>Feature sequence01 66 275 gene locus_tag LOCUS_00010 66 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 667 1026 gene locus_tag LOCUS_00020 667 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2254 2178 gene locus_tag LOCUS_t00010 2254 2178 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2440 3723 gene locus_tag LOCUS_00030 2440 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_00030 4651 3782 gene locus_tag LOCUS_00040 4651 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_00040 5136 4738 gene locus_tag LOCUS_00050 5136 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_00050 7002 5251 gene locus_tag LOCUS_00060 gene ercS 7002 5251 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_00060 8149 6986 gene locus_tag LOCUS_00070 8149 6986 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_00070 10140 8275 gene locus_tag LOCUS_00080 10140 8275 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269166.1 protein_id gnl|my_center|LOCUS_00080 11301 10165 gene locus_tag LOCUS_00090 gene pqqE 11301 10165 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C0 protein_id gnl|my_center|LOCUS_00090 11650 11372 gene locus_tag LOCUS_00100 gene pqqD 11650 11372 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_00100 12743 11976 gene locus_tag LOCUS_00110 gene pqqC 12743 11976 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_00110 13670 12756 gene locus_tag LOCUS_00120 gene pqqB 13670 12756 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C3 protein_id gnl|my_center|LOCUS_00120 15704 14184 gene locus_tag LOCUS_00130 gene exaC 15704 14184 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 protein_id gnl|my_center|LOCUS_00130 16603 15869 gene locus_tag LOCUS_00140 16603 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17889 16600 gene locus_tag LOCUS_00150 17889 16600 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085520.1 protein_id gnl|my_center|LOCUS_00150 19807 18032 gene locus_tag LOCUS_00160 19807 18032 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_00160 20371 21981 gene locus_tag LOCUS_00170 gene mqo1 20371 21981 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_00170 23044 22115 gene locus_tag LOCUS_00180 23044 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23437 23120 gene locus_tag LOCUS_00190 23437 23120 CDS product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405748.1 protein_id gnl|my_center|LOCUS_00190 24264 23509 gene locus_tag LOCUS_00200 24264 23509 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532068.1 protein_id gnl|my_center|LOCUS_00200 25190 24306 gene locus_tag LOCUS_00210 25190 24306 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706375.1 protein_id gnl|my_center|LOCUS_00210 25615 25196 gene locus_tag LOCUS_00220 gene exaB 25615 25196 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_00220 25955 27790 gene locus_tag LOCUS_00230 gene exaA 25955 27790 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4J7 protein_id gnl|my_center|LOCUS_00230 27935 28588 gene locus_tag LOCUS_00240 27935 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_00240 29288 28827 gene locus_tag LOCUS_00250 29288 28827 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_00250 30034 29384 gene locus_tag LOCUS_00260 gene eraR 30034 29384 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_00260 31281 30031 gene locus_tag LOCUS_00270 31281 30031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31722 31285 gene locus_tag LOCUS_00280 31722 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532046.1 protein_id gnl|my_center|LOCUS_00280 31880 33073 gene locus_tag LOCUS_00290 31880 33073 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706377.1 protein_id gnl|my_center|LOCUS_00290 33107 34072 gene locus_tag LOCUS_00300 33107 34072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_00300 34069 34797 gene locus_tag LOCUS_00310 34069 34797 CDS product 2-phenylethanol ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969564.1 protein_id gnl|my_center|LOCUS_00310 34928 35719 gene locus_tag LOCUS_00320 34928 35719 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H04 protein_id gnl|my_center|LOCUS_00320 36000 36551 gene locus_tag LOCUS_00330 36000 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088934.1 protein_id gnl|my_center|LOCUS_00330 36618 37283 gene locus_tag LOCUS_00340 gene agmR 36618 37283 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_00340 40057 37454 gene locus_tag LOCUS_00350 gene ercS' 40057 37454 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 protein_id gnl|my_center|LOCUS_00350 41201 40026 gene locus_tag LOCUS_00360 41201 40026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_00360 42755 41574 gene locus_tag LOCUS_00370 42755 41574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_00370 45714 43177 gene locus_tag LOCUS_00380 gene pqqF 45714 43177 CDS product coenzyme PQQ synthesis protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2D2 protein_id gnl|my_center|LOCUS_00380 46933 45896 gene locus_tag LOCUS_00390 46933 45896 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764509.1 protein_id gnl|my_center|LOCUS_00390 48309 46975 gene locus_tag LOCUS_00400 48309 46975 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 protein_id gnl|my_center|LOCUS_00400 49421 48396 gene locus_tag LOCUS_00410 49421 48396 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104357.1 protein_id gnl|my_center|LOCUS_00410 50422 49472 gene locus_tag LOCUS_00420 50422 49472 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764515.1 protein_id gnl|my_center|LOCUS_00420 51644 50469 gene locus_tag LOCUS_00430 51644 50469 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104358.1 protein_id gnl|my_center|LOCUS_00430 53050 52298 gene locus_tag LOCUS_00440 53050 52298 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_00440 53830 53063 gene locus_tag LOCUS_00450 53830 53063 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331278.1 protein_id gnl|my_center|LOCUS_00450 54033 55016 gene locus_tag LOCUS_00460 gene gcvA 54033 55016 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_00460 56206 55256 gene locus_tag LOCUS_00470 56206 55256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_00470 57512 56295 gene locus_tag LOCUS_00480 57512 56295 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104360.1 protein_id gnl|my_center|LOCUS_00480 57748 58698 gene locus_tag LOCUS_00490 57748 58698 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104359.1 protein_id gnl|my_center|LOCUS_00490 58963 59853 gene locus_tag LOCUS_00500 58963 59853 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_00500 59874 61202 gene locus_tag LOCUS_00510 59874 61202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_00510 61231 62733 gene locus_tag LOCUS_00520 gene dhaL 61231 62733 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973458.1 protein_id gnl|my_center|LOCUS_00520 63071 64012 gene locus_tag LOCUS_00530 63071 64012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267095.1 protein_id gnl|my_center|LOCUS_00530 64102 65292 gene locus_tag LOCUS_00540 64102 65292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402522.1 protein_id gnl|my_center|LOCUS_00540 65573 66574 gene locus_tag LOCUS_00550 gene dusA 65573 66574 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV43 protein_id gnl|my_center|LOCUS_00550 66648 67574 gene locus_tag LOCUS_00560 gene tal 66648 67574 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I047 protein_id gnl|my_center|LOCUS_00560 68129 67635 gene locus_tag LOCUS_00570 68129 67635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_00570 69310 68126 gene locus_tag LOCUS_00580 69310 68126 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_00580 69525 69824 gene locus_tag LOCUS_00590 69525 69824 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382960.1 protein_id gnl|my_center|LOCUS_00590 70591 69890 gene locus_tag LOCUS_00600 70591 69890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_00600 70698 71105 gene locus_tag LOCUS_00610 70698 71105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_00610 71205 71924 gene locus_tag LOCUS_00620 71205 71924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114775.1 protein_id gnl|my_center|LOCUS_00620 72124 72390 gene locus_tag LOCUS_00630 72124 72390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090878.1 protein_id gnl|my_center|LOCUS_00630 73425 72595 gene locus_tag LOCUS_00640 gene queF 73425 72595 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV71 protein_id gnl|my_center|LOCUS_00640 74213 73479 gene locus_tag LOCUS_00650 gene pyrF 74213 73479 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59654 protein_id gnl|my_center|LOCUS_00650 74152 74361 gene locus_tag LOCUS_00660 74152 74361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74773 74303 gene locus_tag LOCUS_00670 74773 74303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 protein_id gnl|my_center|LOCUS_00670 75091 74855 gene locus_tag LOCUS_00680 75091 74855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404198.1 protein_id gnl|my_center|LOCUS_00680 75186 76040 gene locus_tag LOCUS_00690 75186 76040 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766786.1 protein_id gnl|my_center|LOCUS_00690 76812 76030 gene locus_tag LOCUS_00700 76812 76030 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ6 protein_id gnl|my_center|LOCUS_00700 76890 77846 gene locus_tag LOCUS_00710 76890 77846 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_00710 78639 78067 gene locus_tag LOCUS_00720 gene efp 78639 78067 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ2 protein_id gnl|my_center|LOCUS_00720 79819 78686 gene locus_tag LOCUS_00730 79819 78686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268554.1 protein_id gnl|my_center|LOCUS_00730 81378 81896 gene locus_tag LOCUS_00740 81378 81896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 82044 82346 gene locus_tag LOCUS_00750 82044 82346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 82920 82411 gene locus_tag LOCUS_00760 82920 82411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 83664 83822 gene locus_tag LOCUS_00770 83664 83822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 83822 84880 gene locus_tag LOCUS_00780 83822 84880 CDS product bacteriophage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114154.1 protein_id gnl|my_center|LOCUS_00780 84961 84872 gene locus_tag LOCUS_t00020 84961 84872 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85281 85054 gene locus_tag LOCUS_00790 85281 85054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85490 86179 gene locus_tag LOCUS_00800 85490 86179 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_00800 86458 87180 gene locus_tag LOCUS_00810 86458 87180 