center|LOCUS_15530 142546 143016 gene locus_tag LOCUS_15540 142546 143016 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCT4 protein_id gnl|my_center|LOCUS_15540 143244 144731 gene locus_tag LOCUS_15550 gene glpK1 143244 144731 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_15550 144861 145667 gene locus_tag LOCUS_15560 144861 145667 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_15560 146774 145668 gene locus_tag LOCUS_15570 146774 145668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_15570 147691 146771 gene locus_tag LOCUS_15580 gene argF 147691 146771 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 protein_id gnl|my_center|LOCUS_15580 148030 148461 gene locus_tag LOCUS_15590 148030 148461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401233.1 protein_id gnl|my_center|LOCUS_15590 148607 150715 gene locus_tag LOCUS_15600 148607 150715 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_15600 150936 151262 gene locus_tag LOCUS_15610 150936 151262 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_15610 151662 151324 gene locus_tag LOCUS_15620 151662 151324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_15620 151885 151694 gene locus_tag LOCUS_15630 151885 151694 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_15630 154445 151890 gene locus_tag LOCUS_15640 154445 151890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895700.1 protein_id gnl|my_center|LOCUS_15640 154578 154949 gene locus_tag LOCUS_15650 154578 154949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 155049 155801 gene locus_tag LOCUS_15660 155049 155801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_15660 156241 156492 gene locus_tag LOCUS_15670 156241 156492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 156558 158033 gene locus_tag LOCUS_15680 156558 158033 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404259.1 protein_id gnl|my_center|LOCUS_15680 158995 158048 gene locus_tag LOCUS_15690 158995 158048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 162934 159446 gene locus_tag LOCUS_15700 162934 159446 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_15700 163151 163720 gene locus_tag LOCUS_15710 163151 163720 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119682.1 protein_id gnl|my_center|LOCUS_15710 163726 164553 gene locus_tag LOCUS_15720 163726 164553 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_15720 165969 164632 gene locus_tag LOCUS_15730 165969 164632 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268822.1 protein_id gnl|my_center|LOCUS_15730 166160 166732 gene locus_tag LOCUS_15740 166160 166732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_15740 166876 167781 gene locus_tag LOCUS_15750 166876 167781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_15750 169818 167845 gene locus_tag LOCUS_15760 gene bifA 169818 167845 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_15760 170203 171498 gene locus_tag LOCUS_15770 gene amt 170203 171498 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_15770 171501 172145 gene locus_tag LOCUS_15780 171501 172145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 172797 172216 gene locus_tag LOCUS_15790 gene sodB 172797 172216 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_15790 174532 173201 gene locus_tag LOCUS_15800 174532 173201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_15800 175563 174529 gene locus_tag LOCUS_15810 175563 174529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_15810 176750 175560 gene locus_tag LOCUS_15820 176750 175560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 protein_id gnl|my_center|LOCUS_15820 178333 176747 gene locus_tag LOCUS_15830 178333 176747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_15830 179300 178320 gene locus_tag LOCUS_15840 179300 178320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_15840 180022 179297 gene locus_tag LOCUS_15850 180022 179297 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_15850 180883 180125 gene locus_tag LOCUS_15860 180883 180125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101171.1 protein_id gnl|my_center|LOCUS_15860 181068 182516 gene locus_tag LOCUS_15870 gene sbcB 181068 182516 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_15870 183090 182716 gene locus_tag LOCUS_15880 183090 182716 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 protein_id gnl|my_center|LOCUS_15880 183388 184239 gene locus_tag LOCUS_15890 gene purU1 183388 184239 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_15890 184285 184710 gene locus_tag LOCUS_15900 184285 184710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 184727 184906 gene locus_tag LOCUS_15910 184727 184906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768677.1 protein_id gnl|my_center|LOCUS_15910 186825 184948 gene locus_tag LOCUS_15920 gene pctA 186825 184948 CDS product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD24 protein_id gnl|my_center|LOCUS_15920 186984 188459 gene locus_tag LOCUS_15930 186984 188459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 protein_id gnl|my_center|LOCUS_15930 188870 188592 gene locus_tag LOCUS_15940 188870 188592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 189933 189058 gene locus_tag LOCUS_15950 189933 189058 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103395.1 protein_id gnl|my_center|LOCUS_15950 190041 190796 gene locus_tag LOCUS_15960 190041 190796 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_15960 191706 190804 gene locus_tag LOCUS_15970 191706 190804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 protein_id gnl|my_center|LOCUS_15970 193093 191813 gene locus_tag LOCUS_15980 193093 191813 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_15980 193621 193094 gene locus_tag LOCUS_15990 193621 193094 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770954.1 protein_id gnl|my_center|LOCUS_15990 194655 193681 gene locus_tag LOCUS_16000 gene dctP 194655 193681 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_16000 195608 194733 gene locus_tag LOCUS_16010 195608 194733 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_16010 196488 195661 gene locus_tag LOCUS_16020 gene udh 196488 195661 CDS product uronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H1 protein_id gnl|my_center|LOCUS_16020 196864 197889 gene locus_tag LOCUS_16030 196864 197889 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_16030 198997 197894 gene locus_tag LOCUS_16040 198997 197894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102648.1 protein_id gnl|my_center|LOCUS_16040 200061 199000 gene locus_tag LOCUS_16050 200061 199000 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268824.1 protein_id gnl|my_center|LOCUS_16050 201484 200072 gene locus_tag LOCUS_16060 201484 200072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_16060 202458 201637 gene locus_tag LOCUS_16070 202458 201637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 202562 203272 gene locus_tag LOCUS_16080 202562 203272 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_16080 203272 203601 gene locus_tag LOCUS_16090 203272 203601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 204237 203650 gene locus_tag LOCUS_16100 204237 203650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 204743 204402 gene locus_tag LOCUS_16110 204743 204402 CDS product type III effector HopJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_234111.2 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16110 205033 204740 gene locus_tag LOCUS_16120 205033 204740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_16120 205449 205099 gene locus_tag LOCUS_16130 gene folX 205449 205099 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_16130 206030 205470 gene locus_tag LOCUS_16140 gene folE1 206030 205470 CDS product GTP cyclohydrolase 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYG8 protein_id gnl|my_center|LOCUS_16140 206763 206053 gene locus_tag LOCUS_16150 gene folM 206763 206053 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_16150 207647 207081 gene locus_tag LOCUS_16160 207647 207081 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 protein_id gnl|my_center|LOCUS_16160 208198 207761 gene locus_tag LOCUS_16170 208198 207761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245059.1 protein_id gnl|my_center|LOCUS_16170 208219 209241 gene locus_tag LOCUS_16180 208219 209241 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_16180 209871 209263 gene locus_tag LOCUS_16190 209871 209263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406840.1 protein_id gnl|my_center|LOCUS_16190 210383 209937 gene locus_tag LOCUS_16200 210383 209937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 210485 210934 gene locus_tag LOCUS_16210 210485 210934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH1 protein_id gnl|my_center|LOCUS_16210 211114 211899 gene locus_tag LOCUS_16220 211114 211899 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_16220 211896 212789 gene locus_tag LOCUS_16230 211896 212789 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_16230 212782 213312 gene locus_tag LOCUS_16240 212782 213312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170923.1 protein_id gnl|my_center|LOCUS_16240 213419 213697 gene locus_tag LOCUS_16250 213419 213697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 213809 214720 gene locus_tag LOCUS_16260 213809 214720 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_16260 214964 215545 gene locus_tag LOCUS_16270 214964 215545 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_16270 215700 216002 gene locus_tag LOCUS_16280 215700 216002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101146.1 protein_id gnl|my_center|LOCUS_16280 217720 216233 gene locus_tag LOCUS_16290 217720 216233 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406386.1 protein_id gnl|my_center|LOCUS_16290 218373 217717 gene locus_tag LOCUS_16300 218373 217717 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_16300 219042 218392 gene locus_tag LOCUS_16310 219042 218392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_16310 219844 219053 gene locus_tag LOCUS_16320 219844 219053 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_16320 220508 219849 gene locus_tag LOCUS_16330 220508 219849 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_16330 221953 220505 gene locus_tag LOCUS_16340 221953 220505 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_16340 222626 221937 gene locus_tag LOCUS_16350 222626 221937 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_16350 222854 223900 gene locus_tag LOCUS_16360 222854 223900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_16360 224365 223967 gene locus_tag LOCUS_16370 224365 223967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_16370 224477 225067 gene locus_tag LOCUS_16380 224477 225067 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_16380 225064 225948 gene locus_tag LOCUS_16390 225064 225948 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970756.1 protein_id gnl|my_center|LOCUS_16390 225945 227081 gene locus_tag LOCUS_16400 225945 227081 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 protein_id gnl|my_center|LOCUS_16400 227752 227078 gene locus_tag LOCUS_16410 227752 227078 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_16410 227893 229257 gene locus_tag LOCUS_16420 gene dsdA 227893 229257 CDS product putative D-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYN9 protein_id gnl|my_center|LOCUS_16420 230941 229418 gene locus_tag LOCUS_16430 230941 229418 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_16430 231424 232542 gene locus_tag LOCUS_16440 231424 232542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_16440 232535 233473 gene locus_tag LOCUS_16450 232535 233473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246206.1 protein_id gnl|my_center|LOCUS_16450 233535 234308 gene locus_tag LOCUS_16460 233535 234308 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_16460 235897 234446 gene locus_tag LOCUS_16470 gene pykA 235897 234446 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 protein_id gnl|my_center|LOCUS_16470 236859 235969 gene locus_tag LOCUS_16480 236859 235969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence07 445 2190 gene locus_tag LOCUS_16490 445 2190 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_16490 2226 4316 gene locus_tag LOCUS_16500 2226 4316 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_16500 4414 5373 gene locus_tag LOCUS_16510 4414 5373 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 protein_id gnl|my_center|LOCUS_16510 6470 5751 gene locus_tag LOCUS_16520 6470 5751 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 protein_id gnl|my_center|LOCUS_16520 6663 7640 gene locus_tag LOCUS_16530 gene csiD 6663 7640 CDS product protein CsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4G0 protein_id gnl|my_center|LOCUS_16530 7725 8954 gene locus_tag LOCUS_16540 gene lhgO 7725 8954 CDS product L-2-hydroxyglutarate oxidase LhgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPE5 protein_id gnl|my_center|LOCUS_16540 9193 10560 gene locus_tag LOCUS_16550 9193 10560 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813182.1 protein_id gnl|my_center|LOCUS_16550 10670 12121 gene locus_tag LOCUS_16560 gene davD 10670 12121 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_16560 13246 14154 gene locus_tag LOCUS_16570 13246 14154 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_16570 14151 14909 gene locus_tag LOCUS_16580 14151 14909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_16580 14927 15625 gene locus_tag LOCUS_16590 14927 15625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_16590 15622 16557 gene locus_tag LOCUS_16600 15622 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 16926 18377 gene locus_tag LOCUS_16610 16926 18377 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189216.1 protein_id gnl|my_center|LOCUS_16610 19676 18600 gene locus_tag LOCUS_16620 19676 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 protein_id gnl|my_center|LOCUS_16620 20727 19666 gene locus_tag LOCUS_16630 20727 19666 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 protein_id gnl|my_center|LOCUS_16630 20875 21810 gene locus_tag LOCUS_16640 20875 21810 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895497.1 protein_id gnl|my_center|LOCUS_16640 21967 22194 gene locus_tag LOCUS_16650 21967 22194 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740605.1 protein_id gnl|my_center|LOCUS_16650 23170 22268 gene locus_tag LOCUS_16660 23170 22268 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931314.1 protein_id gnl|my_center|LOCUS_16660 23298 24587 gene locus_tag LOCUS_16670 gene salR 23298 24587 CDS product salicylate 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207155.1 protein_id gnl|my_center|LOCUS_16670 24661 26007 gene locus_tag LOCUS_16680 gene benK 24661 26007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_16680 28078 26786 gene locus_tag LOCUS_16690 28078 26786 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104235.1 protein_id gnl|my_center|LOCUS_16690 28547 28356 gene locus_tag LOCUS_16700 28547 28356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 31201 29924 gene locus_tag LOCUS_16710 31201 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 31480 31205 gene locus_tag LOCUS_16720 31480 31205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 33011 31488 gene locus_tag LOCUS_16730 33011 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 33277 33149 gene locus_tag LOCUS_16740 33277 33149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 33967 33614 gene locus_tag LOCUS_16750 33967 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 34275 33964 gene locus_tag LOCUS_16760 34275 33964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 35402 34272 gene locus_tag LOCUS_16770 35402 34272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 35526 35705 gene locus_tag LOCUS_16780 35526 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 35705 35905 gene locus_tag LOCUS_16790 35705 35905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 36255 36488 gene locus_tag LOCUS_16800 36255 36488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 36485 36979 gene locus_tag LOCUS_16810 36485 36979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 37937 38359 gene locus_tag LOCUS_16820 37937 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 38316 39776 gene locus_tag LOCUS_16830 38316 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_16830 39773 42847 gene locus_tag LOCUS_16840 gene dnaE2 39773 42847 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_16840 43195 44448 gene locus_tag LOCUS_16850 43195 44448 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099122.1 protein_id gnl|my_center|LOCUS_16850 45981 44482 gene locus_tag LOCUS_16860 45981 44482 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193099.1 protein_id gnl|my_center|LOCUS_16860 46109 47314 gene locus_tag LOCUS_16870 46109 47314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101497.1 protein_id gnl|my_center|LOCUS_16870 48224 47361 gene locus_tag LOCUS_16880 48224 47361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 48919 48431 gene locus_tag LOCUS_16890 48919 48431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 49976 49083 gene locus_tag LOCUS_16900 49976 49083 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408993.1 protein_id gnl|my_center|LOCUS_16900 51057 50035 gene locus_tag LOCUS_16910 51057 50035 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113302.1 protein_id gnl|my_center|LOCUS_16910 51276 52190 gene locus_tag LOCUS_16920 51276 52190 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_16920 52377 53615 gene locus_tag LOCUS_16930 gene mexE 52377 53615 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_16930 53645 56824 gene locus_tag LOCUS_16940 gene mexF 53645 56824 CDS product resistance-nodulation-cell division multidrug efflux transporter MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_16940 56821 58209 gene locus_tag LOCUS_16950 56821 58209 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 protein_id gnl|my_center|LOCUS_16950 60131 58287 gene locus_tag LOCUS_16960 60131 58287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 60360 60713 gene locus_tag LOCUS_16970 60360 60713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 protein_id gnl|my_center|LOCUS_16970 61421 60699 gene locus_tag LOCUS_16980 61421 60699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_16980 62248 61418 gene locus_tag LOCUS_16990 gene uppP 62248 61418 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E5 protein_id gnl|my_center|LOCUS_16990 62500 64134 gene locus_tag LOCUS_17000 62500 64134 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267230.1 protein_id gnl|my_center|LOCUS_17000 64142 64756 gene locus_tag LOCUS_17010 64142 64756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_17010 64807 65376 gene locus_tag LOCUS_17020 64807 65376 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_17020 65373 65924 gene locus_tag LOCUS_17030 65373 65924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113477.1 protein_id gnl|my_center|LOCUS_17030 66392 65892 gene locus_tag LOCUS_17040 66392 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_17040 67640 66429 gene locus_tag LOCUS_17050 67640 66429 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268154.1 protein_id gnl|my_center|LOCUS_17050 67868 69742 gene locus_tag LOCUS_17060 67868 69742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_17060 69779 70972 gene locus_tag LOCUS_17070 69779 70972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_17070 71154 71423 gene locus_tag LOCUS_17080 71154 71423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104403.1 protein_id gnl|my_center|LOCUS_17080 71525 71752 gene locus_tag LOCUS_17090 71525 71752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42878 protein_id gnl|my_center|LOCUS_17090 72388 71804 gene locus_tag LOCUS_17100 gene nfuA 72388 71804 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_17100 74807 72531 gene locus_tag LOCUS_17110 gene cti 74807 72531 CDS product cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_17110 74960 78670 gene locus_tag LOCUS_17120 gene metH 74960 78670 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_17120 78823 79158 gene locus_tag LOCUS_17130 78823 79158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317036.1 protein_id gnl|my_center|LOCUS_17130 79668 79375 gene locus_tag LOCUS_17140 79668 79375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122824.1 protein_id gnl|my_center|LOCUS_17140 79808 80833 gene locus_tag LOCUS_17150 79808 80833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114118.1 protein_id gnl|my_center|LOCUS_17150 80849 81889 gene locus_tag LOCUS_17160 80849 81889 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q6 protein_id gnl|my_center|LOCUS_17160 82037 83920 gene locus_tag LOCUS_17170 82037 83920 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233308.2 protein_id gnl|my_center|LOCUS_17170 85262 84186 gene locus_tag LOCUS_17180 85262 84186 CDS product spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114385.1 protein_id gnl|my_center|LOCUS_17180 85813 85472 gene locus_tag LOCUS_17190 85813 85472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091873.1 protein_id gnl|my_center|LOCUS_17190 87255 85849 gene locus_tag LOCUS_17200 87255 85849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102335.1 protein_id gnl|my_center|LOCUS_17200 88122 87301 gene locus_tag LOCUS_17210 88122 87301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119583.1 protein_id gnl|my_center|LOCUS_17210 88241 88468 gene locus_tag LOCUS_17220 88241 88468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 89455 88469 gene locus_tag LOCUS_17230 89455 88469 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267701.1 protein_id gnl|my_center|LOCUS_17230 89963 91621 gene locus_tag LOCUS_17240 gene cysI 89963 91621 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_17240 91605 92102 gene locus_tag LOCUS_17250 91605 92102 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_17250 92244 92645 gene locus_tag LOCUS_17260 92244 92645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251963.2 protein_id gnl|my_center|LOCUS_17260 94424 92733 gene locus_tag LOCUS_17270 gene deaD 94424 92733 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q6 protein_id gnl|my_center|LOCUS_17270 95493 94714 gene locus_tag LOCUS_17280 95493 94714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404195.1 protein_id gnl|my_center|LOCUS_17280 95630 96958 gene locus_tag LOCUS_17290 95630 96958 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_17290 96961 97893 gene locus_tag LOCUS_17300 96961 97893 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_17300 97893 98675 gene locus_tag LOCUS_17310 97893 98675 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_17310 98675 99415 gene locus_tag LOCUS_17320 98675 99415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 99412 101205 gene locus_tag LOCUS_17330 99412 101205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_17330 101280 102626 gene locus_tag LOCUS_17340 101280 102626 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_17340 102788 103543 gene locus_tag LOCUS_17350 102788 103543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 protein_id gnl|my_center|LOCUS_17350 103565 103984 gene locus_tag LOCUS_17360 103565 103984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 105174 103981 gene locus_tag LOCUS_17370 105174 103981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_17370 105659 105213 gene locus_tag LOCUS_17380 105659 105213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 protein_id gnl|my_center|LOCUS_17380 106621 105677 gene locus_tag LOCUS_17390 106621 105677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_17390 106870 106646 gene locus_tag LOCUS_17400 106870 106646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110987.1 protein_id gnl|my_center|LOCUS_17400 106968 107822 gene locus_tag LOCUS_17410 106968 107822 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_17410 108584 107817 gene locus_tag LOCUS_17420 108584 107817 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQB5 protein_id gnl|my_center|LOCUS_17420 108685 109647 gene locus_tag LOCUS_17430 108685 109647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_17430 110319 109747 gene locus_tag LOCUS_17440 gene efp 110319 109747 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQB2 protein_id gnl|my_center|LOCUS_17440 111496 110354 gene locus_tag LOCUS_17450 111496 110354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_17450 111811 111605 gene locus_tag LOCUS_17460 111811 111605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 113349 112153 gene locus_tag LOCUS_17470 113349 112153 CDS product hipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232961.1 protein_id gnl|my_center|LOCUS_17470 113600 113349 gene locus_tag LOCUS_17480 113600 113349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 115134 114070 gene locus_tag LOCUS_17490 115134 114070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_17490 118955 115131 gene locus_tag LOCUS_17500 118955 115131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 protein_id gnl|my_center|LOCUS_17500 119722 118952 gene locus_tag LOCUS_17510 119722 118952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 protein_id gnl|my_center|LOCUS_17510 121078 119753 gene locus_tag LOCUS_17520 121078 119753 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_17520 121599 121132 gene locus_tag LOCUS_17530 121599 121132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_17530 121809 122402 gene locus_tag LOCUS_17540 121809 122402 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_17540 122432 123910 gene locus_tag LOCUS_17550 122432 123910 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_17550 123993 124496 gene locus_tag LOCUS_17560 123993 124496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_17560 124517 124957 gene locus_tag LOCUS_17570 124517 124957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114519.1 protein_id gnl|my_center|LOCUS_17570 124941 126728 gene locus_tag LOCUS_17580 124941 126728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_17580 126692 127711 gene locus_tag LOCUS_17590 126692 127711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 protein_id gnl|my_center|LOCUS_17590 127711 130260 gene locus_tag LOCUS_17600 127711 130260 CDS product ClpA/B-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114516.1 protein_id gnl|my_center|LOCUS_17600 130296 131396 gene locus_tag LOCUS_17610 130296 131396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 131410 132480 gene locus_tag LOCUS_17620 131410 132480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 132528 134534 gene locus_tag LOCUS_17630 132528 134534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_17630 134542 135084 gene locus_tag LOCUS_17640 134542 135084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114514.1 protein_id gnl|my_center|LOCUS_17640 135480 135085 gene locus_tag LOCUS_17650 135480 135085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_17650 136720 135752 gene locus_tag LOCUS_17660 136720 135752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_17660 138722 136941 gene locus_tag LOCUS_17670 gene kefB 138722 136941 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_17670 139519 139049 gene locus_tag LOCUS_17680 139519 139049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_17680 142641 139798 gene locus_tag LOCUS_17690 142641 139798 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152116.1 protein_id gnl|my_center|LOCUS_17690 144612 144055 gene locus_tag LOCUS_17700 gene tnpR 144612 144055 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552315.1 protein_id gnl|my_center|LOCUS_17700 147698 144795 gene locus_tag LOCUS_17710 147698 144795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 147972 147682 gene locus_tag LOCUS_17720 147972 147682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 148211 147969 gene locus_tag LOCUS_17730 148211 147969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 148477 148208 gene locus_tag LOCUS_17740 148477 148208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 149200 148862 gene locus_tag LOCUS_17750 149200 148862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 149832 149197 gene locus_tag LOCUS_17760 149832 149197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 150161 149829 gene locus_tag LOCUS_17770 150161 149829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 150442 150158 gene locus_tag LOCUS_17780 150442 150158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 151275 150556 gene locus_tag LOCUS_17790 151275 150556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 152926 151604 gene locus_tag LOCUS_17800 gene intB 152926 151604 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 protein_id gnl|my_center|LOCUS_17800 153175 153089 gene locus_tag LOCUS_t00160 153175 153089 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 153370 153297 gene locus_tag LOCUS_t00170 153370 153297 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 153484 153409 gene locus_tag LOCUS_t00180 153484 153409 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 154112 153552 gene locus_tag LOCUS_17810 gene pgsA 154112 153552 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_17810 155969 154146 gene locus_tag LOCUS_17820 gene uvrC 155969 154146 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 protein_id gnl|my_center|LOCUS_17820 156616 155972 gene locus_tag LOCUS_17830 gene gacA 156616 155972 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 protein_id gnl|my_center|LOCUS_17830 156868 156781 gene locus_tag LOCUS_t00190 156868 156781 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 157034 157702 gene locus_tag LOCUS_17840 157034 157702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03268 protein_id gnl|my_center|LOCUS_17840 157770 158216 gene locus_tag LOCUS_17850 gene tusD 157770 158216 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_17850 158217 158576 gene locus_tag LOCUS_17860 gene tusC 158217 158576 CDS product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N2 protein_id gnl|my_center|LOCUS_17860 158576 158875 gene locus_tag LOCUS_17870 158576 158875 CDS product DsrH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104503.1 protein_id gnl|my_center|LOCUS_17870 158872 159207 gene locus_tag LOCUS_17880 158872 159207 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_17880 159204 160199 gene locus_tag LOCUS_17890 159204 160199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_17890 160273 161271 gene locus_tag LOCUS_17900 160273 161271 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_17900 162714 161326 gene locus_tag LOCUS_17910 gene cysG 162714 161326 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_17910 164160 162880 gene locus_tag LOCUS_17920 gene serS 164160 162880 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_17920 164621 164241 gene locus_tag LOCUS_17930 gene crcB 164621 164241 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS8 protein_id gnl|my_center|LOCUS_17930 165943 164618 gene locus_tag LOCUS_17940 165943 164618 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_17940 166573 165947 gene locus_tag LOCUS_17950 gene lolA 166573 165947 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_17950 169095 166699 gene locus_tag LOCUS_17960 gene ftsK 169095 166699 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS5 protein_id gnl|my_center|LOCUS_17960 169298 170248 gene locus_tag LOCUS_17970 gene trxB1 169298 170248 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_17970 170304 170984 gene locus_tag LOCUS_17980 gene aat 170304 170984 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_17980 171039 171746 gene locus_tag LOCUS_17990 gene ate 171039 171746 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_17990 171884 172102 gene locus_tag LOCUS_18000 gene infA 171884 172102 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_18000 174468 172198 gene locus_tag LOCUS_18010 gene clpA 174468 172198 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_18010 174860 174498 gene locus_tag LOCUS_18020 gene clpS 174860 174498 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK6 protein_id gnl|my_center|LOCUS_18020 175092 175361 gene locus_tag LOCUS_18030 gene cspD 175092 175361 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_18030 176693 175437 gene locus_tag LOCUS_18040 gene icd 176693 175437 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_18040 177054 179282 gene locus_tag LOCUS_18050 gene idh 177054 179282 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_18050 179447 179890 gene locus_tag LOCUS_18060 179447 179890 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_18060 180140 181252 gene locus_tag LOCUS_18070 gene mnmA 180140 181252 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR6 protein_id gnl|my_center|LOCUS_18070 181249 181869 gene locus_tag LOCUS_18080 gene hflD 181249 181869 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR5 protein_id gnl|my_center|LOCUS_18080 181872 182735 gene locus_tag LOCUS_18090 181872 182735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_18090 182884 184254 gene locus_tag LOCUS_18100 182884 184254 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_18100 184333 185499 gene locus_tag LOCUS_18110 184333 185499 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246030.1 protein_id gnl|my_center|LOCUS_18110 185492 185917 gene locus_tag LOCUS_18120 185492 185917 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_18120 185926 186567 gene locus_tag LOCUS_18130 185926 186567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113372.1 protein_id gnl|my_center|LOCUS_18130 186564 187373 gene locus_tag LOCUS_18140 186564 187373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_18140 187932 189527 gene locus_tag LOCUS_18150 187932 189527 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_18150 189828 191831 gene locus_tag LOCUS_18160 189828 191831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_18160 191952 192608 gene locus_tag LOCUS_18170 191952 192608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 194051 192654 gene locus_tag LOCUS_18180 194051 192654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009929563.1 protein_id gnl|my_center|LOCUS_18180 194636 195049 gene locus_tag LOCUS_18190 gene nuoA 194636 195049 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ3 protein_id gnl|my_center|LOCUS_18190 195060 195737 gene locus_tag LOCUS_18200 gene nuoB 195060 195737 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ8 protein_id gnl|my_center|LOCUS_18200 195801 197582 gene locus_tag LOCUS_18210 gene nuoC 195801 197582 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J9 protein_id gnl|my_center|LOCUS_18210 197585 198079 gene locus_tag LOCUS_18220 gene nuoE 197585 198079 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J8 protein_id gnl|my_center|LOCUS_18220 198076 199422 gene locus_tag LOCUS_18230 gene nuoF 198076 199422 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J7 protein_id gnl|my_center|LOCUS_18230 199481 202189 gene locus_tag LOCUS_18240 gene nuoG 199481 202189 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J6 protein_id gnl|my_center|LOCUS_18240 202186 203178 gene locus_tag LOCUS_18250 gene nuoH 202186 203178 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ3 protein_id gnl|my_center|LOCUS_18250 203192 203740 gene locus_tag LOCUS_18260 gene nuoI 203192 203740 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ2 protein_id gnl|my_center|LOCUS_18260 203808 204317 gene locus_tag LOCUS_18270 gene nuoJ 203808 204317 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J3 protein_id gnl|my_center|LOCUS_18270 204314 204622 gene locus_tag LOCUS_18280 gene nuoK 204314 204622 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI4 protein_id gnl|my_center|LOCUS_18280 204619 206469 gene locus_tag LOCUS_18290 204619 206469 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405115.1 protein_id gnl|my_center|LOCUS_18290 206485 208014 gene locus_tag LOCUS_18300 gene nuoM 206485 208014 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J0 protein_id gnl|my_center|LOCUS_18300 208034 209518 gene locus_tag LOCUS_18310 gene nuoN 208034 209518 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_18310 210407 209646 gene locus_tag LOCUS_18320 gene tam 210407 209646 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU33 protein_id gnl|my_center|LOCUS_18320 210731 211738 gene locus_tag LOCUS_18330 210731 211738 CDS product c4-dicarboxylate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_18330 213317 211791 gene locus_tag LOCUS_18340 213317 211791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_18340 216418 213314 gene locus_tag LOCUS_18350 216418 213314 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104174.1 protein_id gnl|my_center|LOCUS_18350 219614 216522 gene locus_tag LOCUS_18360 219614 216522 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_18360 220747 219611 gene locus_tag LOCUS_18370 220747 219611 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104173.1 protein_id gnl|my_center|LOCUS_18370 221597 221097 gene locus_tag LOCUS_18380 gene tpx 221597 221097 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 protein_id gnl|my_center|LOCUS_18380 225456 221773 gene locus_tag LOCUS_18390 225456 221773 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104171.1 protein_id gnl|my_center|LOCUS_18390 227180 225453 gene locus_tag LOCUS_18400 227180 225453 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 protein_id gnl|my_center|LOCUS_18400 228037 227393 gene locus_tag LOCUS_18410 228037 227393 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003139068.1 protein_id gnl|my_center|LOCUS_18410 228309 229121 gene locus_tag LOCUS_18420 gene xthA 228309 229121 CDS product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_18420 229223 230608 gene locus_tag LOCUS_18430 229223 230608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_18430 230771 231763 gene locus_tag LOCUS_18440 230771 231763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_18440 233086 231857 gene locus_tag LOCUS_18450 233086 231857 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_18450 233237 234172 gene locus_tag LOCUS_18460 233237 234172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence08 1503 640 gene locus_tag LOCUS_18470 gene atpG 1503 640 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_18470 3096 1552 gene locus_tag LOCUS_18480 gene atpA 3096 1552 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_18480 3648 3112 gene locus_tag LOCUS_18490 gene atpH 3648 3112 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 protein_id gnl|my_center|LOCUS_18490 4131 3661 gene locus_tag LOCUS_18500 gene atpF 4131 3661 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_18500 4460 4221 gene locus_tag LOCUS_18510 gene atpE 4460 4221 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_18510 5384 4533 gene locus_tag LOCUS_18520 gene atpB 5384 4533 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_18520 5733 5401 gene locus_tag LOCUS_18530 gene atpI 5733 5401 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT13 protein_id gnl|my_center|LOCUS_18530 6802 5933 gene locus_tag LOCUS_18540 gene spoOJ 6802 5933 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_18540 7602 6814 gene locus_tag LOCUS_18550 gene soj 7602 6814 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_18550 8258 7614 gene locus_tag LOCUS_18560 gene rsmG 8258 7614 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_18560 10150 8258 gene locus_tag LOCUS_18570 gene mnmG 10150 8258 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_18570 11357 10659 gene locus_tag LOCUS_18580 11357 10659 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18580 14476 11357 gene locus_tag LOCUS_18590 gene hsdR-1 14476 11357 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_18590 15536 14481 gene locus_tag LOCUS_18600 15536 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_18600 16765 15590 gene locus_tag LOCUS_18610 16765 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 17172 16756 gene locus_tag LOCUS_18620 17172 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 19514 17169 gene locus_tag LOCUS_18630 gene hsdM-1 19514 17169 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_18630 20928 19561 gene locus_tag LOCUS_18640 gene mnmE 20928 19561 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS2 protein_id gnl|my_center|LOCUS_18640 22851 21106 gene locus_tag LOCUS_18650 gene yidC 22851 21106 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_18650 23496 23092 gene locus_tag LOCUS_18660 gene rnpA 23496 23092 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_18660 23644 23510 gene locus_tag LOCUS_18670 gene rpmH 23644 23510 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TR8 protein_id gnl|my_center|LOCUS_18670 24165 25655 gene locus_tag LOCUS_18680 gene dnaA 24165 25655 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U7 protein_id gnl|my_center|LOCUS_18680 25694 26797 gene locus_tag LOCUS_18690 gene dnaN 25694 26797 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_18690 26797 27900 gene locus_tag LOCUS_18700 gene recF 26797 27900 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK1 protein_id gnl|my_center|LOCUS_18700 27905 30325 gene locus_tag LOCUS_18710 gene gyrB 27905 30325 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_18710 30567 31976 gene locus_tag LOCUS_18720 30567 31976 CDS product type I restriction-modification protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102933.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18720 32168 33289 gene locus_tag LOCUS_18730 32168 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 33390 33884 gene locus_tag LOCUS_18740 33390 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102948.