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLE9 protein_id gnl|my_center|LOCUS_00810 88058 87231 gene locus_tag LOCUS_00820 88058 87231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_00820 88417 89388 gene locus_tag LOCUS_00830 88417 89388 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617011.1 protein_id gnl|my_center|LOCUS_00830 90171 89443 gene locus_tag LOCUS_00840 90171 89443 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_00840 90546 90370 gene locus_tag LOCUS_00850 90546 90370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 90539 90748 gene locus_tag LOCUS_00860 90539 90748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93129 90985 gene locus_tag LOCUS_00870 93129 90985 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00870 94499 93294 gene locus_tag LOCUS_00880 94499 93294 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00880 95338 95697 gene locus_tag LOCUS_00890 95338 95697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95694 96515 gene locus_tag LOCUS_00900 95694 96515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100707.1 protein_id gnl|my_center|LOCUS_00900 97259 96525 gene locus_tag LOCUS_00910 97259 96525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_00910 98135 97338 gene locus_tag LOCUS_00920 98135 97338 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 protein_id gnl|my_center|LOCUS_00920 99082 98132 gene locus_tag LOCUS_00930 99082 98132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 protein_id gnl|my_center|LOCUS_00930 100494 99085 gene locus_tag LOCUS_00940 100494 99085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 protein_id gnl|my_center|LOCUS_00940 101997 101365 gene locus_tag LOCUS_00950 101997 101365 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406317.1 protein_id gnl|my_center|LOCUS_00950 102239 103393 gene locus_tag LOCUS_00960 102239 103393 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 protein_id gnl|my_center|LOCUS_00960 103397 106531 gene locus_tag LOCUS_00970 103397 106531 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268787.1 protein_id gnl|my_center|LOCUS_00970 106528 107979 gene locus_tag LOCUS_00980 106528 107979 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768689.1 protein_id gnl|my_center|LOCUS_00980 108756 108049 gene locus_tag LOCUS_00990 108756 108049 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_00990 109225 108884 gene locus_tag LOCUS_01000 109225 108884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371555.1 protein_id gnl|my_center|LOCUS_01000 110312 109551 gene locus_tag LOCUS_01010 110312 109551 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_01010 111241 110312 gene locus_tag LOCUS_01020 111241 110312 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142502.1 protein_id gnl|my_center|LOCUS_01020 112700 111225 gene locus_tag LOCUS_01030 112700 111225 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_01030 112826 113890 gene locus_tag LOCUS_01040 112826 113890 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_01040 114108 114362 gene locus_tag LOCUS_01050 114108 114362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119823.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01050 115353 114493 gene locus_tag LOCUS_01060 gene speE 115353 114493 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884N3 protein_id gnl|my_center|LOCUS_01060 115547 116434 gene locus_tag LOCUS_01070 gene alkA 115547 116434 CDS product 3-methyladenine DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_01070 116439 116936 gene locus_tag LOCUS_01080 116439 116936 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKT3 protein_id gnl|my_center|LOCUS_01080 117552 116989 gene locus_tag LOCUS_01090 117552 116989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 117748 117557 gene locus_tag LOCUS_01100 117748 117557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 protein_id gnl|my_center|LOCUS_01100 118769 118086 gene locus_tag LOCUS_01110 gene mtnC 118769 118086 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_01110 119370 118822 gene locus_tag LOCUS_01120 gene mtnD 119370 118822 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB9 protein_id gnl|my_center|LOCUS_01120 120009 119395 gene locus_tag LOCUS_01130 gene mtnB 120009 119395 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC0 protein_id gnl|my_center|LOCUS_01130 121157 120006 gene locus_tag LOCUS_01140 121157 120006 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_01140 122376 121285 gene locus_tag LOCUS_01150 gene aroC 122376 121285 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P5 protein_id gnl|my_center|LOCUS_01150 122550 123539 gene locus_tag LOCUS_01160 122550 123539 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 protein_id gnl|my_center|LOCUS_01160 123592 124389 gene locus_tag LOCUS_01170 123592 124389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087649.1 protein_id gnl|my_center|LOCUS_01170 125407 124475 gene locus_tag LOCUS_01180 gene prmB 125407 124475 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_01180 125786 126382 gene locus_tag LOCUS_01190 125786 126382 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103179.1 protein_id gnl|my_center|LOCUS_01190 126501 126821 gene locus_tag LOCUS_01200 126501 126821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087644.1 protein_id gnl|my_center|LOCUS_01200 126846 127451 gene locus_tag LOCUS_01210 126846 127451 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 protein_id gnl|my_center|LOCUS_01210 127536 128084 gene locus_tag LOCUS_01220 gene folE 127536 128084 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVD0 protein_id gnl|my_center|LOCUS_01220 128372 128142 gene locus_tag LOCUS_01230 128372 128142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_01230 128542 128913 gene locus_tag LOCUS_01240 128542 128913 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244324.1 protein_id gnl|my_center|LOCUS_01240 129121 130386 gene locus_tag LOCUS_01250 129121 130386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 130478 132814 gene locus_tag LOCUS_01260 130478 132814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 133171 132848 gene locus_tag LOCUS_01270 133171 132848 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084996.1 protein_id gnl|my_center|LOCUS_01270 133761 133258 gene locus_tag LOCUS_01280 133761 133258 CDS product blue copper protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_01280 135267 133855 gene locus_tag LOCUS_01290 135267 133855 CDS product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 protein_id gnl|my_center|LOCUS_01290 136690 135284 gene locus_tag LOCUS_01300 136690 135284 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_01300 137011 136700 gene locus_tag LOCUS_01310 137011 136700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137504 137169 gene locus_tag LOCUS_01320 137504 137169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138209 137607 gene locus_tag LOCUS_01330 138209 137607 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_01330 139409 138225 gene locus_tag LOCUS_01340 139409 138225 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114606.1 protein_id gnl|my_center|LOCUS_01340 139531 139971 gene locus_tag LOCUS_01350 139531 139971 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097819.1 protein_id gnl|my_center|LOCUS_01350 140461 139940 gene locus_tag LOCUS_01360 140461 139940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 140740 141354 gene locus_tag LOCUS_01370 gene ambA 140740 141354 CDS product protein AmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_01370 141354 142550 gene locus_tag LOCUS_01380 141354 142550 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_01380 143541 142657 gene locus_tag LOCUS_01390 143541 142657 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_01390 144454 143693 gene locus_tag LOCUS_01400 144454 143693 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_01400 144558 145688 gene locus_tag LOCUS_01410 144558 145688 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_01410 148928 145863 gene locus_tag LOCUS_01420 148928 145863 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_01420 149869 148925 gene locus_tag LOCUS_01430 149869 148925 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_01430 150847 150053 gene locus_tag LOCUS_01440 150847 150053 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I032 protein_id gnl|my_center|LOCUS_01440 151776 150844 gene locus_tag LOCUS_01450 151776 150844 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267141.1 protein_id gnl|my_center|LOCUS_01450 151782 152057 gene locus_tag LOCUS_01460 151782 152057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 152320 154767 gene locus_tag LOCUS_01470 152320 154767 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_01470 154838 155248 gene locus_tag LOCUS_01480 154838 155248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770653.1 protein_id gnl|my_center|LOCUS_01480 155817 156716 gene locus_tag LOCUS_01490 155817 156716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038904.1 protein_id gnl|my_center|LOCUS_01490 157196 157405 gene locus_tag LOCUS_01500 157196 157405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 157436 158299 gene locus_tag LOCUS_01510 157436 158299 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 protein_id gnl|my_center|LOCUS_01510 158500 160170 gene locus_tag LOCUS_01520 158500 160170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038900.1 protein_id gnl|my_center|LOCUS_01520 160189 160749 gene locus_tag LOCUS_01530 160189 160749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 160754 161905 gene locus_tag LOCUS_01540 160754 161905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01540 162075 162875 gene locus_tag LOCUS_01550 162075 162875 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_01550 162872 163423 gene locus_tag LOCUS_01560 162872 163423 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_01560 163420 163815 gene locus_tag LOCUS_01570 163420 163815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01570 164055 166073 gene locus_tag LOCUS_01580 164055 166073 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_01580 166894 167142 gene locus_tag LOCUS_01590 166894 167142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_01590 167166 167558 gene locus_tag LOCUS_01600 167166 167558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01600 167655 168368 gene locus_tag LOCUS_01610 167655 168368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_01610 169037 170170 gene locus_tag LOCUS_01620 169037 170170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 170176 171006 gene locus_tag LOCUS_01630 170176 171006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171018 