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18740 34161 34400 gene locus_tag LOCUS_18750 34161 34400 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551444.1 protein_id gnl|my_center|LOCUS_18750 34390 34677 gene locus_tag LOCUS_18760 34390 34677 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105461.1 protein_id gnl|my_center|LOCUS_18760 34726 37113 gene locus_tag LOCUS_18770 34726 37113 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_18770 38020 37757 gene locus_tag LOCUS_18780 38020 37757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 38329 38054 gene locus_tag LOCUS_18790 38329 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 39330 38398 gene locus_tag LOCUS_18800 gene cdsA-2 39330 38398 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 protein_id gnl|my_center|LOCUS_18800 39952 39332 gene locus_tag LOCUS_18810 39952 39332 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113327.1 protein_id gnl|my_center|LOCUS_18810 40396 39962 gene locus_tag LOCUS_18820 40396 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113328.1 protein_id gnl|my_center|LOCUS_18820 41723 40386 gene locus_tag LOCUS_18830 41723 40386 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_18830 43477 41723 gene locus_tag LOCUS_18840 43477 41723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_18840 44109 43504 gene locus_tag LOCUS_18850 44109 43504 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_18850 45147 44380 gene locus_tag LOCUS_18860 gene lptA 45147 44380 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_18860 45691 45161 gene locus_tag LOCUS_18870 gene gmhB 45691 45161 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_18870 47826 45772 gene locus_tag LOCUS_18880 gene glyS 47826 45772 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T7 protein_id gnl|my_center|LOCUS_18880 48815 47823 gene locus_tag LOCUS_18890 gene glyQ 48815 47823 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_18890 48987 49541 gene locus_tag LOCUS_18900 gene tag 48987 49541 CDS product DNA-3-methyladenine glycosidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097280.1 protein_id gnl|my_center|LOCUS_18900 49538 50146 gene locus_tag LOCUS_18910 49538 50146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038740.1 protein_id gnl|my_center|LOCUS_18910 50371 51258 gene locus_tag LOCUS_18920 50371 51258 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_18920 51386 51652 gene locus_tag LOCUS_18930 51386 51652 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_18930 51851 54409 gene locus_tag LOCUS_18940 51851 54409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112595.1 protein_id gnl|my_center|LOCUS_18940 54492 55664 gene locus_tag LOCUS_18950 54492 55664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112596.1 protein_id gnl|my_center|LOCUS_18950 56615 55836 gene locus_tag LOCUS_18960 56615 55836 CDS product putative amino-acid ABC transporter ATP-binding protein y4tH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55662 protein_id gnl|my_center|LOCUS_18960 57319 56657 gene locus_tag LOCUS_18970 57319 56657 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812579.1 protein_id gnl|my_center|LOCUS_18970 57975 57316 gene locus_tag LOCUS_18980 57975 57316 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 protein_id gnl|my_center|LOCUS_18980 58918 58040 gene locus_tag LOCUS_18990 58918 58040 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039638.1 protein_id gnl|my_center|LOCUS_18990 59132 60529 gene locus_tag LOCUS_19000 59132 60529 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974134.1 protein_id gnl|my_center|LOCUS_19000 60818 61789 gene locus_tag LOCUS_19010 60818 61789 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530331.1 protein_id gnl|my_center|LOCUS_19010 61799 62776 gene locus_tag LOCUS_19020 gene ocd1 61799 62776 CDS product ornithine cyclodeaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58338 protein_id gnl|my_center|LOCUS_19020 62836 64026 gene locus_tag LOCUS_19030 62836 64026 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_19030 64335 65336 gene locus_tag LOCUS_19040 64335 65336 CDS product N-alpha-acetyl diaminobutyric acid deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888381.1 protein_id gnl|my_center|LOCUS_19040 65462 65938 gene locus_tag LOCUS_19050 65462 65938 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 protein_id gnl|my_center|LOCUS_19050 66155 66472 gene locus_tag LOCUS_19060 66155 66472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 66484 66975 gene locus_tag LOCUS_19070 66484 66975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 67113 67781 gene locus_tag LOCUS_19080 67113 67781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097286.1 protein_id gnl|my_center|LOCUS_19080 68014 69480 gene locus_tag LOCUS_19090 68014 69480 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888393.1 protein_id gnl|my_center|LOCUS_19090 69645 71033 gene locus_tag LOCUS_19100 69645 71033 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 protein_id gnl|my_center|LOCUS_19100 71536 71210 gene locus_tag LOCUS_19110 71536 71210 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 protein_id gnl|my_center|LOCUS_19110 72996 71623 gene locus_tag LOCUS_19120 gene trkA 72996 71623 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_19120 74465 73158 gene locus_tag LOCUS_19130 gene rsmB 74465 73158 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B41 protein_id gnl|my_center|LOCUS_19130 75406 74462 gene locus_tag LOCUS_19140 gene fmt 75406 74462 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 protein_id gnl|my_center|LOCUS_19140 75966 75460 gene locus_tag LOCUS_19150 gene def 75966 75460 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_19150 76120 77157 gene locus_tag LOCUS_19160 76120 77157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_19160 77239 78354 gene locus_tag LOCUS_19170 77239 78354 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103023.1 protein_id gnl|my_center|LOCUS_19170 78431 78988 gene locus_tag LOCUS_19180 gene tsaC 78431 78988 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_19180 80030 79053 gene locus_tag LOCUS_19190 gene qor 80030 79053 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43903 protein_id gnl|my_center|LOCUS_19190 80133 81095 gene locus_tag LOCUS_19200 gene hemF 80133 81095 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_19200 81254 82075 gene locus_tag LOCUS_19210 gene aroE 81254 82075 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B50 protein_id gnl|my_center|LOCUS_19210 83834 82263 gene locus_tag LOCUS_19220 83834 82263 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266137.1 protein_id gnl|my_center|LOCUS_19220 84813 83893 gene locus_tag LOCUS_19230 84813 83893 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103015.1 protein_id gnl|my_center|LOCUS_19230 86529 85021 gene locus_tag LOCUS_19240 gene betC 86529 85021 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_19240 86643 87563 gene locus_tag LOCUS_19250 86643 87563 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 protein_id gnl|my_center|LOCUS_19250 87676 88578 gene locus_tag LOCUS_19260 gene pbpG 87676 88578 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 protein_id gnl|my_center|LOCUS_19260 89739 88846 gene locus_tag LOCUS_19270 gene crgA 89739 88846 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174098.1 protein_id gnl|my_center|LOCUS_19270 89947 90750 gene locus_tag LOCUS_19280 gene dkgB 89947 90750 CDS product 2,5-diketo-D-gluconate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815699.1 protein_id gnl|my_center|LOCUS_19280 91555 90812 gene locus_tag LOCUS_19290 91555 90812 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185690.1 protein_id gnl|my_center|LOCUS_19290 91752 93188 gene locus_tag LOCUS_19300 91752 93188 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268386.1 protein_id gnl|my_center|LOCUS_19300 94072 93263 gene locus_tag LOCUS_19310 gene trpA 94072 93263 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_19310 95283 94069 gene locus_tag LOCUS_19320 gene trpB 95283 94069 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07345 protein_id gnl|my_center|LOCUS_19320 95415 96302 gene locus_tag LOCUS_19330 95415 96302 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266143.1 protein_id gnl|my_center|LOCUS_19330 96368 96583 gene locus_tag LOCUS_19340 96368 96583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_19340 97529 96552 gene locus_tag LOCUS_19350 gene galE 97529 96552 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_19350 97827 98402 gene locus_tag LOCUS_19360 97827 98402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 99653 98424 gene locus_tag LOCUS_19370 99653 98424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_19370 100247 99786 gene locus_tag LOCUS_19380 100247 99786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT89 protein_id gnl|my_center|LOCUS_19380 100422 100258 gene locus_tag LOCUS_19390 100422 100258 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT88 protein_id gnl|my_center|LOCUS_19390 100687 100442 gene locus_tag LOCUS_19400 100687 100442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 101014 101418 gene locus_tag LOCUS_19410 101014 101418 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_19410 102594 101494 gene locus_tag LOCUS_19420 102594 101494 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_19420 102839 103384 gene locus_tag LOCUS_19430 102839 103384 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_19430 103377 104753 gene locus_tag LOCUS_19440 103377 104753 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_19440 104853 105755 gene locus_tag LOCUS_19450 104853 105755 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_19450 106190 107752 gene locus_tag LOCUS_19460 106190 107752 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097814.1 protein_id gnl|my_center|LOCUS_19460 107808 108314 gene locus_tag LOCUS_19470 107808 108314 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 protein_id gnl|my_center|LOCUS_19470 108340 109818 gene locus_tag LOCUS_19480 108340 109818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087596.1 protein_id gnl|my_center|LOCUS_19480 109825 110250 gene locus_tag LOCUS_19490 109825 110250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105491.1 protein_id gnl|my_center|LOCUS_19490 110240 110572 gene locus_tag LOCUS_19500 110240 110572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 110454 111683 gene locus_tag LOCUS_19510 110454 111683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 111676 112062 gene locus_tag LOCUS_19520 111676 112062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 112093 113883 gene locus_tag LOCUS_19530 112093 113883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120358.1 protein_id gnl|my_center|LOCUS_19530 113847 114854 gene locus_tag LOCUS_19540 113847 114854 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 protein_id gnl|my_center|LOCUS_19540 114866 117466 gene locus_tag LOCUS_19550 114866 117466 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105486.1 protein_id gnl|my_center|LOCUS_19550 117477 119006 gene locus_tag LOCUS_19560 117477 119006 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105485.1 protein_id gnl|my_center|LOCUS_19560 119018 119407 gene locus_tag LOCUS_19570 119018 119407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 119445 119579 gene locus_tag LOCUS_19580 119445 119579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 119600 120796 gene locus_tag LOCUS_19590 119600 120796 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105483.1 protein_id gnl|my_center|LOCUS_19590 120802 121284 gene locus_tag LOCUS_19600 120802 121284 CDS product type VI secretion system-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105482.1 protein_id gnl|my_center|LOCUS_19600 121281 122612 gene locus_tag LOCUS_19610 121281 122612 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105481.1 protein_id gnl|my_center|LOCUS_19610 122615 123496 gene locus_tag LOCUS_19620 122615 123496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105480.1 protein_id gnl|my_center|LOCUS_19620 123493 127032 gene locus_tag LOCUS_19630 123493 127032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114614.1 protein_id gnl|my_center|LOCUS_19630 127032 127760 gene locus_tag LOCUS_19640 127032 127760 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105478.1 protein_id gnl|my_center|LOCUS_19640 127757 128728 gene locus_tag LOCUS_19650 127757 128728 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105477.1 protein_id gnl|my_center|LOCUS_19650 128767 130899 gene locus_tag LOCUS_19660 128767 130899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147940.1 protein_id gnl|my_center|LOCUS_19660 130916 131734 gene locus_tag LOCUS_19670 130916 131734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114071.1 protein_id gnl|my_center|LOCUS_19670 131803 132246 gene locus_tag LOCUS_19680 131803 132246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19680 132345 132791 gene locus_tag LOCUS_19690 132345 132791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107600.1 protein_id gnl|my_center|LOCUS_19690 132776 135382 gene locus_tag LOCUS_19700 132776 135382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895654.1 protein_id gnl|my_center|LOCUS_19700 135895 135428 gene locus_tag LOCUS_19710 135895 135428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266632.1 protein_id gnl|my_center|LOCUS_19710 136450 135914 gene locus_tag LOCUS_19720 136450 135914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_19720 136760 136515 gene locus_tag LOCUS_19730 136760 136515 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378385.1 protein_id gnl|my_center|LOCUS_19730 137258 136827 gene locus_tag LOCUS_19740 137258 136827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 137284 137571 gene locus_tag LOCUS_19750 137284 137571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 138738 137653 gene locus_tag LOCUS_19760 gene purK 138738 137653 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72158 protein_id gnl|my_center|LOCUS_19760 139366 138875 gene locus_tag LOCUS_19770 gene purE 139366 138875 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72157 protein_id gnl|my_center|LOCUS_19770 139643 140665 gene locus_tag LOCUS_19780 gene adhA 139643 140665 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_19780 140679 140888 gene locus_tag LOCUS_19790 140679 140888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 140891 141274 gene locus_tag LOCUS_19800 140891 141274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 141356 142348 gene locus_tag LOCUS_19810 141356 142348 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_19810 144579 142543 gene locus_tag LOCUS_19820 144579 142543 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 protein_id gnl|my_center|LOCUS_19820 145166 144576 gene locus_tag LOCUS_19830 145166 144576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767853.1 protein_id gnl|my_center|LOCUS_19830 146436 145159 gene locus_tag LOCUS_19840 146436 145159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268479.1 protein_id gnl|my_center|LOCUS_19840 146761 146447 gene locus_tag LOCUS_19850 146761 146447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 147071 148099 gene locus_tag LOCUS_19860 gene aphA 147071 148099 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_19860 148149 149243 gene locus_tag LOCUS_19870 148149 149243 CDS product spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082943.1 protein_id gnl|my_center|LOCUS_19870 150346 149441 gene locus_tag LOCUS_19880 150346 149441 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 protein_id gnl|my_center|LOCUS_19880 150681 152105 gene locus_tag LOCUS_19890 gene aspA 150681 152105 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTD7 protein_id gnl|my_center|LOCUS_19890 153875 152409 gene locus_tag LOCUS_19900 153875 152409 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114099.1 protein_id gnl|my_center|LOCUS_19900 153973 154605 gene locus_tag LOCUS_19910 153973 154605 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_19910 154625 155065 gene locus_tag LOCUS_19920 154625 155065 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_19920 155065 155736 gene locus_tag LOCUS_19930 155065 155736 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_19930 156559 155741 gene locus_tag LOCUS_19940 156559 155741 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_19940 156719 158158 gene locus_tag LOCUS_19950 156719 158158 CDS product AGCS sodium/alanine/glycine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 protein_id gnl|my_center|LOCUS_19950 158392 159381 gene locus_tag LOCUS_19960 gene ansA 158392 159381 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113732.1 protein_id gnl|my_center|LOCUS_19960 159409 159852 gene locus_tag LOCUS_19970 159409 159852 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_19970 159925 160371 gene locus_tag LOCUS_19980 gene ywrC 159925 160371 CDS product putative HTH-type transcriptional regulator YwrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05217 protein_id gnl|my_center|LOCUS_19980 160764 161858 gene locus_tag LOCUS_19990 160764 161858 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_19990 161863 162384 gene locus_tag LOCUS_20000 161863 162384 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_20000 162381 163706 gene locus_tag LOCUS_20010 162381 163706 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_20010 163728 164564 gene locus_tag LOCUS_20020 163728 164564 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGY7 protein_id gnl|my_center|LOCUS_20020 164574 166157 gene locus_tag LOCUS_20030 gene ggt 164574 166157 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_20030 166698 166303 gene locus_tag LOCUS_20040 166698 166303 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_20040 167706 166762 gene locus_tag LOCUS_20050 gene glsA 167706 166762 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I387 protein_id gnl|my_center|LOCUS_20050 167811 168740 gene locus_tag LOCUS_20060 167811 168740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064119.1 protein_id gnl|my_center|LOCUS_20060 169371 168730 gene locus_tag LOCUS_20070 169371 168730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719730.1 protein_id gnl|my_center|LOCUS_20070 169800 170900 gene locus_tag LOCUS_20080 gene coxB 169800 170900 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_20080 170905 172488 gene locus_tag LOCUS_20090 gene coxA 170905 172488 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_20090 172499 173047 gene locus_tag LOCUS_20100 172499 173047 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_20100 173059 173946 gene locus_tag LOCUS_20110 gene coIII 173059 173946 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_20110 174228 173953 gene locus_tag LOCUS_20120 174228 173953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 174228 174959 gene locus_tag LOCUS_20130 174228 174959 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_20130 174934 175512 gene locus_tag LOCUS_20140 174934 175512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_20140 175568 176623 gene locus_tag LOCUS_20150 175568 176623 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence09 245 517 gene locus_tag LOCUS_20160 245 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112586.1 protein_id gnl|my_center|LOCUS_20160 1093 554 gene locus_tag LOCUS_20170 1093 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268590.1 protein_id gnl|my_center|LOCUS_20170 2104 1274 gene locus_tag LOCUS_20180 2104 1274 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_20180 4359 2116 gene locus_tag LOCUS_20190 gene relA 4359 2116 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_20190 5852 4494 gene locus_tag LOCUS_20200 gene rlmD 5852 4494 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I525 protein_id gnl|my_center|LOCUS_20200 6757 5852 gene locus_tag LOCUS_20210 gene cysM 6757 5852 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_20210 7896 6922 gene locus_tag LOCUS_20220 7896 6922 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 protein_id gnl|my_center|LOCUS_20220 10091 8007 gene locus_tag LOCUS_20230 10091 8007 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 protein_id gnl|my_center|LOCUS_20230 11752 10415 gene locus_tag LOCUS_20240 11752 10415 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_20240 12375 11749 gene locus_tag LOCUS_20250 12375 11749 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102425.1 protein_id gnl|my_center|LOCUS_20250 12579 15329 gene locus_tag LOCUS_20260 gene gacS 12579 15329 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD98 protein_id gnl|my_center|LOCUS_20260 15339 16334 gene locus_tag LOCUS_20270 gene ldhA 15339 16334 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_20270 16362 16793 gene locus_tag LOCUS_20280 16362 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766645.1 protein_id gnl|my_center|LOCUS_20280 16798 17196 gene locus_tag LOCUS_20290 16798 17196 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103672.1 protein_id gnl|my_center|LOCUS_20290 18440 17388 gene locus_tag LOCUS_20300 gene dinB 18440 17388 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 protein_id gnl|my_center|LOCUS_20300 18585 18661 gene locus_tag LOCUS_t00200 18585 18661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18777 18853 gene locus_tag LOCUS_t00210 18777 18853 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18991 19539 gene locus_tag LOCUS_20310 18991 19539 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_20310 19636 20958 gene locus_tag LOCUS_20320 gene rimO 19636 20958 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_20320 21061 21771 gene locus_tag LOCUS_20330 21061 21771 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 protein_id gnl|my_center|LOCUS_20330 21776 22021 gene locus_tag LOCUS_20340 21776 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 22032 22736 gene locus_tag LOCUS_20350 22032 22736 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266991.1 protein_id gnl|my_center|LOCUS_20350 23099 22785 gene locus_tag LOCUS_20360 23099 22785 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113114.1 protein_id gnl|my_center|LOCUS_20360 23149 23565 gene locus_tag LOCUS_20370 23149 23565 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_20370 25854 23902 gene locus_tag LOCUS_20380 25854 23902 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266362.1 protein_id gnl|my_center|LOCUS_20380 27604 26144 gene locus_tag LOCUS_20390 27604 26144 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_20390 28346 27696 gene locus_tag LOCUS_20400 gene maiA 28346 27696 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_20400 29431 28445 gene locus_tag LOCUS_20410 29431 28445 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_20410 30654 29515 gene locus_tag LOCUS_20420 30654 29515 CDS product putative dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSB4 protein_id gnl|my_center|LOCUS_20420 31753 30659 gene locus_tag LOCUS_20430 gene hpd 31753 30659 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I576 protein_id gnl|my_center|LOCUS_20430 32304 31978 gene locus_tag LOCUS_20440 32304 31978 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_20440 33059 32301 gene locus_tag LOCUS_20450 33059 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268299.1 protein_id gnl|my_center|LOCUS_20450 33134 33997 gene locus_tag LOCUS_20460 33134 33997 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267906.1 protein_id gnl|my_center|LOCUS_20460 36093 34312 gene locus_tag LOCUS_20470 36093 34312 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_20470 36718 36086 gene locus_tag LOCUS_20480 36718 36086 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_20480 37660 36722 gene locus_tag LOCUS_20490 37660 36722 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_20490 38159 37854 gene locus_tag LOCUS_20500 38159 37854 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404250.1 protein_id gnl|my_center|LOCUS_20500 38656 38159 gene locus_tag LOCUS_20510 38656 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 protein_id gnl|my_center|LOCUS_20510 38932 39942 gene locus_tag LOCUS_20520 38932 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114233.1 protein_id gnl|my_center|LOCUS_20520 40049 41443 gene locus_tag LOCUS_20530 gene fumC 40049 41443 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885V0 protein_id gnl|my_center|LOCUS_20530 41436 42053 gene locus_tag LOCUS_20540 41436 42053 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_20540 43274 42075 gene locus_tag LOCUS_20550 43274 42075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_20550 44121 43357 gene locus_tag LOCUS_20560 44121 43357 CDS product carbon-phosphorus lyase complex accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_20560 44711 44112 gene locus_tag LOCUS_20570 gene phnN 44711 44112 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM8 protein_id gnl|my_center|LOCUS_20570 45856 44711 gene locus_tag LOCUS_20580 45856 44711 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_20580 46562 45846 gene locus_tag LOCUS_20590 46562 45846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098702.1 protein_id gnl|my_center|LOCUS_20590 47631 46822 gene locus_tag LOCUS_20600 47631 46822 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 protein_id gnl|my_center|LOCUS_20600 48497 47628 gene locus_tag LOCUS_20610 48497 47628 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM4 protein_id gnl|my_center|LOCUS_20610 49573 48497 gene locus_tag LOCUS_20620 gene phnI 49573 48497 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104083.1 protein_id gnl|my_center|LOCUS_20620 50184 49573 gene locus_tag LOCUS_20630 50184 49573 CDS product carbon-phosphorus lyase complex subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 protein_id gnl|my_center|LOCUS_20630 50645 50184 gene locus_tag LOCUS_20640 gene phnG 50645 50184 CDS product phosphonate metabolism protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246944.1 protein_id gnl|my_center|LOCUS_20640 51349 50645 gene locus_tag LOCUS_20650 51349 50645 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113121.1 protein_id gnl|my_center|LOCUS_20650 52179 51388 gene locus_tag LOCUS_20660 gene phnE 52179 51388 CDS product phosphonate transporter PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_20660 53263 52262 gene locus_tag LOCUS_20670 53263 52262 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_20670 54142 53318 gene locus_tag LOCUS_20680 gene phnC2 54142 53318 CDS product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882S0 protein_id gnl|my_center|LOCUS_20680 54599 54853 gene locus_tag LOCUS_20690 54599 54853 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554423.1 protein_id gnl|my_center|LOCUS_20690 56068 54932 gene locus_tag LOCUS_20700 56068 54932 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_20700 57857 56079 gene locus_tag LOCUS_20710 57857 56079 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_20710 58138 57881 gene locus_tag LOCUS_20720 58138 57881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 59268 58339 gene locus_tag LOCUS_20730 59268 58339 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 protein_id gnl|my_center|LOCUS_20730 59411 60133 gene locus_tag LOCUS_20740 59411 60133 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_20740 60145 60474 gene locus_tag LOCUS_20750 60145 60474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 60504 60965 gene locus_tag LOCUS_20760 60504 60965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 62414 60972 gene locus_tag LOCUS_20770 gene mgtE 62414 60972 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I544 protein_id gnl|my_center|LOCUS_20770 62738 63235 gene locus_tag LOCUS_20780 62738 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112600.1 protein_id gnl|my_center|LOCUS_20780 63356 63280 gene locus_tag LOCUS_t00220 63356 63280 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63506 63430 gene locus_tag LOCUS_t00230 63506 63430 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63657 63581 gene locus_tag LOCUS_t00240 63657 63581 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63819 63729 gene locus_tag LOCUS_t00250 63819 63729 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 64066 63881 gene locus_tag LOCUS_20790 gene csrA 64066 63881 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_20790 65496 64258 gene locus_tag LOCUS_20800 65496 64258 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_20800 68223 65599 gene locus_tag LOCUS_20810 gene alaS 68223 65599 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_20810 69567 68563 gene locus_tag LOCUS_20820 69567 68563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_20820 70733 69720 gene locus_tag LOCUS_20830 gene astE 70733 69720 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50177 protein_id gnl|my_center|LOCUS_20830 71089 70811 gene locus_tag LOCUS_20840 71089 70811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085959.1 protein_id gnl|my_center|LOCUS_20840 72477 71116 gene locus_tag LOCUS_20850 gene astB 72477 71116 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50175 protein_id gnl|my_center|LOCUS_20850 73940 72477 gene locus_tag LOCUS_20860 gene astD 73940 72477 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQH8 protein_id gnl|my_center|LOCUS_20860 75020 74004 gene locus_tag LOCUS_20870 gene aruG 75020 74004 CDS product arginine N-succinyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80358 protein_id gnl|my_center|LOCUS_20870 76118 75102 gene locus_tag LOCUS_20880 gene astA 76118 75102 CDS product arginine N-succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80357 protein_id gnl|my_center|LOCUS_20880 77502 76282 gene locus_tag LOCUS_20890 gene argD 77502 76282 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQH5 protein_id gnl|my_center|LOCUS_20890 78917 77937 gene locus_tag LOCUS_20900 gene argR 78917 77937 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103717.1 protein_id gnl|my_center|LOCUS_20900 79737 78973 gene locus_tag LOCUS_20910 gene aotP 79737 78973 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30506 protein_id gnl|my_center|LOCUS_20910 80464 79766 gene locus_tag LOCUS_20920 gene aotM 80464 79766 CDS product arginine/ornithine transporter AotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_20920 81164 80475 gene locus_tag LOCUS_20930 gene aotQ 81164 80475 CDS product arginine/ornithine transporter AotQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 protein_id gnl|my_center|LOCUS_20930 82109 81336 gene locus_tag LOCUS_20940 82109 81336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404105.1 protein_id gnl|my_center|LOCUS_20940 83235 82708 gene locus_tag LOCUS_20950 gene xcpZ 83235 82708 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25061 protein_id gnl|my_center|LOCUS_20950 84374 83235 gene locus_tag LOCUS_20960 gene xcpY 84374 83235 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_20960 85342 84371 gene locus_tag LOCUS_20970 gene xcpX 85342 84371 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_20970 86010 85339 gene locus_tag LOCUS_20980 gene xcpW 86010 85339 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_20980 86576 86193 gene locus_tag LOCUS_20990 gene xcpV 86576 86193 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_20990 87043 86573 gene locus_tag LOCUS_21000 gene xcpU 87043 86573 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_21000 87599 87174 gene locus_tag LOCUS_21010 gene xcpT 87599 87174 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_21010 88820 87603 gene locus_tag LOCUS_21020 gene xcpS 88820 87603 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_21020 90431 88944 gene locus_tag LOCUS_21030 gene xcpR 90431 88944 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_21030 90660 91307 gene locus_tag LOCUS_21040 gene xcpP 90660 91307 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51575 protein_id gnl|my_center|LOCUS_21040 91312 93264 gene locus_tag LOCUS_21050 gene xcpQ 91312 93264 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_21050 96076 94373 gene locus_tag LOCUS_21060 96076 94373 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704696.1 protein_id gnl|my_center|LOCUS_21060 96292 96666 gene locus_tag LOCUS_21070 96292 96666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 96810 97199 gene locus_tag LOCUS_21080 96810 97199 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975438.1 protein_id gnl|my_center|LOCUS_21080 97673 97206 gene locus_tag LOCUS_21090 97673 97206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21090 98041 99126 gene locus_tag LOCUS_21100 98041 99126 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268279.1 protein_id gnl|my_center|LOCUS_21100 99557 101755 gene locus_tag LOCUS_21110 99557 101755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 102596 103156 gene locus_tag LOCUS_21120 102596 103156 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_21120 104836 103169 gene locus_tag LOCUS_21130 104836 103169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 105181 107232 gene locus_tag LOCUS_21140 gene fecA 105181 107232 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037209.1 protein_id gnl|my_center|LOCUS_21140 108576 107437 gene locus_tag LOCUS_21150 108576 107437 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_21150 109644 108664 gene locus_tag LOCUS_21160 109644 108664 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141824.1 protein_id gnl|my_center|LOCUS_21160 109734 110936 gene locus_tag LOCUS_21170 109734 110936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101497.1 protein_id gnl|my_center|LOCUS_21170 111024 112796 gene locus_tag LOCUS_21180 111024 112796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086721.1 protein_id gnl|my_center|LOCUS_21180 113339 112809 gene locus_tag LOCUS_21190 113339 112809 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_21190 113973 113404 gene locus_tag LOCUS_21200 113973 113404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_21200 115408 114038 gene locus_tag LOCUS_21210 115408 114038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 116284 115682 gene locus_tag LOCUS_21220 116284 115682 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318496.1 protein_id gnl|my_center|LOCUS_21220 117251 116358 gene locus_tag LOCUS_21230 117251 116358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_21230 118490 117522 gene locus_tag LOCUS_21240 gene moaA 118490 117522 CDS product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ65 protein_id gnl|my_center|LOCUS_21240 119193 118570 gene locus_tag LOCUS_21250 119193 118570 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_21250 119269 120402 gene locus_tag LOCUS_21260 119269 120402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_21260 121634 120852 gene locus_tag LOCUS_21270 121634 120852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_21270 122105 121749 gene locus_tag LOCUS_21280 gene pilZ 122105 121749 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_21280 123224 122232 gene locus_tag LOCUS_21290 123224 122232 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_21290 123849 123217 gene locus_tag LOCUS_21300 gene tmk 123849 123217 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_21300 124914 123859 gene locus_tag LOCUS_21310 124914 123859 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 protein_id gnl|my_center|LOCUS_21310 125733 124918 gene locus_tag LOCUS_21320 gene pabC 125733 124918 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_21320 126977 125733 gene locus_tag LOCUS_21330 gene fabF 126977 125733 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG8 protein_id gnl|my_center|LOCUS_21330 127325 127089 gene locus_tag LOCUS_21340 gene acpP1 127325 127089 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_21340 128297 127554 gene locus_tag LOCUS_21350 gene fabG 128297 127554 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_21350 129251 128313 gene locus_tag LOCUS_21360 gene fabD 129251 128313 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCZ6 protein_id gnl|my_center|LOCUS_21360 130388 129378 gene locus_tag LOCUS_21370 gene plsX 130388 129378 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN5 protein_id gnl|my_center|LOCUS_21370 130574 130392 gene locus_tag LOCUS_21380 gene rpmF 130574 130392 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG4 protein_id gnl|my_center|LOCUS_21380 131115 130588 gene locus_tag LOCUS_21390 131115 130588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_21390 131504 132085 gene locus_tag LOCUS_21400 131504 132085 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY2 protein_id gnl|my_center|LOCUS_21400 133108 132131 gene locus_tag LOCUS_21410 133108 132131 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_21410 133793 133098 gene locus_tag LOCUS_21420 133793 133098 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_21420 134739 133786 gene locus_tag LOCUS_21430 gene rluC 134739 133786 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_21430 135328 138405 gene locus_tag LOCUS_21440 gene rne 135328 138405 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY6 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21440 139553 138534 gene locus_tag LOCUS_21450 gene murB 139553 138534 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 protein_id gnl|my_center|LOCUS_21450 140014 139550 gene locus_tag LOCUS_21460 gene ptpA 140014 139550 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_21460 140778 140014 gene locus_tag LOCUS_21470 gene kdsB 140778 140014 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF7 protein_id gnl|my_center|LOCUS_21470 140964 140779 gene locus_tag LOCUS_21480 140964 140779 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_21480 141988 140987 gene locus_tag LOCUS_21490 gene lpxK 141988 140987 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY9 protein_id gnl|my_center|LOCUS_21490 142418 141990 gene locus_tag LOCUS_21500 142418 141990 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_21500 143047 142415 gene locus_tag LOCUS_21510 143047 142415 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_21510 145333 143120 gene locus_tag LOCUS_21520 145333 143120 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_21520 145472 145999 gene locus_tag LOCUS_21530 145472 145999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_21530 147278 146034 gene locus_tag LOCUS_21540 147278 146034 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405690.1 protein_id gnl|my_center|LOCUS_21540 147979 147278 gene locus_tag LOCUS_21550 gene lolD 147979 147278 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV73 protein_id gnl|my_center|LOCUS_21550 149231 147984 gene locus_tag LOCUS_21560 149231 147984 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_21560 149525 150091 gene locus_tag LOCUS_21570 149525 150091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251679.2 protein_id gnl|my_center|LOCUS_21570 150111 150419 gene locus_tag LOCUS_21580 150111 150419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 150416 151135 gene locus_tag LOCUS_21590 150416 151135 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence10 1650 325 gene locus_tag LOCUS_21600 1650 325 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367224.1 protein_id gnl|my_center|LOCUS_21600 2384 1710 gene locus_tag LOCUS_21610 2384 1710 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_21610 3444 2545 gene locus_tag LOCUS_21620 3444 2545 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 protein_id gnl|my_center|LOCUS_21620 4816 3482 gene locus_tag LOCUS_21630 4816 3482 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_21630 5172 5765 gene locus_tag LOCUS_21640 5172 5765 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_21640 6158 7024 gene locus_tag LOCUS_21650 gene purU-2 6158 7024 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B4 protein_id gnl|my_center|LOCUS_21650 7021 7944 gene locus_tag LOCUS_21660 gene folD2 7021 7944 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B5 protein_id gnl|my_center|LOCUS_21660 7971 9167 gene locus_tag LOCUS_21670 gene soxB-2 7971 9167 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_21670 9179 9481 gene locus_tag LOCUS_21680 gene soxD-2 9179 9481 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_21680 9478 12375 gene locus_tag LOCUS_21690 9478 12375 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_21690 12379 12948 gene locus_tag LOCUS_21700 gene soxG-2 12379 12948 CDS product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104012.1 protein_id gnl|my_center|LOCUS_21700 13031 13816 gene locus_tag LOCUS_21710 13031 13816 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112902.1 protein_id gnl|my_center|LOCUS_21710 15775 13829 gene locus_tag LOCUS_21720 15775 13829 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_21720 15980 17023 gene locus_tag LOCUS_21730 15980 17023 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267558.1 protein_id gnl|my_center|LOCUS_21730 17092 17250 gene locus_tag LOCUS_21740 17092 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 17375 18061 gene locus_tag LOCUS_21750 17375 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18067 19422 gene locus_tag LOCUS_21760 gene yxlA 18067 19422 CDS product putative purine-cytosine permease YxlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94369 protein_id gnl|my_center|LOCUS_21760 19914 20297 gene locus_tag LOCUS_21770 19914 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 20836 20312 gene locus_tag LOCUS_21780 20836 20312 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_21780 21116 20841 gene locus_tag LOCUS_21790 21116 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 22433 21177 gene locus_tag LOCUS_21800 22433 21177 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 protein_id gnl|my_center|LOCUS_21800 24312 22735 gene locus_tag LOCUS_21810 gene guaA 24312 22735 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_21810 25990 24521 gene locus_tag LOCUS_21820 gene guaB 25990 24521 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_21820 26136 28280 gene locus_tag LOCUS_21830 26136 28280 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765172.1 protein_id gnl|my_center|LOCUS_21830 28996 28388 gene locus_tag LOCUS_21840 28996 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771002.1 protein_id gnl|my_center|LOCUS_21840 29465 28998 gene locus_tag LOCUS_21850 29465 28998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119853.1 protein_id gnl|my_center|LOCUS_21850 29500 30432 gene locus_tag LOCUS_21860 29500 30432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090978.1 protein_id gnl|my_center|LOCUS_21860 30476 31855 gene locus_tag LOCUS_21870 gene xseA 30476 31855 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_21870 31907 32767 gene locus_tag LOCUS_21880 31907 32767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_21880 33030 34292 gene locus_tag LOCUS_21890 33030 34292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_21890 34361 35026 gene locus_tag LOCUS_21900 gene gstA 34361 35026 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_21900 35332 37002 gene locus_tag LOCUS_21910 gene leuA 35332 37002 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXK5 protein_id gnl|my_center|LOCUS_21910 37712 37251 gene locus_tag LOCUS_21920 37712 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107363.1 protein_id gnl|my_center|LOCUS_21920 38506 37724 gene locus_tag LOCUS_21930 38506 37724 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_21930 39727 38579 gene locus_tag LOCUS_21940 39727 38579 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_21940 41348 39870 gene locus_tag LOCUS_21950 gene der 41348 39870 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_21950 42613 41462 gene locus_tag LOCUS_21960 gene bamB 42613 41462 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_21960 43244 42606 gene locus_tag LOCUS_21970 43244 42606 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_21970 44563 43277 gene locus_tag LOCUS_21980 gene hisS 44563 43277 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ5 protein_id gnl|my_center|LOCUS_21980 45696 44584 gene locus_tag LOCUS_21990 gene ispG 45696 44584 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z0 protein_id gnl|my_center|LOCUS_21990 46680 45700 gene locus_tag LOCUS_22000 46680 45700 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771017.1 protein_id gnl|my_center|LOCUS_22000 47438 46677 gene locus_tag LOCUS_22010 gene pilF 47438 46677 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_22010 48600 47452 gene locus_tag LOCUS_22020 gene rlmN 48600 47452 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_22020 49058 48627 gene locus_tag LOCUS_22030 gene ndk 49058 48627 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_22030 49360 49160 gene locus_tag LOCUS_22040 49360 49160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_22040 49715 49374 gene locus_tag LOCUS_22050 49715 49374 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615771.1 protein_id gnl|my_center|LOCUS_22050 51584 49719 gene locus_tag LOCUS_22060 gene hscA 51584 49719 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX30 protein_id gnl|my_center|LOCUS_22060 52151 51630 gene locus_tag LOCUS_22070 gene hscB 52151 51630 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z8 protein_id gnl|my_center|LOCUS_22070 52484 52161 gene locus_tag LOCUS_22080 gene iscA 52484 52161 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ0 protein_id gnl|my_center|LOCUS_22080 52884 52498 gene locus_tag LOCUS_22090 52884 52498 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX33 protein_id gnl|my_center|LOCUS_22090 54172 52958 gene locus_tag LOCUS_22100 gene iscS 54172 52958 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_22100 54694 54203 gene locus_tag LOCUS_22110 gene iscR 54694 54203 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_22110 55610 54831 gene locus_tag LOCUS_22120 gene cysE 55610 54831 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_22120 56391 55603 gene locus_tag LOCUS_22130 gene trmJ 56391 55603 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_22130 56528 57343 gene locus_tag LOCUS_22140 gene suhB 56528 57343 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 protein_id gnl|my_center|LOCUS_22140 57943 57401 gene locus_tag LOCUS_22150 57943 57401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_22150 58978 58061 gene locus_tag LOCUS_22160 gene secF 58978 58061 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A7 protein_id gnl|my_center|LOCUS_22160 60898 58988 gene locus_tag LOCUS_22170 gene secD 60898 58988 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_22170 61411 61082 gene locus_tag LOCUS_22180 61411 61082 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_22180 62585 61452 gene locus_tag LOCUS_22190 gene tgt 62585 61452 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_22190 63631 62588 gene locus_tag LOCUS_22200 gene queA 63631 62588 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_22200 64440 63700 gene locus_tag LOCUS_22210 64440 63700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 64645 64729 gene locus_tag LOCUS_t00260 64645 64729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64905 66125 gene locus_tag LOCUS_22220 64905 66125 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105434.1 protein_id gnl|my_center|LOCUS_22220 66137 66697 gene locus_tag LOCUS_22230 66137 66697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 66771 66995 gene locus_tag LOCUS_22240 66771 66995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 67277 67441 gene locus_tag LOCUS_22250 67277 67441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 67434 67697 gene locus_tag LOCUS_22260 67434 67697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 67681 67959 gene locus_tag LOCUS_22270 67681 67959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 67965 68390 gene locus_tag LOCUS_22280 67965 68390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 68374 69612 gene locus_tag LOCUS_22290 68374 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 69612 69905 gene locus_tag LOCUS_22300 69612 69905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 69902 70138 gene locus_tag LOCUS_22310 69902 70138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 70186 71568 gene locus_tag LOCUS_22320 70186 71568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 71723 71923 gene locus_tag LOCUS_22330 71723 71923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 71960 72322 gene locus_tag LOCUS_22340 71960 72322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 72498 74807 gene locus_tag LOCUS_22350 72498 74807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 74861 75493 gene locus_tag LOCUS_22360 74861 75493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 75873 75661 gene locus_tag LOCUS_22370 75873 75661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 76203 76418 gene locus_tag LOCUS_22380 76203 76418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 76698 76474 gene locus_tag LOCUS_22390 76698 76474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 76929 76708 gene locus_tag LOCUS_22400 76929 76708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 77463 77675 gene locus_tag LOCUS_22410 77463 77675 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 protein_id gnl|my_center|LOCUS_22410 77833 78330 gene locus_tag LOCUS_22420 77833 78330 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_22420 79455 78391 gene locus_tag LOCUS_22430 79455 78391 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_22430 80572 79448 gene locus_tag LOCUS_22440 80572 79448 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_22440 80716 82203 gene locus_tag LOCUS_22450 gene pepA 80716 82203 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_22450 82341 82760 gene locus_tag LOCUS_22460 gene holC 82341 82760 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_22460 82815 83249 gene locus_tag LOCUS_22470 82815 83249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764094.1 protein_id gnl|my_center|LOCUS_22470 83433 86264 gene locus_tag LOCUS_22480 gene valS 83433 86264 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_22480 86484 87914 gene locus_tag LOCUS_22490 86484 87914 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_22490 88096 89472 gene locus_tag LOCUS_22500 88096 89472 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_22500 89510 89806 gene locus_tag LOCUS_22510 89510 89806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 protein_id gnl|my_center|LOCUS_22510 89839 91668 gene locus_tag LOCUS_22520 89839 91668 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_22520 91828 92829 gene locus_tag LOCUS_22530 gene rlmF 91828 92829 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_22530 94223 92979 gene locus_tag LOCUS_22540 94223 92979 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_22540 95090 94311 gene locus_tag LOCUS_22550 95090 94311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 95366 96154 gene locus_tag LOCUS_22560 95366 96154 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_22560 96756 96214 gene locus_tag LOCUS_22570 96756 96214 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_22570 100193 96759 gene locus_tag LOCUS_22580 100193 96759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479723.1 protein_id gnl|my_center|LOCUS_22580 100613 100254 gene locus_tag LOCUS_22590 100613 100254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 101370 100765 gene locus_tag LOCUS_22600 101370 100765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_22600 101728 101453 gene locus_tag LOCUS_22610 101728 101453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 101903 102946 gene locus_tag LOCUS_22620 101903 102946 CDS product putative family 20 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HI37 protein_id gnl|my_center|LOCUS_22620 104036 103668 gene locus_tag LOCUS_22630 104036 103668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 protein_id gnl|my_center|LOCUS_22630 104426 104124 gene locus_tag LOCUS_22640 104426 104124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 105221 104532 gene locus_tag LOCUS_22650 105221 104532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870221.1 protein_id gnl|my_center|LOCUS_22650 106957 105743 gene locus_tag LOCUS_22660 gene sbcD 106957 105743 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK53 protein_id gnl|my_center|LOCUS_22660 107181 107978 gene locus_tag LOCUS_22670 107181 107978 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_22670 107982 109331 gene locus_tag LOCUS_22680 107982 109331 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927297.1 protein_id gnl|my_center|LOCUS_22680 109757 109338 gene locus_tag LOCUS_22690 109757 109338 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 protein_id gnl|my_center|LOCUS_22690 109880 111133 gene locus_tag LOCUS_22700 109880 111133 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705120.1 protein_id gnl|my_center|LOCUS_22700 111245 112570 gene locus_tag LOCUS_22710 111245 112570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_22710 112763 113770 gene locus_tag LOCUS_22720 112763 113770 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI3 protein_id gnl|my_center|LOCUS_22720 113983 114303 gene locus_tag LOCUS_22730 113983 114303 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406715.1 protein_id gnl|my_center|LOCUS_22730 