171569 gene locus_tag LOCUS_01640 171018 171569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01640 171690 172283 gene locus_tag LOCUS_01650 171690 172283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01650 172947 173831 gene locus_tag LOCUS_01660 172947 173831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 174017 174844 gene locus_tag LOCUS_01670 174017 174844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107012.1 protein_id gnl|my_center|LOCUS_01670 174936 175205 gene locus_tag LOCUS_01680 174936 175205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 177931 175307 gene locus_tag LOCUS_01690 177931 175307 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267002.1 protein_id gnl|my_center|LOCUS_01690 179084 178032 gene locus_tag LOCUS_01700 179084 178032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 181708 179471 gene locus_tag LOCUS_01710 181708 179471 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_01710 182978 181683 gene locus_tag LOCUS_01720 182978 181683 CDS product DUF2791 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_01720 185206 182975 gene locus_tag LOCUS_01730 185206 182975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104238.1 protein_id gnl|my_center|LOCUS_01730 185881 186405 gene locus_tag LOCUS_01740 185881 186405 CDS product secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038885.1 protein_id gnl|my_center|LOCUS_01740 186411 187055 gene locus_tag LOCUS_01750 186411 187055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 187065 187790 gene locus_tag LOCUS_01760 187065 187790 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_01760 187772 188353 gene locus_tag LOCUS_01770 187772 188353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_01770 188350 188877 gene locus_tag LOCUS_01780 188350 188877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_01780 188888 191062 gene locus_tag LOCUS_01790 188888 191062 CDS product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_01790 191059 191808 gene locus_tag LOCUS_01800 191059 191808 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_01800 193323 191827 gene locus_tag LOCUS_01810 193323 191827 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_01810 193624 193995 gene locus_tag LOCUS_01820 193624 193995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 193992 194225 gene locus_tag LOCUS_01830 193992 194225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 194238 194600 gene locus_tag LOCUS_01840 194238 194600 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_01840 194617 195012 gene locus_tag LOCUS_01850 194617 195012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_01850 195009 195683 gene locus_tag LOCUS_01860 195009 195683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 195680 196549 gene locus_tag LOCUS_01870 195680 196549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 196539 197960 gene locus_tag LOCUS_01880 196539 197960 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_01880 197941 198360 gene locus_tag LOCUS_01890 197941 198360 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_01890 198360 201224 gene locus_tag LOCUS_01900 198360 201224 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_01900 201237 201623 gene locus_tag LOCUS_01910 201237 201623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 202152 201766 gene locus_tag LOCUS_01920 202152 201766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01920 202421 202149 gene locus_tag LOCUS_01930 202421 202149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 202759 203259 gene locus_tag LOCUS_01940 202759 203259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 203428 203865 gene locus_tag LOCUS_01950 203428 203865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 203865 204797 gene locus_tag LOCUS_01960 203865 204797 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_01960 204806 206209 gene locus_tag LOCUS_01970 204806 206209 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_01970 206206 206535 gene locus_tag LOCUS_01980 206206 206535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 206548 208062 gene locus_tag LOCUS_01990 206548 208062 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 protein_id gnl|my_center|LOCUS_01990 208448 208071 gene locus_tag LOCUS_02000 208448 208071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 208936 208478 gene locus_tag LOCUS_02010 208936 208478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_02010 209322 208936 gene locus_tag LOCUS_02020 209322 208936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 209491 211368 gene locus_tag LOCUS_02030 209491 211368 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_02030 213043 212207 gene locus_tag LOCUS_02040 213043 212207 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975379.1 protein_id gnl|my_center|LOCUS_02040 213274 214293 gene locus_tag LOCUS_02050 213274 214293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 215304 214438 gene locus_tag LOCUS_02060 215304 214438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 216459 215365 gene locus_tag LOCUS_02070 216459 215365 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_02070 217320 216520 gene locus_tag LOCUS_02080 gene paaG 217320 216520 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 protein_id gnl|my_center|LOCUS_02080 218390 217317 gene locus_tag LOCUS_02090 218390 217317 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_02090 219541 218393 gene locus_tag LOCUS_02100 219541 218393 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 protein_id gnl|my_center|LOCUS_02100 221048 219741 gene locus_tag LOCUS_02110 221048 219741 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_02110 222478 221204 gene locus_tag LOCUS_02120 222478 221204 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 protein_id gnl|my_center|LOCUS_02120 223159 222656 gene locus_tag LOCUS_02130 223159 222656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 224334 223162 gene locus_tag LOCUS_02140 gene fadA 224334 223162 CDS product acetyl-CoA acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228952.1 protein_id gnl|my_center|LOCUS_02140 225236 224331 gene locus_tag LOCUS_02150 225236 224331 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_02150 226103 225249 gene locus_tag LOCUS_02160 226103 225249 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_02160 227179 226103 gene locus_tag LOCUS_02170 227179 226103 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730490.1 protein_id gnl|my_center|LOCUS_02170 228260 227529 gene locus_tag LOCUS_02180 228260 227529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 228599 230071 gene locus_tag LOCUS_02190 228599 230071 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_02190 231196 230390 gene locus_tag LOCUS_02200 gene fabG 231196 230390 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893580.1 protein_id gnl|my_center|LOCUS_02200 231297 232052 gene locus_tag LOCUS_02210 231297 232052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 232788 232213 gene locus_tag LOCUS_02220 232788 232213 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_02220 234242 232842 gene locus_tag LOCUS_02230 234242 232842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 235439 234462 gene locus_tag LOCUS_02240 235439 234462 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_02240 236184 235483 gene locus_tag LOCUS_02250 gene fabG 236184 235483 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_02250 236325 236723 gene locus_tag LOCUS_02260 236325 236723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 236723 237913 gene locus_tag LOCUS_02270 236723 237913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 238726 237932 gene locus_tag LOCUS_02280 238726 237932 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929924.1 protein_id gnl|my_center|LOCUS_02280 240450 238834 gene locus_tag LOCUS_02290 gene tetV 240450 238834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 protein_id gnl|my_center|LOCUS_02290 241331 240447 gene locus_tag LOCUS_02300 241331 240447 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_02300 242275 241334 gene locus_tag LOCUS_02310 242275 241334 CDS product iron-dependent extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_02310 243128 242367 gene locus_tag LOCUS_02320 gene fabG-1 243128 242367 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941129.1 protein_id gnl|my_center|LOCUS_02320 243411 243175 gene locus_tag LOCUS_02330 243411 243175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 245382 243730 gene locus_tag LOCUS_02340 245382 243730 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_02340 245570 246850 gene locus_tag LOCUS_02350 245570 246850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_02350 246861 247181 gene locus_tag LOCUS_02360 246861 247181 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 protein_id gnl|my_center|LOCUS_02360 247226 248461 gene locus_tag LOCUS_02370 gene hcaD 247226 248461 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222328.1 protein_id gnl|my_center|LOCUS_02370 248540 249724 gene locus_tag LOCUS_02380 248540 249724 CDS product UPF0226 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2B6 protein_id gnl|my_center|LOCUS_02380 250128 249778 gene locus_tag LOCUS_02390 250128 249778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 251455 250187 gene locus_tag LOCUS_02400 251455 250187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_02400 252295 251507 gene locus_tag LOCUS_02410 252295 251507 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 protein_id gnl|my_center|LOCUS_02410 253412 252381 gene locus_tag LOCUS_02420 253412 252381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 254942 253653 gene locus_tag LOCUS_02430 gene pksS 254942 253653 CDS product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 protein_id gnl|my_center|LOCUS_02430 256679 255021 gene locus_tag LOCUS_02440 256679 255021 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_02440 257331 257738 gene locus_tag LOCUS_02450 257331 257738 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_02450 258536 257757 gene locus_tag LOCUS_02460 258536 257757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035638.1 protein_id gnl|my_center|LOCUS_02460 258710 259360 gene locus_tag LOCUS_02470 258710 259360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_02470 260246 259416 gene locus_tag LOCUS_02480 260246 259416 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063718.1 protein_id gnl|my_center|LOCUS_02480 261102 260284 gene locus_tag LOCUS_02490 261102 260284 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887794.1 protein_id gnl|my_center|LOCUS_02490 262070 261099 gene locus_tag LOCUS_02500 262070 