115257 114322 gene locus_tag LOCUS_22740 115257 114322 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_22740 115602 115291 gene locus_tag LOCUS_22750 115602 115291 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXF2 protein_id gnl|my_center|LOCUS_22750 116318 115599 gene locus_tag LOCUS_22760 gene pcs 116318 115599 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_22760 116888 116418 gene locus_tag LOCUS_22770 116888 116418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_22770 117051 117992 gene locus_tag LOCUS_22780 117051 117992 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 protein_id gnl|my_center|LOCUS_22780 119274 118513 gene locus_tag LOCUS_22790 119274 118513 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 protein_id gnl|my_center|LOCUS_22790 120528 119431 gene locus_tag LOCUS_22800 120528 119431 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_22800 121722 120538 gene locus_tag LOCUS_22810 121722 120538 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 protein_id gnl|my_center|LOCUS_22810 122848 121820 gene locus_tag LOCUS_22820 122848 121820 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 protein_id gnl|my_center|LOCUS_22820 123326 123985 gene locus_tag LOCUS_22830 123326 123985 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 protein_id gnl|my_center|LOCUS_22830 124009 125910 gene locus_tag LOCUS_22840 124009 125910 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_22840 126102 127040 gene locus_tag LOCUS_22850 126102 127040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 127194 128357 gene locus_tag LOCUS_22860 127194 128357 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_22860 128468 129916 gene locus_tag LOCUS_22870 gene rhlB 128468 129916 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_22870 129990 131129 gene locus_tag LOCUS_22880 gene dauA 129990 131129 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_22880 131266 131547 gene locus_tag LOCUS_22890 131266 131547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 132472 131528 gene locus_tag LOCUS_22900 132472 131528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087664.1 protein_id gnl|my_center|LOCUS_22900 132655 132476 gene locus_tag LOCUS_22910 132655 132476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22910 133374 133072 gene locus_tag LOCUS_22920 133374 133072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 134424 133438 gene locus_tag LOCUS_22930 134424 133438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_22930 137083 134687 gene locus_tag LOCUS_22940 gene polB 137083 134687 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2L1 protein_id gnl|my_center|LOCUS_22940 137214 137642 gene locus_tag LOCUS_22950 137214 137642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 137644 137982 gene locus_tag LOCUS_22960 137644 137982 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXS4 protein_id gnl|my_center|LOCUS_22960 137975 138901 gene locus_tag LOCUS_22970 137975 138901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_22970 140661 139111 gene locus_tag LOCUS_22980 140661 139111 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_22980 141011 142192 gene locus_tag LOCUS_22990 gene hmp 141011 142192 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H4 protein_id gnl|my_center|LOCUS_22990 142211 142462 gene locus_tag LOCUS_23000 gene ppyR 142211 142462 CDS product psl and pyoverdine operon regulator PpyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090502.1 protein_id gnl|my_center|LOCUS_23000 142443 143624 gene locus_tag LOCUS_23010 142443 143624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence11 1152 361 gene locus_tag LOCUS_23020 1152 361 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 protein_id gnl|my_center|LOCUS_23020 1234 2220 gene locus_tag LOCUS_23030 1234 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 protein_id gnl|my_center|LOCUS_23030 2297 3358 gene locus_tag LOCUS_23040 2297 3358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_23040 3388 3690 gene locus_tag LOCUS_23050 3388 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3725 4453 gene locus_tag LOCUS_23060 3725 4453 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 protein_id gnl|my_center|LOCUS_23060 4877 4575 gene locus_tag LOCUS_23070 4877 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_23070 5820 4879 gene locus_tag LOCUS_23080 5820 4879 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_23080 8220 6409 gene locus_tag LOCUS_23090 8220 6409 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 protein_id gnl|my_center|LOCUS_23090 9644 8229 gene locus_tag LOCUS_23100 9644 8229 CDS product acetyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_23100 9799 10773 gene locus_tag LOCUS_23110 9799 10773 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_23110 10845 12032 gene locus_tag LOCUS_23120 10845 12032 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_23120 14416 12302 gene locus_tag LOCUS_23130 14416 12302 CDS product exported oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_23130 15012 14554 gene locus_tag LOCUS_23140 15012 14554 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930750.1 protein_id gnl|my_center|LOCUS_23140 15263 15934 gene locus_tag LOCUS_23150 15263 15934 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_23150 16203 17138 gene locus_tag LOCUS_23160 16203 17138 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_23160 17135 18244 gene locus_tag LOCUS_23170 17135 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 protein_id gnl|my_center|LOCUS_23170 18237 18473 gene locus_tag LOCUS_23180 18237 18473 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523445.1 protein_id gnl|my_center|LOCUS_23180 18470 19705 gene locus_tag LOCUS_23190 18470 19705 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_23190 19776 20528 gene locus_tag LOCUS_23200 19776 20528 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082563.1 protein_id gnl|my_center|LOCUS_23200 20780 21598 gene locus_tag LOCUS_23210 20780 21598 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 protein_id gnl|my_center|LOCUS_23210 21698 23509 gene locus_tag LOCUS_23220 21698 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114962.1 protein_id gnl|my_center|LOCUS_23220 23502 24167 gene locus_tag LOCUS_23230 23502 24167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 protein_id gnl|my_center|LOCUS_23230 24180 24830 gene locus_tag LOCUS_23240 24180 24830 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114963.1 protein_id gnl|my_center|LOCUS_23240 24823 25545 gene locus_tag LOCUS_23250 24823 25545 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 protein_id gnl|my_center|LOCUS_23250 25557 26594 gene locus_tag LOCUS_23260 25557 26594 CDS product putative trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I489 protein_id gnl|my_center|LOCUS_23260 26793 27731 gene locus_tag LOCUS_23270 gene dapA 26793 27731 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206383.1 protein_id gnl|my_center|LOCUS_23270 28003 28236 gene locus_tag LOCUS_23280 28003 28236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 28236 29174 gene locus_tag LOCUS_23290 28236 29174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23290 29228 30811 gene locus_tag LOCUS_23300 29228 30811 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 protein_id gnl|my_center|LOCUS_23300 31919 30912 gene locus_tag LOCUS_23310 gene lhpD 31919 30912 CDS product delta(1)-pyrroline-2-carboxylate/Delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I492 protein_id gnl|my_center|LOCUS_23310 32207 32025 gene locus_tag LOCUS_23320 32207 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719786.1 protein_id gnl|my_center|LOCUS_23320 33170 32304 gene locus_tag LOCUS_23330 33170 32304 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 protein_id gnl|my_center|LOCUS_23330 33441 34883 gene locus_tag LOCUS_23340 gene zwf 33441 34883 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTC7 protein_id gnl|my_center|LOCUS_23340 35167 35685 gene locus_tag LOCUS_23350 gene hcpB 35167 35685 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253954.1 protein_id gnl|my_center|LOCUS_23350 35872 38010 gene locus_tag LOCUS_23360 35872 38010 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105496.1 protein_id gnl|my_center|LOCUS_23360 38007 38807 gene locus_tag LOCUS_23370 38007 38807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 38804 42745 gene locus_tag LOCUS_23380 38804 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 43418 43227 gene locus_tag LOCUS_23390 43418 43227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 43320 43793 gene locus_tag LOCUS_23400 43320 43793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 44433 44194 gene locus_tag LOCUS_23410 44433 44194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 44335 44808 gene locus_tag LOCUS_23420 44335 44808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 44963 45919 gene locus_tag LOCUS_23430 44963 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 45956 46429 gene locus_tag LOCUS_23440 45956 46429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 46489 46851 gene locus_tag LOCUS_23450 46489 46851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 48530 47292 gene locus_tag LOCUS_23460 gene ampG4 48530 47292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_23460 49692 48748 gene locus_tag LOCUS_23470 49692 48748 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403882.1 protein_id gnl|my_center|LOCUS_23470 50015 50500 gene locus_tag LOCUS_23480 50015 50500 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 protein_id gnl|my_center|LOCUS_23480 50497 51285 gene locus_tag LOCUS_23490 gene znuC 50497 51285 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_23490 51285 52073 gene locus_tag LOCUS_23500 gene znuB 51285 52073 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 protein_id gnl|my_center|LOCUS_23500 52273 53118 gene locus_tag LOCUS_23510 52273 53118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142141.1 protein_id gnl|my_center|LOCUS_23510 53291 54298 gene locus_tag LOCUS_23520 gene metN1 53291 54298 CDS product methionine import ATP-binding protein MetN 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR8 protein_id gnl|my_center|LOCUS_23520 54298 54966 gene locus_tag LOCUS_23530 54298 54966 CDS product D-methionine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_23530 55031 55801 gene locus_tag LOCUS_23540 55031 55801 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_23540 56775 55921 gene locus_tag LOCUS_23550 56775 55921 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114205.1 protein_id gnl|my_center|LOCUS_23550 56918 57343 gene locus_tag LOCUS_23560 56918 57343 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 protein_id gnl|my_center|LOCUS_23560 60241 57359 gene locus_tag LOCUS_23570 60241 57359 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 protein_id gnl|my_center|LOCUS_23570 60337 60543 gene locus_tag LOCUS_23580 60337 60543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 60533 62716 gene locus_tag LOCUS_23590 gene uvrD 60533 62716 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_23590 62740 63834 gene locus_tag LOCUS_23600 62740 63834 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_23600 63884 64966 gene locus_tag LOCUS_23610 63884 64966 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_23610 65144 65725 gene locus_tag LOCUS_23620 65144 65725 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_23620 65902 66756 gene locus_tag LOCUS_23630 65902 66756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768318.1 protein_id gnl|my_center|LOCUS_23630 67330 66860 gene locus_tag LOCUS_23640 67330 66860 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083750.1 protein_id gnl|my_center|LOCUS_23640 67436 67843 gene locus_tag LOCUS_23650 67436 67843 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768316.1 protein_id gnl|my_center|LOCUS_23650 68605 67952 gene locus_tag LOCUS_23660 68605 67952 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_23660 68853 70247 gene locus_tag LOCUS_23670 68853 70247 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 protein_id gnl|my_center|LOCUS_23670 70339 71706 gene locus_tag LOCUS_23680 70339 71706 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_23680 73016 71754 gene locus_tag LOCUS_23690 73016 71754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 73729 73013 gene locus_tag LOCUS_23700 73729 73013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114137.1 protein_id gnl|my_center|LOCUS_23700 73817 74308 gene locus_tag LOCUS_23710 73817 74308 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_23710 74870 74337 gene locus_tag LOCUS_23720 74870 74337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 74992 75387 gene locus_tag LOCUS_23730 74992 75387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 protein_id gnl|my_center|LOCUS_23730 76360 75482 gene locus_tag LOCUS_23740 gene poxA 76360 75482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_23740 77375 76395 gene locus_tag LOCUS_23750 77375 76395 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105543.1 protein_id gnl|my_center|LOCUS_23750 77471 77821 gene locus_tag LOCUS_23760 77471 77821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099679.1 protein_id gnl|my_center|LOCUS_23760 78850 78206 gene locus_tag LOCUS_23770 78850 78206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_23770 80055 78850 gene locus_tag LOCUS_23780 80055 78850 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 protein_id gnl|my_center|LOCUS_23780 80493 80071 gene locus_tag LOCUS_23790 gene dksA 80493 80071 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT38 protein_id gnl|my_center|LOCUS_23790 80565 81455 gene locus_tag LOCUS_23800 gene folE2 80565 81455 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_23800 81692 83611 gene locus_tag LOCUS_23810 81692 83611 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_23810 83955 83862 gene locus_tag LOCUS_t00270 83955 83862 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 84377 84538 gene locus_tag LOCUS_23820 84377 84538 CDS product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266868.1 protein_id gnl|my_center|LOCUS_23820 85727 84825 gene locus_tag LOCUS_23830 85727 84825 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976227.1 protein_id gnl|my_center|LOCUS_23830 85911 87299 gene locus_tag LOCUS_23840 gene sdaA 85911 87299 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_23840 89307 87640 gene locus_tag LOCUS_23850 89307 87640 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538264.1 protein_id gnl|my_center|LOCUS_23850 89590 91035 gene locus_tag LOCUS_23860 gene clsA 89590 91035 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH0 protein_id gnl|my_center|LOCUS_23860 91094 91819 gene locus_tag LOCUS_23870 91094 91819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 92413 91823 gene locus_tag LOCUS_23880 92413 91823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105545.1 protein_id gnl|my_center|LOCUS_23880 92884 92477 gene locus_tag LOCUS_23890 92884 92477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_23890 94908 92881 gene locus_tag LOCUS_23900 94908 92881 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_23900 96105 95152 gene locus_tag LOCUS_23910 96105 95152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_23910 98084 96744 gene locus_tag LOCUS_23920 gene mifR 98084 96744 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_23920 100074 98317 gene locus_tag LOCUS_23930 gene mifS 100074 98317 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114131.1 protein_id gnl|my_center|LOCUS_23930 101299 100115 gene locus_tag LOCUS_23940 101299 100115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114148.1 protein_id gnl|my_center|LOCUS_23940 102391 101384 gene locus_tag LOCUS_23950 102391 101384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114019.1 protein_id gnl|my_center|LOCUS_23950 103311 102388 gene locus_tag LOCUS_23960 103311 102388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101423.1 protein_id gnl|my_center|LOCUS_23960 104186 103416 gene locus_tag LOCUS_23970 104186 103416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101422.1 protein_id gnl|my_center|LOCUS_23970 106234 104186 gene locus_tag LOCUS_23980 106234 104186 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_23980 107623 106925 gene locus_tag LOCUS_23990 107623 106925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 108572 107844 gene locus_tag LOCUS_24000 108572 107844 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114021.1 protein_id gnl|my_center|LOCUS_24000 109771 108569 gene locus_tag LOCUS_24010 gene cobL 109771 108569 CDS product precorrin-6Y C(5,15)-methyltransferase [decarboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU0 protein_id gnl|my_center|LOCUS_24010 110370 111680 gene locus_tag LOCUS_24020 110370 111680 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895641.1 protein_id gnl|my_center|LOCUS_24020 111673 112299 gene locus_tag LOCUS_24030 gene cobH 111673 112299 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU2 protein_id gnl|my_center|LOCUS_24030 112296 113039 gene locus_tag LOCUS_24040 gene cobI 112296 113039 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU3 protein_id gnl|my_center|LOCUS_24040 113174 114823 gene locus_tag LOCUS_24050 gene cobJ 113174 114823 CDS product precorrin-3 methylase CobJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147855.1 protein_id gnl|my_center|LOCUS_24050 115348 116187 gene locus_tag LOCUS_24060 115348 116187 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_24060 116265 116864 gene locus_tag LOCUS_24070 116265 116864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_24070 117926 116946 gene locus_tag LOCUS_24080 117926 116946 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 protein_id gnl|my_center|LOCUS_24080 118021 118632 gene locus_tag LOCUS_24090 118021 118632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065048.1 protein_id gnl|my_center|LOCUS_24090 119214 118645 gene locus_tag LOCUS_24100 119214 118645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529959.1 protein_id gnl|my_center|LOCUS_24100 120041 119298 gene locus_tag LOCUS_24110 120041 119298 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_24110 120182 121093 gene locus_tag LOCUS_24120 120182 121093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142546.1 protein_id gnl|my_center|LOCUS_24120 121195 122190 gene locus_tag LOCUS_24130 121195 122190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 122288 122094 gene locus_tag LOCUS_24140 122288 122094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 123154 122393 gene locus_tag LOCUS_24150 gene cobF 123154 122393 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228664.1 protein_id gnl|my_center|LOCUS_24150 123747 123151 gene locus_tag LOCUS_24160 123747 123151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119819.1 protein_id gnl|my_center|LOCUS_24160 124901 123900 gene locus_tag LOCUS_24170 124901 123900 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114001.1 protein_id gnl|my_center|LOCUS_24170 128934 125188 gene locus_tag LOCUS_24180 gene cobN 128934 125188 CDS product aerobic cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ3 protein_id gnl|my_center|LOCUS_24180 130075 129026 gene locus_tag LOCUS_24190 gene cobW 130075 129026 CDS product protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ2 protein_id gnl|my_center|LOCUS_24190 130074 130319 gene locus_tag LOCUS_24200 130074 130319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 130696 130484 gene locus_tag LOCUS_24210 130696 130484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 130586 130888 gene locus_tag LOCUS_24220 130586 130888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 130885 131640 gene locus_tag LOCUS_24230 gene cobM 130885 131640 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP9 protein_id gnl|my_center|LOCUS_24230 132093 131863 gene locus_tag LOCUS_24240 132093 131863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719758.1 protein_id gnl|my_center|LOCUS_24240 132284 132496 gene locus_tag LOCUS_24250 132284 132496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 132493 133272 gene locus_tag LOCUS_24260 gene map 132493 133272 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_24260 133565 134170 gene locus_tag LOCUS_24270 133565 134170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 135117 134296 gene locus_tag LOCUS_24280 135117 134296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence12 2337 154 gene locus_tag LOCUS_24290 gene ppk 2337 154 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZQ6 protein_id gnl|my_center|LOCUS_24290 3370 2357 gene locus_tag LOCUS_24300 3370 2357 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZQ7 protein_id gnl|my_center|LOCUS_24300 3564 4118 gene locus_tag LOCUS_24310 3564 4118 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_24310 5470 4211 gene locus_tag LOCUS_24320 gene erg3 5470 4211 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_24320 5646 6305 gene locus_tag LOCUS_24330 5646 6305 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_24330 6621 7088 gene locus_tag LOCUS_24340 6621 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_24340 7642 7193 gene locus_tag LOCUS_24350 7642 7193 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU7 protein_id gnl|my_center|LOCUS_24350 8030 7695 gene locus_tag LOCUS_24360 8030 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 10047 8158 gene locus_tag LOCUS_24370 10047 8158 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 protein_id gnl|my_center|LOCUS_24370 10930 10298 gene locus_tag LOCUS_24380 10930 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 protein_id gnl|my_center|LOCUS_24380 11546 11007 gene locus_tag LOCUS_24390 11546 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 protein_id gnl|my_center|LOCUS_24390 13459 11546 gene locus_tag LOCUS_24400 13459 11546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_24400 13498 13941 gene locus_tag LOCUS_24410 13498 13941 CDS product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266154.1 protein_id gnl|my_center|LOCUS_24410 14810 13938 gene locus_tag LOCUS_24420 14810 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24420 15006 15653 gene locus_tag LOCUS_24430 15006 15653 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B84 protein_id gnl|my_center|LOCUS_24430 16290 15868 gene locus_tag LOCUS_24440 gene algQ 16290 15868 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_24440 17129 16578 gene locus_tag LOCUS_24450 gene dsbB1 17129 16578 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_24450 18468 17221 gene locus_tag LOCUS_24460 18468 17221 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_24460 19598 18465 gene locus_tag LOCUS_24470 19598 18465 CDS product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103003.1 protein_id gnl|my_center|LOCUS_24470 20378 19611 gene locus_tag LOCUS_24480 gene hemD 20378 19611 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_24480 21313 20375 gene locus_tag LOCUS_24490 gene hemC 21313 20375 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_24490 22153 21407 gene locus_tag LOCUS_24500 22153 21407 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_24500 23232 22150 gene locus_tag LOCUS_24510 gene algZ 23232 22150 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_24510 23476 24870 gene locus_tag LOCUS_24520 gene argH 23476 24870 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_24520 24933 25394 gene locus_tag LOCUS_24530 24933 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082771.1 protein_id gnl|my_center|LOCUS_24530 25587 26066 gene locus_tag LOCUS_24540 25587 26066 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_24540 26138 26890 gene locus_tag LOCUS_24550 26138 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 26917 27201 gene locus_tag LOCUS_24560 26917 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266241.1 protein_id gnl|my_center|LOCUS_24560 27369 28106 gene locus_tag LOCUS_24570 27369 28106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 28103 28357 gene locus_tag LOCUS_24580 28103 28357 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_24580 28477 31335 gene locus_tag LOCUS_24590 gene cyaA 28477 31335 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_24590 32132 31332 gene locus_tag LOCUS_24600 32132 31332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 32598 32191 gene locus_tag LOCUS_24610 gene rnk 32598 32191 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096424.1 protein_id gnl|my_center|LOCUS_24610 32915 32718 gene locus_tag LOCUS_24620 32915 32718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 33237 32905 gene locus_tag LOCUS_24630 gene cyaY 33237 32905 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B06 protein_id gnl|my_center|LOCUS_24630 34343 33306 gene locus_tag LOCUS_24640 34343 33306 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_24640 34411 34650 gene locus_tag LOCUS_24650 34411 34650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 34664 35911 gene locus_tag LOCUS_24660 gene lysA 34664 35911 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_24660 35922 36752 gene locus_tag LOCUS_24670 gene dapF 35922 36752 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B09 protein_id gnl|my_center|LOCUS_24670 36749 37447 gene locus_tag LOCUS_24680 36749 37447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_24680 37742 38644 gene locus_tag LOCUS_24690 gene xerC 37742 38644 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51566 protein_id gnl|my_center|LOCUS_24690 38641 39342 gene locus_tag LOCUS_24700 38641 39342 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_24700 39859 39536 gene locus_tag LOCUS_24710 39859 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 40362 39937 gene locus_tag LOCUS_24720 40362 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096441.1 protein_id gnl|my_center|LOCUS_24720 41711 40461 gene locus_tag LOCUS_24730 41711 40461 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_24730 42380 42042 gene locus_tag LOCUS_24740 gene glnK 42380 42042 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_24740 42791 43048 gene locus_tag LOCUS_24750 42791 43048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768515.1 protein_id gnl|my_center|LOCUS_24750 43332 44825 gene locus_tag LOCUS_24760 43332 44825 CDS product magnesium chelatase subunit ChlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413980.1 protein_id gnl|my_center|LOCUS_24760 46803 44827 gene locus_tag LOCUS_24770 46803 44827 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769504.1 protein_id gnl|my_center|LOCUS_24770 48038 47118 gene locus_tag LOCUS_24780 48038 47118 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098255.1 protein_id gnl|my_center|LOCUS_24780 48178 49563 gene locus_tag LOCUS_24790 gene norM 48178 49563 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA2 protein_id gnl|my_center|LOCUS_24790 51290 49623 gene locus_tag LOCUS_24800 51290 49623 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121292.1 protein_id gnl|my_center|LOCUS_24800 51595 53571 gene locus_tag LOCUS_24810 gene rep 51595 53571 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500M3 protein_id gnl|my_center|LOCUS_24810 53772 54254 gene locus_tag LOCUS_24820 53772 54254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 54422 54994 gene locus_tag LOCUS_24830 gene xpt 54422 54994 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ6 protein_id gnl|my_center|LOCUS_24830 57151 55019 gene locus_tag LOCUS_24840 57151 55019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 57699 57277 gene locus_tag LOCUS_24850 gene cycB 57699 57277 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_24850 58361 57813 gene locus_tag LOCUS_24860 58361 57813 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_24860 59553 58465 gene locus_tag LOCUS_24870 gene dadX 59553 58465 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BB4 protein_id gnl|my_center|LOCUS_24870 60154 59807 gene locus_tag LOCUS_24880 60154 59807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_24880 61492 60194 gene locus_tag LOCUS_24890 gene dadA 61492 60194 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW4 protein_id gnl|my_center|LOCUS_24890 61649 62137 gene locus_tag LOCUS_24900 gene lrp 61649 62137 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_24900 62694 62341 gene locus_tag LOCUS_24910 62694 62341 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098616.1 protein_id gnl|my_center|LOCUS_24910 62907 64220 gene locus_tag LOCUS_24920 62907 64220 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_24920 65391 64234 gene locus_tag LOCUS_24930 65391 64234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114355.1 protein_id gnl|my_center|LOCUS_24930 67432 65939 gene locus_tag LOCUS_24940 67432 65939 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_24940 67686 68045 gene locus_tag LOCUS_24950 67686 68045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096551.1 protein_id gnl|my_center|LOCUS_24950 69754 68474 gene locus_tag LOCUS_24960 gene davT 69754 68474 CDS product 5-aminovalerate aminotransferase DavT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M4 protein_id gnl|my_center|LOCUS_24960 71462 70011 gene locus_tag LOCUS_24970 gene davD 71462 70011 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_24970 71809 71885 gene locus_tag LOCUS_t00280 71809 71885 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 75013 71963 gene locus_tag LOCUS_24980 75013 71963 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_24980 76218 75019 gene locus_tag LOCUS_24990 76218 75019 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 protein_id gnl|my_center|LOCUS_24990 77738 76215 gene locus_tag LOCUS_25000 77738 76215 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_25000 78771 77731 gene locus_tag LOCUS_25010 78771 77731 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_25010 80267 78768 gene locus_tag LOCUS_25020 gene hsdM 80267 78768 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_25020 81873 80443 gene locus_tag LOCUS_25030 81873 80443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 81974 82744 gene locus_tag LOCUS_25040 81974 82744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 protein_id gnl|my_center|LOCUS_25040 84094 82793 gene locus_tag LOCUS_25050 84094 82793 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267448.1 protein_id gnl|my_center|LOCUS_25050 85783 84200 gene locus_tag LOCUS_25060 85783 84200 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 protein_id gnl|my_center|LOCUS_25060 87002 86001 gene locus_tag LOCUS_25070 87002 86001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111007.1 protein_id gnl|my_center|LOCUS_25070 87136 88080 gene locus_tag LOCUS_25080 87136 88080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 protein_id gnl|my_center|LOCUS_25080 89228 88089 gene locus_tag LOCUS_25090 gene gbd 89228 88089 CDS product NAD-dependent 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039242.1 protein_id gnl|my_center|LOCUS_25090 89391 90323 gene locus_tag LOCUS_25100 89391 90323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 protein_id gnl|my_center|LOCUS_25100 91688 90507 gene locus_tag LOCUS_25110 91688 90507 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206835.1 protein_id gnl|my_center|LOCUS_25110 91847 92803 gene locus_tag LOCUS_25120 91847 92803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 92959 93942 gene locus_tag LOCUS_25130 92959 93942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_25130 94012 94461 gene locus_tag LOCUS_25140 94012 94461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 94472 96007 gene locus_tag LOCUS_25150 94472 96007 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_25150 96004 97050 gene locus_tag LOCUS_25160 96004 97050 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927167.1 protein_id gnl|my_center|LOCUS_25160 98630 97425 gene locus_tag LOCUS_25170 gene lldA 98630 97425 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930497.1 protein_id gnl|my_center|LOCUS_25170 99529 98681 gene locus_tag LOCUS_25180 99529 98681 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389975.1 protein_id gnl|my_center|LOCUS_25180 100446 99526 gene locus_tag LOCUS_25190 100446 99526 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530537.1 protein_id gnl|my_center|LOCUS_25190 101531 100509 gene locus_tag LOCUS_25200 101531 100509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_25200 102906 101626 gene locus_tag LOCUS_25210 102906 101626 CDS product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809707.1 protein_id gnl|my_center|LOCUS_25210 103478 102975 gene locus_tag LOCUS_25220 103478 102975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706104.1 protein_id gnl|my_center|LOCUS_25220 103707 105242 gene locus_tag LOCUS_25230 gene garD 103707 105242 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_25230 106373 105393 gene locus_tag LOCUS_25240 106373 105393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268751.1 protein_id gnl|my_center|LOCUS_25240 106773 106537 gene locus_tag LOCUS_25250 106773 106537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 107566 106793 gene locus_tag LOCUS_25260 gene glcC 107566 106793 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_25260 107806 109305 gene locus_tag LOCUS_25270 107806 109305 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_25270 109305 110360 gene locus_tag LOCUS_25280 gene glcE 109305 110360 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268366.1 protein_id gnl|my_center|LOCUS_25280 110364 111581 gene locus_tag LOCUS_25290 110364 111581 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR57 protein_id gnl|my_center|LOCUS_25290 111671 112069 gene locus_tag LOCUS_25300 111671 112069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098332.1 protein_id gnl|my_center|LOCUS_25300 112369 114546 gene locus_tag LOCUS_25310 gene glcB 112369 114546 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA82 protein_id gnl|my_center|LOCUS_25310 114850 116550 gene locus_tag LOCUS_25320 114850 116550 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_25320 116690 116857 gene locus_tag LOCUS_25330 116690 116857 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 protein_id gnl|my_center|LOCUS_25330 117155 117442 gene locus_tag LOCUS_25340 117155 117442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 118814 117918 gene locus_tag LOCUS_25350 118814 117918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_25350 120013 119105 gene locus_tag LOCUS_25360 120013 119105 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 protein_id gnl|my_center|LOCUS_25360 120877 120149 gene locus_tag LOCUS_25370 gene phoU 120877 120149 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_25370 121873 121040 gene locus_tag LOCUS_25380 gene pstB 121873 121040 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_25380 123610 121940 gene locus_tag LOCUS_25390 123610 121940 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U30 protein_id gnl|my_center|LOCUS_25390 126164 123777 gene locus_tag LOCUS_25400 126164 123777 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_25400 127196 126228 gene locus_tag LOCUS_25410 gene pstS 127196 126228 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_25410 >Feature sequence13 1517 216 gene locus_tag LOCUS_25420 1517 216 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 protein_id gnl|my_center|LOCUS_25420 2379 1558 gene locus_tag LOCUS_25430 2379 1558 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526776.1 protein_id gnl|my_center|LOCUS_25430 2559 3296 gene locus_tag LOCUS_25440 2559 3296 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088392.1 protein_id gnl|my_center|LOCUS_25440 4678 3368 gene locus_tag LOCUS_25450 4678 3368 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222940.1 protein_id gnl|my_center|LOCUS_25450 4825 5031 gene locus_tag LOCUS_25460 4825 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25460 5654 5124 gene locus_tag LOCUS_25470 5654 5124 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_25470 5850 6113 gene locus_tag LOCUS_25480 5850 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 7591 6146 gene locus_tag LOCUS_25490 7591 6146 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 protein_id gnl|my_center|LOCUS_25490 7743 8099 gene locus_tag LOCUS_25500 gene arsR 7743 8099 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_25500 8109 9392 gene locus_tag LOCUS_25510 gene arsB 8109 9392 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1J6 protein_id gnl|my_center|LOCUS_25510 9407 9877 gene locus_tag LOCUS_25520 gene arsC 9407 9877 CDS product low molecular weight phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_25520 9888 10577 gene locus_tag LOCUS_25530 9888 10577 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113752.1 protein_id gnl|my_center|LOCUS_25530 11908 10952 gene locus_tag LOCUS_25540 gene cyoE 11908 10952 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCB5 protein_id gnl|my_center|LOCUS_25540 12243 11908 gene locus_tag LOCUS_25550 gene cyoD 12243 11908 CDS product cytochrome bo(3) ubiquinol oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I424 protein_id gnl|my_center|LOCUS_25550 12869 12243 gene locus_tag LOCUS_25560 12869 12243 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_25560 14860 12872 gene locus_tag LOCUS_25570 gene cyoB 14860 12872 CDS product cytochrome bo(3) ubiquinol oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I426 protein_id gnl|my_center|LOCUS_25570 15780 14863 gene locus_tag LOCUS_25580 gene cyoA 15780 14863 CDS product cytochrome bo(3) ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I427 protein_id gnl|my_center|LOCUS_25580 17218 16643 gene locus_tag LOCUS_25590 17218 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_25590 17478 17215 gene locus_tag LOCUS_25600 17478 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 21586 17543 gene locus_tag LOCUS_25610 21586 17543 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_25610 22947 21775 gene locus_tag LOCUS_25620 22947 21775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366882.1 protein_id gnl|my_center|LOCUS_25620 23069 23935 gene locus_tag LOCUS_25630 23069 23935 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 protein_id gnl|my_center|LOCUS_25630 24071 24241 gene locus_tag LOCUS_25640 24071 24241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 24241 24666 gene locus_tag LOCUS_25650 24241 24666 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351248.1 protein_id gnl|my_center|LOCUS_25650 25227 24793 gene locus_tag LOCUS_25660 25227 24793 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192716.1 protein_id gnl|my_center|LOCUS_25660 25382 26284 gene locus_tag LOCUS_25670 25382 26284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 26559 26359 gene locus_tag LOCUS_25680 26559 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 28479 26791 gene locus_tag LOCUS_25690 gene fadD1 28479 26791 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_25690 30559 28871 gene locus_tag LOCUS_25700 gene fadD2 30559 28871 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_25700 30792 31742 gene locus_tag LOCUS_25710 30792 31742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_25710 31739 32212 gene locus_tag LOCUS_25720 31739 32212 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402365.1 protein_id gnl|my_center|LOCUS_25720 32202 32420 gene locus_tag LOCUS_25730 32202 32420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 32563 34095 gene locus_tag LOCUS_25740 32563 34095 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_25740 34447 35718 gene locus_tag LOCUS_25750 gene codB 34447 35718 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205458.1 protein_id gnl|my_center|LOCUS_25750 35715 36938 gene locus_tag LOCUS_25760 35715 36938 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528031.1 protein_id gnl|my_center|LOCUS_25760 36950 38185 gene locus_tag LOCUS_25770 gene codA 36950 38185 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 protein_id gnl|my_center|LOCUS_25770 39381 38530 gene locus_tag LOCUS_25780 39381 38530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091654.1 protein_id gnl|my_center|LOCUS_25780 39595 39392 gene locus_tag LOCUS_25790 39595 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719765.1 protein_id gnl|my_center|LOCUS_25790 41755 39743 gene locus_tag LOCUS_25800 41755 39743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_25800 42429 42268 gene locus_tag LOCUS_25810 42429 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268687.1 protein_id gnl|my_center|LOCUS_25810 43025 42426 gene locus_tag LOCUS_25820 43025 42426 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_25820 43476 43183 gene locus_tag LOCUS_25830 43476 43183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091664.1 protein_id gnl|my_center|LOCUS_25830 43643 46486 gene locus_tag LOCUS_25840 gene rapA 43643 46486 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPQ0 protein_id gnl|my_center|LOCUS_25840 47869 46637 gene locus_tag LOCUS_25850 47869 46637 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_25850 48023 48661 gene locus_tag LOCUS_25860 48023 48661 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_25860 48938 49636 gene locus_tag LOCUS_25870 gene cmoA 48938 49636 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G3 protein_id gnl|my_center|LOCUS_25870 49633 50601 gene locus_tag LOCUS_25880 gene cmoB 49633 50601 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G4 protein_id gnl|my_center|LOCUS_25880 50926 50666 gene locus_tag LOCUS_25890 50926 50666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 51043 51927 gene locus_tag LOCUS_25900 51043 51927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_25900 52749 52003 gene locus_tag LOCUS_25910 gene pdxJ 52749 52003 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG4 protein_id gnl|my_center|LOCUS_25910 53431 52742 gene locus_tag LOCUS_25920 gene recO 53431 52742 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_25920 54388 53489 gene locus_tag LOCUS_25930 gene era 54388 53489 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_25930 55070 54381 gene locus_tag LOCUS_25940 gene rnc 55070 54381 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE1 protein_id gnl|my_center|LOCUS_25940 55444 55067 gene locus_tag LOCUS_25950 55444 55067 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 protein_id gnl|my_center|LOCUS_25950 56387 55533 gene locus_tag LOCUS_25960 gene lepB 56387 55533 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_25960 58193 56394 gene locus_tag LOCUS_25970 gene lepA 58193 56394 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD8 protein_id gnl|my_center|LOCUS_25970 59767 58343 gene locus_tag LOCUS_25980 59767 58343 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_25980 60258 59803 gene locus_tag LOCUS_25990 gene mucC 60258 59803 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_25990 61202 60255 gene locus_tag LOCUS_26000 gene mucB 61202 60255 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_26000 61790 61218 gene locus_tag LOCUS_26010 gene mucA 61790 61218 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246812.1 protein_id gnl|my_center|LOCUS_26010 62402 61821 gene locus_tag LOCUS_26020 62402 61821 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_26020 62769 64400 gene locus_tag LOCUS_26030 62769 64400 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD3 protein_id gnl|my_center|LOCUS_26030 64821 64354 gene locus_tag LOCUS_26040 64821 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104913.1 protein_id gnl|my_center|LOCUS_26040 65059 64805 gene locus_tag LOCUS_26050 65059 64805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_26050 65205 66146 gene locus_tag LOCUS_26060 65205 66146 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD0 protein_id gnl|my_center|LOCUS_26060 66193 67029 gene locus_tag LOCUS_26070 66193 67029 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_26070 67169 67924 gene locus_tag LOCUS_26080 67169 67924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_26080 69304 67907 gene locus_tag LOCUS_26090 69304 67907 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_26090 69993 69301 gene locus_tag LOCUS_26100 69993 69301 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085524.1 protein_id gnl|my_center|LOCUS_26100 70242 71507 gene locus_tag LOCUS_26110 gene opdH 70242 71507 CDS product cis-aconitate porin Opd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 protein_id gnl|my_center|LOCUS_26110 71537 72517 gene locus_tag LOCUS_26120 71537 72517 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764747.1 protein_id gnl|my_center|LOCUS_26120 72609 73052 gene locus_tag LOCUS_26130 72609 73052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114175.1 protein_id gnl|my_center|LOCUS_26130 73054 74574 gene locus_tag LOCUS_26140 73054 74574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_26140 74558 75580 gene locus_tag LOCUS_26150 74558 75580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 protein_id gnl|my_center|LOCUS_26150 76643 75798 gene locus_tag LOCUS_26160 76643 75798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_26160 77270 76875 gene locus_tag LOCUS_26170 77270 76875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 77151 77606 gene locus_tag LOCUS_26180 77151 77606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 77709 79322 gene locus_tag LOCUS_26190 77709 79322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_26190 80244 79729 gene locus_tag LOCUS_26200 80244 79729 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082093.1 protein_id gnl|my_center|LOCUS_26200 80681 80343 gene locus_tag LOCUS_26210 80681 80343 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_26210 80963 80694 gene locus_tag LOCUS_26220 80963 80694 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_26220 81445 80948 gene locus_tag LOCUS_26230 81445 80948 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_26230 82953 81442 gene locus_tag LOCUS_26240 82953 81442 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_26240 83279 82950 gene locus_tag LOCUS_26250 83279 82950 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_26250 86073 83281 gene locus_tag LOCUS_26260 86073 83281 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_26260 86895 86434 gene locus_tag LOCUS_26270 86895 86434 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_26270 88143 87010 gene locus_tag LOCUS_26280 88143 87010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_26280 89565 88198 gene locus_tag LOCUS_26290 89565 88198 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_26290 90881 89751 gene locus_tag LOCUS_26300 90881 89751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112517.1 protein_id gnl|my_center|LOCUS_26300 91660 91142 gene locus_tag LOCUS_26310 91660 91142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099002.1 protein_id gnl|my_center|LOCUS_26310 91963 92259 gene locus_tag LOCUS_26320 91963 92259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 92800 92495 gene locus_tag LOCUS_26330 gene arsR 92800 92495 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_26330 94017 92893 gene locus_tag LOCUS_26340 94017 92893 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_26340 95094 94447 gene locus_tag LOCUS_26350 gene pdxH 95094 94447 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_26350 95829 95176 gene locus_tag LOCUS_26360 95829 95176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 97201 96056 gene locus_tag LOCUS_26370 97201 96056 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 protein_id gnl|my_center|LOCUS_26370 97422 100142 gene locus_tag LOCUS_26380 97422 100142 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974809.1 protein_id gnl|my_center|LOCUS_26380 100142 100546 gene locus_tag LOCUS_26390 100142 100546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 100543 102039 gene locus_tag LOCUS_26400 100543 102039 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_26400 102039 102536 gene locus_tag LOCUS_26410 102039 102536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 102533 102844 gene locus_tag LOCUS_26420 102533 102844 CDS product pesticidal protein Cry22Aa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404442.1 protein_id gnl|my_center|LOCUS_26420 102841 103182 gene locus_tag LOCUS_26430 102841 103182 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974815.1 protein_id gnl|my_center|LOCUS_26430 105332 103188 gene locus_tag LOCUS_26440 gene dinG 105332 103188 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_26440 105473 105937 gene locus_tag LOCUS_26450 105473 105937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_26450 106739 105978 gene locus_tag LOCUS_26460 106739 105978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268703.1 protein_id gnl|my_center|LOCUS_26460 107037 106732 gene locus_tag LOCUS_26470 107037 106732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082018.1 protein_id gnl|my_center|LOCUS_26470 107931 107197 gene locus_tag LOCUS_26480 107931 107197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082015.1 protein_id gnl|my_center|LOCUS_26480 108536 108075 gene locus_tag LOCUS_26490 108536 108075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 108868 109365 gene locus_tag LOCUS_26500 108868 109365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381502.1 protein_id gnl|my_center|LOCUS_26500 109370 109852 gene locus_tag LOCUS_26510 109370 109852 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPM9 protein_id gnl|my_center|LOCUS_26510 109920 111086 gene locus_tag LOCUS_26520 109920 111086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 111656 111102 gene locus_tag LOCUS_26530 111656 111102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_26530 111936 112346 gene locus_tag LOCUS_26540 111936 112346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_26540 112364 112558 gene locus_tag LOCUS_26550 112364 112558 CDS product zinc chelation protein SecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402305.1 protein_id gnl|my_center|LOCUS_26550 112566 113030 gene locus_tag LOCUS_26560 112566 113030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 113131 115644 gene locus_tag LOCUS_26570 gene quiP 113131 115644 CDS product acyl-homoserine lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U2 protein_id gnl|my_center|LOCUS_26570 >Feature sequence14 92 364 gene locus_tag LOCUS_26580 gene rpsQ 92 364 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ3 protein_id gnl|my_center|LOCUS_26580 388 756 gene locus_tag LOCUS_26590 gene rplN 388 756 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ4 protein_id gnl|my_center|LOCUS_26590 768 1082 gene locus_tag LOCUS_26600 gene rplX 768 1082 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_26600 1102 1641 gene locus_tag LOCUS_26610 gene rplE 1102 1641 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V9 protein_id gnl|my_center|LOCUS_26610 1656 1961 gene locus_tag LOCUS_26620 gene rpsN 1656 1961 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_26620 2156 2548 gene locus_tag LOCUS_26630 gene rpsH 2156 2548 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ8 protein_id gnl|my_center|LOCUS_26630 2562 3095 gene locus_tag LOCUS_26640 gene rplF 2562 3095 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_26640 3107 3457 gene locus_tag LOCUS_26650 gene rplR 3107 3457 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR0 protein_id gnl|my_center|LOCUS_26650 3461 3961 gene locus_tag LOCUS_26660 gene rpsE 3461 3961 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_26660 3964 4143 gene locus_tag LOCUS_26670 gene rpmD 3964 4143 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF3 protein_id gnl|my_center|LOCUS_26670 4146 4577 gene locus_tag LOCUS_26680 gene rplO 4146 4577 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF4 protein_id gnl|my_center|LOCUS_26680 4578 5906 gene locus_tag LOCUS_26690 gene secY 4578 5906 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_26690 6185 6541 gene locus_tag LOCUS_26700 gene rpsM 6185 6541 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR5 protein_id gnl|my_center|LOCUS_26700 6572 6961 gene locus_tag LOCUS_26710 gene rpsK 6572 6961 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_26710 6979 7599 gene locus_tag LOCUS_26720 gene rpsD 6979 7599 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR7 protein_id gnl|my_center|LOCUS_26720 7622 8623 gene locus_tag LOCUS_26730 gene rpoA 7622 8623 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR8 protein_id gnl|my_center|LOCUS_26730 8668 9054 gene locus_tag LOCUS_26740 gene rplQ 8668 9054 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR9 protein_id gnl|my_center|LOCUS_26740 9303 11453 gene locus_tag LOCUS_26750 gene katG 9303 11453 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G105 protein_id gnl|my_center|LOCUS_26750 11589 12053 gene locus_tag LOCUS_26760 gene bfr 11589 12053 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF9 protein_id gnl|my_center|LOCUS_26760 14934 12100 gene locus_tag LOCUS_26770 gene uvrA 14934 12100 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_26770 15070 16464 gene locus_tag LOCUS_26780 15070 16464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_26780 16474 16965 gene locus_tag LOCUS_26790 16474 16965 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMS4 protein_id gnl|my_center|LOCUS_26790 16991 17869 gene locus_tag LOCUS_26800 16991 17869 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103231.1 protein_id gnl|my_center|LOCUS_26800 17862 18785 gene locus_tag LOCUS_26810 17862 18785 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_26810 19533 18841 gene locus_tag LOCUS_26820 19533 18841 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_26820 19726 20499 gene locus_tag LOCUS_26830 19726 20499 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_26830 20496 21845 gene locus_tag LOCUS_26840 gene ttpC 20496 21845 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_26840 21838 22386 gene locus_tag LOCUS_26850 21838 22386 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_26850 22398 22808 gene locus_tag LOCUS_26860 22398 22808 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_26860 22808 23491 gene locus_tag LOCUS_26870 22808 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 23494 24591 gene locus_tag LOCUS_26880 23494 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 25241 24720 gene locus_tag LOCUS_26890 25241 24720 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412093.1 protein_id gnl|my_center|LOCUS_26890 26559 25294 gene locus_tag LOCUS_26900 26559 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_26900 27268 26561 gene locus_tag LOCUS_26910 27268 26561 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_26910 28072 27488 gene locus_tag LOCUS_26920 28072 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_26920 28186 28527 gene locus_tag LOCUS_26930 28186 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269049.1 protein_id gnl|my_center|LOCUS_26930 29659 28787 gene locus_tag LOCUS_26940 29659 28787 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_26940 30374 29715 gene locus_tag LOCUS_26950 30374 29715 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269047.1 protein_id gnl|my_center|LOCUS_26950 30811 30371 gene locus_tag LOCUS_26960 30811 30371 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419544.1 protein_id gnl|my_center|LOCUS_26960 30912 31424 gene locus_tag LOCUS_26970 gene nrdR 30912 31424 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_26970 31421 32536 gene locus_tag LOCUS_26980 gene ribD 31421 32536 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_26980 32902 32750 gene locus_tag LOCUS_26990 32902 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 32977 33639 gene locus_tag LOCUS_27000 32977 33639 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_27000 33652 34731 gene locus_tag LOCUS_27010 gene ribB 33652 34731 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY2 protein_id gnl|my_center|LOCUS_27010 34945 35421 gene locus_tag LOCUS_27020 gene ribH 34945 35421 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_27020 35418 35897 gene locus_tag LOCUS_27030 gene nusB 35418 35897 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_27030 35988 36941 gene locus_tag LOCUS_27040 gene thiL 35988 36941 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY5 protein_id gnl|my_center|LOCUS_27040 36957 37484 gene locus_tag LOCUS_27050 gene pgpA 36957 37484 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX8 protein_id gnl|my_center|LOCUS_27050 37499 38227 gene locus_tag LOCUS_27060 37499 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 protein_id gnl|my_center|LOCUS_27060 38246 38890 gene locus_tag LOCUS_27070 38246 38890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_27070 38963 39622 gene locus_tag LOCUS_27080 gene ribA 38963 39622 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY6 protein_id gnl|my_center|LOCUS_27080 39619 40032 gene locus_tag LOCUS_27090 39619 40032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769026.1 protein_id gnl|my_center|LOCUS_27090 40032 40826 gene locus_tag LOCUS_27100 40032 40826 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102817.1 protein_id gnl|my_center|LOCUS_27100 42771 40864 gene locus_tag LOCUS_27110 42771 40864 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_27110 45469 43241 gene locus_tag LOCUS_27120 45469 43241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 47477 45582 gene locus_tag LOCUS_27130 gene dxs 47477 45582 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_27130 48510 47560 gene locus_tag LOCUS_27140 48510 47560 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731041.1 protein_id gnl|my_center|LOCUS_27140 51964 48692 gene locus_tag LOCUS_27150 51964 48692 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_27150 53001 52114 gene locus_tag LOCUS_27160 gene ispA 53001 52114 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_27160 53327 52998 gene locus_tag LOCUS_27170 53327 52998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 54292 53522 gene locus_tag LOCUS_27180 54292 53522 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG0 protein_id gnl|my_center|LOCUS_27180 54439 55371 gene locus_tag LOCUS_27190 gene pcaQ 54439 55371 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 protein_id gnl|my_center|LOCUS_27190 55488 56207 gene locus_tag LOCUS_27200 55488 56207 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 protein_id gnl|my_center|LOCUS_27200 56220 56828 gene locus_tag LOCUS_27210 gene pcaG 56220 56828 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_27210 56830 57840 gene locus_tag LOCUS_27220 56830 57840 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 protein_id gnl|my_center|LOCUS_27220 57834 58781 gene locus_tag LOCUS_27230 57834 58781 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_27230 58944 59789 gene locus_tag LOCUS_27240 58944 59789 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363842.1 protein_id gnl|my_center|LOCUS_27240 60138 61094 gene locus_tag LOCUS_27250 gene xylS 60138 61094 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_27250 61369 62736 gene locus_tag LOCUS_27260 gene xylX 61369 62736 CDS product toluate 1,2-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113315.1 protein_id gnl|my_center|LOCUS_27260 62737 63225 gene locus_tag LOCUS_27270 gene xylY 62737 63225 CDS product toluate 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113314.1 protein_id gnl|my_center|LOCUS_27270 63308 64318 gene locus_tag LOCUS_27280 gene xylZ 63308 64318 CDS product toluate 1,2-dioxygenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_27280 64529 65293 gene locus_tag LOCUS_27290 gene xylL 64529 65293 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_27290 65411 66751 gene locus_tag LOCUS_27300 gene benK 65411 66751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_27300 66787 67908 gene locus_tag LOCUS_27310 gene catB 66787 67908 CDS product muconate cycloisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_27310 67925 68215 gene locus_tag LOCUS_27320 gene catC 67925 68215 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0X4 protein_id gnl|my_center|LOCUS_27320 68246 69187 gene locus_tag LOCUS_27330 gene catA 68246 69187 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_27330 69309 70517 gene locus_tag LOCUS_27340 69309 70517 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_27340 70602 71882 gene locus_tag LOCUS_27350 70602 71882 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115516.1 protein_id gnl|my_center|LOCUS_27350 71935 72804 gene locus_tag LOCUS_27360 71935 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 72932 73780 gene locus_tag LOCUS_27370 72932 73780 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_27370 73780 74577 gene locus_tag LOCUS_27380 73780 74577 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_27380 74574 75779 gene locus_tag LOCUS_27390 gene pcaF 74574 75779 CDS product beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6R0 protein_id gnl|my_center|LOCUS_27390 76104 77456 gene locus_tag LOCUS_27400 gene pcaB 76104 77456 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 protein_id gnl|my_center|LOCUS_27400 77466 78254 gene locus_tag LOCUS_27410 gene pcaD 77466 78254 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_27410 78359 78754 gene locus_tag LOCUS_27420 78359 78754 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315610.1 protein_id gnl|my_center|LOCUS_27420 80530 78836 gene locus_tag LOCUS_27430 gene pslM 80530 78836 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 protein_id gnl|my_center|LOCUS_27430 82712 80778 gene locus_tag LOCUS_27440 82712 80778 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115040.1 protein_id gnl|my_center|LOCUS_27440 84094 82820 gene locus_tag LOCUS_27450 84094 82820 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267448.1 protein_id gnl|my_center|LOCUS_27450 85546 84224 gene locus_tag LOCUS_27460 85546 84224 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_27460 86073 85543 gene locus_tag LOCUS_27470 86073 85543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 87184 86132 gene locus_tag LOCUS_27480 87184 86132 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_27480 88581 87391 gene locus_tag LOCUS_27490 88581 87391 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 protein_id gnl|my_center|LOCUS_27490 88713 89582 gene locus_tag LOCUS_27500 gene pobR 88713 89582 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244403.1 protein_id gnl|my_center|LOCUS_27500 90637 89636 gene locus_tag LOCUS_27510 90637 89636 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814174.1 protein_id gnl|my_center|LOCUS_27510 92221 90707 gene locus_tag LOCUS_27520 92221 90707 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_27520 92704 92234 gene locus_tag LOCUS_27530 92704 92234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 93259 94035 gene locus_tag LOCUS_27540 93259 94035 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 protein_id gnl|my_center|LOCUS_27540 94527 95576 gene locus_tag LOCUS_27550 94527 95576 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_27550 95590 96405 gene locus_tag LOCUS_27560 95590 96405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_27560 96503 97420 gene locus_tag LOCUS_27570 96503 97420 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267449.1 protein_id gnl|my_center|LOCUS_27570 97609 99516 gene locus_tag LOCUS_27580 97609 99516 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267451.1 protein_id gnl|my_center|LOCUS_27580 99615 100286 gene locus_tag LOCUS_27590 99615 100286 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416207.1 protein_id gnl|my_center|LOCUS_27590 101341 100340 gene locus_tag LOCUS_27600 101341 100340 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_27600 103193 101436 gene locus_tag LOCUS_27610 103193 101436 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086439.1 protein_id gnl|my_center|LOCUS_27610 103580 103260 gene locus_tag LOCUS_27620 103580 103260 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521451.1 protein_id gnl|my_center|LOCUS_27620 105326 103584 gene locus_tag LOCUS_27630 105326 103584 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089544.1 protein_id gnl|my_center|LOCUS_27630 106185 105337 gene locus_tag LOCUS_27640 106185 105337 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086639.1 protein_id gnl|my_center|LOCUS_27640 106291 107061 gene locus_tag LOCUS_27650 gene pcaR 106291 107061 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385634.1 protein_id gnl|my_center|LOCUS_27650 107961 107107 gene locus_tag LOCUS_27660 gene aroE 107961 107107 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6P4 protein_id gnl|my_center|LOCUS_27660 108406 107966 gene locus_tag LOCUS_27670 gene aroQ2 108406 107966 CDS product 3-dehydroquinate dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6P3 protein_id gnl|my_center|LOCUS_27670 109367 110296 gene locus_tag LOCUS_27680 109367 110296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence15 154 849 gene locus_tag LOCUS_27690 154 849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 protein_id gnl|my_center|LOCUS_27690 846 1535 gene locus_tag LOCUS_27700 846 1535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_27700 1588 2802 gene locus_tag LOCUS_27710 1588 2802 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105444.1 protein_id gnl|my_center|LOCUS_27710 3097 3172 gene locus_tag LOCUS_t00290 3097 3172 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3306 4367 gene locus_tag LOCUS_27720 3306 4367 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLL0 protein_id gnl|my_center|LOCUS_27720 4455 5327 gene locus_tag LOCUS_27730 gene rfbA 4455 5327 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E7 protein_id gnl|my_center|LOCUS_27730 5324 5872 gene locus_tag LOCUS_27740 gene rfbC-2 5324 5872 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_27740 5869 6732 gene locus_tag LOCUS_27750 gene rfbD 5869 6732 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807150.1 protein_id gnl|my_center|LOCUS_27750 6823 8637 gene locus_tag LOCUS_27760 6823 8637 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269322.1 protein_id gnl|my_center|LOCUS_27760 8634 10019 gene locus_tag LOCUS_27770 8634 10019 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246574.1 protein_id gnl|my_center|LOCUS_27770 10326 11315 gene locus_tag LOCUS_27780 gene dctP 10326 11315 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_27780 11456 12085 gene locus_tag LOCUS_27790 gene dctQ 11456 12085 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU17 protein_id gnl|my_center|LOCUS_27790 12082 13362 gene locus_tag LOCUS_27800 gene dctM 12082 13362 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_27800 13558 14229 gene locus_tag LOCUS_27810 13558 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_27810 14693 14226 gene locus_tag LOCUS_27820 14693 14226 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100361.1 protein_id gnl|my_center|LOCUS_27820 14821 15147 gene locus_tag LOCUS_27830 14821 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 15271 17055 gene locus_tag LOCUS_27840 15271 17055 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_27840 17704 17030 gene locus_tag LOCUS_27850 17704 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_27850 17870 18124 gene locus_tag LOCUS_27860 17870 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 18213 18542 gene locus_tag LOCUS_27870 18213 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096280.1 protein_id gnl|my_center|LOCUS_27870 19923 18652 gene locus_tag LOCUS_27880 19923 18652 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_27880 21321 20350 gene locus_tag LOCUS_27890 21321 20350 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266178.1 protein_id gnl|my_center|LOCUS_27890 22622 21432 gene locus_tag LOCUS_27900 gene desA 22622 21432 CDS product delta-9 fatty acid desaturase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_27900 22785 25088 gene locus_tag LOCUS_27910 22785 25088 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_27910 25091 26212 gene locus_tag LOCUS_27920 25091 26212 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_27920 26223 30074 gene locus_tag LOCUS_27930 26223 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 30071 32968 gene locus_tag LOCUS_27940 30071 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27940 32961 33347 gene locus_tag LOCUS_27950 32961 33347 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_27950 33340 35019 gene locus_tag LOCUS_27960 33340 35019 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_27960 35956 35129 gene locus_tag LOCUS_27970 35956 35129 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951362.1 protein_id gnl|my_center|LOCUS_27970 36792 35953 gene locus_tag LOCUS_27980 36792 35953 CDS product sulfate/thiosulfate transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 protein_id gnl|my_center|LOCUS_27980 38105 37089 gene locus_tag LOCUS_27990 gene cysP 38105 37089 CDS product thiosulfate transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208512.1 protein_id gnl|my_center|LOCUS_27990 38551 38423 gene locus_tag LOCUS_28000 38551 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28000 39080 38865 gene locus_tag LOCUS_28010 39080 38865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 39671 39429 gene locus_tag LOCUS_28020 39671 39429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 40118 39948 gene locus_tag LOCUS_28030 40118 39948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 40382 40176 gene locus_tag LOCUS_28040 40382 40176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 41717 40383 gene locus_tag LOCUS_28050 41717 40383 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_28050 43709 42468 gene locus_tag LOCUS_28060 43709 42468 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 protein_id gnl|my_center|LOCUS_28060 44323 44039 gene locus_tag LOCUS_28070 44323 44039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 44489 45130 gene locus_tag LOCUS_28080 44489 45130 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_28080 45313 46089 gene locus_tag LOCUS_28090 gene modA 45313 46089 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104307.1 protein_id gnl|my_center|LOCUS_28090 46169 46849 gene locus_tag LOCUS_28100 gene modB 46169 46849 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_28100 46849 47973 gene locus_tag LOCUS_28110 gene modC 46849 47973 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_28110 48927 48112 gene locus_tag LOCUS_28120 48927 48112 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266324.1 protein_id gnl|my_center|LOCUS_28120 49627 49046 gene locus_tag LOCUS_28130 49627 49046 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266323.1 protein_id gnl|my_center|LOCUS_28130 49873 50055 gene locus_tag LOCUS_28140 49873 50055 CDS product DUF2292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084246.1 protein_id gnl|my_center|LOCUS_28140 50158 51156 gene locus_tag LOCUS_28150 gene sbp 50158 51156 CDS product sulfate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_28150 51249 52067 gene locus_tag LOCUS_28160 51249 52067 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 protein_id gnl|my_center|LOCUS_28160 52078 52950 gene locus_tag LOCUS_28170 gene cysW 52078 52950 CDS product sulfate transporter CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084239.1 protein_id gnl|my_center|LOCUS_28170 52953 53945 gene locus_tag LOCUS_28180 gene cysA 52953 53945 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6L0 protein_id gnl|my_center|LOCUS_28180 54853 54161 gene locus_tag LOCUS_28190 54853 54161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112933.1 protein_id gnl|my_center|LOCUS_28190 54935 55297 gene locus_tag LOCUS_28200 54935 55297 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_28200 55290 56027 gene locus_tag LOCUS_28210 55290 56027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112932.1 protein_id gnl|my_center|LOCUS_28210 56438 56037 gene locus_tag LOCUS_28220 56438 56037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 56552 57346 gene locus_tag LOCUS_28230 56552 57346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_28230 57478 58224 gene locus_tag LOCUS_28240 57478 58224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_28240 58889 58365 gene locus_tag LOCUS_28250 58889 58365 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_28250 59013 59696 gene locus_tag LOCUS_28260 59013 59696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_28260 59758 61752 gene locus_tag LOCUS_28270 59758 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_28270 62109 61804 gene locus_tag LOCUS_28280 62109 61804 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710151.1 protein_id gnl|my_center|LOCUS_28280 63503 62190 gene locus_tag LOCUS_28290 63503 62190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114273.1 protein_id gnl|my_center|LOCUS_28290 65026 63659 gene locus_tag LOCUS_28300 65026 63659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106001.1 protein_id gnl|my_center|LOCUS_28300 65330 65148 gene locus_tag LOCUS_28310 65330 65148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 66423 65404 gene locus_tag LOCUS_28320 66423 65404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 68372 66801 gene locus_tag LOCUS_28330 68372 66801 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_28330 69821 68745 gene locus_tag LOCUS_28340 69821 68745 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_28340 70831 69818 gene locus_tag LOCUS_28350 70831 69818 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 protein_id gnl|my_center|LOCUS_28350 70935 71993 gene locus_tag LOCUS_28360 70935 71993 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_28360 72166 75045 gene locus_tag LOCUS_28370 72166 75045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 76292 75033 gene locus_tag LOCUS_28380 76292 75033 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_28380 76688 76533 gene locus_tag LOCUS_28390 gene rpmG 76688 76533 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_28390 76935 76699 gene locus_tag LOCUS_28400 gene rpmB 76935 76699 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_28400 77281 78858 gene locus_tag LOCUS_28410 77281 78858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102986.1 protein_id gnl|my_center|LOCUS_28410 79647 78973 gene locus_tag LOCUS_28420 79647 78973 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_28420 79787 80995 gene locus_tag LOCUS_28430 gene coaC 79787 80995 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_28430 80998 81453 gene locus_tag LOCUS_28440 gene dut 80998 81453 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN3 protein_id gnl|my_center|LOCUS_28440 81492 84083 gene locus_tag LOCUS_28450 81492 84083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 84108 85013 gene locus_tag LOCUS_28460 gene argB 84108 85013 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_28460 85231 85677 gene locus_tag LOCUS_28470 85231 85677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_28470 86291 85689 gene locus_tag LOCUS_28480 86291 85689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_28480 86953 86312 gene locus_tag LOCUS_28490 gene pyrE 86953 86312 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_28490 87034 87813 gene locus_tag LOCUS_28500 gene crc 87034 87813 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_28500 88244 87873 gene locus_tag LOCUS_28510 88244 87873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_28510 88992 88273 gene locus_tag LOCUS_28520 gene rph 88992 88273 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY6 protein_id gnl|my_center|LOCUS_28520 89167 90030 gene locus_tag LOCUS_28530 89167 90030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_28530 90236 90853 gene locus_tag LOCUS_28540 gene gmk 90236 90853 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_28540 90948 91211 gene locus_tag LOCUS_28550 gene rpoZ 90948 91211 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_28550 91275 93386 gene locus_tag LOCUS_28560 gene spoT 91275 93386 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_28560 93455 93835 gene locus_tag LOCUS_28570 93455 93835 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_28570 93891 94622 gene locus_tag LOCUS_28580 93891 94622 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313983.1 protein_id gnl|my_center|LOCUS_28580 95277 94660 gene locus_tag LOCUS_28590 95277 94660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096613.1 protein_id gnl|my_center|LOCUS_28590 96216 95416 gene locus_tag LOCUS_28600 96216 95416 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114367.1 protein_id gnl|my_center|LOCUS_28600 97075 96218 gene locus_tag LOCUS_28610 97075 96218 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_28610 97174 98103 gene locus_tag LOCUS_28620 gene oxyR 97174 98103 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_28620 98112 100187 gene locus_tag LOCUS_28630 gene recG 98112 100187 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_28630 100279 101685 gene locus_tag LOCUS_28640 100279 101685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_28640 102568 101801 gene locus_tag LOCUS_28650 102568 101801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 103174 102779 gene locus_tag LOCUS_28660 103174 102779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096629.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence16 323 871 gene locus_tag LOCUS_28670 323 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1298 831 gene locus_tag LOCUS_28680 1298 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2049 1717 gene locus_tag LOCUS_28690 2049 1717 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_28690 2407 2042 gene locus_tag LOCUS_28700 2407 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_28700 2786 3994 gene locus_tag LOCUS_28710 2786 3994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402522.1 protein_id gnl|my_center|LOCUS_28710 4980 4036 gene locus_tag LOCUS_28720 4980 4036 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267095.1 protein_id gnl|my_center|LOCUS_28720 6096 5167 gene locus_tag LOCUS_28730 gene serA 6096 5167 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 protein_id gnl|my_center|LOCUS_28730 7625 6111 gene locus_tag LOCUS_28740 7625 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_28740 8080 7628 gene locus_tag LOCUS_28750 8080 7628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 protein_id gnl|my_center|LOCUS_28750 9113 8133 gene locus_tag LOCUS_28760 9113 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_28760 10357 9155 gene locus_tag LOCUS_28770 gene opdH 10357 9155 CDS product cis-aconitate porin Opd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 protein_id gnl|my_center|LOCUS_28770 11521 10445 gene locus_tag LOCUS_28780 11521 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704356.1 protein_id gnl|my_center|LOCUS_28780 11734 12666 gene locus_tag LOCUS_28790 11734 12666 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_28790 12796 14994 gene locus_tag LOCUS_28800 12796 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_28800 14997 15590 gene locus_tag LOCUS_28810 14997 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 protein_id gnl|my_center|LOCUS_28810 16528 15644 gene locus_tag LOCUS_28820 gene dhcR 16528 15644 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_28820 16652 17350 gene locus_tag LOCUS_28830 gene dhcA 16652 17350 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_28830 17362 18018 gene locus_tag LOCUS_28840 gene dhcB 17362 18018 CDS product dehydrocarnitine CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_28840 18150 19331 gene locus_tag LOCUS_28850 gene atoB 18150 19331 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A8 protein_id gnl|my_center|LOCUS_28850 19522 20865 gene locus_tag LOCUS_28860 19522 20865 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_28860 23695 21089 gene locus_tag LOCUS_28870 23695 21089 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114487.1 protein_id gnl|my_center|LOCUS_28870 25239 23866 gene locus_tag LOCUS_28880 25239 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_28880 27057 25261 gene locus_tag LOCUS_28890 27057 25261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 protein_id gnl|my_center|LOCUS_28890 28432 27416 gene locus_tag LOCUS_28900 28432 27416 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_28900 29751 28597 gene locus_tag LOCUS_28910 29751 28597 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_28910 30326 29754 gene locus_tag LOCUS_28920 30326 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268811.1 protein_id gnl|my_center|LOCUS_28920 30775 30455 gene locus_tag LOCUS_28930 30775 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 protein_id gnl|my_center|LOCUS_28930 31890 30772 gene locus_tag LOCUS_28940 31890 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_28940 32759 31974 gene locus_tag LOCUS_28950 32759 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_28950 33860 32970 gene locus_tag LOCUS_28960 33860 32970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 protein_id gnl|my_center|LOCUS_28960 34153 34884 gene locus_tag LOCUS_28970 34153 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_28970 35036 35812 gene locus_tag LOCUS_28980 35036 35812 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768622.1 protein_id gnl|my_center|LOCUS_28980 36667 35819 gene locus_tag LOCUS_28990 36667 35819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_28990 36843 39557 gene locus_tag LOCUS_29000 36843 39557 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_29000 40278 39673 gene locus_tag LOCUS_29010 40278 39673 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_29010 40381 40701 gene locus_tag LOCUS_29020 40381 40701 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093978.1 protein_id gnl|my_center|LOCUS_29020 40729 41778 gene locus_tag LOCUS_29030 40729 41778 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268815.1 protein_id gnl|my_center|LOCUS_29030 42739 41891 gene locus_tag LOCUS_29040 42739 41891 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 protein_id gnl|my_center|LOCUS_29040 43090 43362 gene locus_tag LOCUS_29050 43090 43362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719778.1 protein_id gnl|my_center|LOCUS_29050 44351 43353 gene locus_tag LOCUS_29060 44351 43353 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103823.1 protein_id gnl|my_center|LOCUS_29060 45366 44464 gene locus_tag LOCUS_29070 45366 44464 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 protein_id gnl|my_center|LOCUS_29070 45461 45874 gene locus_tag LOCUS_29080 45461 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_29080 45874 46476 gene locus_tag LOCUS_29090 45874 46476 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_29090 46670 47626 gene locus_tag LOCUS_29100 46670 47626 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895497.1 protein_id gnl|my_center|LOCUS_29100 47717 47899 gene locus_tag LOCUS_29110 47717 47899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 47985 48212 gene locus_tag LOCUS_29120 47985 48212 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740605.1 protein_id gnl|my_center|LOCUS_29120 48809 48240 gene locus_tag LOCUS_29130 48809 48240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 48906 49796 gene locus_tag LOCUS_29140 48906 49796 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039238.1 protein_id gnl|my_center|LOCUS_29140 50037 50210 gene locus_tag LOCUS_29150 50037 50210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 50360 54295 gene locus_tag LOCUS_29160 50360 54295 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VC2 protein_id gnl|my_center|LOCUS_29160 54698 56125 gene locus_tag LOCUS_29170 gene arcD 54698 56125 CDS product arginine/ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18275 protein_id gnl|my_center|LOCUS_29170 56198 57448 gene locus_tag LOCUS_29180 gene arcA 56198 57448 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13981 protein_id gnl|my_center|LOCUS_29180 57530 58540 gene locus_tag LOCUS_29190 gene arcB 57530 58540 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08308 protein_id gnl|my_center|LOCUS_29190 58651 59577 gene locus_tag LOCUS_29200 gene arcC 58651 59577 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13982 protein_id gnl|my_center|LOCUS_29200 59590 59955 gene locus_tag LOCUS_29210 59590 59955 CDS product DUF5064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082140.1 protein_id gnl|my_center|LOCUS_29210 61581 60181 gene locus_tag LOCUS_29220 gene lpd3 61581 60181 CDS product dihydrolipoyl dehydrogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUY1 protein_id gnl|my_center|LOCUS_29220 62796 61597 gene locus_tag LOCUS_29230 62796 61597 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919112.1 protein_id gnl|my_center|LOCUS_29230 62892 63461 gene locus_tag LOCUS_29240 62892 63461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_29240 63491 64057 gene locus_tag LOCUS_29250 63491 64057 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_29250 64975 64181 gene locus_tag LOCUS_29260 64975 64181 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095350.1 protein_id gnl|my_center|LOCUS_29260 65335 66141 gene locus_tag LOCUS_29270 65335 66141 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_29270 66262 67107 gene locus_tag LOCUS_29280 66262 67107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_29280 67162 67635 gene locus_tag LOCUS_29290 67162 67635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_29290 68471 67662 gene locus_tag LOCUS_29300 68471 67662 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704454.1 protein_id gnl|my_center|LOCUS_29300 68940 69281 gene locus_tag LOCUS_29310 68940 69281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_29310 70021 69317 gene locus_tag LOCUS_29320 70021 69317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251759.2 protein_id gnl|my_center|LOCUS_29320 71565 70234 gene locus_tag LOCUS_29330 71565 70234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_29330 72897 71875 gene locus_tag LOCUS_29340 gene hemH 72897 71875 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU9 protein_id gnl|my_center|LOCUS_29340 73955 73053 gene locus_tag LOCUS_29350 73955 73053 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_29350 74160 75146 gene locus_tag LOCUS_29360 74160 75146 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_29360 75143 75385 gene locus_tag LOCUS_29370 75143 75385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_29370 75553 76503 gene locus_tag LOCUS_29380 75553 76503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 protein_id gnl|my_center|LOCUS_29380 76493 77464 gene locus_tag LOCUS_29390 76493 77464 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768834.1 protein_id gnl|my_center|LOCUS_29390 77452 78888 gene locus_tag LOCUS_29400 gene phrB 77452 78888 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_29400 78885 79307 gene locus_tag LOCUS_29410 78885 79307 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_29410 79304 80059 gene locus_tag LOCUS_29420 79304 80059 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_29420 80056 81303 gene locus_tag LOCUS_29430 80056 81303 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_29430 81303 82103 gene locus_tag LOCUS_29440 81303 82103 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_29440 82090 83364 gene locus_tag LOCUS_29450 82090 83364 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_29450 83357 83884 gene locus_tag LOCUS_29460 83357 83884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_29460 84164 84475 gene locus_tag LOCUS_29470 84164 84475 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704510.1 protein_id gnl|my_center|LOCUS_29470 85054 84539 gene locus_tag LOCUS_29480 gene pagL 85054 84539 CDS product lipid A deacylase PagL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD1 protein_id gnl|my_center|LOCUS_29480 85942 85151 gene locus_tag LOCUS_29490 gene murI 85942 85151 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888B8 protein_id gnl|my_center|LOCUS_29490 86728 85976 gene locus_tag LOCUS_29500 gene moeB 86728 85976 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_29500 87566 86733 gene locus_tag LOCUS_29510 gene prmC 87566 86733 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC8 protein_id gnl|my_center|LOCUS_29510 88758 87676 gene locus_tag LOCUS_29520 gene prfA 88758 87676 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_29520 90035 88755 gene locus_tag LOCUS_29530 gene hemA 90035 88755 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_29530 90245 91972 gene locus_tag LOCUS_29540 90245 91972 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_29540 91972 92586 gene locus_tag LOCUS_29550 gene lolB 91972 92586 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX0 protein_id gnl|my_center|LOCUS_29550 93378 94247 gene locus_tag LOCUS_29560 gene ispE 93378 94247 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_29560 94274 94348 gene locus_tag LOCUS_t00300 94274 94348 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 94405 94479 gene locus_tag LOCUS_t00310 94405 94479 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 94526 95467 gene locus_tag LOCUS_29570 gene prs 94526 95467 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C6 protein_id gnl|my_center|LOCUS_29570 95575 96180 gene locus_tag LOCUS_29580 gene rplY 95575 96180 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_29580 96244 96834 gene locus_tag LOCUS_29590 gene pth 96244 96834 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_29590 96859 97959 gene locus_tag LOCUS_29600 gene ychF 96859 97959 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_29600 98642 99082 gene locus_tag LOCUS_29610 98642 99082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence17 340 4056 gene locus_tag LOCUS_29620 340 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29620 4072 6249 gene locus_tag LOCUS_29630 4072 6249 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105270.1 protein_id gnl|my_center|LOCUS_29630 7161 6265 gene locus_tag LOCUS_29640 7161 6265 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_29640 9498 7405 gene locus_tag LOCUS_29650 gene pta 9498 7405 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_29650 10692 9508 gene locus_tag LOCUS_29660 gene ackA 10692 9508 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A4 protein_id gnl|my_center|LOCUS_29660 10989 11474 gene locus_tag LOCUS_29670 gene slyD 10989 11474 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A3 protein_id gnl|my_center|LOCUS_29670 11653 12138 gene locus_tag LOCUS_29680 11653 12138 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_29680 12271 13008 gene locus_tag LOCUS_29690 12271 13008 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_29690 13284 15848 gene locus_tag LOCUS_29700 gene clpB 13284 15848 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_29700 17898 16186 gene locus_tag LOCUS_29710 gene dld 17898 16186 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_29710 19042 17903 gene locus_tag LOCUS_29720 gene lldD 19042 17903 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV37 protein_id gnl|my_center|LOCUS_29720 20819 19125 gene locus_tag LOCUS_29730 20819 19125 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_29730 21067 21882 gene locus_tag LOCUS_29740 21067 21882 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_29740 22603 22121 gene locus_tag LOCUS_29750 gene smpB 22603 22121 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN9 protein_id gnl|my_center|LOCUS_29750 22731 24134 gene locus_tag LOCUS_29760 22731 24134 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_29760 24135 24569 gene locus_tag LOCUS_29770 gene ratA 24135 24569 CDS product ribosome association toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68560 protein_id gnl|my_center|LOCUS_29770 24562 24882 gene locus_tag LOCUS_29780 24562 24882 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_29780 25470 24952 gene locus_tag LOCUS_29790 gene omlA 25470 24952 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN6 protein_id gnl|my_center|LOCUS_29790 25550 25969 gene locus_tag LOCUS_29800 gene fur 25550 25969 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_29800 27758 26082 gene locus_tag LOCUS_29810 gene recN 27758 26082 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_29810 27916 28485 gene locus_tag LOCUS_29820 gene grpE 27916 28485 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP6 protein_id gnl|my_center|LOCUS_29820 28585 30501 gene locus_tag LOCUS_29830 gene dnaK 28585 30501 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_29830 30637 31764 gene locus_tag LOCUS_29840 gene dnaJ 30637 31764 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_29840 31956 32759 gene locus_tag LOCUS_29850 gene dapB 31956 32759 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_29850 33052 34098 gene locus_tag LOCUS_29860 gene carA 33052 34098 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_29860 34135 37356 gene locus_tag LOCUS_29870 gene carB 34135 37356 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38100 protein_id gnl|my_center|LOCUS_29870 37353 37829 gene locus_tag LOCUS_29880 gene greA 37353 37829 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ2 protein_id gnl|my_center|LOCUS_29880 37807 38247 gene locus_tag LOCUS_29890 37807 38247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 protein_id gnl|my_center|LOCUS_29890 38589 38278 gene locus_tag LOCUS_29900 38589 38278 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_29900 38680 39303 gene locus_tag LOCUS_29910 gene rlmE 38680 39303 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_29910 39467 41389 gene locus_tag LOCUS_29920 gene ftsH 39467 41389 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_29920 41470 42249 gene locus_tag LOCUS_29930 gene folP 41470 42249 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_29930 42404 43741 gene locus_tag LOCUS_29940 gene glmM 42404 43741 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV50 protein_id gnl|my_center|LOCUS_29940 43807 44562 gene locus_tag LOCUS_29950 gene tpiA 43807 44562 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ1 protein_id gnl|my_center|LOCUS_29950 44566 44943 gene locus_tag LOCUS_29960 gene secG 44566 44943 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95577 protein_id gnl|my_center|LOCUS_29960 44951 45036 gene locus_tag LOCUS_t00320 44951 45036 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45134 45210 gene locus_tag LOCUS_t00330 45134 45210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45340 45798 gene locus_tag LOCUS_29970 gene rimP 45340 45798 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_29970 45959 47440 gene locus_tag LOCUS_29980 gene nusA 45959 47440 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR1 protein_id gnl|my_center|LOCUS_29980 47467 49953 gene locus_tag LOCUS_29990 gene infB 47467 49953 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_29990 50063 50455 gene locus_tag LOCUS_30000 gene rbfA 50063 50455 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_30000 50459 51379 gene locus_tag LOCUS_30010 