261099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 264652 262154 gene locus_tag LOCUS_02510 264652 262154 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_02510 265835 264687 gene locus_tag LOCUS_02520 265835 264687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_02520 267332 265968 gene locus_tag LOCUS_02530 267332 265968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_02530 269021 267357 gene locus_tag LOCUS_02540 269021 267357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 269469 270317 gene locus_tag LOCUS_02550 269469 270317 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528161.1 protein_id gnl|my_center|LOCUS_02550 270391 270942 gene locus_tag LOCUS_02560 gene btuE 270391 270942 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P365 protein_id gnl|my_center|LOCUS_02560 271923 271012 gene locus_tag LOCUS_02570 271923 271012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533150.1 protein_id gnl|my_center|LOCUS_02570 272098 273003 gene locus_tag LOCUS_02580 272098 273003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 274512 273145 gene locus_tag LOCUS_02590 274512 273145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_02590 276195 274537 gene locus_tag LOCUS_02600 276195 274537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_02600 277798 276308 gene locus_tag LOCUS_02610 277798 276308 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_02610 279414 277795 gene locus_tag LOCUS_02620 279414 277795 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_02620 279719 279411 gene locus_tag LOCUS_02630 279719 279411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 280990 279716 gene locus_tag LOCUS_02640 280990 279716 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_02640 281268 281840 gene locus_tag LOCUS_02650 281268 281840 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978556.1 protein_id gnl|my_center|LOCUS_02650 282536 281736 gene locus_tag LOCUS_02660 282536 281736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 283891 282965 gene locus_tag LOCUS_02670 283891 282965 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557395.1 protein_id gnl|my_center|LOCUS_02670 285234 283987 gene locus_tag LOCUS_02680 285234 283987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_02680 286191 285304 gene locus_tag LOCUS_02690 286191 285304 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_02690 287564 286188 gene locus_tag LOCUS_02700 287564 286188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 288064 287618 gene locus_tag LOCUS_02710 288064 287618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 288909 288112 gene locus_tag LOCUS_02720 288909 288112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510929.1 protein_id gnl|my_center|LOCUS_02720 290325 288973 gene locus_tag LOCUS_02730 290325 288973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_02730 292145 290481 gene locus_tag LOCUS_02740 292145 290481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 292509 296072 gene locus_tag LOCUS_02750 292509 296072 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_02750 296189 296566 gene locus_tag LOCUS_02760 296189 296566 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318521.1 protein_id gnl|my_center|LOCUS_02760 296607 297788 gene locus_tag LOCUS_02770 gene ivd 296607 297788 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184784.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence02 1743 328 gene locus_tag LOCUS_02780 1743 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4060 1892 gene locus_tag LOCUS_02790 gene pnp 4060 1892 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ8 protein_id gnl|my_center|LOCUS_02790 4477 4208 gene locus_tag LOCUS_02800 gene rpsO 4477 4208 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ7 protein_id gnl|my_center|LOCUS_02800 5608 4688 gene locus_tag LOCUS_02810 gene truB 5608 4688 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR4 protein_id gnl|my_center|LOCUS_02810 6017 5613 gene locus_tag LOCUS_02820 gene rbfA 6017 5613 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_02820 8619 6127 gene locus_tag LOCUS_02830 gene infB 8619 6127 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ5 protein_id gnl|my_center|LOCUS_02830 10127 8646 gene locus_tag LOCUS_02840 gene nusA 10127 8646 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR1 protein_id gnl|my_center|LOCUS_02840 10652 10194 gene locus_tag LOCUS_02850 gene rimP 10652 10194 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_02850 10858 10782 gene locus_tag LOCUS_t00030 10858 10782 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11041 10956 gene locus_tag LOCUS_t00040 11041 10956 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11435 11052 gene locus_tag LOCUS_02860 gene secG 11435 11052 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_02860 12195 11440 gene locus_tag LOCUS_02870 gene tpiA 12195 11440 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 protein_id gnl|my_center|LOCUS_02870 13598 12261 gene locus_tag LOCUS_02880 gene glmM 13598 12261 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95575 protein_id gnl|my_center|LOCUS_02880 14398 13619 gene locus_tag LOCUS_02890 gene folP 14398 13619 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_02890 16395 14479 gene locus_tag LOCUS_02900 gene ftsH 16395 14479 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_02900 17217 16594 gene locus_tag LOCUS_02910 gene rlmE 17217 16594 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_02910 17320 17631 gene locus_tag LOCUS_02920 17320 17631 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340569.1 protein_id gnl|my_center|LOCUS_02920 18128 17688 gene locus_tag LOCUS_02930 18128 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 protein_id gnl|my_center|LOCUS_02930 18582 18106 gene locus_tag LOCUS_02940 gene greA 18582 18106 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ2 protein_id gnl|my_center|LOCUS_02940 21836 18579 gene locus_tag LOCUS_02950 gene carB 21836 18579 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38100 protein_id gnl|my_center|LOCUS_02950 23120 21972 gene locus_tag LOCUS_02960 gene carA 23120 21972 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_02960 24133 23330 gene locus_tag LOCUS_02970 gene dapB 24133 23330 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_02970 25338 24208 gene locus_tag LOCUS_02980 gene dnaJ 25338 24208 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP1 protein_id gnl|my_center|LOCUS_02980 27376 25460 gene locus_tag LOCUS_02990 gene dnaK 27376 25460 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP0 protein_id gnl|my_center|LOCUS_02990 28045 27476 gene locus_tag LOCUS_03000 gene grpE 28045 27476 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP6 protein_id gnl|my_center|LOCUS_03000 28266 29951 gene locus_tag LOCUS_03010 28266 29951 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_03010 30422 30018 gene locus_tag LOCUS_03020 gene fur 30422 30018 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_03020 30520 31035 gene locus_tag LOCUS_03030 gene bamE 30520 31035 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP3 protein_id gnl|my_center|LOCUS_03030 31428 31108 gene locus_tag LOCUS_03040 31428 31108 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_03040 31855 31421 gene locus_tag LOCUS_03050 gene ratA 31855 31421 CDS product ribosome association toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68560 protein_id gnl|my_center|LOCUS_03050 33293 31890 gene locus_tag LOCUS_03060 33293 31890 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_03060 33404 33886 gene locus_tag LOCUS_03070 gene smpB 33404 33886 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN9 protein_id gnl|my_center|LOCUS_03070 34768 33992 gene locus_tag LOCUS_03080 34768 33992 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_03080 35090 36784 gene locus_tag LOCUS_03090 35090 36784 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_03090 36933 38078 gene locus_tag LOCUS_03100 gene lldD 36933 38078 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV37 protein_id gnl|my_center|LOCUS_03100 38201 41011 gene locus_tag LOCUS_03110 38201 41011 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_03110 41183 41428 gene locus_tag LOCUS_03120 41183 41428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 44366 41448 gene locus_tag LOCUS_03130 44366 41448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 44515 44902 gene locus_tag LOCUS_tm00010 44515 44902 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 45042 45269 gene locus_tag LOCUS_03140 45042 45269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039279.1 protein_id gnl|my_center|LOCUS_03140 46265 45276 gene locus_tag LOCUS_03150 46265 45276 CDS product bacteriophage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114154.1 protein_id gnl|my_center|LOCUS_03150 46408 46265 gene locus_tag LOCUS_03160 46408 46265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 46409 47272 gene locus_tag LOCUS_03170 46409 47272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 47744 48055 gene locus_tag LOCUS_03180 47744 48055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 48055 48984 gene locus_tag LOCUS_03190 48055 48984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 49632 50594 gene locus_tag LOCUS_03200 49632 50594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 50591 51529 gene locus_tag LOCUS_03210 50591 51529 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703829.1 protein_id gnl|my_center|LOCUS_03210 52223 51957 gene locus_tag LOCUS_03220 52223 51957 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_03220 53548 52223 gene locus_tag LOCUS_03230 53548 52223 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073057.1 protein_id gnl|my_center|LOCUS_03230 54255 54647 gene locus_tag LOCUS_03240 54255 54647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_03240 55974 54724 gene locus_tag LOCUS_03250 55974 54724 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267448.1 protein_id gnl|my_center|LOCUS_03250 57708 56125 gene locus_tag LOCUS_03260 57708 56125 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 protein_id gnl|my_center|LOCUS_03260 58873 57872 gene locus_tag LOCUS_03270 58873 57872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111007.1 protein_id gnl|my_center|LOCUS_03270 58996 59943 gene locus_tag LOCUS_03280 58996 59943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 protein_id gnl|my_center|LOCUS_03280 61136 59955 gene locus_tag LOCUS_03290 61136 59955 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206835.1 protein_id gnl|my_center|LOCUS_03290 61302 62246 gene locus_tag LOCUS_03300 61302 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 62404 63393 gene locus_tag