gene truB 50459 51379 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI9 protein_id gnl|my_center|LOCUS_30010 51550 51819 gene locus_tag LOCUS_30020 gene rpsO 51550 51819 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ7 protein_id gnl|my_center|LOCUS_30020 51991 54096 gene locus_tag LOCUS_30030 gene pnp 51991 54096 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ8 protein_id gnl|my_center|LOCUS_30030 54419 54772 gene locus_tag LOCUS_30040 54419 54772 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095177.1 protein_id gnl|my_center|LOCUS_30040 54830 55027 gene locus_tag LOCUS_30050 54830 55027 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV61 protein_id gnl|my_center|LOCUS_30050 55546 55244 gene locus_tag LOCUS_30060 55546 55244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253425.2 protein_id gnl|my_center|LOCUS_30060 55868 55560 gene locus_tag LOCUS_30070 55868 55560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100541.1 protein_id gnl|my_center|LOCUS_30070 58747 55865 gene locus_tag LOCUS_30080 58747 55865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268876.1 protein_id gnl|my_center|LOCUS_30080 59875 58850 gene locus_tag LOCUS_30090 59875 58850 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 protein_id gnl|my_center|LOCUS_30090 60809 59937 gene locus_tag LOCUS_30100 60809 59937 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266655.1 protein_id gnl|my_center|LOCUS_30100 62817 60880 gene locus_tag LOCUS_30110 gene acsA2 62817 60880 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_30110 64619 62955 gene locus_tag LOCUS_30120 gene pgi 64619 62955 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY88 protein_id gnl|my_center|LOCUS_30120 65557 64700 gene locus_tag LOCUS_30130 gene panC 65557 64700 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_30130 66354 65554 gene locus_tag LOCUS_30140 gene panB 66354 65554 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_30140 67113 66628 gene locus_tag LOCUS_30150 gene folK 67113 66628 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV71 protein_id gnl|my_center|LOCUS_30150 68507 67113 gene locus_tag LOCUS_30160 gene pcnB 68507 67113 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q3 protein_id gnl|my_center|LOCUS_30160 68966 68583 gene locus_tag LOCUS_30170 68966 68583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 70710 69277 gene locus_tag LOCUS_30180 gene cbrB 70710 69277 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_30180 73718 70764 gene locus_tag LOCUS_30190 73718 70764 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266662.1 protein_id gnl|my_center|LOCUS_30190 73878 73702 gene locus_tag LOCUS_30200 73878 73702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_30200 74907 74023 gene locus_tag LOCUS_30210 gene gluQ 74907 74023 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_30210 75404 74958 gene locus_tag LOCUS_30220 gene dksA 75404 74958 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_30220 75663 76844 gene locus_tag LOCUS_30230 75663 76844 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV76 protein_id gnl|my_center|LOCUS_30230 76834 77541 gene locus_tag LOCUS_30240 gene sfsA 76834 77541 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV77 protein_id gnl|my_center|LOCUS_30240 77862 77545 gene locus_tag LOCUS_30250 77862 77545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_30250 78163 79227 gene locus_tag LOCUS_30260 78163 79227 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_30260 79287 80186 gene locus_tag LOCUS_30270 gene phuT 79287 80186 CDS product heme-transporter PhuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 protein_id gnl|my_center|LOCUS_30270 80210 81223 gene locus_tag LOCUS_30280 80210 81223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_30280 81223 81990 gene locus_tag LOCUS_30290 gene hmuV 81223 81990 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_30290 82006 82890 gene locus_tag LOCUS_30300 82006 82890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_30300 82952 83359 gene locus_tag LOCUS_30310 82952 83359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_30310 84452 83655 gene locus_tag LOCUS_30320 gene cbpA 84452 83655 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_30320 84830 84558 gene locus_tag LOCUS_30330 84830 84558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_30330 85275 84931 gene locus_tag LOCUS_30340 85275 84931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_30340 86925 85363 gene locus_tag LOCUS_30350 86925 85363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_30350 87091 89358 gene locus_tag LOCUS_30360 gene mrcB 87091 89358 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_30360 89426 90118 gene locus_tag LOCUS_30370 89426 90118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095080.1 protein_id gnl|my_center|LOCUS_30370 90118 90447 gene locus_tag LOCUS_30380 90118 90447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_30380 90900 90466 gene locus_tag LOCUS_30390 90900 90466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_30390 91302 93026 gene locus_tag LOCUS_30400 gene ilvI 91302 93026 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_30400 93028 93519 gene locus_tag LOCUS_30410 gene ilvH 93028 93519 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_30410 94454 93573 gene locus_tag LOCUS_30420 gene ilvY 94454 93573 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_30420 94581 95597 gene locus_tag LOCUS_30430 gene ilvC 94581 95597 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY66 protein_id gnl|my_center|LOCUS_30430 95628 96560 gene locus_tag LOCUS_30440 gene pssA 95628 96560 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_30440 96627 97637 gene locus_tag LOCUS_30450 gene msrP 96627 97637 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_30450 97637 98263 gene locus_tag LOCUS_30460 gene msrQ 97637 98263 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence18 233 1366 gene locus_tag LOCUS_30470 233 1366 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_30470 2490 1570 gene locus_tag LOCUS_30480 2490 1570 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_30480 3305 2688 gene locus_tag LOCUS_30490 3305 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_30490 3609 4169 gene locus_tag LOCUS_30500 3609 4169 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_30500 4166 5773 gene locus_tag LOCUS_30510 4166 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_30510 5770 6639 gene locus_tag LOCUS_30520 gene tesB 5770 6639 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_30520 6636 7229 gene locus_tag LOCUS_30530 6636 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_30530 8845 7412 gene locus_tag LOCUS_30540 gene oprM 8845 7412 CDS product outer membrane protein OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51487 protein_id gnl|my_center|LOCUS_30540 11985 8842 gene locus_tag LOCUS_30550 gene mexB 11985 8842 CDS product multidrug resistance protein MexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52002 protein_id gnl|my_center|LOCUS_30550 13148 12000 gene locus_tag LOCUS_30560 gene mexA 13148 12000 CDS product multidrug resistance protein MexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52477 protein_id gnl|my_center|LOCUS_30560 13330 13986 gene locus_tag LOCUS_30570 13330 13986 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 protein_id gnl|my_center|LOCUS_30570 14250 14068 gene locus_tag LOCUS_30580 14250 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 15527 14511 gene locus_tag LOCUS_30590 15527 14511 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_30590 15843 15550 gene locus_tag LOCUS_30600 15843 15550 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_30600 15949 16863 gene locus_tag LOCUS_30610 15949 16863 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 protein_id gnl|my_center|LOCUS_30610 16970 17356 gene locus_tag LOCUS_30620 16970 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104226.1 protein_id gnl|my_center|LOCUS_30620 17468 19498 gene locus_tag LOCUS_30630 17468 19498 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 protein_id gnl|my_center|LOCUS_30630 19495 20931 gene locus_tag LOCUS_30640 19495 20931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 20981 22351 gene locus_tag LOCUS_30650 20981 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113806.1 protein_id gnl|my_center|LOCUS_30650 22425 22919 gene locus_tag LOCUS_30660 22425 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269021.1 protein_id gnl|my_center|LOCUS_30660 22919 23293 gene locus_tag LOCUS_30670 22919 23293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 23356 25446 gene locus_tag LOCUS_30680 gene oprC 23356 25446 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_30680 25690 25956 gene locus_tag LOCUS_30690 25690 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406383.1 protein_id gnl|my_center|LOCUS_30690 25956 26492 gene locus_tag LOCUS_30700 25956 26492 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245030.1 protein_id gnl|my_center|LOCUS_30700 27502 26555 gene locus_tag LOCUS_30710 27502 26555 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Y4 protein_id gnl|my_center|LOCUS_30710 28661 27702 gene locus_tag LOCUS_30720 28661 27702 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_30720 30083 29001 gene locus_tag LOCUS_30730 30083 29001 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 protein_id gnl|my_center|LOCUS_30730 31917 30562 gene locus_tag LOCUS_30740 gene atzB 31917 30562 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 protein_id gnl|my_center|LOCUS_30740 32156 32620 gene locus_tag LOCUS_30750 32156 32620 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_30750 33625 32699 gene locus_tag LOCUS_30760 33625 32699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266555.1 protein_id gnl|my_center|LOCUS_30760 34839 33736 gene locus_tag LOCUS_30770 34839 33736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266556.1 protein_id gnl|my_center|LOCUS_30770 36398 34851 gene locus_tag LOCUS_30780 36398 34851 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266557.1 protein_id gnl|my_center|LOCUS_30780 37463 36777 gene locus_tag LOCUS_30790 37463 36777 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103271.1 protein_id gnl|my_center|LOCUS_30790 38195 37629 gene locus_tag LOCUS_30800 38195 37629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 38776 38192 gene locus_tag LOCUS_30810 38776 38192 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266558.1 protein_id gnl|my_center|LOCUS_30810 39438 38776 gene locus_tag LOCUS_30820 39438 38776 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_30820 41026 39599 gene locus_tag LOCUS_30830 41026 39599 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_30830 42079 41162 gene locus_tag LOCUS_30840 42079 41162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 protein_id gnl|my_center|LOCUS_30840 42242 43588 gene locus_tag LOCUS_30850 gene bauA 42242 43588 CDS product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I700 protein_id gnl|my_center|LOCUS_30850 43696 45192 gene locus_tag LOCUS_30860 gene bauC 43696 45192 CDS product putative 3-oxopropanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I702 protein_id gnl|my_center|LOCUS_30860 45498 45295 gene locus_tag LOCUS_30870 45498 45295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 45677 46504 gene locus_tag LOCUS_30880 gene nat 45677 46504 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJI5 protein_id gnl|my_center|LOCUS_30880 48244 47153 gene locus_tag LOCUS_30890 48244 47153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_30890 49161 48337 gene locus_tag LOCUS_30900 49161 48337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_30900 50794 49283 gene locus_tag LOCUS_30910 50794 49283 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_30910 51610 50879 gene locus_tag LOCUS_30920 51610 50879 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_30920 52161 51925 gene locus_tag LOCUS_30930 52161 51925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102660.1 protein_id gnl|my_center|LOCUS_30930 53224 52520 gene locus_tag LOCUS_30940 53224 52520 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_30940 55154 53508 gene locus_tag LOCUS_30950 gene groL 55154 53508 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_30950 55496 55203 gene locus_tag LOCUS_30960 gene groS 55496 55203 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP19 protein_id gnl|my_center|LOCUS_30960 56269 55820 gene locus_tag LOCUS_30970 56269 55820 CDS product phage exclusion suppressor FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_30970 57071 56337 gene locus_tag LOCUS_30980 57071 56337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_30980 57338 58096 gene locus_tag LOCUS_30990 gene speA 57338 58096 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_30990 59227 58259 gene locus_tag LOCUS_31000 gene ispB 59227 58259 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381308.1 protein_id gnl|my_center|LOCUS_31000 59474 59785 gene locus_tag LOCUS_31010 gene rplU 59474 59785 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK3 protein_id gnl|my_center|LOCUS_31010 59822 60079 gene locus_tag LOCUS_31020 gene rpmA 59822 60079 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F2 protein_id gnl|my_center|LOCUS_31020 60220 61440 gene locus_tag LOCUS_31030 gene obg 60220 61440 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_31030 61522 62640 gene locus_tag LOCUS_31040 gene proB 61522 62640 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_31040 62792 63253 gene locus_tag LOCUS_31050 62792 63253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_31050 64809 63310 gene locus_tag LOCUS_31060 gene mqo2 64809 63310 CDS product putative malate:quinone oxidoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVF1 protein_id gnl|my_center|LOCUS_31060 64838 65254 gene locus_tag LOCUS_31070 64838 65254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 65503 65273 gene locus_tag LOCUS_31080 65503 65273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406900.1 protein_id gnl|my_center|LOCUS_31080 65670 66254 gene locus_tag LOCUS_31090 65670 66254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094953.1 protein_id gnl|my_center|LOCUS_31090 66522 66316 gene locus_tag LOCUS_31100 66522 66316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346138.1 protein_id gnl|my_center|LOCUS_31100 66797 67072 gene locus_tag LOCUS_31110 66797 67072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114705.1 protein_id gnl|my_center|LOCUS_31110 68297 67137 gene locus_tag LOCUS_31120 68297 67137 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768804.1 protein_id gnl|my_center|LOCUS_31120 68400 68582 gene locus_tag LOCUS_31130 68400 68582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719780.1 protein_id gnl|my_center|LOCUS_31130 68582 68842 gene locus_tag LOCUS_31140 68582 68842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318203.1 protein_id gnl|my_center|LOCUS_31140 68870 69487 gene locus_tag LOCUS_31150 68870 69487 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736538.1 protein_id gnl|my_center|LOCUS_31150 71680 69554 gene locus_tag LOCUS_31160 71680 69554 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 protein_id gnl|my_center|LOCUS_31160 71874 72695 gene locus_tag LOCUS_31170 71874 72695 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266752.1 protein_id gnl|my_center|LOCUS_31170 73222 72749 gene locus_tag LOCUS_31180 73222 72749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_31180 73888 73304 gene locus_tag LOCUS_31190 73888 73304 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_31190 75231 74227 gene locus_tag LOCUS_31200 gene rsmC 75231 74227 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVG4 protein_id gnl|my_center|LOCUS_31200 76251 75349 gene locus_tag LOCUS_31210 gene hprA 76251 75349 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_31210 76171 76350 gene locus_tag LOCUS_31220 76171 76350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 76394 77023 gene locus_tag LOCUS_31230 76394 77023 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_31230 78266 77091 gene locus_tag LOCUS_31240 78266 77091 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_31240 78457 80139 gene locus_tag LOCUS_31250 78457 80139 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_31250 80357 82336 gene locus_tag LOCUS_31260 80357 82336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103441.1 protein_id gnl|my_center|LOCUS_31260 82363 83736 gene locus_tag LOCUS_31270 82363 83736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_31270 >Feature sequence19 401 159 gene locus_tag LOCUS_31280 401 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 606 412 gene locus_tag LOCUS_31290 606 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1475 753 gene locus_tag LOCUS_31300 1475 753 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLE9 protein_id gnl|my_center|LOCUS_31300 2867 1638 gene locus_tag LOCUS_31310 2867 1638 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172146.1 protein_id gnl|my_center|LOCUS_31310 4132 3020 gene locus_tag LOCUS_31320 4132 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 4951 4373 gene locus_tag LOCUS_31330 4951 4373 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_31330 6181 4970 gene locus_tag LOCUS_31340 6181 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113582.1 protein_id gnl|my_center|LOCUS_31340 6618 6409 gene locus_tag LOCUS_31350 6618 6409 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 protein_id gnl|my_center|LOCUS_31350 9365 6765 gene locus_tag LOCUS_31360 gene acnB 9365 6765 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V5 protein_id gnl|my_center|LOCUS_31360 9910 10386 gene locus_tag LOCUS_31370 9910 10386 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_31370 11337 10474 gene locus_tag LOCUS_31380 11337 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_31380 11495 12175 gene locus_tag LOCUS_31390 11495 12175 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_31390 13079 12351 gene locus_tag LOCUS_31400 gene lpxH 13079 12351 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP2 protein_id gnl|my_center|LOCUS_31400 13720 13229 gene locus_tag LOCUS_31410 gene ppiB 13720 13229 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_31410 13881 15545 gene locus_tag LOCUS_31420 gene glnS 13881 15545 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U8 protein_id gnl|my_center|LOCUS_31420 15545 16930 gene locus_tag LOCUS_31430 gene cysS 15545 16930 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_31430 17304 18620 gene locus_tag LOCUS_31440 gene braB 17304 18620 CDS product branched-chain amino acid transport system 2 carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19072 protein_id gnl|my_center|LOCUS_31440 18726 19460 gene locus_tag LOCUS_31450 18726 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_31450 19457 19852 gene locus_tag LOCUS_31460 19457 19852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947947.1 protein_id gnl|my_center|LOCUS_31460 20191 19895 gene locus_tag LOCUS_31470 20191 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 20368 20847 gene locus_tag LOCUS_31480 20368 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_31480 20844 21290 gene locus_tag LOCUS_31490 20844 21290 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_31490 21360 22607 gene locus_tag LOCUS_31500 21360 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114261.1 protein_id gnl|my_center|LOCUS_31500 22907 24805 gene locus_tag LOCUS_31510 gene htpG 22907 24805 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_31510 24941 28633 gene locus_tag LOCUS_31520 24941 28633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 28630 29634 gene locus_tag LOCUS_31530 28630 29634 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_31530 29730 30518 gene locus_tag LOCUS_31540 29730 30518 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390585.1 protein_id gnl|my_center|LOCUS_31540 31359 30580 gene locus_tag LOCUS_31550 31359 30580 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_31550 32255 31542 gene locus_tag LOCUS_31560 32255 31542 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_31560 32800 32252 gene locus_tag LOCUS_31570 32800 32252 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_31570 33732 32920 gene locus_tag LOCUS_31580 33732 32920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 34652 33792 gene locus_tag LOCUS_31590 34652 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189178.1 protein_id gnl|my_center|LOCUS_31590 35050 34649 gene locus_tag LOCUS_31600 35050 34649 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814742.1 protein_id gnl|my_center|LOCUS_31600 36504 35110 gene locus_tag LOCUS_31610 36504 35110 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545572.1 protein_id gnl|my_center|LOCUS_31610 36752 37762 gene locus_tag LOCUS_31620 36752 37762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_31620 37921 38385 gene locus_tag LOCUS_31630 37921 38385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087466.1 protein_id gnl|my_center|LOCUS_31630 38772 38386 gene locus_tag LOCUS_31640 gene dgkA 38772 38386 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_31640 39470 38769 gene locus_tag LOCUS_31650 39470 38769 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_31650 40161 39472 gene locus_tag LOCUS_31660 40161 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094031.1 protein_id gnl|my_center|LOCUS_31660 41511 40243 gene locus_tag LOCUS_31670 41511 40243 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_31670 42184 41501 gene locus_tag LOCUS_31680 42184 41501 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_31680 42288 44246 gene locus_tag LOCUS_31690 42288 44246 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_31690 44256 44981 gene locus_tag LOCUS_31700 44256 44981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112760.1 protein_id gnl|my_center|LOCUS_31700 44978 45658 gene locus_tag LOCUS_31710 gene tpbA 44978 45658 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105672.1 protein_id gnl|my_center|LOCUS_31710 45663 46013 gene locus_tag LOCUS_31720 45663 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107850.1 protein_id gnl|my_center|LOCUS_31720 46201 47826 gene locus_tag LOCUS_31730 46201 47826 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 protein_id gnl|my_center|LOCUS_31730 49140 47920 gene locus_tag LOCUS_31740 gene fabB 49140 47920 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_31740 49667 49152 gene locus_tag LOCUS_31750 gene fabA 49667 49152 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_31750 51780 49882 gene locus_tag LOCUS_31760 51780 49882 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_31760 52063 53085 gene locus_tag LOCUS_31770 gene gpsA 52063 53085 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_31770 53115 53462 gene locus_tag LOCUS_31780 53115 53462 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_31780 53459 53917 gene locus_tag LOCUS_31790 53459 53917 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_31790 54096 55763 gene locus_tag LOCUS_31800 54096 55763 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_31800 55818 56261 gene locus_tag LOCUS_31810 55818 56261 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_31810 56320 57123 gene locus_tag LOCUS_31820 56320 57123 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114248.1 protein_id gnl|my_center|LOCUS_31820 57313 57945 gene locus_tag LOCUS_31830 57313 57945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120430.1 protein_id gnl|my_center|LOCUS_31830 58045 58848 gene locus_tag LOCUS_31840 58045 58848 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_31840 58845 59708 gene locus_tag LOCUS_31850 58845 59708 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_31850 59848 60651 gene locus_tag LOCUS_31860 59848 60651 CDS product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267384.1 protein_id gnl|my_center|LOCUS_31860 60728 61807 gene locus_tag LOCUS_31870 60728 61807 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114591.1 protein_id gnl|my_center|LOCUS_31870 61926 63071 gene locus_tag LOCUS_31880 gene acrE 61926 63071 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_31880 63071 63751 gene locus_tag LOCUS_31890 gene macB 63071 63751 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNB9 protein_id gnl|my_center|LOCUS_31890 63751 64965 gene locus_tag LOCUS_31900 63751 64965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 64965 66161 gene locus_tag LOCUS_31910 64965 66161 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_31910 67169 66162 gene locus_tag LOCUS_31920 67169 66162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_31920 67275 68309 gene locus_tag LOCUS_31930 gene selD 67275 68309 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I383 protein_id gnl|my_center|LOCUS_31930 68309 69409 gene locus_tag LOCUS_31940 gene selU 68309 69409 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_31940 69698 69976 gene locus_tag LOCUS_31950 69698 69976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097836.1 protein_id gnl|my_center|LOCUS_31950 69976 70581 gene locus_tag LOCUS_31960 69976 70581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_31960 70708 72675 gene locus_tag LOCUS_31970 70708 72675 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 protein_id gnl|my_center|LOCUS_31970 72771 73688 gene locus_tag LOCUS_31980 72771 73688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_31980 73688 74641 gene locus_tag LOCUS_31990 73688 74641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_31990 74638 76623 gene locus_tag LOCUS_32000 gene tgpA 74638 76623 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_32000 76696 77466 gene locus_tag LOCUS_32010 76696 77466 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103916.1 protein_id gnl|my_center|LOCUS_32010 77555 78370 gene locus_tag LOCUS_32020 77555 78370 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_32020 78734 78372 gene locus_tag LOCUS_32030 78734 78372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101677.1 protein_id gnl|my_center|LOCUS_32030 80301 78838 gene locus_tag LOCUS_32040 80301 78838 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110283.1 protein_id gnl|my_center|LOCUS_32040 81213 80386 gene locus_tag LOCUS_32050 81213 80386 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_32050 81487 82902 gene locus_tag LOCUS_32060 81487 82902 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114749.1 protein_id gnl|my_center|LOCUS_32060 83008 83442 gene locus_tag LOCUS_32070 83008 83442 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765767.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence20 727 2022 gene locus_tag LOCUS_32080 gene oprD 727 2022 CDS product porin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32722 protein_id gnl|my_center|LOCUS_32080 2505 2092 gene locus_tag LOCUS_32090 2505 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_32090 2629 4344 gene locus_tag LOCUS_32100 gene proS 2629 4344 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y24 protein_id gnl|my_center|LOCUS_32100 4365 5321 gene locus_tag LOCUS_32110 4365 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102379.1 protein_id gnl|my_center|LOCUS_32110 6184 5423 gene locus_tag LOCUS_32120 6184 5423 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114196.1 protein_id gnl|my_center|LOCUS_32120 6666 6205 gene locus_tag LOCUS_32130 6666 6205 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808387.1 protein_id gnl|my_center|LOCUS_32130 7349 6669 gene locus_tag LOCUS_32140 7349 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 7528 10626 gene locus_tag LOCUS_32150 7528 10626 CDS product glycosyl transferase family 51 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104904.1 protein_id gnl|my_center|LOCUS_32150 10722 11606 gene locus_tag LOCUS_32160 10722 11606 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765167.1 protein_id gnl|my_center|LOCUS_32160 11834 11622 gene locus_tag LOCUS_32170 11834 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 13040 11907 gene locus_tag LOCUS_32180 13040 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 14704 13238 gene locus_tag LOCUS_32190 gene putP 14704 13238 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_32190 16325 15192 gene locus_tag LOCUS_32200 16325 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_32200 16380 16847 gene locus_tag LOCUS_32210 gene ppa 16380 16847 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP34 protein_id gnl|my_center|LOCUS_32210 18296 17007 gene locus_tag LOCUS_32220 gene oprO 18296 17007 CDS product porin O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32977 protein_id gnl|my_center|LOCUS_32220 18788 18456 gene locus_tag LOCUS_32230 18788 18456 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886F1 protein_id gnl|my_center|LOCUS_32230 19226 18798 gene locus_tag LOCUS_32240 19226 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_32240 20464 19301 gene locus_tag LOCUS_32250 20464 19301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_32250 21377 20565 gene locus_tag LOCUS_32260 21377 20565 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_32260 21851 21483 gene locus_tag LOCUS_32270 21851 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_32270 22187 21858 gene locus_tag LOCUS_32280 22187 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_32280 22380 22604 gene locus_tag LOCUS_32290 22380 22604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091551.1 protein_id gnl|my_center|LOCUS_32290 22764 24062 gene locus_tag LOCUS_32300 22764 24062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114807.1 protein_id gnl|my_center|LOCUS_32300 24055 24825 gene locus_tag LOCUS_32310 24055 24825 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402525.1 protein_id gnl|my_center|LOCUS_32310 24936 25790 gene locus_tag LOCUS_32320 24936 25790 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 protein_id gnl|my_center|LOCUS_32320 26978 25797 gene locus_tag LOCUS_32330 26978 25797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_32330 28090 27158 gene locus_tag LOCUS_32340 gene lpxL 28090 27158 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_32340 28318 29046 gene locus_tag LOCUS_32350 gene minC 28318 29046 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 protein_id gnl|my_center|LOCUS_32350 29148 29963 gene locus_tag LOCUS_32360 gene minD 29148 29963 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_32360 29960 30214 gene locus_tag LOCUS_32370 gene minE 29960 30214 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC6 protein_id gnl|my_center|LOCUS_32370 30364 30999 gene locus_tag LOCUS_32380 gene rluA 30364 30999 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770474.1 protein_id gnl|my_center|LOCUS_32380 31181 32470 gene locus_tag LOCUS_32390 gene apeB 31181 32470 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_32390 32485 33072 gene locus_tag LOCUS_32400 gene gmhA 32485 33072 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIK9 protein_id gnl|my_center|LOCUS_32400 33501 33082 gene locus_tag LOCUS_32410 33501 33082 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_32410 34325 33504 gene locus_tag LOCUS_32420 34325 33504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_32420 36668 34329 gene locus_tag LOCUS_32430 36668 34329 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 protein_id gnl|my_center|LOCUS_32430 37332 36655 gene locus_tag LOCUS_32440 37332 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 protein_id gnl|my_center|LOCUS_32440 38219 37470 gene locus_tag LOCUS_32450 gene pruR 38219 37470 CDS product proline utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_32450 38465 39169 gene locus_tag LOCUS_32460 38465 39169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 39231 41627 gene locus_tag LOCUS_32470 gene lon 39231 41627 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_32470 41787 42179 gene locus_tag LOCUS_32480 41787 42179 CDS product peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405351.1 protein_id gnl|my_center|LOCUS_32480 43252 42491 gene locus_tag LOCUS_32490 43252 42491 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWM8 protein_id gnl|my_center|LOCUS_32490 44321 43398 gene locus_tag LOCUS_32500 44321 43398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_32500 45525 44584 gene locus_tag LOCUS_32510 45525 44584 CDS product D-isomer specific 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 protein_id gnl|my_center|LOCUS_32510 46970 45552 gene locus_tag LOCUS_32520 46970 45552 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_32520 48528 46972 gene locus_tag LOCUS_32530 48528 46972 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 protein_id gnl|my_center|LOCUS_32530 49876 48551 gene locus_tag LOCUS_32540 49876 48551 CDS product D-galactonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431603.1 protein_id gnl|my_center|LOCUS_32540 51420 50071 gene locus_tag LOCUS_32550 51420 50071 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_32550 52443 51532 gene locus_tag LOCUS_32560 52443 51532 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WJ7 protein_id gnl|my_center|LOCUS_32560 52992 54386 gene locus_tag LOCUS_32570 52992 54386 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_32570 54422 55399 gene locus_tag LOCUS_32580 54422 55399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_32580 55466 55972 gene locus_tag LOCUS_32590 55466 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 55982 57502 gene locus_tag LOCUS_32600 55982 57502 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_32600 57677 58582 gene locus_tag LOCUS_32610 57677 58582 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267910.1 protein_id gnl|my_center|LOCUS_32610 59741 58587 gene locus_tag LOCUS_32620 59741 58587 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_32620 59968 61593 gene locus_tag LOCUS_32630 59968 61593 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104059.1 protein_id gnl|my_center|LOCUS_32630 61849 62079 gene locus_tag LOCUS_32640 61849 62079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094765.1 protein_id gnl|my_center|LOCUS_32640 63047 62418 gene locus_tag LOCUS_32650 63047 62418 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI7 protein_id gnl|my_center|LOCUS_32650 64803 63268 gene locus_tag LOCUS_32660 64803 63268 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104675.1 protein_id gnl|my_center|LOCUS_32660 66200 64800 gene locus_tag LOCUS_32670 66200 64800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 66499 66197 gene locus_tag LOCUS_32680 66499 66197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268921.1 protein_id gnl|my_center|LOCUS_32680 67123 66632 gene locus_tag LOCUS_32690 67123 66632 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI5 protein_id gnl|my_center|LOCUS_32690 67616 67263 gene locus_tag LOCUS_32700 67616 67263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094775.1 protein_id gnl|my_center|LOCUS_32700 70271 67782 gene locus_tag LOCUS_32710 70271 67782 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 protein_id gnl|my_center|LOCUS_32710 70423 71403 gene locus_tag LOCUS_32720 70423 71403 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_32720 71717 71373 gene locus_tag LOCUS_32730 71717 71373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112819.1 protein_id gnl|my_center|LOCUS_32730 71881 73713 gene locus_tag LOCUS_32740 71881 73713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_32740 73780 74025 gene locus_tag LOCUS_32750 73780 74025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708617.1 protein_id gnl|my_center|LOCUS_32750 76957 74042 gene locus_tag LOCUS_32760 76957 74042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence21 976 335 gene locus_tag LOCUS_32770 976 335 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 protein_id gnl|my_center|LOCUS_32770 2731 1007 gene locus_tag LOCUS_32780 2731 1007 CDS product peptidase C13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770114.1 protein_id gnl|my_center|LOCUS_32780 3323 2868 gene locus_tag LOCUS_32790 3323 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_32790 3567 3926 gene locus_tag LOCUS_32800 3567 3926 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 protein_id gnl|my_center|LOCUS_32800 3923 4639 gene locus_tag LOCUS_32810 3923 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_32810 4702 5289 gene locus_tag LOCUS_32820 4702 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_32820 6659 5343 gene locus_tag LOCUS_32830 6659 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 protein_id gnl|my_center|LOCUS_32830 7375 6656 gene locus_tag LOCUS_32840 7375 6656 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX17 protein_id gnl|my_center|LOCUS_32840 7621 8886 gene locus_tag LOCUS_32850 gene proA 7621 8886 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_32850 8887 9546 gene locus_tag LOCUS_32860 gene nadD 8887 9546 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN74 protein_id gnl|my_center|LOCUS_32860 9598 9966 gene locus_tag LOCUS_32870 gene rsfS 9598 9966 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_32870 9976 10443 gene locus_tag LOCUS_32880 gene rlmH 9976 10443 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_32880 10454 12346 gene locus_tag LOCUS_32890 gene pbpA 10454 12346 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_32890 12343 13488 gene locus_tag LOCUS_32900 12343 13488 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_32900 13508 14518 gene locus_tag LOCUS_32910 gene mltB 13508 14518 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_32910 14515 15516 gene locus_tag LOCUS_32920 gene rlpA 14515 15516 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V6 protein_id gnl|my_center|LOCUS_32920 15625 16800 gene locus_tag LOCUS_32930 15625 16800 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376558.1 protein_id gnl|my_center|LOCUS_32930 16863 17141 gene locus_tag LOCUS_32940 16863 17141 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_32940 17147 17764 gene locus_tag LOCUS_32950 gene lipB 17147 17764 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V9 protein_id gnl|my_center|LOCUS_32950 18963 17911 gene locus_tag LOCUS_32960 gene lipA 18963 17911 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_32960 20285 19164 gene locus_tag LOCUS_32970 20285 19164 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 protein_id gnl|my_center|LOCUS_32970 20648 20454 gene locus_tag LOCUS_32980 20648 20454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 21815 20781 gene locus_tag LOCUS_32990 gene holA 21815 20781 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_32990 22482 21871 gene locus_tag LOCUS_33000 gene lptE 22482 21871 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN89 protein_id gnl|my_center|LOCUS_33000 25149 22537 gene locus_tag LOCUS_33010 gene leuS 25149 22537 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX33 protein_id gnl|my_center|LOCUS_33010 25328 25756 gene locus_tag LOCUS_33020 25328 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114329.1 protein_id gnl|my_center|LOCUS_33020 25861 26631 gene locus_tag LOCUS_33030 25861 26631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_33030 28360 26837 gene locus_tag LOCUS_33040 gene lnt 28360 26837 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_33040 29416 28577 gene locus_tag LOCUS_33050 29416 28577 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_33050 30060 29605 gene locus_tag LOCUS_33060 gene ybeY 30060 29605 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX9 protein_id gnl|my_center|LOCUS_33060 31090 30053 gene locus_tag LOCUS_33070 31090 30053 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_33070 32476 31133 gene locus_tag LOCUS_33080 gene miaB 32476 31133 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_33080 32666 32989 gene locus_tag LOCUS_33090 32666 32989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_33090 33652 33104 gene locus_tag LOCUS_33100 33652 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093155.1 protein_id gnl|my_center|LOCUS_33100 34391 33759 gene locus_tag LOCUS_33110 34391 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 35680 34391 gene locus_tag LOCUS_33120 gene hemL 35680 34391 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_33120 36332 35703 gene locus_tag LOCUS_33130 gene thiE 36332 35703 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_33130 37126 36329 gene locus_tag LOCUS_33140 gene thiD 37126 36329 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_33140 37270 38430 gene locus_tag LOCUS_33150 37270 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 38521 39267 gene locus_tag LOCUS_33160 gene alcD 38521 39267 CDS product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814016.1 protein_id gnl|my_center|LOCUS_33160 39261 40028 gene locus_tag LOCUS_33170 39261 40028 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_229858.2 protein_id gnl|my_center|LOCUS_33170 40031 42007 gene locus_tag LOCUS_33180 40031 42007 CDS product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115021.1 protein_id gnl|my_center|LOCUS_33180 42004 42894 gene locus_tag LOCUS_33190 42004 42894 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263607.1 protein_id gnl|my_center|LOCUS_33190 42986 45397 gene locus_tag LOCUS_33200 gene ladS 42986 45397 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_33200 45623 46264 gene locus_tag LOCUS_33210 45623 46264 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_33210 46261 47910 gene locus_tag LOCUS_33220 46261 47910 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_33220 47995 48694 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggatgaaccg 48992 49672 gene locus_tag LOCUS_33230 48992 49672 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975415.1 protein_id gnl|my_center|LOCUS_33230 50714 49992 gene locus_tag LOCUS_33240 50714 49992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 50840 52312 gene locus_tag LOCUS_33250 gene amn 50840 52312 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA5 protein_id gnl|my_center|LOCUS_33250 53285 52314 gene locus_tag LOCUS_33260 53285 52314 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_33260 52660 52748 gene locus_tag LOCUS_t00340 52660 52748 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 53366 54697 gene locus_tag LOCUS_33270 53366 54697 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089356.1 protein_id gnl|my_center|LOCUS_33270 55294 54863 gene locus_tag LOCUS_33280 55294 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 55443 57008 gene locus_tag LOCUS_33290 gene aer-1 55443 57008 CDS product aerotaxis receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103647.1 protein_id gnl|my_center|LOCUS_33290 57017 58741 gene locus_tag LOCUS_33300 57017 58741 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103090.1 protein_id gnl|my_center|LOCUS_33300 59251 58814 gene locus_tag LOCUS_33310 59251 58814 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 protein_id gnl|my_center|LOCUS_33310 60495 59464 gene locus_tag LOCUS_33320 gene yjgB 60495 59464 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_33320 60670 61239 gene locus_tag LOCUS_33330 gene rluE 60670 61239 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_33330 61859 61467 gene locus_tag LOCUS_33340 61859 61467 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_33340 62157 61939 gene locus_tag LOCUS_33350 62157 61939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_33350 62727 62248 gene locus_tag LOCUS_33360 62727 62248 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_33360 63983 63102 gene locus_tag LOCUS_33370 63983 63102 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763294.1 protein_id gnl|my_center|LOCUS_33370 63721 63789 gene locus_tag LOCUS_t00350 63721 63789 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64407 63988 gene locus_tag LOCUS_33380 64407 63988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340868.1 protein_id gnl|my_center|LOCUS_33380 64536 67067 gene locus_tag LOCUS_33390 64536 67067 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_33390 67122 68588 gene locus_tag LOCUS_33400 67122 68588 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105143.1 protein_id gnl|my_center|LOCUS_33400 68585 70513 gene locus_tag LOCUS_33410 68585 70513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105142.1 protein_id gnl|my_center|LOCUS_33410 70510 72558 gene locus_tag LOCUS_33420 70510 72558 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105141.1 protein_id gnl|my_center|LOCUS_33420 72561 72989 gene locus_tag LOCUS_33430 72561 72989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888823.1 protein_id gnl|my_center|LOCUS_33430 73343 73122 gene locus_tag LOCUS_33440 73343 73122 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_33440 73448 74026 gene locus_tag LOCUS_33450 73448 74026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 74023 75423 gene locus_tag LOCUS_33460 74023 75423 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 protein_id gnl|my_center|LOCUS_33460 75514 75816 gene locus_tag LOCUS_33470 75514 75816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 75816 76310 gene locus_tag LOCUS_33480 75816 76310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 76370 76687 gene locus_tag LOCUS_33490 76370 76687 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 protein_id gnl|my_center|LOCUS_33490 76684 77019 gene locus_tag LOCUS_33500 76684 77019 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 protein_id gnl|my_center|LOCUS_33500 77254 77042 gene locus_tag LOCUS_33510 77254 77042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence22 883 263 gene locus_tag LOCUS_33520 883 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093439.1 protein_id gnl|my_center|LOCUS_33520 2086 887 gene locus_tag LOCUS_33530 gene araJ 2086 887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 protein_id gnl|my_center|LOCUS_33530 3085 2162 gene locus_tag LOCUS_33540 3085 2162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390625.1 protein_id gnl|my_center|LOCUS_33540 3381 4430 gene locus_tag LOCUS_33550 3381 4430 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_33550 4492 5787 gene locus_tag LOCUS_33560 4492 5787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_33560 6722 6021 gene locus_tag LOCUS_33570 6722 6021 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_33570 7073 7510 gene locus_tag LOCUS_33580 7073 7510 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113165.1 protein_id gnl|my_center|LOCUS_33580 7830 7564 gene locus_tag LOCUS_33590 7830 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091540.1 protein_id gnl|my_center|LOCUS_33590 8016 8441 gene locus_tag LOCUS_33600 8016 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091632.1 protein_id gnl|my_center|LOCUS_33600 8519 9808 gene locus_tag LOCUS_33610 8519 9808 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 protein_id gnl|my_center|LOCUS_33610 10289 9810 gene locus_tag LOCUS_33620 10289 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 10857 10387 gene locus_tag LOCUS_33630 10857 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071468.1 protein_id gnl|my_center|LOCUS_33630 11412 10939 gene locus_tag LOCUS_33640 11412 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 11910 11485 gene locus_tag LOCUS_33650 11910 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 12355 12158 gene locus_tag LOCUS_33660 12355 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 12946 12524 gene locus_tag LOCUS_33670 12946 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 14465 12948 gene locus_tag LOCUS_33680 14465 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 15368 14616 gene locus_tag LOCUS_33690 15368 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558837.1 protein_id gnl|my_center|LOCUS_33690 15510 16076 gene locus_tag LOCUS_33700 15510 16076 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_33700 16078 17109 gene locus_tag LOCUS_33710 16078 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 17181 18098 gene locus_tag LOCUS_33720 17181 18098 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 protein_id gnl|my_center|LOCUS_33720 18196 19308 gene locus_tag LOCUS_33730 gene aguA 18196 19308 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLK2 protein_id gnl|my_center|LOCUS_33730 19318 20409 gene locus_tag LOCUS_33740 19318 20409 CDS product spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114385.1 protein_id gnl|my_center|LOCUS_33740 21045 20413 gene locus_tag LOCUS_33750 21045 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33750 22825 21215 gene locus_tag LOCUS_33760 22825 21215 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_33760 23057 24184 gene locus_tag LOCUS_33770 23057 24184 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_33770 24257 24859 gene locus_tag LOCUS_33780 24257 24859 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_33780 24853 25086 gene locus_tag LOCUS_33790 24853 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 27040 25322 gene locus_tag LOCUS_33800 27040 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 28011 27037 gene locus_tag LOCUS_33810 28011 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 28528 28821 gene locus_tag LOCUS_33820 28528 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 28842 29684 gene locus_tag LOCUS_33830 28842 29684 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYW0 protein_id gnl|my_center|LOCUS_33830 29681 30391 gene locus_tag LOCUS_33840 29681 30391 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_33840 30397 30996 gene locus_tag LOCUS_33850 30397 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_33850 32027 30993 gene locus_tag LOCUS_33860 32027 30993 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_33860 32153 33748 gene locus_tag LOCUS_33870 32153 33748 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_33870 33751 35331 gene locus_tag LOCUS_33880 33751 35331 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_33880 35551 37125 gene locus_tag LOCUS_33890 35551 37125 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_33890 38001 37303 gene locus_tag LOCUS_33900 38001 37303 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_33900 38179 39096 gene locus_tag LOCUS_33910 38179 39096 CDS product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI3 protein_id gnl|my_center|LOCUS_33910 39190 40122 gene locus_tag LOCUS_33920 39190 40122 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_33920 40250 41056 gene locus_tag LOCUS_33930 40250 41056 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268341.1 protein_id gnl|my_center|LOCUS_33930 43041 41113 gene locus_tag LOCUS_33940 43041 41113 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 protein_id gnl|my_center|LOCUS_33940 43278 45203 gene locus_tag LOCUS_33950 43278 45203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245346.1 protein_id gnl|my_center|LOCUS_33950 45222 45908 gene locus_tag LOCUS_33960 45222 45908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_33960 46448 45999 gene locus_tag LOCUS_33970 46448 45999 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_33970 47421 46600 gene locus_tag LOCUS_33980 47421 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119795.1 protein_id gnl|my_center|LOCUS_33980 47363 47590 gene locus_tag LOCUS_33990 47363 47590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 47891 50038 gene locus_tag LOCUS_34000 gene fadB 47891 50038 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_34000 50069 51244 gene locus_tag LOCUS_34010 gene fadA 50069 51244 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ3 protein_id gnl|my_center|LOCUS_34010 51318 51560 gene locus_tag LOCUS_34020 51318 51560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_34020 51802 54411 gene locus_tag LOCUS_34030 gene topA 51802 54411 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_34030 54540 55058 gene locus_tag LOCUS_34040 54540 55058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113979.1 protein_id gnl|my_center|LOCUS_34040 55139 55375 gene locus_tag LOCUS_34050 55139 55375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109483.1 protein_id gnl|my_center|LOCUS_34050 55909 55436 gene locus_tag LOCUS_34060 55909 55436 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA6 protein_id gnl|my_center|LOCUS_34060 56533 55919 gene locus_tag LOCUS_34070 gene lexA 56533 55919 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_34070 56762 57469 gene locus_tag LOCUS_34080 gene psrA 56762 57469 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_34080 57523 58050 gene locus_tag LOCUS_34090 57523 58050 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_34090 58063 59061 gene locus_tag LOCUS_34100 gene nagZ 58063 59061 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK0 protein_id gnl|my_center|LOCUS_34100 59072 59809 gene locus_tag LOCUS_34110 59072 59809 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_34110 60488 59967 gene locus_tag LOCUS_34120 60488 59967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_34120 63937 60500 gene locus_tag LOCUS_34130 gene mfd 63937 60500 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_34130 64069 65535 gene locus_tag LOCUS_34140 64069 65535 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_34140 65968 67179 gene locus_tag LOCUS_34150 gene nqrA 65968 67179 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_34150 67183 68394 gene locus_tag LOCUS_34160 gene nqrB 67183 68394 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_34160 68387 69175 gene locus_tag LOCUS_34170 gene nqrC 68387 69175 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_34170 69178 69846 gene locus_tag LOCUS_34180 gene nqrD 69178 69846 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_34180 69846 70454 gene locus_tag LOCUS_34190 gene nqrE 69846 70454 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_34190 70470 71693 gene locus_tag LOCUS_34200 gene nqrF 70470 71693 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_34200 71799 72722 gene locus_tag LOCUS_34210 71799 72722 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL2 protein_id gnl|my_center|LOCUS_34210 72719 72949 gene locus_tag LOCUS_34220 72719 72949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_34220 73046 74440 gene locus_tag LOCUS_34230 gene sthA 73046 74440 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884I6 protein_id gnl|my_center|LOCUS_34230 >Feature sequence23 403 125 gene locus_tag LOCUS_34240 403 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1857 532 gene locus_tag LOCUS_34250 1857 532 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_34250 2363 1857 gene locus_tag LOCUS_34260 2363 1857 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_34260 3469 2522 gene locus_tag LOCUS_34270 3469 2522 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_34270 4462 3563 gene locus_tag LOCUS_34280 4462 3563 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385186.1 protein_id gnl|my_center|LOCUS_34280 4735 5214 gene locus_tag LOCUS_34290 4735 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 6358 5276 gene locus_tag LOCUS_34300 gene desB 6358 5276 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121132.1 protein_id gnl|my_center|LOCUS_34300 7443 6355 gene locus_tag LOCUS_34310 7443 6355 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112305.1 protein_id gnl|my_center|LOCUS_34310 7591 8226 gene locus_tag LOCUS_34320 gene desT 7591 8226 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107570.1 protein_id gnl|my_center|LOCUS_34320 8390 8890 gene locus_tag LOCUS_34330 gene ureE 8390 8890 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS2 protein_id gnl|my_center|LOCUS_34330 8928 9602 gene locus_tag LOCUS_34340 gene ureF 8928 9602 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMZ0 protein_id gnl|my_center|LOCUS_34340 9619 10233 gene locus_tag LOCUS_34350 gene ureG 9619 10233 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS0 protein_id gnl|my_center|LOCUS_34350 10256 10828 gene locus_tag LOCUS_34360 10256 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112304.1 protein_id gnl|my_center|LOCUS_34360 11028 11942 gene locus_tag LOCUS_34370 11028 11942 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_34370 12466 13080 gene locus_tag LOCUS_34380 gene chpE 12466 13080 CDS product chemotactic transduction protein ChpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87005 protein_id gnl|my_center|LOCUS_34380 13317 13904 gene locus_tag LOCUS_34390 13317 13904 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_34390 13969 14892 gene locus_tag LOCUS_34400 13969 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_34400 15282 15731 gene locus_tag LOCUS_34410 15282 15731 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCT6 protein_id gnl|my_center|LOCUS_34410 16674 15781 gene locus_tag LOCUS_34420 16674 15781 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_34420 19157 16671 gene locus_tag LOCUS_34430 19157 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_34430 22563 19270 gene locus_tag LOCUS_34440 22563 19270 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_34440 23855 22749 gene locus_tag LOCUS_34450 23855 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 25099 23852 gene locus_tag LOCUS_34460 25099 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 25261 25989 gene locus_tag LOCUS_34470 25261 25989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 28406 26109 gene locus_tag LOCUS_34480 28406 26109 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_34480 28696 30603 gene locus_tag LOCUS_34490 28696 30603 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_34490 31902 30826 gene locus_tag LOCUS_34500 gene alr 31902 30826 CDS product alanine racemase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN4 protein_id gnl|my_center|LOCUS_34500 33478 32084 gene locus_tag LOCUS_34510 gene dnaB 33478 32084 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_34510 34043 33597 gene locus_tag LOCUS_34520 gene rplI 34043 33597 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_34520 34958 34065 gene locus_tag LOCUS_34530 34958 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_34530 35225 34995 gene locus_tag LOCUS_34540 gene rpsR 35225 34995 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK4 protein_id gnl|my_center|LOCUS_34540 35676 35254 gene locus_tag LOCUS_34550 gene rpsF 35676 35254 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX1 protein_id gnl|my_center|LOCUS_34550 36842 36078 gene locus_tag LOCUS_34560 gene rlmB 36842 36078 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_34560 39346 36839 gene locus_tag LOCUS_34570 gene rnr 39346 36839 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_34570 39554 39640 gene locus_tag LOCUS_t00360 39554 39640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39725 39811 gene locus_tag LOCUS_t00370 39725 39811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41875 39941 gene locus_tag LOCUS_34580 41875 39941 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266498.1 protein_id gnl|my_center|LOCUS_34580 43332 42037 gene locus_tag LOCUS_34590 gene purA 43332 42037 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ9 protein_id gnl|my_center|LOCUS_34590 44576 43389 gene locus_tag LOCUS_34600 gene hisZ 44576 43389 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_34600 44799 44614 gene locus_tag LOCUS_34610 44799 44614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_34610 45774 44905 gene locus_tag LOCUS_34620 45774 44905 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_34620 46940 45774 gene locus_tag LOCUS_34630 gene hflK 46940 45774 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_34630 48339 47038 gene locus_tag LOCUS_34640 gene hflX 48339 47038 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX9 protein_id gnl|my_center|LOCUS_34640 48612 48352 gene locus_tag LOCUS_34650 gene hfq 48612 48352 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY0 protein_id gnl|my_center|LOCUS_34650 49654 48713 gene locus_tag LOCUS_34660 gene miaA 49654 48713 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_34660 51609 49738 gene locus_tag LOCUS_34670 gene mutL 51609 49738 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_34670 53045 51618 gene locus_tag LOCUS_34680 gene amiB 53045 51618 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_34680 53523 53056 gene locus_tag LOCUS_34690 53523 53056 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_34690 54983 53511 gene locus_tag LOCUS_34700 54983 53511 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_34700 55005 56135 gene locus_tag LOCUS_34710 gene queG 55005 56135 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_34710 56762 56220 gene locus_tag LOCUS_34720 gene orn 56762 56220 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_34720 57562 56792 gene locus_tag LOCUS_34730 57562 56792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 57674 58705 gene locus_tag LOCUS_34740 gene rsgA 57674 58705 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY9 protein_id gnl|my_center|LOCUS_34740 59694 58699 gene locus_tag LOCUS_34750 gene motB 59694 58699 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_34750 60549 59698 gene locus_tag LOCUS_34760 gene motA 60549 59698 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_34760 60668 62191 gene locus_tag LOCUS_34770 60668 62191 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105242.1 protein_id gnl|my_center|LOCUS_34770 62242 63057 gene locus_tag LOCUS_34780 gene rhdA 62242 63057 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_34780 63128 63988 gene locus_tag LOCUS_34790 63128 63988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 64156 65958 gene locus_tag LOCUS_34800 64156 65958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_34800 66021 68090 gene locus_tag LOCUS_34810 gene fimX 66021 68090 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence24 770 216 gene locus_tag LOCUS_34820 770 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1887 1000 gene locus_tag LOCUS_34830 1887 1000 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_34830 2088 2915 gene locus_tag LOCUS_34840 2088 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 protein_id gnl|my_center|LOCUS_34840 3102 4265 gene locus_tag LOCUS_34850 3102 4265 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_34850 4276 5628 gene locus_tag LOCUS_34860 4276 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_34860 5643 6845 gene locus_tag LOCUS_34870 5643 6845 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_34870 6997 7818 gene locus_tag LOCUS_34880 6997 7818 CDS product acyl-CoA lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 protein_id gnl|my_center|LOCUS_34880 7949 8944 gene locus_tag LOCUS_34890 gene dctP 7949 8944 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_34890 10210 9275 gene locus_tag LOCUS_34900 10210 9275 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_34900 11682 10480 gene locus_tag LOCUS_34910 11682 10480 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_34910 11851 12771 gene locus_tag LOCUS_34920 11851 12771 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 protein_id gnl|my_center|LOCUS_34920 12889 13893 gene locus_tag LOCUS_34930 gene dctP 12889 13893 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_34930 14187 14816 gene locus_tag LOCUS_34940 gene dctQ 14187 14816 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU17 protein_id gnl|my_center|LOCUS_34940 14813 16093 gene locus_tag LOCUS_34950 gene dctM 14813 16093 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_34950 16335 18296 gene locus_tag LOCUS_34960 gene acsA1 16335 18296 CDS product acetyl-coenzyme A synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I558 protein_id gnl|my_center|LOCUS_34960 18514 19239 gene locus_tag LOCUS_34970 18514 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 19387 20169 gene locus_tag LOCUS_34980 19387 20169 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_34980 21032 20355 gene locus_tag LOCUS_34990 21032 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_34990 21150 21551 gene locus_tag LOCUS_35000 21150 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 protein_id gnl|my_center|LOCUS_35000 23186 21786 gene locus_tag LOCUS_35010 gene oprJ 23186 21786 CDS product outer membrane protein OprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51397 protein_id gnl|my_center|LOCUS_35010 26325 23191 gene locus_tag LOCUS_35020 gene saxG 26325 23191 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104100.1 protein_id gnl|my_center|LOCUS_35020 27513 26341 gene locus_tag LOCUS_35030 27513 26341 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104101.1 protein_id gnl|my_center|LOCUS_35030 27686 28237 gene locus_tag LOCUS_35040 gene nfxB 27686 28237 CDS product HTH-type transcriptional regulator nfxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32265 protein_id gnl|my_center|LOCUS_35040 28963 28265 gene locus_tag LOCUS_35050 gene csgA 28963 28265 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_35050 29493 28960 gene locus_tag LOCUS_35060 29493 28960 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_35060 30047 29502 gene locus_tag LOCUS_35070 30047 29502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 protein_id gnl|my_center|LOCUS_35070 31956 30178 gene locus_tag LOCUS_35080 31956 30178 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_35080 32922 32290 gene locus_tag LOCUS_35090 32922 32290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 32903 33385 gene locus_tag LOCUS_35100 32903 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 33466 34827 gene locus_tag LOCUS_35110 gene dos 33466 34827 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206293.1 protein_id gnl|my_center|LOCUS_35110 35059 35715 gene locus_tag LOCUS_35120 35059 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_35120 36892 35720 gene locus_tag LOCUS_35130 gene visC 36892 35720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_35130 37223 38209 gene locus_tag LOCUS_35140 gene glk 37223 38209 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887K3 protein_id gnl|my_center|LOCUS_35140 38407 39141 gene locus_tag LOCUS_35150 gene gltR 38407 39141 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091475.1 protein_id gnl|my_center|LOCUS_35150 39131 40573 gene locus_tag LOCUS_35160 39131 40573 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266832.1 protein_id gnl|my_center|LOCUS_35160 40773 42026 gene locus_tag LOCUS_35170 40773 42026 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_35170 42401 43309 gene locus_tag LOCUS_35180 42401 43309 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_35180 43380 44207 gene locus_tag LOCUS_35190 43380 44207 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615493.1 protein_id gnl|my_center|LOCUS_35190 44341 45486 gene locus_tag LOCUS_35200 gene gltK 44341 45486 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764049.1 protein_id gnl|my_center|LOCUS_35200 45627 46865 gene locus_tag LOCUS_35210 gene lamB 45627 46865 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_35210 48485 47073 gene locus_tag LOCUS_35220 48485 47073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_35220 50333 48921 gene locus_tag LOCUS_35230 50333 48921 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35230 50676 52343 gene locus_tag LOCUS_35240 50676 52343 CDS product sulfite/nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113006.1 protein_id gnl|my_center|LOCUS_35240 52340 52858 gene locus_tag LOCUS_35250 52340 52858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093457.1 protein_id gnl|my_center|LOCUS_35250 52855 53208 gene locus_tag LOCUS_35260 52855 53208 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407954.1 protein_id gnl|my_center|LOCUS_35260 53205 53888 gene locus_tag LOCUS_35270 53205 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_35270 54186 55793 gene locus_tag LOCUS_35280 gene mqo1 54186 55793 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_35280 56412 56026 gene locus_tag LOCUS_35290 56412 56026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 57394 56681 gene locus_tag LOCUS_35300 57394 56681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 60019 57536 gene locus_tag LOCUS_35310 gene plsB 60019 57536 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU3 protein_id gnl|my_center|LOCUS_35310 60159 60338 gene locus_tag LOCUS_35320 60159 60338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 61407 60565 gene locus_tag LOCUS_35330 61407 60565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 protein_id gnl|my_center|LOCUS_35330 61766 63577 gene locus_tag LOCUS_35340 61766 63577 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084180.1 protein_id gnl|my_center|LOCUS_35340 64050 63634 gene locus_tag LOCUS_35350 64050 63634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 64453 64061 gene locus_tag LOCUS_35360 64453 64061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 65801 64893 gene locus_tag LOCUS_35370 65801 64893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 66937 65909 gene locus_tag LOCUS_35380 66937 65909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974295.1 protein_id gnl|my_center|LOCUS_35380 67625 67050 gene locus_tag LOCUS_35390 67625 67050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence25 455 1015 gene locus_tag LOCUS_35400 455 1015 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404145.1 protein_id gnl|my_center|LOCUS_35400 2356 1028 gene locus_tag LOCUS_35410 2356 1028 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 protein_id gnl|my_center|LOCUS_35410 2834 2421 gene locus_tag LOCUS_35420 2834 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114831.1 protein_id gnl|my_center|LOCUS_35420 3806 3129 gene locus_tag LOCUS_35430 3806 3129 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 protein_id gnl|my_center|LOCUS_35430 4184 3810 gene locus_tag LOCUS_35440 4184 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4525 4226 gene locus_tag LOCUS_35450 4525 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_35450 4598 5509 gene locus_tag LOCUS_35460 4598 5509 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_35460 5481 6149 gene locus_tag LOCUS_35470 5481 6149 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396553.1 protein_id gnl|my_center|LOCUS_35470 6221 7435 gene locus_tag LOCUS_35480 gene trpS-1 6221 7435 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_35480 7450 8274 gene locus_tag LOCUS_35490 7450 8274 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_35490 8271 9068 gene locus_tag LOCUS_35500 8271 9068 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L8 protein_id gnl|my_center|LOCUS_35500 9166 9315 gene locus_tag LOCUS_35510 9166 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 9532 10689 gene locus_tag LOCUS_35520 gene rluB 9532 10689 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ55 protein_id gnl|my_center|LOCUS_35520 11730 10804 gene locus_tag LOCUS_35530 11730 10804 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_35530 12713 11973 gene locus_tag LOCUS_35540 12713 11973 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_35540 13460 12789 gene locus_tag LOCUS_35550 gene gph2 13460 12789 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_35550 14158 13460 gene locus_tag LOCUS_35560 gene ubiG 14158 13460 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_35560 15768 14383 gene locus_tag LOCUS_35570 15768 14383 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_35570 15929 17005 gene locus_tag LOCUS_35580 gene mtnA 15929 17005 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_35580 17857 20625 gene locus_tag LOCUS_35590 gene gyrA 17857 20625 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48372 protein_id gnl|my_center|LOCUS_35590 20757 21863 gene locus_tag LOCUS_35600 gene serC 20757 21863 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_35600 21865 22959 gene locus_tag LOCUS_35610 21865 22959 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_35610 23230 23024 gene locus_tag LOCUS_35620 23230 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 23321 23692 gene locus_tag LOCUS_35630 23321 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 23953 25062 gene locus_tag LOCUS_35640 gene hisC2 23953 25062 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_35640 25059 27299 gene locus_tag LOCUS_35650 gene aroA 25059 27299 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_35650 27296 27961 gene locus_tag LOCUS_35660 gene cmk 27296 27961 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T2 protein_id gnl|my_center|LOCUS_35660 28111 29793 gene locus_tag LOCUS_35670 gene rpsA 28111 29793 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_35670 31201 31485 gene locus_tag LOCUS_35680 gene ihfB 31201 31485 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_35680 31783 33183 gene locus_tag LOCUS_35690 31783 33183 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268561.1 protein_id gnl|my_center|LOCUS_35690 33323 34552 gene locus_tag LOCUS_35700 33323 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_35700 34621 35985 gene locus_tag LOCUS_35710 gene manB 34621 35985 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_35710 35982 37112 gene locus_tag LOCUS_35720 gene rfbB 35982 37112 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMB1 protein_id gnl|my_center|LOCUS_35720 37245 38120 gene locus_tag LOCUS_35730 gene rmlA 37245 38120 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECF6 protein_id gnl|my_center|LOCUS_35730 38123 38695 gene locus_tag LOCUS_35740 gene vioB 38123 38695 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084180.1 protein_id gnl|my_center|LOCUS_35740 38682 39812 gene locus_tag LOCUS_35750 gene wecE 38682 39812 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM85 protein_id gnl|my_center|LOCUS_35750 39809 41215 gene locus_tag LOCUS_35760 39809 41215 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208049.1 protein_id gnl|my_center|LOCUS_35760 41218 42516 gene locus_tag LOCUS_35770 41218 42516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 42588 43454 gene locus_tag LOCUS_35780 42588 43454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 43867 45369 gene locus_tag LOCUS_35790 43867 45369 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_35790 45327 46496 gene locus_tag LOCUS_35800 45327 46496 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_35800 46542 47810 gene locus_tag LOCUS_35810 gene wbpO 46542 47810 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_35810 47851 48873 gene locus_tag LOCUS_35820 gene wbpP 47851 48873 CDS product UDP-GlkcNAc C4 epimerase WbpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_35820 48898 50007 gene locus_tag LOCUS_35830 48898 50007 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_35830 50004 50600 gene locus_tag LOCUS_35840 50004 50600 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_35840 50597 51220 gene locus_tag LOCUS_35850 50597 51220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 51236 52411 gene locus_tag LOCUS_35860 51236 52411 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_35860 52560 52925 gene locus_tag LOCUS_35870 52560 52925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 52995 55007 gene locus_tag LOCUS_35880 gene wbpM 52995 55007 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_35880 55590 55036 gene locus_tag LOCUS_35890 55590 55036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35890 55954 55879 gene locus_tag LOCUS_t00380 55954 55879 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 57642 56446 gene locus_tag LOCUS_35900 gene aspC 57642 56446 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72173 protein_id gnl|my_center|LOCUS_35900 57888 59903 gene locus_tag LOCUS_35910 gene uvrB 57888 59903 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV05 protein_id gnl|my_center|LOCUS_35910 61011 60118 gene locus_tag LOCUS_35920 61011 60118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 61310 60954 gene locus_tag LOCUS_35930 61310 60954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 62170 61292 gene locus_tag LOCUS_35940 62170 61292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 62188 62493 gene locus_tag LOCUS_35950 62188 62493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35950 62661 64142 gene locus_tag LOCUS_35960 gene gltX 62661 64142 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_35960 64345 64420 gene locus_tag LOCUS_t00390 64345 64420 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 64481 64556 gene locus_tag LOCUS_t00400 64481 64556 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 64606 64681 gene locus_tag LOCUS_t00410 64606 64681 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 1047 1751 gene locus_tag LOCUS_35970 gene pcpS 1047 1751 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 protein_id gnl|my_center|LOCUS_35970 3625 2018 gene locus_tag LOCUS_35980 3625 2018 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_35980 4391 3636 gene locus_tag LOCUS_35990 4391 3636 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_35990 5154 8063 gene locus_tag LOCUS_36000 gene nrdA 5154 8063 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_36000 8522 9772 gene locus_tag LOCUS_36010 gene nrdB 8522 9772 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I2 protein_id gnl|my_center|LOCUS_36010 10920 10708 gene locus_tag LOCUS_36020 10920 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 11320 12099 gene locus_tag LOCUS_36030 11320 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 12417 12953 gene locus_tag LOCUS_36040 12417 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_36040 13285 13097 gene locus_tag LOCUS_36050 13285 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 13604 13269 gene locus_tag LOCUS_36060 13604 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104024.1 protein_id gnl|my_center|LOCUS_36060 13832 15004 gene locus_tag LOCUS_36070 13832 15004 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040458.1 protein_id gnl|my_center|LOCUS_36070 15114 15809 gene locus_tag LOCUS_36080 15114 15809 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 protein_id gnl|my_center|LOCUS_36080 16855 15956 gene locus_tag LOCUS_36090 gene gcvA 16855 15956 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974849.1 protein_id gnl|my_center|LOCUS_36090 16975 17676 gene locus_tag LOCUS_36100 gene azoR 16975 17676 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 protein_id gnl|my_center|LOCUS_36100 18455 17712 gene locus_tag LOCUS_36110 18455 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_36110 18740 19003 gene locus_tag LOCUS_36120 18740 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 19195 19542 gene locus_tag LOCUS_36130 19195 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 protein_id gnl|my_center|LOCUS_36130 19677 20153 gene locus_tag LOCUS_36140 gene eco 19677 20153 CDS product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I088 protein_id gnl|my_center|LOCUS_36140 20604 20191 gene locus_tag LOCUS_36150 20604 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 20723 21181 gene locus_tag LOCUS_36160 20723 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 21871 21227 gene locus_tag LOCUS_36170 21871 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 protein_id gnl|my_center|LOCUS_36170 22016 24025 gene locus_tag LOCUS_36180 22016 24025 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_36180 24454 24146 gene locus_tag LOCUS_36190 24454 24146 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142851.1 protein_id gnl|my_center|LOCUS_36190 24608 25195 gene locus_tag LOCUS_36200 24608 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 protein_id gnl|my_center|LOCUS_36200 26057 25209 gene locus_tag LOCUS_36210 26057 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112483.1 protein_id gnl|my_center|LOCUS_36210 26336 27295 gene locus_tag LOCUS_36220 26336 27295 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391138.1 protein_id gnl|my_center|LOCUS_36220 27756 27307 gene locus_tag LOCUS_36230 27756 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 28233 27892 gene locus_tag LOCUS_36240 28233 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 28401 28682 gene locus_tag LOCUS_36250 28401 28682 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_36250 28764 30293 gene locus_tag LOCUS_36260 28764 30293 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104099.1 protein_id gnl|my_center|LOCUS_36260 30444 30893 gene locus_tag LOCUS_36270 30444 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 31971 31078 gene locus_tag LOCUS_36280 31971 31078 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189104.1 protein_id gnl|my_center|LOCUS_36280 32111 32845 gene locus_tag LOCUS_36290 32111 32845 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_36290 33724 33011 gene locus_tag LOCUS_36300 33724 33011 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_36300 33940 34059 gene locus_tag LOCUS_36310 33940 34059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 34234 34935 gene locus_tag LOCUS_36320 34234 34935 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS10 protein_id gnl|my_center|LOCUS_36320 35072 35341 gene locus_tag LOCUS_36330 35072 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 35484 35813 gene locus_tag LOCUS_36340 35484 35813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082265.1 protein_id gnl|my_center|LOCUS_36340 36865 35957 gene locus_tag LOCUS_36350 36865 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 38365 36881 gene locus_tag LOCUS_36360 38365 36881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 39170 38382 gene locus_tag LOCUS_36370 39170 38382 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_36370 39313 39723 gene locus_tag LOCUS_36380 39313 39723 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268641.1 protein_id gnl|my_center|LOCUS_36380 39832 40878 gene locus_tag LOCUS_36390 39832 40878 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_36390 41209 40883 gene locus_tag LOCUS_36400 41209 40883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 42422 41403 gene locus_tag LOCUS_36410 42422 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 42528 43406 gene locus_tag LOCUS_36420 42528 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 43518 46964 gene locus_tag LOCUS_36430 43518 46964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 46983 47726 gene locus_tag LOCUS_36440 46983 47726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 47723 48532 gene locus_tag LOCUS_36450 47723 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 protein_id gnl|my_center|LOCUS_36450 48732 48657 gene locus_tag LOCUS_t00420 48732 48657 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49630 48788 gene locus_tag LOCUS_36460 49630 48788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_36460 49871 50062 gene locus_tag LOCUS_36470 49871 50062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719741.1 protein_id gnl|my_center|LOCUS_36470 51247 50102 gene locus_tag LOCUS_36480 51247 50102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_36480 52056 51331 gene locus_tag LOCUS_36490 52056 51331 CDS product polar amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_36490 52204 53181 gene locus_tag LOCUS_36500 52204 53181 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_36500 53466 55637 gene locus_tag LOCUS_36510 53466 55637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 56054 57883 gene locus_tag LOCUS_36520 56054 57883 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36520 58765 57986 gene locus_tag LOCUS_36530 gene hyi 58765 57986 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_36530 59652 58762 gene locus_tag LOCUS_36540 59652 58762 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_36540 59788 60639 gene locus_tag LOCUS_36550 59788 60639 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 protein_id gnl|my_center|LOCUS_36550 60636 61436 gene locus_tag LOCUS_36560 gene phnC1 60636 61436 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_36560 61430 62257 gene locus_tag LOCUS_36570 61430 62257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_36570 62254 63015 gene locus_tag LOCUS_36580 62254 63015 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266574.1 protein_id gnl|my_center|LOCUS_36580 63210 63911 gene locus_tag LOCUS_36590 63210 63911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence27 <1 654 gene locus_tag LOCUS_36600 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I099:threonine--tRNA ligase 672 1205 gene locus_tag LOCUS_36610 gene infC 672 1205 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_36610 1266 1460 gene locus_tag LOCUS_36620 gene rpmI 1266 1460 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG5 protein_id gnl|my_center|LOCUS_36620 1490 1846 gene locus_tag LOCUS_36630 gene rplT 1490 1846 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A159 protein_id gnl|my_center|LOCUS_36630 1943 2959 gene locus_tag LOCUS_36640 gene pheS 1943 2959 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_36640 3136 5517 gene locus_tag LOCUS_36650 gene pheT 3136 5517 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 protein_id gnl|my_center|LOCUS_36650 5521 5823 gene locus_tag LOCUS_36660 gene ihfA 5521 5823 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_36660 5804 6160 gene locus_tag LOCUS_36670 5804 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_36670 6236 6312 gene locus_tag LOCUS_t00430 6236 6312 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7607 6408 gene locus_tag LOCUS_36680 gene intD 7607 6408 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_36680 8457 9374 gene locus_tag LOCUS_36690 8457 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 10745 9507 gene locus_tag LOCUS_36700 10745 9507 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_36700 11038 10742 gene locus_tag LOCUS_36710 11038 10742 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015969.1 protein_id gnl|my_center|LOCUS_36710 11589 11335 gene locus_tag LOCUS_36720 11589 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 12194 11586 gene locus_tag LOCUS_36730 12194 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 12907 12329 gene locus_tag LOCUS_36740 12907 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 13719 13588 gene locus_tag LOCUS_36750 13719 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 13726 14223 gene locus_tag LOCUS_36760 13726 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 14509 15429 gene locus_tag LOCUS_36770 14509 15429 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 protein_id gnl|my_center|LOCUS_36770 15422 16783 gene locus_tag LOCUS_36780 15422 16783 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_36780 16795 17118 gene locus_tag LOCUS_36790 16795 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 17132 17584 gene locus_tag LOCUS_36800 17132 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 18323 17616 gene locus_tag LOCUS_36810 18323 17616 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 protein_id gnl|my_center|LOCUS_36810 18760 18320 gene locus_tag LOCUS_36820 18760 18320 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_36820 19865 18762 gene locus_tag LOCUS_36830 19865 18762 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU72 protein_id gnl|my_center|LOCUS_36830 20159 19872 gene locus_tag LOCUS_36840 20159 19872 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764692.1 protein_id gnl|my_center|LOCUS_36840 20270 20629 gene locus_tag LOCUS_36850 20270 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 20676 21413 gene locus_tag LOCUS_36860 20676 21413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_36860 21425 22099 gene locus_tag LOCUS_36870 21425 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_36870 23254 22559 gene locus_tag LOCUS_36880 23254 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706194.1 protein_id gnl|my_center|LOCUS_36880 23661 23254 gene locus_tag LOCUS_36890 23661 23254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 24013 23747 gene locus_tag LOCUS_36900 24013 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 24651 24013 gene locus_tag LOCUS_36910 24651 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36910 25076 24768 gene locus_tag LOCUS_36920 25076 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 25838 25416 gene locus_tag LOCUS_36930 25838 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 25932 25726 gene locus_tag LOCUS_36940 25932 25726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36940 29700 26500 gene locus_tag LOCUS_36950 29700 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 30155 29697 gene locus_tag LOCUS_36960 30155 29697 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_36960 35578 30152 gene locus_tag LOCUS_36970 35578 30152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 37824 35581 gene locus_tag LOCUS_36980 37824 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 38964 37834 gene locus_tag LOCUS_36990 38964 37834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 39625 38957 gene locus_tag LOCUS_37000 gene mglA 39625 38957 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_37000 40157 39618 gene locus_tag LOCUS_37010 40157 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 41497 40154 gene locus_tag LOCUS_37020 41497 40154 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_37020 42777 41494 gene locus_tag LOCUS_37030 42777 41494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 44323 43670 gene locus_tag LOCUS_37040 44323 43670 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086251.1 protein_id gnl|my_center|LOCUS_37040 44512 45216 gene locus_tag LOCUS_37050 44512 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 45291 45614 gene locus_tag LOCUS_37060 45291 45614 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268558.1 protein_id gnl|my_center|LOCUS_37060 45776 49189 gene locus_tag LOCUS_37070 gene recC 45776 49189 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB5 protein_id gnl|my_center|LOCUS_37070 49186 52815 gene locus_tag LOCUS_37080 gene recB 49186 52815 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYM1 protein_id gnl|my_center|LOCUS_37080 52812 54842 gene locus_tag LOCUS_37090 gene recD 52812 54842 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889H1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence28 1826 324 gene locus_tag LOCUS_37100 1826 324 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_37100 2434 1925 gene locus_tag LOCUS_37110 gene allA 2434 1925 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_37110 3162 2431 gene locus_tag LOCUS_37120 3162 2431 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432251.1 protein_id gnl|my_center|LOCUS_37120 3796 3149 gene locus_tag LOCUS_37130 3796 3149 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105389.1 protein_id gnl|my_center|LOCUS_37130 4461 3796 gene locus_tag LOCUS_37140 4461 3796 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 protein_id gnl|my_center|LOCUS_37140 5267 4482 gene locus_tag LOCUS_37150 5267 4482 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266305.1 protein_id gnl|my_center|LOCUS_37150 5555 6259 gene locus_tag LOCUS_37160 5555 6259 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247319.1 protein_id gnl|my_center|LOCUS_37160 6431 6757 gene locus_tag LOCUS_37170 gene trxA 6431 6757 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_37170 7068 8327 gene locus_tag LOCUS_37180 gene rho 7068 8327 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_37180 8461 9927 gene locus_tag LOCUS_37190 gene ubiD 8461 9927 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV3 protein_id gnl|my_center|LOCUS_37190 9927 10895 gene locus_tag LOCUS_37200 9927 10895 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_37200 11937 10957 gene locus_tag LOCUS_37210 11937 10957 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_37210 12051 12497 gene locus_tag LOCUS_37220 12051 12497 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551568.1 protein_id gnl|my_center|LOCUS_37220 13391 12663 gene locus_tag LOCUS_37230 13391 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 14049 13429 gene locus_tag LOCUS_37240 14049 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 14501 14704 gene locus_tag LOCUS_37250 14501 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 14889 15119 gene locus_tag LOCUS_37260 14889 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 15107 15571 gene locus_tag LOCUS_37270 15107 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407251.1 protein_id gnl|my_center|LOCUS_37270 18396 16603 gene locus_tag LOCUS_37280 18396 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37280 19421 18393 gene locus_tag LOCUS_37290 19421 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37290 20374 19418 gene locus_tag LOCUS_37300 20374 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 20762 20436 gene locus_tag LOCUS_37310 20762 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 21287 21072 gene locus_tag LOCUS_37320 21287 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 23177 21786 gene locus_tag LOCUS_37330 23177 21786 CDS product phage integrase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204924.1 protein_id gnl|my_center|LOCUS_37330 24625 23501 gene locus_tag LOCUS_37340 24625 23501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_37340 27330 24625 gene locus_tag LOCUS_37350 27330 24625 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_37350 28418 27327 gene locus_tag LOCUS_37360 28418 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_37360 30319 28463 gene locus_tag LOCUS_37370 30319 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 30818 30369 gene locus_tag LOCUS_37380 30818 30369 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114044.1 protein_id gnl|my_center|LOCUS_37380 31796 31200 gene locus_tag LOCUS_37390 31796 31200 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_37390 32403 32098 gene locus_tag LOCUS_37400 gene zapA 32403 32098 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_37400 32609 32400 gene locus_tag LOCUS_37410 32609 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 32945 33499 gene locus_tag LOCUS_37420 32945 33499 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US2 protein_id gnl|my_center|LOCUS_37420 33519 34853 gene locus_tag LOCUS_37430 gene pepP 33519 34853 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_37430 34858 36042 gene locus_tag LOCUS_37440 gene ubiH 34858 36042 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_37440 36121 37338 gene locus_tag LOCUS_37450 36121 37338 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_37450 37450 38451 gene locus_tag LOCUS_37460 37450 38451 CDS product putative binding protein component of ABC iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX3 protein_id gnl|my_center|LOCUS_37460 38647 40263 gene locus_tag LOCUS_37470 38647 40263 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_37470 40578 41660 gene locus_tag LOCUS_37480 gene gcvT 40578 41660 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_37480 41755 42144 gene locus_tag LOCUS_37490 gene gcvH2 41755 42144 CDS product glycine cleavage system H protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX6 protein_id gnl|my_center|LOCUS_37490 42464 42778 gene locus_tag LOCUS_37500 