LOCUS_03310 62404 63393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_03310 63462 63917 gene locus_tag LOCUS_03320 63462 63917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 63928 65457 gene locus_tag LOCUS_03330 63928 65457 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_03330 65454 66500 gene locus_tag LOCUS_03340 65454 66500 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927167.1 protein_id gnl|my_center|LOCUS_03340 67913 66708 gene locus_tag LOCUS_03350 gene lldA 67913 66708 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930497.1 protein_id gnl|my_center|LOCUS_03350 68819 67971 gene locus_tag LOCUS_03360 68819 67971 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389975.1 protein_id gnl|my_center|LOCUS_03360 69733 68816 gene locus_tag LOCUS_03370 69733 68816 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969897.1 protein_id gnl|my_center|LOCUS_03370 70820 69801 gene locus_tag LOCUS_03380 70820 69801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_03380 72201 70921 gene locus_tag LOCUS_03390 72201 70921 CDS product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809707.1 protein_id gnl|my_center|LOCUS_03390 72771 72268 gene locus_tag LOCUS_03400 72771 72268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706104.1 protein_id gnl|my_center|LOCUS_03400 73030 74565 gene locus_tag LOCUS_03410 gene garD 73030 74565 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_03410 75739 74762 gene locus_tag LOCUS_03420 75739 74762 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268751.1 protein_id gnl|my_center|LOCUS_03420 77455 76073 gene locus_tag LOCUS_03430 77455 76073 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112673.1 protein_id gnl|my_center|LOCUS_03430 78868 77510 gene locus_tag LOCUS_03440 78868 77510 CDS product amino acid APC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_03440 80457 78967 gene locus_tag LOCUS_03450 80457 78967 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 protein_id gnl|my_center|LOCUS_03450 80708 81631 gene locus_tag LOCUS_03460 80708 81631 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_03460 82411 81638 gene locus_tag LOCUS_03470 82411 81638 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528023.1 protein_id gnl|my_center|LOCUS_03470 82522 83640 gene locus_tag LOCUS_03480 82522 83640 CDS product spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082943.1 protein_id gnl|my_center|LOCUS_03480 83686 84804 gene locus_tag LOCUS_03490 83686 84804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083160.1 protein_id gnl|my_center|LOCUS_03490 86114 84957 gene locus_tag LOCUS_03500 86114 84957 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_03500 87030 86356 gene locus_tag LOCUS_03510 87030 86356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_03510 87589 87158 gene locus_tag LOCUS_03520 87589 87158 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_03520 88981 87662 gene locus_tag LOCUS_03530 88981 87662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_03530 89655 90449 gene locus_tag LOCUS_03540 89655 90449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_03540 90605 91444 gene locus_tag LOCUS_03550 90605 91444 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_03550 91579 92043 gene locus_tag LOCUS_03560 91579 92043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_03560 92192 92515 gene locus_tag LOCUS_03570 92192 92515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 92722 92576 gene locus_tag LOCUS_03580 92722 92576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 92790 93134 gene locus_tag LOCUS_03590 92790 93134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_03590 94001 93174 gene locus_tag LOCUS_03600 94001 93174 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_03600 94240 95211 gene locus_tag LOCUS_03610 94240 95211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 95495 96322 gene locus_tag LOCUS_03620 95495 96322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_03620 96436 97716 gene locus_tag LOCUS_03630 96436 97716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 97725 98819 gene locus_tag LOCUS_03640 97725 98819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 99370 98897 gene locus_tag LOCUS_03650 99370 98897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 101322 99826 gene locus_tag LOCUS_03660 gene bauC 101322 99826 CDS product putative 3-oxopropanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I702 protein_id gnl|my_center|LOCUS_03660 102775 101429 gene locus_tag LOCUS_03670 gene bauA 102775 101429 CDS product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I700 protein_id gnl|my_center|LOCUS_03670 102982 103902 gene locus_tag LOCUS_03680 102982 103902 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 protein_id gnl|my_center|LOCUS_03680 104147 105070 gene locus_tag LOCUS_03690 104147 105070 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_03690 105229 106530 gene locus_tag LOCUS_03700 105229 106530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_03700 106865 107536 gene locus_tag LOCUS_03710 106865 107536 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_03710 107536 108120 gene locus_tag LOCUS_03720 107536 108120 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245544.1 protein_id gnl|my_center|LOCUS_03720 108298 108756 gene locus_tag LOCUS_03730 108298 108756 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_03730 109047 110621 gene locus_tag LOCUS_03740 109047 110621 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266557.1 protein_id gnl|my_center|LOCUS_03740 110633 111730 gene locus_tag LOCUS_03750 110633 111730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266556.1 protein_id gnl|my_center|LOCUS_03750 111834 112760 gene locus_tag LOCUS_03760 111834 112760 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266555.1 protein_id gnl|my_center|LOCUS_03760 112989 114344 gene locus_tag LOCUS_03770 gene atzB 112989 114344 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 protein_id gnl|my_center|LOCUS_03770 114646 115728 gene locus_tag LOCUS_03780 114646 115728 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 protein_id gnl|my_center|LOCUS_03780 115937 116905 gene locus_tag LOCUS_03790 115937 116905 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266548.1 protein_id gnl|my_center|LOCUS_03790 117060 118010 gene locus_tag LOCUS_03800 117060 118010 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Y4 protein_id gnl|my_center|LOCUS_03800 118591 118106 gene locus_tag LOCUS_03810 118591 118106 CDS product copper(I)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763123.1 protein_id gnl|my_center|LOCUS_03810 120054 118681 gene locus_tag LOCUS_03820 120054 118681 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 protein_id gnl|my_center|LOCUS_03820 120549 120166 gene locus_tag LOCUS_03830 120549 120166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104226.1 protein_id gnl|my_center|LOCUS_03830 121549 120632 gene locus_tag LOCUS_03840 121549 120632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 protein_id gnl|my_center|LOCUS_03840 121659 121952 gene locus_tag LOCUS_03850 121659 121952 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_03850 121976 122992 gene locus_tag LOCUS_03860 121976 122992 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_03860 123119 123388 gene locus_tag LOCUS_03870 123119 123388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091540.1 protein_id gnl|my_center|LOCUS_03870 123588 125447 gene locus_tag LOCUS_03880 123588 125447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 125514 125693 gene locus_tag LOCUS_03890 125514 125693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104346.1 protein_id gnl|my_center|LOCUS_03890 126888 125701 gene locus_tag LOCUS_03900 126888 125701 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_03900 130376 127242 gene locus_tag LOCUS_03910 130376 127242 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_03910 131534 130389 gene locus_tag LOCUS_03920 131534 130389 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_03920 131682 132305 gene locus_tag LOCUS_03930 gene nalD 131682 132305 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_03930 132698 132501 gene locus_tag LOCUS_03940 132698 132501 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719768.1 protein_id gnl|my_center|LOCUS_03940 132847 133239 gene locus_tag LOCUS_03950 132847 133239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318651.1 protein_id gnl|my_center|LOCUS_03950 133308 135692 gene locus_tag LOCUS_03960 133308 135692 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_03960 135994 136401 gene locus_tag LOCUS_03970 135994 136401 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_03970 137082 136498 gene locus_tag LOCUS_03980 137082 136498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_03980 138096 137131 gene locus_tag LOCUS_03990 138096 137131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099330.1 protein_id gnl|my_center|LOCUS_03990 140420 138111 gene locus_tag LOCUS_04000 140420 138111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114701.1 protein_id gnl|my_center|LOCUS_04000 141201 140434 gene locus_tag LOCUS_04010 141201 140434 CDS product pili assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114703.1 protein_id gnl|my_center|LOCUS_04010 141759 141217 gene locus_tag LOCUS_04020 141759 141217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099337.1 protein_id gnl|my_center|LOCUS_04020 142277 141756 gene locus_tag LOCUS_04030 142277 141756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346702.1 protein_id gnl|my_center|LOCUS_04030 142862 142326 gene locus_tag LOCUS_04040 142862 142326 CDS product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210852.1 protein_id gnl|my_center|LOCUS_04040 143993 143124 gene locus_tag LOCUS_04050 gene tesB 143993 143124 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_04050 145614 144016 gene locus_tag LOCUS_04060 145614 144016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_04060 146174 145611 gene locus_tag LOCUS_04070 146174 145611 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_04070 146244 147164 gene locus_tag LOCUS_04080 146244 147164 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_04080 147222 148400 gene locus_tag LOCUS_04090 gene ampC 147222 148400 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UQ4 protein_id gnl|my_center|LOCUS_04090 149689 148556 gene locus_tag LOCUS_04100 149689 148556 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_04100 149826 151061 gene locus_tag LOCUS_04110 149826 151061 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_04110 152793 151456 gene locus_tag LOCUS_04120 152793 151456 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_04120 