42464 42778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184362.1 protein_id gnl|my_center|LOCUS_37500 42775 43209 gene locus_tag LOCUS_37510 42775 43209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_37510 43212 43631 gene locus_tag LOCUS_37520 43212 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_37520 43950 44939 gene locus_tag LOCUS_37530 43950 44939 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_37530 46147 45041 gene locus_tag LOCUS_37540 gene aguA 46147 45041 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_37540 47099 46218 gene locus_tag LOCUS_37550 gene aguB 47099 46218 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_37550 48001 47360 gene locus_tag LOCUS_37560 gene aguR 48001 47360 CDS product transcriptional regulator AguR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_37560 49131 48073 gene locus_tag LOCUS_37570 49131 48073 CDS product polyamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107781.1 protein_id gnl|my_center|LOCUS_37570 50828 49449 gene locus_tag LOCUS_37580 50828 49449 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 protein_id gnl|my_center|LOCUS_37580 51623 52981 gene locus_tag LOCUS_37590 gene spuB 51623 52981 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 protein_id gnl|my_center|LOCUS_37590 >Feature sequence29 332 673 gene locus_tag LOCUS_37600 gene sugE 332 673 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_37600 1004 825 gene locus_tag LOCUS_37610 1004 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 2432 1059 gene locus_tag LOCUS_37620 2432 1059 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_37620 3666 2680 gene locus_tag LOCUS_37630 3666 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 6288 3943 gene locus_tag LOCUS_37640 6288 3943 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968355.1 protein_id gnl|my_center|LOCUS_37640 7769 6399 gene locus_tag LOCUS_37650 7769 6399 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_37650 8680 7766 gene locus_tag LOCUS_37660 gene folD2 8680 7766 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B5 protein_id gnl|my_center|LOCUS_37660 9531 8677 gene locus_tag LOCUS_37670 gene purU-2 9531 8677 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B4 protein_id gnl|my_center|LOCUS_37670 10695 9565 gene locus_tag LOCUS_37680 10695 9565 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067514.1 protein_id gnl|my_center|LOCUS_37680 11739 10723 gene locus_tag LOCUS_37690 11739 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_37690 12685 11756 gene locus_tag LOCUS_37700 12685 11756 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 protein_id gnl|my_center|LOCUS_37700 13209 12682 gene locus_tag LOCUS_37710 13209 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 13402 14067 gene locus_tag LOCUS_37720 13402 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 14759 14274 gene locus_tag LOCUS_37730 14759 14274 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405523.1 protein_id gnl|my_center|LOCUS_37730 16204 15050 gene locus_tag LOCUS_37740 16204 15050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267653.1 protein_id gnl|my_center|LOCUS_37740 17031 16222 gene locus_tag LOCUS_37750 17031 16222 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104134.1 protein_id gnl|my_center|LOCUS_37750 17931 17035 gene locus_tag LOCUS_37760 17931 17035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267654.1 protein_id gnl|my_center|LOCUS_37760 18953 17928 gene locus_tag LOCUS_37770 18953 17928 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762684.1 protein_id gnl|my_center|LOCUS_37770 20430 19321 gene locus_tag LOCUS_37780 gene ribB 20430 19321 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTT1 protein_id gnl|my_center|LOCUS_37780 20511 20798 gene locus_tag LOCUS_37790 20511 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_37790 21920 21000 gene locus_tag LOCUS_37800 gene rdgC 21920 21000 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW36 protein_id gnl|my_center|LOCUS_37800 22225 22300 gene locus_tag LOCUS_t00440 22225 22300 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22316 22392 gene locus_tag LOCUS_t00450 22316 22392 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22580 23296 gene locus_tag LOCUS_37810 22580 23296 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW30 protein_id gnl|my_center|LOCUS_37810 23632 24075 gene locus_tag LOCUS_37820 23632 24075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408555.1 protein_id gnl|my_center|LOCUS_37820 24217 24540 gene locus_tag LOCUS_37830 24217 24540 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770454.1 protein_id gnl|my_center|LOCUS_37830 24537 24902 gene locus_tag LOCUS_37840 24537 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267117.1 protein_id gnl|my_center|LOCUS_37840 24895 25380 gene locus_tag LOCUS_37850 24895 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 protein_id gnl|my_center|LOCUS_37850 27123 25369 gene locus_tag LOCUS_37860 27123 25369 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_37860 29303 27222 gene locus_tag LOCUS_37870 gene prc 29303 27222 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_37870 29432 30394 gene locus_tag LOCUS_37880 29432 30394 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_37880 30550 31113 gene locus_tag LOCUS_37890 gene ahpC 30550 31113 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_37890 31266 32822 gene locus_tag LOCUS_37900 gene ahpF 31266 32822 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z2 protein_id gnl|my_center|LOCUS_37900 33820 32978 gene locus_tag LOCUS_37910 33820 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086528.1 protein_id gnl|my_center|LOCUS_37910 33964 34818 gene locus_tag LOCUS_37920 33964 34818 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 protein_id gnl|my_center|LOCUS_37920 35572 34919 gene locus_tag LOCUS_37930 35572 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_37930 36558 35572 gene locus_tag LOCUS_37940 36558 35572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 protein_id gnl|my_center|LOCUS_37940 37349 36555 gene locus_tag LOCUS_37950 37349 36555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770465.1 protein_id gnl|my_center|LOCUS_37950 38178 37336 gene locus_tag LOCUS_37960 38178 37336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 protein_id gnl|my_center|LOCUS_37960 38981 38175 gene locus_tag LOCUS_37970 38981 38175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104767.1 protein_id gnl|my_center|LOCUS_37970 40142 39084 gene locus_tag LOCUS_37980 40142 39084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091586.1 protein_id gnl|my_center|LOCUS_37980 40458 41174 gene locus_tag LOCUS_37990 40458 41174 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091585.1 protein_id gnl|my_center|LOCUS_37990 41323 41697 gene locus_tag LOCUS_38000 41323 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_38000 41731 42513 gene locus_tag LOCUS_38010 41731 42513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_38010 42679 43101 gene locus_tag LOCUS_38020 42679 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 44083 43133 gene locus_tag LOCUS_38030 44083 43133 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_38030 44273 44983 gene locus_tag LOCUS_38040 44273 44983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_38040 44971 45387 gene locus_tag LOCUS_38050 44971 45387 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262590.1 protein_id gnl|my_center|LOCUS_38050 45931 45395 gene locus_tag LOCUS_38060 45931 45395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 46086 47213 gene locus_tag LOCUS_38070 46086 47213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114765.1 protein_id gnl|my_center|LOCUS_38070 48644 47385 gene locus_tag LOCUS_38080 48644 47385 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267448.1 protein_id gnl|my_center|LOCUS_38080 49128 49481 gene locus_tag LOCUS_38090 49128 49481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 49936 49478 gene locus_tag LOCUS_38100 49936 49478 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368733.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence30 669 382 gene locus_tag LOCUS_38110 669 382 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266148.1 protein_id gnl|my_center|LOCUS_38110 2714 666 gene locus_tag LOCUS_38120 gene prlC 2714 666 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114658.1 protein_id gnl|my_center|LOCUS_38120 2844 3386 gene locus_tag LOCUS_38130 2844 3386 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_38130 3383 3883 gene locus_tag LOCUS_38140 3383 3883 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104065.1 protein_id gnl|my_center|LOCUS_38140 4347 5318 gene locus_tag LOCUS_38150 4347 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114660.1 protein_id gnl|my_center|LOCUS_38150 5378 6025 gene locus_tag LOCUS_38160 5378 6025 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I767 protein_id gnl|my_center|LOCUS_38160 6519 6289 gene locus_tag LOCUS_38170 6519 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318449.1 protein_id gnl|my_center|LOCUS_38170 7645 6584 gene locus_tag LOCUS_38180 7645 6584 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_38180 7770 8192 gene locus_tag LOCUS_38190 7770 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 protein_id gnl|my_center|LOCUS_38190 8677 8252 gene locus_tag LOCUS_38200 gene osmC 8677 8252 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_38200 9761 8760 gene locus_tag LOCUS_38210 9761 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768139.1 protein_id gnl|my_center|LOCUS_38210 10986 9958 gene locus_tag LOCUS_38220 10986 9958 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_38220 11158 12129 gene locus_tag LOCUS_38230 11158 12129 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704329.1 protein_id gnl|my_center|LOCUS_38230 12277 14835 gene locus_tag LOCUS_38240 12277 14835 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_38240 15102 16610 gene locus_tag LOCUS_38250 15102 16610 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143047.1 protein_id gnl|my_center|LOCUS_38250 18252 16612 gene locus_tag LOCUS_38260 18252 16612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102996.1 protein_id gnl|my_center|LOCUS_38260 19471 18341 gene locus_tag LOCUS_38270 gene uptC 19471 18341 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_38270 19659 20399 gene locus_tag LOCUS_38280 19659 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 21321 20416 gene locus_tag LOCUS_38290 21321 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_38290 21390 21794 gene locus_tag LOCUS_38300 21390 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102545.1 protein_id gnl|my_center|LOCUS_38300 22031 23371 gene locus_tag LOCUS_38310 22031 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267842.1 protein_id gnl|my_center|LOCUS_38310 23441 26422 gene locus_tag LOCUS_38320 23441 26422 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816324.1 protein_id gnl|my_center|LOCUS_38320 26419 29133 gene locus_tag LOCUS_38330 26419 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267840.1 protein_id gnl|my_center|LOCUS_38330 29137 30156 gene locus_tag LOCUS_38340 29137 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267839.1 protein_id gnl|my_center|LOCUS_38340 30153 32141 gene locus_tag LOCUS_38350 30153 32141 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 protein_id gnl|my_center|LOCUS_38350 32152 32868 gene locus_tag LOCUS_38360 32152 32868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771461.1 protein_id gnl|my_center|LOCUS_38360 32855 34081 gene locus_tag LOCUS_38370 32855 34081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771463.1 protein_id gnl|my_center|LOCUS_38370 34038 35636 gene locus_tag LOCUS_38380 34038 35636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267835.1 protein_id gnl|my_center|LOCUS_38380 35646 36374 gene locus_tag LOCUS_38390 35646 36374 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267834.1 protein_id gnl|my_center|LOCUS_38390 36520 37011 gene locus_tag LOCUS_38400 36520 37011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 37090 38727 gene locus_tag LOCUS_38410 37090 38727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 40785 38830 gene locus_tag LOCUS_38420 40785 38830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269381.1 protein_id gnl|my_center|LOCUS_38420 41102 40782 gene locus_tag LOCUS_38430 41102 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096910.1 protein_id gnl|my_center|LOCUS_38430 41571 41248 gene locus_tag LOCUS_38440 41571 41248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 41858 41655 gene locus_tag LOCUS_38450 41858 41655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 42298 42083 gene locus_tag LOCUS_38460 42298 42083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555870.1 protein_id gnl|my_center|LOCUS_38460 44093 42657 gene locus_tag LOCUS_38470 gene pntB 44093 42657 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6T9 protein_id gnl|my_center|LOCUS_38470 44410 44096 gene locus_tag LOCUS_38480 gene pntAB 44410 44096 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_38480 45543 44422 gene locus_tag LOCUS_38490 gene pntAA 45543 44422 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_38490 46908 46012 gene locus_tag LOCUS_38500 46908 46012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269377.1 protein_id gnl|my_center|LOCUS_38500 47089 48267 gene locus_tag LOCUS_38510 gene gcdH 47089 48267 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_38510 48324 49547 gene locus_tag LOCUS_38520 48324 49547 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269376.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence31 975 61 gene locus_tag LOCUS_38530 975 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_38530 1394 1047 gene locus_tag LOCUS_38540 1394 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084357.1 protein_id gnl|my_center|LOCUS_38540 2413 1496 gene locus_tag LOCUS_38550 2413 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121726.1 protein_id gnl|my_center|LOCUS_38550 3162 2497 gene locus_tag LOCUS_38560 3162 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_38560 4667 3276 gene locus_tag LOCUS_38570 4667 3276 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_38570 4849 6078 gene locus_tag LOCUS_38580 gene serA 4849 6078 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_38580 6827 6321 gene locus_tag LOCUS_38590 6827 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 protein_id gnl|my_center|LOCUS_38590 7489 6866 gene locus_tag LOCUS_38600 7489 6866 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105413.1 protein_id gnl|my_center|LOCUS_38600 7603 8370 gene locus_tag LOCUS_38610 7603 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 protein_id gnl|my_center|LOCUS_38610 9567 8626 gene locus_tag LOCUS_38620 9567 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_38620 9691 10272 gene locus_tag LOCUS_38630 9691 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_38630 11471 10425 gene locus_tag LOCUS_38640 11471 10425 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112941.1 protein_id gnl|my_center|LOCUS_38640 11591 13969 gene locus_tag LOCUS_38650 11591 13969 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_38650 14749 14306 gene locus_tag LOCUS_38660 14749 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269282.1 protein_id gnl|my_center|LOCUS_38660 14748 15212 gene locus_tag LOCUS_38670 gene trmL 14748 15212 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU57 protein_id gnl|my_center|LOCUS_38670 15761 15276 gene locus_tag LOCUS_38680 gene secB 15761 15276 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_38680 16050 15790 gene locus_tag LOCUS_38690 16050 15790 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_38690 16465 16052 gene locus_tag LOCUS_38700 16465 16052 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 protein_id gnl|my_center|LOCUS_38700 16613 18145 gene locus_tag LOCUS_38710 gene gpmI 16613 18145 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_38710 18311 19558 gene locus_tag LOCUS_38720 18311 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_38720 19761 21077 gene locus_tag LOCUS_38730 19761 21077 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_38730 22077 21322 gene locus_tag LOCUS_38740 22077 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096075.1 protein_id gnl|my_center|LOCUS_38740 22966 22211 gene locus_tag LOCUS_38750 22966 22211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_38750 23785 23051 gene locus_tag LOCUS_38760 23785 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106332.1 protein_id gnl|my_center|LOCUS_38760 24743 23973 gene locus_tag LOCUS_38770 gene hisF1 24743 23973 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_38770 25558 24821 gene locus_tag LOCUS_38780 gene hisA 25558 24821 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_38780 25850 25596 gene locus_tag LOCUS_38790 25850 25596 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 protein_id gnl|my_center|LOCUS_38790 26488 25850 gene locus_tag LOCUS_38800 gene hisH1 26488 25850 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_38800 27081 26488 gene locus_tag LOCUS_38810 gene hisB 27081 26488 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_38810 28887 27229 gene locus_tag LOCUS_38820 28887 27229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 protein_id gnl|my_center|LOCUS_38820 29265 31490 gene locus_tag LOCUS_38830 29265 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_38830 31487 32554 gene locus_tag LOCUS_38840 gene mutY 31487 32554 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_38840 32551 32823 gene locus_tag LOCUS_38850 32551 32823 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UF5 protein_id gnl|my_center|LOCUS_38850 33012 33087 gene locus_tag LOCUS_t00460 33012 33087 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 33406 34494 gene locus_tag LOCUS_38860 33406 34494 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103179.1 protein_id gnl|my_center|LOCUS_38860 34733 35104 gene locus_tag LOCUS_38870 34733 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 35384 35626 gene locus_tag LOCUS_38880 35384 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 35623 36687 gene locus_tag LOCUS_38890 35623 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 37147 36740 gene locus_tag LOCUS_38900 37147 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 37695 37351 gene locus_tag LOCUS_38910 37695 37351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 38027 37710 gene locus_tag LOCUS_38920 38027 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 38643 38335 gene locus_tag LOCUS_38930 38643 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 39235 38975 gene locus_tag LOCUS_38940 39235 38975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 39603 39274 gene locus_tag LOCUS_38950 39603 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 41537 39600 gene locus_tag LOCUS_38960 41537 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 42904 43317 gene locus_tag LOCUS_38970 42904 43317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 43314 44228 gene locus_tag LOCUS_38980 43314 44228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 44282 44740 gene locus_tag LOCUS_38990 44282 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 45621 46394 gene locus_tag LOCUS_39000 45621 46394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737152.1 protein_id gnl|my_center|LOCUS_39000 46410 47162 gene locus_tag LOCUS_39010 46410 47162 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_39010 >Feature sequence32 405 779 gene locus_tag LOCUS_39020 405 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120855.1 protein_id gnl|my_center|LOCUS_39020 854 1276 gene locus_tag LOCUS_39030 854 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_39030 1336 1692 gene locus_tag LOCUS_39040 1336 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 protein_id gnl|my_center|LOCUS_39040 2530 1727 gene locus_tag LOCUS_39050 2530 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768735.1 protein_id gnl|my_center|LOCUS_39050 2631 3653 gene locus_tag LOCUS_39060 gene ldh 2631 3653 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_39060 3809 4051 gene locus_tag LOCUS_39070 3809 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719739.1 protein_id gnl|my_center|LOCUS_39070 4372 4109 gene locus_tag LOCUS_39080 4372 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_39080 5455 4481 gene locus_tag LOCUS_39090 5455 4481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_39090 5682 6176 gene locus_tag LOCUS_39100 5682 6176 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_39100 8877 6247 gene locus_tag LOCUS_39110 8877 6247 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267302.1 protein_id gnl|my_center|LOCUS_39110 9950 9078 gene locus_tag LOCUS_39120 9950 9078 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266784.1 protein_id gnl|my_center|LOCUS_39120 10156 12462 gene locus_tag LOCUS_39130 10156 12462 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268778.1 protein_id gnl|my_center|LOCUS_39130 12723 14258 gene locus_tag LOCUS_39140 gene opgG 12723 14258 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA5 protein_id gnl|my_center|LOCUS_39140 14514 14263 gene locus_tag LOCUS_39150 14514 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 14434 16791 gene locus_tag LOCUS_39160 gene opgH 14434 16791 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA6 protein_id gnl|my_center|LOCUS_39160 16983 17516 gene locus_tag LOCUS_39170 16983 17516 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 protein_id gnl|my_center|LOCUS_39170 18985 17798 gene locus_tag LOCUS_39180 18985 17798 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_39180 20447 19260 gene locus_tag LOCUS_39190 20447 19260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 protein_id gnl|my_center|LOCUS_39190 21454 20555 gene locus_tag LOCUS_39200 21454 20555 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529948.1 protein_id gnl|my_center|LOCUS_39200 23391 21475 gene locus_tag LOCUS_39210 23391 21475 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3T9 protein_id gnl|my_center|LOCUS_39210 23541 24437 gene locus_tag LOCUS_39220 23541 24437 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 protein_id gnl|my_center|LOCUS_39220 25802 24483 gene locus_tag LOCUS_39230 gene oprD 25802 24483 CDS product porin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32722 protein_id gnl|my_center|LOCUS_39230 26566 25895 gene locus_tag LOCUS_39240 26566 25895 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887376.1 protein_id gnl|my_center|LOCUS_39240 27873 26566 gene locus_tag LOCUS_39250 27873 26566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 protein_id gnl|my_center|LOCUS_39250 28439 27870 gene locus_tag LOCUS_39260 28439 27870 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383446.1 protein_id gnl|my_center|LOCUS_39260 29490 28459 gene locus_tag LOCUS_39270 29490 28459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038955.1 protein_id gnl|my_center|LOCUS_39270 30710 29868 gene locus_tag LOCUS_39280 30710 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969685.1 protein_id gnl|my_center|LOCUS_39280 33024 31057 gene locus_tag LOCUS_39290 gene mnmC 33024 31057 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPZ9 protein_id gnl|my_center|LOCUS_39290 33159 34646 gene locus_tag LOCUS_39300 33159 34646 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_39300 34927 36114 gene locus_tag LOCUS_39310 34927 36114 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_39310 36239 36859 gene locus_tag LOCUS_39320 36239 36859 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 protein_id gnl|my_center|LOCUS_39320 36947 37846 gene locus_tag LOCUS_39330 36947 37846 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930749.1 protein_id gnl|my_center|LOCUS_39330 37843 38733 gene locus_tag LOCUS_39340 37843 38733 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104037.1 protein_id gnl|my_center|LOCUS_39340 38881 39507 gene locus_tag LOCUS_39350 38881 39507 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 protein_id gnl|my_center|LOCUS_39350 39560 41605 gene locus_tag LOCUS_39360 39560 41605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 42128 41955 gene locus_tag LOCUS_39370 42128 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 43693 42458 gene locus_tag LOCUS_39380 43693 42458 CDS product FMN oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 protein_id gnl|my_center|LOCUS_39380 44323 43886 gene locus_tag LOCUS_39390 44323 43886 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462760.1 protein_id gnl|my_center|LOCUS_39390 44482 45231 gene locus_tag LOCUS_39400 44482 45231 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103614.1 protein_id gnl|my_center|LOCUS_39400 45253 45915 gene locus_tag LOCUS_39410 45253 45915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 46186 45872 gene locus_tag LOCUS_39420 46186 45872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence33 1014 64 gene locus_tag LOCUS_39430 1014 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 protein_id gnl|my_center|LOCUS_39430 2426 1017 gene locus_tag LOCUS_39440 2426 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 protein_id gnl|my_center|LOCUS_39440 3363 2815 gene locus_tag LOCUS_39450 3363 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_39450 3591 5030 gene locus_tag LOCUS_39460 gene ccoN2 3591 5030 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_39460 5030 5638 gene locus_tag LOCUS_39470 gene ccoO2 5030 5638 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_39470 5644 5823 gene locus_tag LOCUS_39480 gene ccoQ2 5644 5823 CDS product cytochrome C oxidase cbb3-type subunit CcoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 protein_id gnl|my_center|LOCUS_39480 5820 6746 gene locus_tag LOCUS_39490 gene ccoP1 5820 6746 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_39490 7091 8533 gene locus_tag LOCUS_39500 gene ccoN1 7091 8533 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 protein_id gnl|my_center|LOCUS_39500 8533 9141 gene locus_tag LOCUS_39510 gene ccoO2 8533 9141 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_39510 9148 9336 gene locus_tag LOCUS_39520 gene ccoQ1 9148 9336 CDS product cytochrome C oxidase cbb3-type subunit CcoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087298.1 protein_id gnl|my_center|LOCUS_39520 9333 10328 gene locus_tag LOCUS_39530 gene ccoP1 9333 10328 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_39530 10489 11904 gene locus_tag LOCUS_39540 10489 11904 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_39540 11918 12436 gene locus_tag LOCUS_39550 11918 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_39550 12445 14853 gene locus_tag LOCUS_39560 12445 14853 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_39560 14928 15134 gene locus_tag LOCUS_39570 14928 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_39570 15127 15810 gene locus_tag LOCUS_39580 15127 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_39580 16013 17395 gene locus_tag LOCUS_39590 gene hemN 16013 17395 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_39590 17886 17443 gene locus_tag LOCUS_39600 17886 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 18040 18774 gene locus_tag LOCUS_39610 18040 18774 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408100.1 protein_id gnl|my_center|LOCUS_39610 18817 19365 gene locus_tag LOCUS_39620 gene apt 18817 19365 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04633 protein_id gnl|my_center|LOCUS_39620 19422 20273 gene locus_tag LOCUS_39630 19422 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 20509 21345 gene locus_tag LOCUS_39640 20509 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_39640 21402 22955 gene locus_tag LOCUS_39650 21402 22955 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_39650 22952 23836 gene locus_tag LOCUS_39660 22952 23836 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_39660 24067 24315 gene locus_tag LOCUS_39670 24067 24315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119823.1 protein_id gnl|my_center|LOCUS_39670 24607 24392 gene locus_tag LOCUS_39680 24607 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 protein_id gnl|my_center|LOCUS_39680 25269 24676 gene locus_tag LOCUS_39690 25269 24676 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_39690 26056 25313 gene locus_tag LOCUS_39700 26056 25313 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_39700 26134 26700 gene locus_tag LOCUS_39710 26134 26700 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204251.1 protein_id gnl|my_center|LOCUS_39710 26749 27399 gene locus_tag LOCUS_39720 26749 27399 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882E2 protein_id gnl|my_center|LOCUS_39720 27417 27734 gene locus_tag LOCUS_39730 27417 27734 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267468.1 protein_id gnl|my_center|LOCUS_39730 27808 28260 gene locus_tag LOCUS_39740 gene ohrR 27808 28260 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090940.1 protein_id gnl|my_center|LOCUS_39740 28569 28694 gene locus_tag LOCUS_39750 28569 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 28741 29166 gene locus_tag LOCUS_39760 28741 29166 CDS product osmotic/stress-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_39760 29248 29517 gene locus_tag LOCUS_39770 29248 29517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 29639 32641 gene locus_tag LOCUS_39780 gene cutL 29639 32641 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086315.1 protein_id gnl|my_center|LOCUS_39780 32638 33444 gene locus_tag LOCUS_39790 gene cutM 32638 33444 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086316.1 protein_id gnl|my_center|LOCUS_39790 33447 33953 gene locus_tag LOCUS_39800 33447 33953 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086317.1 protein_id gnl|my_center|LOCUS_39800 33953 35485 gene locus_tag LOCUS_39810 33953 35485 CDS product 4-chlorobenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086318.1 protein_id gnl|my_center|LOCUS_39810 35513 36316 gene locus_tag LOCUS_39820 35513 36316 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086319.1 protein_id gnl|my_center|LOCUS_39820 36400 37641 gene locus_tag LOCUS_39830 36400 37641 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393273.1 protein_id gnl|my_center|LOCUS_39830 37790 39088 gene locus_tag LOCUS_39840 37790 39088 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115516.1 protein_id gnl|my_center|LOCUS_39840 39585 40556 gene locus_tag LOCUS_39850 39585 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 protein_id gnl|my_center|LOCUS_39850 40882 41736 gene locus_tag LOCUS_39860 40882 41736 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086314.1 protein_id gnl|my_center|LOCUS_39860 >Feature sequence34 1614 2969 gene locus_tag LOCUS_39870 1614 2969 CDS product agglutination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951431.1 protein_id gnl|my_center|LOCUS_39870 3048 5207 gene locus_tag LOCUS_39880 3048 5207 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_39880 5220 6578 gene locus_tag LOCUS_39890 5220 6578 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_39890 7213 6707 gene locus_tag LOCUS_39900 7213 6707 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766709.1 protein_id gnl|my_center|LOCUS_39900 7094 7393 gene locus_tag LOCUS_39910 7094 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 8948 7383 gene locus_tag LOCUS_39920 gene aer-1 8948 7383 CDS product aerotaxis receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103647.1 protein_id gnl|my_center|LOCUS_39920 9959 9066 gene locus_tag LOCUS_39930 gene gbuR 9959 9066 CDS product protein GbuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 protein_id gnl|my_center|LOCUS_39930 10381 11223 gene locus_tag LOCUS_39940 10381 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 11233 12273 gene locus_tag LOCUS_39950 11233 12273 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530699.1 protein_id gnl|my_center|LOCUS_39950 12462 13268 gene locus_tag LOCUS_39960 12462 13268 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889234.1 protein_id gnl|my_center|LOCUS_39960 13397 14911 gene locus_tag LOCUS_39970 13397 14911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 protein_id gnl|my_center|LOCUS_39970 14908 15630 gene locus_tag LOCUS_39980 14908 15630 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_39980 15776 16735 gene locus_tag LOCUS_39990 gene gbuA 15776 16735 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_39990 16810 18204 gene locus_tag LOCUS_40000 16810 18204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 protein_id gnl|my_center|LOCUS_40000 18226 19827 gene locus_tag LOCUS_40010 18226 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_40010 20007 21347 gene locus_tag LOCUS_40020 20007 21347 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_40020 21463 22194 gene locus_tag LOCUS_40030 21463 22194 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112427.1 protein_id gnl|my_center|LOCUS_40030 22329 22201 gene locus_tag LOCUS_40040 22329 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 24135 22417 gene locus_tag LOCUS_40050 gene aceK 24135 22417 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_40050 24347 25237 gene locus_tag LOCUS_40060 24347 25237 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_40060 26542 25571 gene locus_tag LOCUS_40070 gene cysK 26542 25571 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0D3 protein_id gnl|my_center|LOCUS_40070 26670 27752 gene locus_tag LOCUS_40080 26670 27752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_40080 27898 28743 gene locus_tag LOCUS_40090 27898 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_40090 28807 29985 gene locus_tag LOCUS_40100 28807 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_40100 31157 30111 gene locus_tag LOCUS_40110 31157 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_40110 37562 31371 gene locus_tag LOCUS_40120 37562 31371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 38241 39587 gene locus_tag LOCUS_40130 38241 39587 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976168.1 protein_id gnl|my_center|LOCUS_40130 40267 39599 gene locus_tag LOCUS_40140 40267 39599 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976169.1 protein_id gnl|my_center|LOCUS_40140 <41321 40342 gene locus_tag LOCUS_40150 <41321 40342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338282.1:glycoside hydrolase >Feature sequence35 263 2137 gene locus_tag LOCUS_40160 263 2137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_40160 2579 2265 gene locus_tag LOCUS_40170 2579 2265 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 protein_id gnl|my_center|LOCUS_40170 3673 2726 gene locus_tag LOCUS_40180 3673 2726 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_40180 4690 3821 gene locus_tag LOCUS_40190 gene hexR 4690 3821 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375897.1 protein_id gnl|my_center|LOCUS_40190 4892 6358 gene locus_tag LOCUS_40200 gene zwf-1 4892 6358 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887J2 protein_id gnl|my_center|LOCUS_40200 6345 7058 gene locus_tag LOCUS_40210 gene pgl 6345 7058 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764047.1 protein_id gnl|my_center|LOCUS_40210 7060 7731 gene locus_tag LOCUS_40220 7060 7731 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266838.1 protein_id gnl|my_center|LOCUS_40220 7789 8652 gene locus_tag LOCUS_40230 7789 8652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_40230 8829 10751 gene locus_tag LOCUS_40240 8829 10751 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266704.1 protein_id gnl|my_center|LOCUS_40240 12375 11035 gene locus_tag LOCUS_40250 gene malE 12375 11035 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_40250 13370 12447 gene locus_tag LOCUS_40260 13370 12447 CDS product maltose operon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705089.1 protein_id gnl|my_center|LOCUS_40260 14770 13496 gene locus_tag LOCUS_40270 gene lamB 14770 13496 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU8 protein_id gnl|my_center|LOCUS_40270 15135 16802 gene locus_tag LOCUS_40280 15135 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 16965 17495 gene locus_tag LOCUS_40290 16965 17495 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_40290 18683 17604 gene locus_tag LOCUS_40300 18683 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706391.1 protein_id gnl|my_center|LOCUS_40300 20892 18814 gene locus_tag LOCUS_40310 20892 18814 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094958.1 protein_id gnl|my_center|LOCUS_40310 21134 22321 gene locus_tag LOCUS_40320 gene malE 21134 22321 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_40320 22381 23955 gene locus_tag LOCUS_40330 gene malF 22381 23955 CDS product maltose transport system permease protein MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL06 protein_id gnl|my_center|LOCUS_40330 23966 24856 gene locus_tag LOCUS_40340 gene malG 23966 24856 CDS product maltose transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_40340 25002 27746 gene locus_tag LOCUS_40350 gene malT 25002 27746 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF3 protein_id gnl|my_center|LOCUS_40350 28282 29910 gene locus_tag LOCUS_40360 gene algA 28282 29910 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_40360 30269 31384 gene locus_tag LOCUS_40370 gene malK 30269 31384 CDS product maltose/maltodextrin import ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1U0 protein_id gnl|my_center|LOCUS_40370 31496 31870 gene locus_tag LOCUS_40380 31496 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 31807 32112 gene locus_tag LOCUS_40390 31807 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 32087 32245 gene locus_tag LOCUS_40400 32087 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40400 34643 32385 gene locus_tag LOCUS_40410 34643 32385 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 protein_id gnl|my_center|LOCUS_40410 36152 34902 gene locus_tag LOCUS_40420 gene ycaD 36152 34902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_40420 37552 36356 gene locus_tag LOCUS_40430 gene phhC 37552 36356 CDS product aromatic-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43336 protein_id gnl|my_center|LOCUS_40430 37902 37549 gene locus_tag LOCUS_40440 gene phhB 37902 37549 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43335 protein_id gnl|my_center|LOCUS_40440 39030 38245 gene locus_tag LOCUS_40450 gene phhA 39030 38245 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_40450 39465 41018 gene locus_tag LOCUS_40460 gene phhR 39465 41018 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence36 831 139 gene locus_tag LOCUS_40470 831 139 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112292.1 protein_id gnl|my_center|LOCUS_40470 973 1617 gene locus_tag LOCUS_40480 973 1617 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112290.1 protein_id gnl|my_center|LOCUS_40480 1614 2813 gene locus_tag LOCUS_40490 gene pncB1 1614 2813 CDS product nicotinate phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUP4 protein_id gnl|my_center|LOCUS_40490 2824 3651 gene locus_tag LOCUS_40500 gene nadE 2824 3651 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUP3 protein_id gnl|my_center|LOCUS_40500 3924 3712 gene locus_tag LOCUS_40510 3924 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 4622 4056 gene locus_tag LOCUS_40520 gene dcd 4622 4056 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC9 protein_id gnl|my_center|LOCUS_40520 4923 5132 gene locus_tag LOCUS_40530 gene capB 4923 5132 CDS product cold shock protein CapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A105 protein_id gnl|my_center|LOCUS_40530 6490 5402 gene locus_tag LOCUS_40540 6490 5402 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_40540 6653 8689 gene locus_tag LOCUS_40550 gene metG 6653 8689 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_40550 8809 9393 gene locus_tag LOCUS_40560 8809 9393 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC0 protein_id gnl|my_center|LOCUS_40560 9390 9965 gene locus_tag LOCUS_40570 9390 9965 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_40570 9962 12223 gene locus_tag LOCUS_40580 9962 12223 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB8 protein_id gnl|my_center|LOCUS_40580 12417 13448 gene locus_tag LOCUS_40590 12417 13448 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_40590 13451 14086 gene locus_tag LOCUS_40600 13451 14086 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_40600 14083 14790 gene locus_tag LOCUS_40610 14083 14790 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_40610 14890 15528 gene locus_tag LOCUS_40620 gene nth 14890 15528 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_40620 15640 15819 gene locus_tag LOCUS_40630 15640 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092052.1 protein_id gnl|my_center|LOCUS_40630 16933 15866 gene locus_tag LOCUS_40640 16933 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 17397 17005 gene locus_tag LOCUS_40650 gene gloA 17397 17005 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_40650 18685 17468 gene locus_tag LOCUS_40660 gene argG 18685 17468 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_40660 19750 18803 gene locus_tag LOCUS_40670 19750 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_40670 19904 20950 gene locus_tag LOCUS_40680 gene pyrC 19904 20950 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_40680 20947 21621 gene locus_tag LOCUS_40690 gene rnt 20947 21621 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_40690 22561 22779 gene locus_tag LOCUS_40700 22561 22779 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003350768.1 protein_id gnl|my_center|LOCUS_40700 23218 22847 gene locus_tag LOCUS_40710 23218 22847 CDS product DUF5064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082140.1 protein_id gnl|my_center|LOCUS_40710 23631 23314 gene locus_tag LOCUS_40720 23631 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_40720 23927 25048 gene locus_tag LOCUS_40730 gene braC 23927 25048 CDS product leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21175 protein_id gnl|my_center|LOCUS_40730 25165 26088 gene locus_tag LOCUS_40740 gene braD 25165 26088 CDS product high-affinity branched-chain amino acid transport system permease protein BraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21627 protein_id gnl|my_center|LOCUS_40740 26085 27344 gene locus_tag LOCUS_40750 gene braE 26085 27344 CDS product high-affinity branched-chain amino acid transport system permease protein BraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21628 protein_id gnl|my_center|LOCUS_40750 27341 28108 gene locus_tag LOCUS_40760 gene braF 27341 28108 CDS product high-affinity branched-chain amino acid transport ATP-binding protein BraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21629 protein_id gnl|my_center|LOCUS_40760 28112 28813 gene locus_tag LOCUS_40770 28112 28813 CDS product high-affinity branched-chain amino acid transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPP3 protein_id gnl|my_center|LOCUS_40770 29057 29917 gene locus_tag LOCUS_40780 29057 29917 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103617.1 protein_id gnl|my_center|LOCUS_40780 30626 29937 gene locus_tag LOCUS_40790 gene ung 30626 29937 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPC2 protein_id gnl|my_center|LOCUS_40790 30764 31012 gene locus_tag LOCUS_40800 30764 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 31045 31575 gene locus_tag LOCUS_40810 31045 31575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 31674 32087 gene locus_tag LOCUS_40820 31674 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093139.1 protein_id gnl|my_center|LOCUS_40820 33163 32288 gene locus_tag LOCUS_40830 gene mmsR 33163 32288 CDS product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 protein_id gnl|my_center|LOCUS_40830 33293 34789 gene locus_tag LOCUS_40840 33293 34789 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_40840 34887 36134 gene locus_tag LOCUS_40850 34887 36134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_40850 36141 37304 gene locus_tag LOCUS_40860 36141 37304 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 protein_id gnl|my_center|LOCUS_40860 37359 38177 gene locus_tag LOCUS_40870 37359 38177 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_40870 38337 39440 gene locus_tag LOCUS_40880 38337 39440 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_40880 39568 40452 gene locus_tag LOCUS_40890 39568 40452 CDS product NAD-dependent L-serine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5I6 protein_id gnl|my_center|LOCUS_40890 40797 40552 gene locus_tag LOCUS_40900 40797 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085479.