153429 152896 gene locus_tag LOCUS_04130 153429 152896 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268947.1 protein_id gnl|my_center|LOCUS_04130 153994 153515 gene locus_tag LOCUS_04140 153994 153515 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 protein_id gnl|my_center|LOCUS_04140 154227 154889 gene locus_tag LOCUS_04150 154227 154889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770243.1 protein_id gnl|my_center|LOCUS_04150 155060 155494 gene locus_tag LOCUS_04160 155060 155494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_04160 156353 155508 gene locus_tag LOCUS_04170 156353 155508 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_04170 156697 156458 gene locus_tag LOCUS_04180 156697 156458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 156912 158000 gene locus_tag LOCUS_04190 156912 158000 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105114.1 protein_id gnl|my_center|LOCUS_04190 158116 158862 gene locus_tag LOCUS_04200 158116 158862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093112.1 protein_id gnl|my_center|LOCUS_04200 161630 159066 gene locus_tag LOCUS_04210 161630 159066 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_04210 161772 162191 gene locus_tag LOCUS_04220 161772 162191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340868.1 protein_id gnl|my_center|LOCUS_04220 162228 163082 gene locus_tag LOCUS_04230 162228 163082 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_04230 163231 163079 gene locus_tag LOCUS_04240 163231 163079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 163789 164268 gene locus_tag LOCUS_04250 163789 164268 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_04250 164450 164653 gene locus_tag LOCUS_04260 164450 164653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_04260 165410 164835 gene locus_tag LOCUS_04270 165410 164835 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_04270 165607 166641 gene locus_tag LOCUS_04280 gene yjgB 165607 166641 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_04280 167805 166681 gene locus_tag LOCUS_04290 167805 166681 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707684.1 protein_id gnl|my_center|LOCUS_04290 169192 168095 gene locus_tag LOCUS_04300 gene spuD 169192 168095 CDS product putrescine-binding periplasmic protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J1 protein_id gnl|my_center|LOCUS_04300 170103 169195 gene locus_tag LOCUS_04310 170103 169195 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 protein_id gnl|my_center|LOCUS_04310 171160 170108 gene locus_tag LOCUS_04320 171160 170108 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_04320 171294 172169 gene locus_tag LOCUS_04330 171294 172169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707685.1 protein_id gnl|my_center|LOCUS_04330 173807 172332 gene locus_tag LOCUS_04340 gene amn 173807 172332 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX46 protein_id gnl|my_center|LOCUS_04340 173939 174700 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgctggcgcggggaacac 176436 174787 gene locus_tag LOCUS_04350 176436 174787 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_04350 177074 176433 gene locus_tag LOCUS_04360 177074 176433 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_04360 177336 177139 gene locus_tag LOCUS_04370 177336 177139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 179702 177315 gene locus_tag LOCUS_04380 gene ladS 179702 177315 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_04380 180048 180815 gene locus_tag LOCUS_04390 180048 180815 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105183.1 protein_id gnl|my_center|LOCUS_04390 180852 181478 gene locus_tag LOCUS_04400 gene thiE 180852 181478 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_04400 181532 182821 gene locus_tag LOCUS_04410 gene hemL 181532 182821 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_04410 182944 183594 gene locus_tag LOCUS_04420 182944 183594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 183685 184236 gene locus_tag LOCUS_04430 183685 184236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399809.1 protein_id gnl|my_center|LOCUS_04430 184640 184317 gene locus_tag LOCUS_04440 184640 184317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_04440 184767 186116 gene locus_tag LOCUS_04450 gene miaB 184767 186116 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN97 protein_id gnl|my_center|LOCUS_04450 186205 187209 gene locus_tag LOCUS_04460 186205 187209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_04460 187202 187675 gene locus_tag LOCUS_04470 gene ybeY 187202 187675 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX9 protein_id gnl|my_center|LOCUS_04470 187869 188708 gene locus_tag LOCUS_04480 187869 188708 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_04480 188870 190390 gene locus_tag LOCUS_04490 gene lnt 188870 190390 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN93 protein_id gnl|my_center|LOCUS_04490 191261 190482 gene locus_tag LOCUS_04500 191261 190482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_04500 191734 191288 gene locus_tag LOCUS_04510 191734 191288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114329.1 protein_id gnl|my_center|LOCUS_04510 192132 194738 gene locus_tag LOCUS_04520 gene leuS 192132 194738 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN90 protein_id gnl|my_center|LOCUS_04520 194798 195409 gene locus_tag LOCUS_04530 gene lptE 194798 195409 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX32 protein_id gnl|my_center|LOCUS_04530 195452 196486 gene locus_tag LOCUS_04540 gene holA 195452 196486 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_04540 196627 196785 gene locus_tag LOCUS_04550 196627 196785 CDS product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093169.1 protein_id gnl|my_center|LOCUS_04550 196858 198141 gene locus_tag LOCUS_04560 196858 198141 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763248.1 protein_id gnl|my_center|LOCUS_04560 198302 199354 gene locus_tag LOCUS_04570 gene lipA 198302 199354 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_04570 200236 199583 gene locus_tag LOCUS_04580 gene lipB 200236 199583 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V9 protein_id gnl|my_center|LOCUS_04580 200514 200236 gene locus_tag LOCUS_04590 200514 200236 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_04590 201741 200581 gene locus_tag LOCUS_04600 201741 200581 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376558.1 protein_id gnl|my_center|LOCUS_04600 202870 201866 gene locus_tag LOCUS_04610 gene rlpA 202870 201866 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V6 protein_id gnl|my_center|LOCUS_04610 203769 202870 gene locus_tag LOCUS_04620 gene mltB 203769 202870 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_04620 205043 203898 gene locus_tag LOCUS_04630 205043 203898 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_04630 206929 205040 gene locus_tag LOCUS_04640 206929 205040 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_04640 207410 206943 gene locus_tag LOCUS_04650 gene rlmH 207410 206943 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_04650 207808 207422 gene locus_tag LOCUS_04660 gene rsfS 207808 207422 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_04660 208490 207831 gene locus_tag LOCUS_04670 gene nadD 208490 207831 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV7 protein_id gnl|my_center|LOCUS_04670 209751 208483 gene locus_tag LOCUS_04680 gene proA 209751 208483 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN73 protein_id gnl|my_center|LOCUS_04680 209961 211289 gene locus_tag LOCUS_04690 209961 211289 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114088.1 protein_id gnl|my_center|LOCUS_04690 212251 211397 gene locus_tag LOCUS_04700 212251 211397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_04700 212316 213032 gene locus_tag LOCUS_04710 212316 213032 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX17 protein_id gnl|my_center|LOCUS_04710 213029 214345 gene locus_tag LOCUS_04720 213029 214345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 protein_id gnl|my_center|LOCUS_04720 215005 214421 gene locus_tag LOCUS_04730 215005 214421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_04730 215732 215016 gene locus_tag LOCUS_04740 215732 215016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_04740 216091 215729 gene locus_tag LOCUS_04750 216091 215729 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122011.1 protein_id gnl|my_center|LOCUS_04750 216340 216795 gene locus_tag LOCUS_04760 216340 216795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_04760 216929 218656 gene locus_tag LOCUS_04770 216929 218656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114085.1 protein_id gnl|my_center|LOCUS_04770 218687 219328 gene locus_tag LOCUS_04780 218687 219328 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 protein_id gnl|my_center|LOCUS_04780 219349 219696 gene locus_tag LOCUS_04790 219349 219696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267193.1 protein_id gnl|my_center|LOCUS_04790 219714 220325 gene locus_tag LOCUS_04800 gene pmtA 219714 220325 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_04800 220427 223015 gene locus_tag LOCUS_04810 220427 223015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 223025 223396 gene locus_tag LOCUS_04820 223025 223396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 223747 223406 gene locus_tag LOCUS_04830 223747 223406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 224426 223740 gene locus_tag LOCUS_04840 gene ubiX 224426 223740 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889L9 protein_id gnl|my_center|LOCUS_04840 225832 224480 gene locus_tag LOCUS_04850 gene mpl 225832 224480 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M0 protein_id gnl|my_center|LOCUS_04850 226212 226667 gene locus_tag LOCUS_04860 226212 226667 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093235.1 protein_id gnl|my_center|LOCUS_04860 226721 227515 gene locus_tag LOCUS_04870 226721 227515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102782.1 protein_id gnl|my_center|LOCUS_04870 229133 227529 gene locus_tag LOCUS_04880 229133 227529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719774.1 protein_id gnl|my_center|LOCUS_04880 229256 230095 gene locus_tag LOCUS_04890 229256 230095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093244.1 protein_id gnl|my_center|LOCUS_04890 230174 230701 gene locus_tag LOCUS_04900 gene ppa 230174 230701 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_04900 231059 231241 gene locus_tag LOCUS_04910 231059 