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence37 1289 528 gene locus_tag LOCUS_40910 1289 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 1799 1593 gene locus_tag LOCUS_40920 1799 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 2810 2037 gene locus_tag LOCUS_40930 2810 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40930 3750 2737 gene locus_tag LOCUS_40940 3750 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40940 3848 4753 gene locus_tag LOCUS_40950 3848 4753 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_40950 5184 4762 gene locus_tag LOCUS_40960 5184 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 5587 6648 gene locus_tag LOCUS_40970 5587 6648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764738.1 protein_id gnl|my_center|LOCUS_40970 7106 7921 gene locus_tag LOCUS_40980 7106 7921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_40980 7918 8778 gene locus_tag LOCUS_40990 7918 8778 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_40990 10067 9135 gene locus_tag LOCUS_41000 10067 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 11089 10064 gene locus_tag LOCUS_41010 11089 10064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_41010 11589 12656 gene locus_tag LOCUS_41020 11589 12656 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_41020 12738 13466 gene locus_tag LOCUS_41030 12738 13466 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_41030 13477 14112 gene locus_tag LOCUS_41040 13477 14112 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_41040 14327 18001 gene locus_tag LOCUS_41050 14327 18001 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 protein_id gnl|my_center|LOCUS_41050 18479 19945 gene locus_tag LOCUS_41060 18479 19945 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_41060 19945 20148 gene locus_tag LOCUS_41070 19945 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 20152 20844 gene locus_tag LOCUS_41080 20152 20844 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPB1 protein_id gnl|my_center|LOCUS_41080 21239 22126 gene locus_tag LOCUS_41090 gene phaG 21239 22126 CDS product (R)-3-hydroxydecanoyl-ACP:CoA transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51553 protein_id gnl|my_center|LOCUS_41090 22352 22425 gene locus_tag LOCUS_t00470 22352 22425 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22663 24456 gene locus_tag LOCUS_41100 22663 24456 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046961.1 protein_id gnl|my_center|LOCUS_41100 26062 27705 gene locus_tag LOCUS_41110 26062 27705 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104672.1 protein_id gnl|my_center|LOCUS_41110 27913 29046 gene locus_tag LOCUS_41120 27913 29046 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096867.1 protein_id gnl|my_center|LOCUS_41120 29213 29911 gene locus_tag LOCUS_41130 gene endA 29213 29911 CDS product DNA-specific endonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_41130 30377 30180 gene locus_tag LOCUS_41140 30377 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 30451 31971 gene locus_tag LOCUS_41150 30451 31971 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105794.1 protein_id gnl|my_center|LOCUS_41150 32837 32286 gene locus_tag LOCUS_41160 gene sodC 32837 32286 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59623 protein_id gnl|my_center|LOCUS_41160 33173 33556 gene locus_tag LOCUS_41170 gene gcvH1 33173 33556 CDS product glycine cleavage system H protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I136 protein_id gnl|my_center|LOCUS_41170 33566 36418 gene locus_tag LOCUS_41180 gene gcvP 33566 36418 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH2 protein_id gnl|my_center|LOCUS_41180 36620 37873 gene locus_tag LOCUS_41190 gene glyA2 36620 37873 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I138 protein_id gnl|my_center|LOCUS_41190 37943 39067 gene locus_tag LOCUS_41200 37943 39067 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH3 protein_id gnl|my_center|LOCUS_41200 >Feature sequence38 92 167 gene locus_tag LOCUS_t00480 92 167 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 216 291 gene locus_tag LOCUS_t00490 216 291 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 477 1016 gene locus_tag LOCUS_41210 477 1016 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 protein_id gnl|my_center|LOCUS_41210 1040 1879 gene locus_tag LOCUS_41220 1040 1879 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_41220 3711 1849 gene locus_tag LOCUS_41230 3711 1849 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_41230 3915 4364 gene locus_tag LOCUS_41240 3915 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_41240 4766 4371 gene locus_tag LOCUS_41250 4766 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4863 5813 gene locus_tag LOCUS_41260 gene dusC 4863 5813 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 protein_id gnl|my_center|LOCUS_41260 6062 6511 gene locus_tag LOCUS_41270 gene ibpA 6062 6511 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_41270 9905 6618 gene locus_tag LOCUS_41280 9905 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 10894 10013 gene locus_tag LOCUS_41290 10894 10013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_41290 11119 12546 gene locus_tag LOCUS_41300 gene leuC 11119 12546 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58949 protein_id gnl|my_center|LOCUS_41300 12558 13205 gene locus_tag LOCUS_41310 gene leuD 12558 13205 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5K9 protein_id gnl|my_center|LOCUS_41310 13308 14390 gene locus_tag LOCUS_41320 gene leuB 13308 14390 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_41320 14447 15559 gene locus_tag LOCUS_41330 gene asd 14447 15559 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51344 protein_id gnl|my_center|LOCUS_41330 15695 16705 gene locus_tag LOCUS_41340 gene asd-2 15695 16705 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104739.1 protein_id gnl|my_center|LOCUS_41340 16860 19709 gene locus_tag LOCUS_41350 gene fimV 16860 19709 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_41350 19717 20580 gene locus_tag LOCUS_41360 gene truA 19717 20580 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_41360 20617 21258 gene locus_tag LOCUS_41370 gene trpF 20617 21258 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_41370 21397 22281 gene locus_tag LOCUS_41380 gene accD 21397 22281 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW0 protein_id gnl|my_center|LOCUS_41380 22278 23555 gene locus_tag LOCUS_41390 gene folC 22278 23555 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_41390 23570 24187 gene locus_tag LOCUS_41400 23570 24187 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104736.1 protein_id gnl|my_center|LOCUS_41400 24274 24795 gene locus_tag LOCUS_41410 24274 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_41410 24871 26379 gene locus_tag LOCUS_41420 gene purF 24871 26379 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_41420 26521 27732 gene locus_tag LOCUS_41430 gene metZ 26521 27732 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_41430 27735 28511 gene locus_tag LOCUS_41440 27735 28511 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415691.1 protein_id gnl|my_center|LOCUS_41440 30302 28638 gene locus_tag LOCUS_41450 30302 28638 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_41450 30627 31376 gene locus_tag LOCUS_41460 gene etfB 30627 31376 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_41460 31377 32306 gene locus_tag LOCUS_41470 gene etfA 31377 32306 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_41470 34066 33140 gene locus_tag LOCUS_41480 34066 33140 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_41480 34175 35008 gene locus_tag LOCUS_41490 34175 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_41490 35018 35368 gene locus_tag LOCUS_41500 35018 35368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091008.1 protein_id gnl|my_center|LOCUS_41500 35368 36180 gene locus_tag LOCUS_41510 35368 36180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267374.1 protein_id gnl|my_center|LOCUS_41510 >Feature sequence39 1096 164 gene locus_tag LOCUS_41520 1096 164 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104783.1 protein_id gnl|my_center|LOCUS_41520 1537 1244 gene locus_tag LOCUS_41530 1537 1244 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y82 protein_id gnl|my_center|LOCUS_41530 2828 1707 gene locus_tag LOCUS_41540 gene rnd 2828 1707 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 protein_id gnl|my_center|LOCUS_41540 3094 4158 gene locus_tag LOCUS_41550 3094 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_41550 5004 4324 gene locus_tag LOCUS_41560 5004 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_41560 6471 5134 gene locus_tag LOCUS_41570 gene gdhA 6471 5134 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_41570 6778 7632 gene locus_tag LOCUS_41580 gene sseA 6778 7632 CDS product putative 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I452 protein_id gnl|my_center|LOCUS_41580 7968 8447 gene locus_tag LOCUS_41590 7968 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_41590 8596 9870 gene locus_tag LOCUS_41600 8596 9870 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103685.1 protein_id gnl|my_center|LOCUS_41600 10155 10766 gene locus_tag LOCUS_41610 10155 10766 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_41610 12515 10767 gene locus_tag LOCUS_41620 12515 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 13586 12528 gene locus_tag LOCUS_41630 gene lifO 13586 12528 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_41630 14555 13629 gene locus_tag LOCUS_41640 gene lipA 14555 13629 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_41640 15253 14702 gene locus_tag LOCUS_41650 15253 14702 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ70 protein_id gnl|my_center|LOCUS_41650 16816 15611 gene locus_tag LOCUS_41660 16816 15611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103683.1 protein_id gnl|my_center|LOCUS_41660 17273 16869 gene locus_tag LOCUS_41670 17273 16869 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_41670 18078 17347 gene locus_tag LOCUS_41680 gene cobS 18078 17347 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I463 protein_id gnl|my_center|LOCUS_41680 18647 18075 gene locus_tag LOCUS_41690 18647 18075 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_41690 19702 18647 gene locus_tag LOCUS_41700 gene cobT 19702 18647 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_41700 20220 19699 gene locus_tag LOCUS_41710 gene cobP 20220 19699 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766684.1 protein_id gnl|my_center|LOCUS_41710 21758 20310 gene locus_tag LOCUS_41720 gene cobQ 21758 20310 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885W8 protein_id gnl|my_center|LOCUS_41720 22768 21758 gene locus_tag LOCUS_41730 gene cobC 22768 21758 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_41730 23669 22761 gene locus_tag LOCUS_41740 gene cobD 23669 22761 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ62 protein_id gnl|my_center|LOCUS_41740 24326 23673 gene locus_tag LOCUS_41750 24326 23673 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766675.1 protein_id gnl|my_center|LOCUS_41750 25615 24323 gene locus_tag LOCUS_41760 gene cobB 25615 24323 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I471 protein_id gnl|my_center|LOCUS_41760 26226 25615 gene locus_tag LOCUS_41770 gene cobO 26226 25615 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_41770 26979 26659 gene locus_tag LOCUS_41780 26979 26659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 27514 26990 gene locus_tag LOCUS_41790 27514 26990 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_41790 28310 27600 gene locus_tag LOCUS_41800 28310 27600 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268584.1 protein_id gnl|my_center|LOCUS_41800 29616 28402 gene locus_tag LOCUS_41810 29616 28402 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_41810 30152 29613 gene locus_tag LOCUS_41820 gene moaB2 30152 29613 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_41820 30221 30811 gene locus_tag LOCUS_41830 gene mobA 30221 30811 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68799 protein_id gnl|my_center|LOCUS_41830 30898 31119 gene locus_tag LOCUS_41840 30898 31119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_41840 31249 31325 gene locus_tag LOCUS_t00500 31249 31325 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31623 31387 gene locus_tag LOCUS_41850 31623 31387 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_41850 32812 31673 gene locus_tag LOCUS_41860 32812 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 33132 34379 gene locus_tag LOCUS_41870 33132 34379 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence40 172 783 gene locus_tag LOCUS_41880 gene pmtA 172 783 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_41880 1149 2891 gene locus_tag LOCUS_41890 1149 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 3534 2896 gene locus_tag LOCUS_41900 gene bfiR 3534 2896 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_41900 5581 3671 gene locus_tag LOCUS_41910 5581 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 5723 7342 gene locus_tag LOCUS_41920 5723 7342 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_41920 7443 8816 gene locus_tag LOCUS_41930 7443 8816 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_41930 8877 10649 gene locus_tag LOCUS_41940 8877 10649 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_41940 10839 11705 gene locus_tag LOCUS_41950 10839 11705 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_41950 11869 12348 gene locus_tag LOCUS_41960 11869 12348 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 protein_id gnl|my_center|LOCUS_41960 12714 12418 gene locus_tag LOCUS_41970 12714 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114084.1 protein_id gnl|my_center|LOCUS_41970 13336 12707 gene locus_tag LOCUS_41980 gene ubiX 13336 12707 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889L9 protein_id gnl|my_center|LOCUS_41980 14770 13418 gene locus_tag LOCUS_41990 gene mpl 14770 13418 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_41990 15020 15475 gene locus_tag LOCUS_42000 15020 15475 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093235.1 protein_id gnl|my_center|LOCUS_42000 16753 15503 gene locus_tag LOCUS_42010 16753 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42010 16432 16342 gene locus_tag LOCUS_t00510 16432 16342 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17084 16731 gene locus_tag LOCUS_42020 17084 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42020 17199 18026 gene locus_tag LOCUS_42030 17199 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093244.1 protein_id gnl|my_center|LOCUS_42030 18105 18632 gene locus_tag LOCUS_42040 gene ppa 18105 18632 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_42040 18986 19198 gene locus_tag LOCUS_42050 18986 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 19426 20145 gene locus_tag LOCUS_42060 19426 20145 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_42060 20746 20168 gene locus_tag LOCUS_42070 gene nudL 20746 20168 CDS product putative Nudix hydrolase NudL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2L0 protein_id gnl|my_center|LOCUS_42070 21801 20788 gene locus_tag LOCUS_42080 gene mphP 21801 20788 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_42080 22821 21838 gene locus_tag LOCUS_42090 22821 21838 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_42090 23189 22839 gene locus_tag LOCUS_42100 23189 22839 CDS product Rieske family ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434108.1 protein_id gnl|my_center|LOCUS_42100 24112 23210 gene locus_tag LOCUS_42110 24112 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 25060 24296 gene locus_tag LOCUS_42120 gene benD 25060 24296 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 protein_id gnl|my_center|LOCUS_42120 26017 25160 gene locus_tag LOCUS_42130 26017 25160 CDS product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700830.1 protein_id gnl|my_center|LOCUS_42130 27992 26022 gene locus_tag LOCUS_42140 27992 26022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_42140 29476 28118 gene locus_tag LOCUS_42150 gene oprO 29476 28118 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036714.1 protein_id gnl|my_center|LOCUS_42150 30712 29663 gene locus_tag LOCUS_42160 30712 29663 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_42160 31492 30962 gene locus_tag LOCUS_42170 31492 30962 CDS product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816691.1 protein_id gnl|my_center|LOCUS_42170 32828 31527 gene locus_tag LOCUS_42180 32828 31527 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063917.1 protein_id gnl|my_center|LOCUS_42180 33734 32904 gene locus_tag LOCUS_42190 33734 32904 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_42190 33931 33731 gene locus_tag LOCUS_42200 33931 33731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence41 <1 4179 gene locus_tag LOCUS_42210 <1 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:type I secretion C-terminal target domain-containing protein 4331 4672 gene locus_tag LOCUS_42220 4331 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 6711 4765 gene locus_tag LOCUS_42230 6711 4765 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_42230 7401 6721 gene locus_tag LOCUS_42240 7401 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_42240 7982 7584 gene locus_tag LOCUS_42250 7982 7584 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 protein_id gnl|my_center|LOCUS_42250 8612 8028 gene locus_tag LOCUS_42260 8612 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_42260 8928 11060 gene locus_tag LOCUS_42270 gene recQ 8928 11060 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_42270 11151 12311 gene locus_tag LOCUS_42280 11151 12311 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_42280 12444 12875 gene locus_tag LOCUS_42290 12444 12875 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381003.1 protein_id gnl|my_center|LOCUS_42290 13155 15251 gene locus_tag LOCUS_42300 13155 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147952.1 protein_id gnl|my_center|LOCUS_42300 17492 15306 gene locus_tag LOCUS_42310 gene plpD 17492 15306 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_42310 17564 17848 gene locus_tag LOCUS_42320 17564 17848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_42320 17963 18457 gene locus_tag LOCUS_42330 17963 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 19428 18577 gene locus_tag LOCUS_42340 19428 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_42340 19760 19425 gene locus_tag LOCUS_42350 gene csaA 19760 19425 CDS product molecular chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109191.1 protein_id gnl|my_center|LOCUS_42350 20682 19936 gene locus_tag LOCUS_42360 20682 19936 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_42360 20817 21629 gene locus_tag LOCUS_42370 20817 21629 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_42370 21626 22666 gene locus_tag LOCUS_42380 21626 22666 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_42380 24157 22769 gene locus_tag LOCUS_42390 gene cyaB 24157 22769 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_42390 24903 24316 gene locus_tag LOCUS_42400 24903 24316 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_42400 25267 24950 gene locus_tag LOCUS_42410 25267 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_42410 25398 26408 gene locus_tag LOCUS_42420 25398 26408 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_42420 27872 26418 gene locus_tag LOCUS_42430 gene trkH 27872 26418 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_42430 29330 27876 gene locus_tag LOCUS_42440 gene trkH 29330 27876 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_42440 29480 29851 gene locus_tag LOCUS_42450 29480 29851 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 protein_id gnl|my_center|LOCUS_42450 >Feature sequence42 69 968 gene locus_tag LOCUS_42460 gene cyoE1 69 968 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_42460 977 1609 gene locus_tag LOCUS_42470 gene senC 977 1609 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_42470 2819 1869 gene locus_tag LOCUS_42480 gene thrB 2819 1869 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZS7 protein_id gnl|my_center|LOCUS_42480 3120 2836 gene locus_tag LOCUS_42490 3120 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_42490 3337 6132 gene locus_tag LOCUS_42500 gene polA 3337 6132 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_42500 7189 6755 gene locus_tag LOCUS_42510 7189 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036511.1 protein_id gnl|my_center|LOCUS_42510 8087 7257 gene locus_tag LOCUS_42520 8087 7257 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763472.1 protein_id gnl|my_center|LOCUS_42520 8298 9650 gene locus_tag LOCUS_42530 8298 9650 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318895.1 protein_id gnl|my_center|LOCUS_42530 9676 11460 gene locus_tag LOCUS_42540 9676 11460 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266285.1 protein_id gnl|my_center|LOCUS_42540 11738 11553 gene locus_tag LOCUS_42550 11738 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 12068 11757 gene locus_tag LOCUS_42560 12068 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 13431 12244 gene locus_tag LOCUS_42570 13431 12244 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104155.1 protein_id gnl|my_center|LOCUS_42570 14036 13425 gene locus_tag LOCUS_42580 14036 13425 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 protein_id gnl|my_center|LOCUS_42580 14842 14033 gene locus_tag LOCUS_42590 14842 14033 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104153.1 protein_id gnl|my_center|LOCUS_42590 18318 14842 gene locus_tag LOCUS_42600 18318 14842 CDS product two-component system sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104152.1 protein_id gnl|my_center|LOCUS_42600 18468 18860 gene locus_tag LOCUS_42610 18468 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 19117 19782 gene locus_tag LOCUS_42620 19117 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705570.1 protein_id gnl|my_center|LOCUS_42620 19916 20320 gene locus_tag LOCUS_42630 19916 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 21106 20324 gene locus_tag LOCUS_42640 gene ampDh2 21106 20324 CDS product protein AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_42640 21693 21103 gene locus_tag LOCUS_42650 21693 21103 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT85 protein_id gnl|my_center|LOCUS_42650 21923 23446 gene locus_tag LOCUS_42660 21923 23446 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 protein_id gnl|my_center|LOCUS_42660 25368 23509 gene locus_tag LOCUS_42670 25368 23509 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114121.1 protein_id gnl|my_center|LOCUS_42670 26246 25374 gene locus_tag LOCUS_42680 26246 25374 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_42680 26892 26266 gene locus_tag LOCUS_42690 gene dsbA 26892 26266 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_42690 27850 27245 gene locus_tag LOCUS_42700 gene cc4 27850 27245 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_42700 28191 27901 gene locus_tag LOCUS_42710 28191 27901 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096979.1 protein_id gnl|my_center|LOCUS_42710 28574 29215 gene locus_tag LOCUS_42720 gene engB 28574 29215 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP4 protein_id gnl|my_center|LOCUS_42720 >Feature sequence43 275 1720 gene locus_tag LOCUS_42730 275 1720 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_42730 1807 3498 gene locus_tag LOCUS_42740 1807 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638263.2 protein_id gnl|my_center|LOCUS_42740 3495 4067 gene locus_tag LOCUS_42750 3495 4067 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_42750 4064 4741 gene locus_tag LOCUS_42760 4064 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 4832 5326 gene locus_tag LOCUS_42770 4832 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 7195 5369 gene locus_tag LOCUS_42780 gene atuH 7195 5369 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_42780 8308 7484 gene locus_tag LOCUS_42790 gene atuG 8308 7484 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_42790 10529 8541 gene locus_tag LOCUS_42800 gene atuF 10529 8541 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_42800 11499 10702 gene locus_tag LOCUS_42810 gene atuE 11499 10702 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_42810 12732 11572 gene locus_tag LOCUS_42820 gene atuD 12732 11572 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_42820 14431 12815 gene locus_tag LOCUS_42830 gene atuC 14431 12815 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_42830 15305 14436 gene locus_tag LOCUS_42840 gene atuB 15305 14436 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_42840 17184 15397 gene locus_tag LOCUS_42850 gene atuA 17184 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_42850 17406 18029 gene locus_tag LOCUS_42860 gene atuR 17406 18029 CDS product atu genes repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_42860 18268 19053 gene locus_tag LOCUS_42870 18268 19053 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103807.1 protein_id gnl|my_center|LOCUS_42870 19172 19948 gene locus_tag LOCUS_42880 19172 19948 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103807.1 protein_id gnl|my_center|LOCUS_42880 20657 19899 gene locus_tag LOCUS_42890 20657 19899 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090986.1 protein_id gnl|my_center|LOCUS_42890 20915 20742 gene locus_tag LOCUS_42900 20915 20742 CDS product DUF2897 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090984.1 protein_id gnl|my_center|LOCUS_42900 21735 20971 gene locus_tag LOCUS_42910 gene eutC 21735 20971 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFC6 protein_id gnl|my_center|LOCUS_42910 23129 21735 gene locus_tag LOCUS_42920 gene eutB 23129 21735 CDS product ethanolamine ammonia-lyase heavy chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_42920 23361 24665 gene locus_tag LOCUS_42930 23361 24665 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_42930 24665 25579 gene locus_tag LOCUS_42940 24665 25579 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_42940 25821 26522 gene locus_tag LOCUS_42950 gene pyrF 25821 26522 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59654 protein_id gnl|my_center|LOCUS_42950 26741 27502 gene locus_tag LOCUS_42960 26741 27502 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_42960 >Feature sequence44 359 1741 gene locus_tag LOCUS_42970 359 1741 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_42970 3135 2461 gene locus_tag LOCUS_42980 3135 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42980 3512 3189 gene locus_tag LOCUS_42990 3512 3189 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_42990 4539 3622 gene locus_tag LOCUS_43000 4539 3622 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814488.1 protein_id gnl|my_center|LOCUS_43000 4822 5994 gene locus_tag LOCUS_43010 4822 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 6005 6724 gene locus_tag LOCUS_43020 6005 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 7077 6769 gene locus_tag LOCUS_43030 7077 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115518.1 protein_id gnl|my_center|LOCUS_43030 7583 7074 gene locus_tag LOCUS_43040 7583 7074 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 protein_id gnl|my_center|LOCUS_43040 7862 9343 gene locus_tag LOCUS_43050 7862 9343 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887352.1 protein_id gnl|my_center|LOCUS_43050 10019 10336 gene locus_tag LOCUS_43060 10019 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 10349 10783 gene locus_tag LOCUS_43070 10349 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 11633 11466 gene locus_tag LOCUS_43080 11633 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 12201 11752 gene locus_tag LOCUS_43090 12201 11752 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317797.1 protein_id gnl|my_center|LOCUS_43090 12703 12212 gene locus_tag LOCUS_43100 12703 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266618.1 protein_id gnl|my_center|LOCUS_43100 12902 14551 gene locus_tag LOCUS_43110 gene mqo 12902 14551 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTU6 protein_id gnl|my_center|LOCUS_43110 17126 14595 gene locus_tag LOCUS_43120 17126 14595 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_43120 18011 17142 gene locus_tag LOCUS_43130 gene ku 18011 17142 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZG4 protein_id gnl|my_center|LOCUS_43130 18298 19464 gene locus_tag LOCUS_43140 18298 19464 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113678.1 protein_id gnl|my_center|LOCUS_43140 19696 19472 gene locus_tag LOCUS_43150 19696 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 19823 21160 gene locus_tag LOCUS_43160 19823 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 21178 21366 gene locus_tag LOCUS_43170 21178 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 21363 22244 gene locus_tag LOCUS_43180 21363 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113650.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence45 773 417 gene locus_tag LOCUS_43190 773 417 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H2 protein_id gnl|my_center|LOCUS_43190 1965 886 gene locus_tag LOCUS_43200 1965 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_43200 2111 2419 gene locus_tag LOCUS_43210 2111 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 protein_id gnl|my_center|LOCUS_43210 2419 2733 gene locus_tag LOCUS_43220 2419 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_43220 2733 3401 gene locus_tag LOCUS_43230 2733 3401 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_43230 3398 4711 gene locus_tag LOCUS_43240 3398 4711 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_43240 5411 4815 gene locus_tag LOCUS_43250 5411 4815 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_43250 7701 5557 gene locus_tag LOCUS_43260 7701 5557 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113383.1 protein_id gnl|my_center|LOCUS_43260 7815 9206 gene locus_tag LOCUS_43270 7815 9206 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_43270 9322 11004 gene locus_tag LOCUS_43280 9322 11004 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I6 protein_id gnl|my_center|LOCUS_43280 11908 11006 gene locus_tag LOCUS_43290 11908 11006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 protein_id gnl|my_center|LOCUS_43290 12025 12633 gene locus_tag LOCUS_43300 gene azoR2 12025 12633 CDS product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 protein_id gnl|my_center|LOCUS_43300 14280 12694 gene locus_tag LOCUS_43310 14280 12694 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267725.1 protein_id gnl|my_center|LOCUS_43310 14729 15259 gene locus_tag LOCUS_43320 gene foxI 14729 15259 CDS product ECF sigma factor FoxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 protein_id gnl|my_center|LOCUS_43320 15259 16176 gene locus_tag LOCUS_43330 gene foxR 15259 16176 CDS product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 protein_id gnl|my_center|LOCUS_43330 16242 18611 gene locus_tag LOCUS_43340 gene bfrH 16242 18611 CDS product ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065177.1 protein_id gnl|my_center|LOCUS_43340 18608 19453 gene locus_tag LOCUS_43350 18608 19453 CDS product IroE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098699.1 protein_id gnl|my_center|LOCUS_43350 20364 19642 gene locus_tag LOCUS_43360 20364 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113762.1 protein_id gnl|my_center|LOCUS_43360 20921 20619 gene locus_tag LOCUS_43370 20921 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 21156 20914 gene locus_tag LOCUS_43380 21156 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence46 7970 9709 gene locus_tag LOCUS_43390 gene hasD 7970 9709 CDS product transporter HasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_43390 9716 11062 gene locus_tag LOCUS_43400 gene hasE 9716 11062 CDS product metalloprotease secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_43400 11064 12407 gene locus_tag LOCUS_43410 gene tliF 11064 12407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767364.1 protein_id gnl|my_center|LOCUS_43410 12985 12461 gene locus_tag LOCUS_43420 12985 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_43420 13763 12990 gene locus_tag LOCUS_43430 13763 12990 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407244.1 protein_id gnl|my_center|LOCUS_43430 14214 13768 gene locus_tag LOCUS_43440 14214 13768 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895549.1 protein_id gnl|my_center|LOCUS_43440 14748 14278 gene locus_tag LOCUS_43450 14748 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086834.1 protein_id gnl|my_center|LOCUS_43450 14857 16899 gene locus_tag LOCUS_43460 14857 16899 CDS product oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112365.1 protein_id gnl|my_center|LOCUS_43460 17270 16956 gene locus_tag LOCUS_43470 17270 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 17355 17696 gene locus_tag LOCUS_43480 17355 17696 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_43480 17744 18214 gene locus_tag LOCUS_43490 17744 18214 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317406.1 protein_id gnl|my_center|LOCUS_43490 19467 18241 gene locus_tag LOCUS_43500 19467 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 20017 19568 gene locus_tag LOCUS_43510 20017 19568 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I445 protein_id gnl|my_center|LOCUS_43510 >Feature sequence47 1580 234 gene locus_tag LOCUS_43520 1580 234 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389008.1 protein_id gnl|my_center|LOCUS_43520 2182 1610 gene locus_tag LOCUS_43530 2182 1610 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101576.1 protein_id gnl|my_center|LOCUS_43530 3473 2184 gene locus_tag LOCUS_43540 3473 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101571.1 protein_id gnl|my_center|LOCUS_43540 3851 3552 gene locus_tag LOCUS_43550 3851 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 4349 5296 gene locus_tag LOCUS_43560 4349 5296 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_43560 6548 5400 gene locus_tag LOCUS_43570 6548 5400 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_43570 7193 6615 gene locus_tag LOCUS_43580 7193 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 7823 7224 gene locus_tag LOCUS_43590 gene recR 7823 7224 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H9 protein_id gnl|my_center|LOCUS_43590 8498 8172 gene locus_tag LOCUS_43600 8498 8172 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_43600 10622 8547 gene locus_tag LOCUS_43610 gene dnaX 10622 8547 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_43610 11087 11308 gene locus_tag LOCUS_43620 11087 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 11362 11649 gene locus_tag LOCUS_43630 11362 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719769.1 protein_id gnl|my_center|LOCUS_43630 13610 11976 gene locus_tag LOCUS_43640 13610 11976 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_43640 13807 15399 gene locus_tag LOCUS_43650 13807 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 15537 15815 gene locus_tag LOCUS_43660 15537 15815 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_43660 16152 15859 gene locus_tag LOCUS_43670 16152 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 16666 16172 gene locus_tag LOCUS_43680 16666 16172 CDS product blue copper protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_43680 17884 16718 gene locus_tag LOCUS_43690 17884 16718 CDS product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43690 18130 17888 gene locus_tag LOCUS_43700 18130 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43700 19547 18147 gene locus_tag LOCUS_43710 19547 18147 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43710 >Feature sequence48 754 581 gene locus_tag LOCUS_43720 754 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 1847 1074 gene locus_tag LOCUS_43730 1847 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920547.1 protein_id gnl|my_center|LOCUS_43730 3388 1844 gene locus_tag LOCUS_43740 3388 1844 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265837.1 protein_id gnl|my_center|LOCUS_43740 4407 3469 gene locus_tag LOCUS_43750 4407 3469 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920548.1 protein_id gnl|my_center|LOCUS_43750 6161 4827 gene locus_tag LOCUS_43760 6161 4827 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_43760 6838 6158 gene locus_tag LOCUS_43770 6838 6158 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_43770 6983 8713 gene locus_tag LOCUS_43780 gene dsbD2 6983 8713 CDS product thiol:disulfide interchange protein DsbD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I104 protein_id gnl|my_center|LOCUS_43780 8713 9522 gene locus_tag LOCUS_43790 8713 9522 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_43790 9519 10286 gene locus_tag LOCUS_43800 gene dsbG 9519 10286 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_43800 10353 10997 gene locus_tag LOCUS_43810 10353 10997 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_43810 10994 11914 gene locus_tag LOCUS_43820 10994 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_43820 12682 11948 gene locus_tag LOCUS_43830 12682 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093112.1 protein_id gnl|my_center|LOCUS_43830 13822 12779 gene locus_tag LOCUS_43840 13822 12779 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105114.1 protein_id gnl|my_center|LOCUS_43840 13961 14200 gene locus_tag LOCUS_43850 13961 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 14233 15078 gene locus_tag LOCUS_43860 14233 15078 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_43860 15078 15821 gene locus_tag LOCUS_43870 15078 15821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706549.1 protein_id gnl|my_center|LOCUS_43870 >Feature sequence49 582 127 gene locus_tag LOCUS_43880 gene rimI 582 127 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB7 protein_id gnl|my_center|LOCUS_43880 1400 615 gene locus_tag LOCUS_43890 1400 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771509.1 protein_id gnl|my_center|LOCUS_43890 2751 1558 gene locus_tag LOCUS_43900 2751 1558 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 protein_id gnl|my_center|LOCUS_43900 4022 2925 gene locus_tag LOCUS_43910 gene nspC 4022 2925 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG65 protein_id gnl|my_center|LOCUS_43910 5040 4435 gene locus_tag LOCUS_43920 5040 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_43920 5262 6503 gene locus_tag LOCUS_43930 5262 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404706.1 protein_id gnl|my_center|LOCUS_43930 6588 7280 gene locus_tag LOCUS_43940 6588 7280 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319438.1 protein_id gnl|my_center|LOCUS_43940 7277 10108 gene locus_tag LOCUS_43950 7277 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_43950 12527 10224 gene locus_tag LOCUS_43960 12527 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_43960 13137 12520 gene locus_tag LOCUS_43970 13137 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719782.1 protein_id gnl|my_center|LOCUS_43970 13702 13124 gene locus_tag LOCUS_43980 13702 13124 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719783.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence50 200 820 gene locus_tag LOCUS_43990 200 820 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_43990 1830 913 gene locus_tag LOCUS_44000 1830 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_44000 2474 1827 gene locus_tag LOCUS_44010 2474 1827 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_44010 3308 2532 gene locus_tag LOCUS_44020 gene dsbG 3308 2532 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_44020 4120 3305 gene locus_tag LOCUS_44030 4120 3305 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_44030 5823 4120 gene locus_tag LOCUS_44040 gene dsbD2 5823 4120 CDS product thiol:disulfide interchange protein DsbD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I104 protein_id gnl|my_center|LOCUS_44040 6058 6753 gene locus_tag LOCUS_44050 6058 6753 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_44050 6750 8078 gene locus_tag LOCUS_44060 6750 8078 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_44060 8168 9556 gene locus_tag LOCUS_44070 8168 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123120.1 protein_id gnl|my_center|LOCUS_44070 10394 9612 gene locus_tag LOCUS_44080 10394 9612 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500L8 protein_id gnl|my_center|LOCUS_44080 10871 10446 gene locus_tag LOCUS_44090 10871 10446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_44090 11312 10881 gene locus_tag LOCUS_44100 11312 10881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_44100 11647 11309 gene locus_tag LOCUS_44110 11647 11309 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817043.1 protein_id gnl|my_center|LOCUS_44110 11836 12270 gene locus_tag LOCUS_44120 11836 12270 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065756.1 protein_id gnl|my_center|LOCUS_44120 12282 13031 gene locus_tag LOCUS_44130 gene gly3 12282 13031 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_44130 >Feature sequence51 245 1141 gene locus_tag LOCUS_44140 245 1141 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_44140 2419 1229 gene locus_tag LOCUS_44150 2419 1229 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_44150 3030 2419 gene locus_tag LOCUS_44160 gene ambA 3030 2419 CDS product protein AmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_44160 3174 3821 gene locus_tag LOCUS_44170 3174 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114605.1 protein_id gnl|my_center|LOCUS_44170 6463 4013 gene locus_tag LOCUS_44180 gene fiuA 6463 4013 CDS product ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 protein_id gnl|my_center|LOCUS_44180 7503 6544 gene locus_tag LOCUS_44190 7503 6544 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_44190 8024 7500 gene locus_tag LOCUS_44200 8024 7500 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244528.1 protein_id gnl|my_center|LOCUS_44200 8643 8236 gene locus_tag LOCUS_44210 8643 8236 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097819.1 protein_id gnl|my_center|LOCUS_44210 8841 9998 gene locus_tag LOCUS_44220 8841 9998 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114606.1 protein_id gnl|my_center|LOCUS_44220 10134 10736 gene locus_tag LOCUS_44230 10134 10736 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_44230 11080 12186 gene locus_tag LOCUS_44240 gene arcD 11080 12186 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44240 12256 12651 gene locus_tag LOCUS_44250 12256 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 12726 13004 gene locus_tag LOCUS_44260 12726 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 >Feature sequence52 331 1236 gene locus_tag LOCUS_44270 331 1236 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_44270 1317 3110 gene locus_tag LOCUS_44280 1317 3110 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_44280 3218 3760 gene locus_tag LOCUS_44290 3218 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122551.1 protein_id gnl|my_center|LOCUS_44290 4327 3890 gene locus_tag LOCUS_44300 4327 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 4871 4407 gene locus_tag LOCUS_44310 4871 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_44310 5552 5001 gene locus_tag LOCUS_44320 5552 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113679.1 protein_id gnl|my_center|LOCUS_44320 5971 6384 gene locus_tag LOCUS_44330 5971 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 6922 6464 gene locus_tag LOCUS_44340 6922 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143316.1 protein_id gnl|my_center|LOCUS_44340 7103 7960 gene locus_tag LOCUS_44350 7103 7960 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975791.1 protein_id gnl|my_center|LOCUS_44350 7957 10488 gene locus_tag LOCUS_44360 gene qoxA 7957 10488 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_44360 10488 10841 gene locus_tag LOCUS_44370 10488 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 10832 11653 gene locus_tag LOCUS_44380 10832 11653 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_44380 12000 12317 gene locus_tag LOCUS_44390 12000 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 12405 12722 gene locus_tag LOCUS_44400 12405 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 >Feature sequence53 762 454 gene locus_tag LOCUS_44410 762 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 1495 2436 gene locus_tag LOCUS_44420 1495 2436 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT26 protein_id gnl|my_center|LOCUS_44420 3364 2441 gene locus_tag LOCUS_44430 3364 2441 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_44430 3460 4317 gene locus_tag LOCUS_44440 3460 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945980.1 protein_id gnl|my_center|LOCUS_44440 4314 5249 gene locus_tag LOCUS_44450 gene cysD 4314 5249 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50273 protein_id gnl|my_center|LOCUS_44450 7827 5380 gene locus_tag LOCUS_44460 7827 5380 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRQ4 protein_id gnl|my_center|LOCUS_44460 9350 7824 gene locus_tag LOCUS_44470 9350 7824 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_44470 9454 10326 gene locus_tag LOCUS_44480 9454 10326 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927682.1 protein_id gnl|my_center|LOCUS_44480 >Feature sequence54 647 375 gene locus_tag LOCUS_44490 gene hupA 647 375 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_44490 1984 836 gene locus_tag LOCUS_44500 gene alkT 1984 836 CDS product Rubredoxin-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK9 protein_id gnl|my_center|LOCUS_44500 2929 2174 gene locus_tag LOCUS_44510 2929 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 4520 3180 gene locus_tag LOCUS_44520 4520 3180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367992.1 protein_id gnl|my_center|LOCUS_44520 5902 4583 gene locus_tag LOCUS_44530 gene phoR 5902 4583 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_44530 6634 5945 gene locus_tag LOCUS_44540 gene phoB 6634 5945 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_44540 6934 7320 gene locus_tag LOCUS_44550 6934 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 8241 7351 gene locus_tag LOCUS_44560 gene ubiA 8241 7351 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 protein_id gnl|my_center|LOCUS_44560 9052 8501 gene locus_tag LOCUS_44570 gene ubiC 9052 8501 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_44570 9472 9951 gene locus_tag LOCUS_44580 9472 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44580 9964 10479 gene locus_tag LOCUS_44590 9964 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 >Feature sequence55 837 181 gene locus_tag LOCUS_44600 837 181 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_44600 1648 980 gene locus_tag LOCUS_44610 1648 980 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_44610 2354 1713 gene locus_tag LOCUS_44620 2354 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_44620 3100 4107 gene locus_tag LOCUS_44630 3100 4107 CDS product abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525237.1 protein_id gnl|my_center|LOCUS_44630 5315 4296 gene locus_tag LOCUS_44640 gene oruR 5315 4296 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_44640 5529 6374 gene locus_tag LOCUS_44650 5529 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_44650 7409 6468 gene locus_tag LOCUS_44660 7409 6468 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_44660 10268 7527 gene locus_tag LOCUS_44670 10268 7527 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103006.1 protein_id gnl|my_center|LOCUS_44670 >Feature sequence56 75 872 gene locus_tag LOCUS_44680 75 872 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 protein_id gnl|my_center|LOCUS_44680 1124 975 gene locus_tag LOCUS_44690 1124 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 1788 1069 gene locus_tag LOCUS_44700 1788 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100707.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44700 2204 1785 gene locus_tag LOCUS_44710 2204 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 2823 4028 gene locus_tag LOCUS_44720 2823 4028 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_44720 4116 6260 gene locus_tag LOCUS_44730 4116 6260 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_44730 6689 6423 gene locus_tag LOCUS_44740 6689 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 6946 6746 gene locus_tag LOCUS_44750 6946 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 7965 7306 gene locus_tag LOCUS_44760 7965 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 8577 9302 gene locus_tag LOCUS_44770 8577 9302 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence57 597 160 gene locus_tag LOCUS_44780 597 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_44780 1299 631 gene locus_tag LOCUS_44790 1299 631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268949.1 protein_id gnl|my_center|LOCUS_44790 1848 1363 gene locus_tag LOCUS_44800 1848 1363 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272746.1 protein_id gnl|my_center|LOCUS_44800 1950 2429 gene locus_tag LOCUS_44810 1950 2429 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 protein_id gnl|my_center|LOCUS_44810 2582 3184 gene locus_tag LOCUS_44820 2582 3184 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268947.1 protein_id gnl|my_center|LOCUS_44820 3368 4711 gene locus_tag LOCUS_44830 3368 4711 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_44830 5352 4915 gene locus_tag LOCUS_44840 5352 4915 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556144.1 protein_id gnl|my_center|LOCUS_44840 6358 5357 gene locus_tag LOCUS_44850 6358 5357 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770940.1 protein_id gnl|my_center|LOCUS_44850 7721 6486 gene locus_tag LOCUS_44860 7721 6486 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_44860 >Feature sequence58