231241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 232486 231272 gene locus_tag LOCUS_04920 232486 231272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_04920 232950 232486 gene locus_tag LOCUS_04930 232950 232486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 233546 232953 gene locus_tag LOCUS_04940 gene chrC 233546 232953 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D83 protein_id gnl|my_center|LOCUS_04940 234838 233606 gene locus_tag LOCUS_04950 234838 233606 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_04950 235779 234835 gene locus_tag LOCUS_04960 gene chrB 235779 234835 CDS product chromate resistance exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552495.1 protein_id gnl|my_center|LOCUS_04960 236057 236617 gene locus_tag LOCUS_04970 gene tnpR 236057 236617 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_569373.1 protein_id gnl|my_center|LOCUS_04970 236621 239587 gene locus_tag LOCUS_04980 236621 239587 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138065.1 protein_id gnl|my_center|LOCUS_04980 239920 240639 gene locus_tag LOCUS_04990 239920 240639 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_04990 241240 240662 gene locus_tag LOCUS_05000 gene nudL 241240 240662 CDS product putative Nudix hydrolase NudL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2L0 protein_id gnl|my_center|LOCUS_05000 242298 241282 gene locus_tag LOCUS_05010 gene mphP 242298 241282 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_05010 243318 242335 gene locus_tag LOCUS_05020 243318 242335 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_05020 243686 243336 gene locus_tag LOCUS_05030 243686 243336 CDS product Rieske family ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434108.1 protein_id gnl|my_center|LOCUS_05030 244609 243707 gene locus_tag LOCUS_05040 244609 243707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 245557 244793 gene locus_tag LOCUS_05050 gene benD 245557 244793 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 protein_id gnl|my_center|LOCUS_05050 246514 245657 gene locus_tag LOCUS_05060 246514 245657 CDS product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700830.1 protein_id gnl|my_center|LOCUS_05060 248489 246519 gene locus_tag LOCUS_05070 248489 246519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_05070 249973 248615 gene locus_tag LOCUS_05080 gene oprO 249973 248615 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036714.1 protein_id gnl|my_center|LOCUS_05080 251210 250161 gene locus_tag LOCUS_05090 251210 250161 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_05090 251990 251460 gene locus_tag LOCUS_05100 251990 251460 CDS product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816691.1 protein_id gnl|my_center|LOCUS_05100 253326 252025 gene locus_tag LOCUS_05110 253326 252025 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063917.1 protein_id gnl|my_center|LOCUS_05110 254231 253401 gene locus_tag LOCUS_05120 254231 253401 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_05120 254428 254228 gene locus_tag LOCUS_05130 254428 254228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence03 329 102 gene locus_tag LOCUS_05140 329 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1074 550 gene locus_tag LOCUS_05150 gene ligT 1074 550 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY3 protein_id gnl|my_center|LOCUS_05150 1300 1608 gene locus_tag LOCUS_05160 1300 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05160 2109 1612 gene locus_tag LOCUS_05170 gene greB 2109 1612 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_05170 4648 2144 gene locus_tag LOCUS_05180 4648 2144 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_05180 5331 4648 gene locus_tag LOCUS_05190 5331 4648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_05190 5342 5947 gene locus_tag LOCUS_05200 5342 5947 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_05200 6006 6287 gene locus_tag LOCUS_05210 6006 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315714.1 protein_id gnl|my_center|LOCUS_05210 6365 7321 gene locus_tag LOCUS_05220 6365 7321 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_05220 7709 7458 gene locus_tag LOCUS_05230 gene oprI 7709 7458 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11221 protein_id gnl|my_center|LOCUS_05230 8017 9393 gene locus_tag LOCUS_05240 gene yxjC 8017 9393 CDS product putative transporter YxjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42314 protein_id gnl|my_center|LOCUS_05240 9476 10741 gene locus_tag LOCUS_05250 9476 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 10763 11044 gene locus_tag LOCUS_05260 10763 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05260 12177 11101 gene locus_tag LOCUS_05270 12177 11101 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_05270 12769 12350 gene locus_tag LOCUS_05280 12769 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 12749 13156 gene locus_tag LOCUS_05290 12749 13156 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 protein_id gnl|my_center|LOCUS_05290 13153 14115 gene locus_tag LOCUS_05300 13153 14115 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y5 protein_id gnl|my_center|LOCUS_05300 14123 15028 gene locus_tag LOCUS_05310 14123 15028 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_05310 15181 15681 gene locus_tag LOCUS_05320 15181 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_05320 15800 16774 gene locus_tag LOCUS_05330 gene cysB 15800 16774 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_05330 17568 16834 gene locus_tag LOCUS_05340 gene cysH 17568 16834 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617365.1 protein_id gnl|my_center|LOCUS_05340 18115 18732 gene locus_tag LOCUS_05350 gene thrH 18115 18732 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_05350 20034 18820 gene locus_tag LOCUS_05360 20034 18820 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_05360 20454 23060 gene locus_tag LOCUS_05370 20454 23060 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120314.1 protein_id gnl|my_center|LOCUS_05370 23057 25780 gene locus_tag LOCUS_05380 23057 25780 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113574.1 protein_id gnl|my_center|LOCUS_05380 26026 26469 gene locus_tag LOCUS_05390 26026 26469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098074.1 protein_id gnl|my_center|LOCUS_05390 26558 27319 gene locus_tag LOCUS_05400 26558 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098072.1 protein_id gnl|my_center|LOCUS_05400 27418 28392 gene locus_tag LOCUS_05410 27418 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_05410 28411 30003 gene locus_tag LOCUS_05420 28411 30003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_05420 30021 31175 gene locus_tag LOCUS_05430 30021 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113576.1 protein_id gnl|my_center|LOCUS_05430 32253 31267 gene locus_tag LOCUS_05440 32253 31267 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_05440 33784 32258 gene locus_tag LOCUS_05450 33784 32258 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 protein_id gnl|my_center|LOCUS_05450 34326 33790 gene locus_tag LOCUS_05460 34326 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087811.1 protein_id gnl|my_center|LOCUS_05460 34633 35370 gene locus_tag LOCUS_05470 34633 35370 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_05470 35367 36251 gene locus_tag LOCUS_05480 gene prpB 35367 36251 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_05480 36306 37466 gene locus_tag LOCUS_05490 gene prpC 36306 37466 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_05490 37463 40054 gene locus_tag LOCUS_05500 37463 40054 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267428.1 protein_id gnl|my_center|LOCUS_05500 40163 41350 gene locus_tag LOCUS_05510 40163 41350 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_05510 42245 41418 gene locus_tag LOCUS_05520 42245 41418 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_05520 42458 44830 gene locus_tag LOCUS_05530 gene ppsA 42458 44830 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_05530 45133 46152 gene locus_tag LOCUS_05540 45133 46152 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765719.1 protein_id gnl|my_center|LOCUS_05540 46327 46815 gene locus_tag LOCUS_05550 46327 46815 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_05550 46842 47837 gene locus_tag LOCUS_05560 gene cmaX 46842 47837 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_05560 47892 48137 gene locus_tag LOCUS_05570 47892 48137 CDS product crfX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406745.1 protein_id gnl|my_center|LOCUS_05570 48139 48963 gene locus_tag LOCUS_05580 48139 48963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_05580 49056 49646 gene locus_tag LOCUS_05590 49056 49646 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_05590 49755 50738 gene locus_tag LOCUS_05600 gene oprF 49755 50738 CDS product outer membrane porin F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13794 protein_id gnl|my_center|LOCUS_05600 51582 50845 gene locus_tag LOCUS_05610 51582 50845 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267433.1 protein_id gnl|my_center|LOCUS_05610 54305 51594 gene locus_tag LOCUS_05620 54305 51594 CDS product assimilatory nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_05620 54681 54352 gene locus_tag LOCUS_05630 gene nirD 54681 54352 CDS product assimilatory nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_05630 57134 54678 gene locus_tag LOCUS_05640 gene nirB 57134 54678 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113579.1 protein_id gnl|my_center|LOCUS_05640 59129 57462 gene locus_tag LOCUS_05650 59129 57462 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267435.1 protein_id gnl|my_center|LOCUS_05650 60575 59364 gene locus_tag LOCUS_05660 60575 59364 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103940.1 protein_id gnl|my_center|LOCUS_05660 61570 62124 gene locus_tag LOCUS_05670 61570 62124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 protein_id gnl|my_center|LOCUS_05670 62504 62166 gene locus_tag LOCUS_05680 62504 62166 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709070.1 protein_id gnl|my_center|LOCUS_05680 63113 62523 gene locus_tag LOCUS_05690 gene coxP 63113 62523 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_05690 63915 63238 gene locus_tag LOCUS_05700 63915 63238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 65702 63927 gene locus_tag LOCUS_05710 gene coxN 65702 63927 CDS product alternative cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P98000 protein_id gnl|my_center|LOCUS_05710 67180 65744 gene locus_tag LOCUS_05720 67180 65744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 67861 67418 gene locus_tag LOCUS_05730 67861 67418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 68658 67969 gene locus_tag LOCUS_05740 68658 67969 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087865.1 protein_id gnl|my_center|LOCUS_05740 69640 68849 gene locus_tag LOCUS_05750 69640 68849 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_05750 70653 69799 gene locus_tag LOCUS_05760 70653 69799 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_05760 71950 70667 gene locus_tag LOCUS_05770 71950 70667 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267438.1 protein_id gnl|my_center|LOCUS_05770 72788 72474 gene locus_tag LOCUS_05780 72788 72474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086015.1 protein_id gnl|my_center|LOCUS_05780 72987 73379 gene locus_tag LOCUS_05790 72987 73379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 74696 73455 gene locus_tag LOCUS_05800 74696 73455 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 protein_id gnl|my_center|LOCUS_05800 76221 74857 gene locus_tag LOCUS_05810 76221 74857 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 protein_id gnl|my_center|LOCUS_05810 76995 76411 gene locus_tag LOCUS_05820 76995 76411 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406734.1 protein_id gnl|my_center|LOCUS_05820 78221 77010 gene locus_tag LOCUS_05830 78221 77010 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103941.1 protein_id gnl|my_center|LOCUS_05830 78672 78433 gene locus_tag LOCUS_05840 78672 78433 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 protein_id gnl|my_center|LOCUS_05840 81697 79097 gene locus_tag LOCUS_05850 81697 79097 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP8 protein_id gnl|my_center|LOCUS_05850 82353 82766 gene locus_tag LOCUS_05860 82353 82766 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404500.1 protein_id gnl|my_center|LOCUS_05860 83739 82876 gene locus_tag LOCUS_05870 83739 82876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_05870 83979 84584 gene locus_tag LOCUS_05880 83979 84584 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_05880 85381 84656 gene locus_tag LOCUS_05890 gene lpxH 85381 84656 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V0 protein_id gnl|my_center|LOCUS_05890 85872 85378 gene locus_tag LOCUS_05900 gene ppiB 85872 85378 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_05900 86187 87851 gene locus_tag LOCUS_05910 gene glnS 86187 87851 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U8 protein_id gnl|my_center|LOCUS_05910 87922 89304 gene locus_tag LOCUS_05920 gene cysS 87922 89304 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN9 protein_id gnl|my_center|LOCUS_05920 90955 89654 gene locus_tag LOCUS_05930 90955 89654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 91263 90955 gene locus_tag LOCUS_05940 91263 90955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 93300 91459 gene locus_tag LOCUS_05950 93300 91459 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769193.1 protein_id gnl|my_center|LOCUS_05950 93582 94676 gene locus_tag LOCUS_05960 93582 94676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_05960 94676 95788 gene locus_tag LOCUS_05970 94676 95788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_05970 95785 96648 gene locus_tag LOCUS_05980 95785 96648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 protein_id gnl|my_center|LOCUS_05980 96660 97457 gene locus_tag LOCUS_05990 96660 97457 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 protein_id gnl|my_center|LOCUS_05990 97470 97742 gene locus_tag LOCUS_06000 97470 97742 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 protein_id gnl|my_center|LOCUS_06000 97836 99578 gene locus_tag LOCUS_06010 97836 99578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267212.1 protein_id gnl|my_center|LOCUS_06010 100509 99655 gene locus_tag LOCUS_06020 gene folD1 100509 99655 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN1 protein_id gnl|my_center|LOCUS_06020 100780 100856 gene locus_tag LOCUS_t00050 100780 100856 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 100890 100965 gene locus_tag LOCUS_t00060 100890 100965 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 101023 101107 gene locus_tag LOCUS_t00070 101023 101107 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101277 102545 gene locus_tag LOCUS_06030 gene tig 101277 102545 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 protein_id gnl|my_center|LOCUS_06030 102629 103279 gene locus_tag LOCUS_06040 gene clpP1 102629 103279 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U1 protein_id gnl|my_center|LOCUS_06040 103388 104668 gene locus_tag LOCUS_06050 gene clpX 103388 104668 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_06050 104819 107215 gene locus_tag LOCUS_06060 gene lon-1 104819 107215 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR8 protein_id gnl|my_center|LOCUS_06060 107353 107625 gene locus_tag LOCUS_06070 gene hupB 107353 107625 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_06070 107677 107753 gene locus_tag LOCUS_t00080 107677 107753 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 107851 109716 gene locus_tag LOCUS_06080 107851 109716 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_06080 110566 109772 gene locus_tag LOCUS_06090 110566 109772 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_06090 112208 110589 gene locus_tag LOCUS_06100 112208 110589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770761.1 protein_id gnl|my_center|LOCUS_06100 113229 112210 gene locus_tag LOCUS_06110 113229 112210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315267.1 protein_id gnl|my_center|LOCUS_06110 114304 113231 gene locus_tag LOCUS_06120 114304 113231 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_06120 116150 114306 gene locus_tag LOCUS_06130 116150 114306 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 protein_id gnl|my_center|LOCUS_06130 117979 116147 gene locus_tag LOCUS_06140 117979 116147 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 protein_id gnl|my_center|LOCUS_06140 118243 119568 gene locus_tag LOCUS_06150 118243 119568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 121021 119570 gene locus_tag LOCUS_06160 121021 119570 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267223.1 protein_id gnl|my_center|LOCUS_06160 122029 121223 gene locus_tag LOCUS_06170 gene gloB 122029 121223 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_06170 122071 122832 gene locus_tag LOCUS_06180 122071 122832 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104690.1 protein_id gnl|my_center|LOCUS_06180 122871 123323 gene locus_tag LOCUS_06190 gene rnhA 122871 123323 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVL1 protein_id gnl|my_center|LOCUS_06190 123316 124059 gene locus_tag LOCUS_06200 gene dnaQ 123316 124059 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_06200 124198 126453 gene locus_tag LOCUS_06210 gene ldcA 124198 126453 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_06210 126683 127495 gene locus_tag LOCUS_06220 126683 127495 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_06220 127546 129225 gene locus_tag LOCUS_06230 gene fimL 127546 129225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_06230 129226 130056 gene locus_tag LOCUS_06240 gene nudC 129226 130056 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86062 protein_id gnl|my_center|LOCUS_06240 130809 130030 gene locus_tag LOCUS_06250 130809 130030 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S1 protein_id gnl|my_center|LOCUS_06250 130910 131557 gene locus_tag LOCUS_06260 130910 131557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_06260 132544 131777 gene locus_tag LOCUS_06270 132544 131777 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_06270 133645 132578 gene locus_tag LOCUS_06280 133645 132578 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_06280 134166 133855 gene locus_tag LOCUS_06290 134166 133855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_06290 134936 134226 gene locus_tag LOCUS_06300 134936 134226 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_06300 135151 136170 gene locus_tag LOCUS_06310 135151 136170 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_06310 136197 137186 gene locus_tag LOCUS_06320 136197 137186 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_06320 137778 137278 gene locus_tag LOCUS_06330 137778 137278 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_06330 139420 137762 gene locus_tag LOCUS_06340 gene cysI 139420 137762 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_06340 140198 139929 gene locus_tag LOCUS_06350 140198 139929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 140091 141032 gene locus_tag LOCUS_06360 140091 141032 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104160.1 protein_id gnl|my_center|LOCUS_06360 141255 141034 gene locus_tag LOCUS_06370 141255 141034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_06370 142647 141607 gene locus_tag LOCUS_06380 142647 141607 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q6 protein_id gnl|my_center|LOCUS_06380 142801 143103 gene locus_tag LOCUS_06390 142801 143103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122824.1 protein_id gnl|my_center|LOCUS_06390 144475 143129 gene locus_tag LOCUS_06400 144475 143129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 148278 144562 gene locus_tag LOCUS_06410 gene metH 148278 144562 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267702.1 protein_id gnl|my_center|LOCUS_06410 148450 150729 gene locus_tag LOCUS_06420 gene cti 148450 150729 CDS product cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_06420 150958 151542 gene locus_tag LOCUS_06430 gene nfuA 150958 151542 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_06430 151951 151718 gene locus_tag LOCUS_06440 151951 151718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709019.1 protein_id gnl|my_center|LOCUS_06440 152602 152333 gene locus_tag LOCUS_06450 152602 152333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315350.1 protein_id gnl|my_center|LOCUS_06450 153190 153894 gene locus_tag LOCUS_06460 153190 153894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 154874 154032 gene locus_tag LOCUS_06470 154874 154032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_06470 156190 155111 gene locus_tag LOCUS_06480 156190 155111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_06480 156393 156701 gene locus_tag LOCUS_06490 156393 156701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 protein_id gnl|my_center|LOCUS_06490 156701 157015 gene locus_tag LOCUS_06500 156701 157015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_06500 157016 157684 gene locus_tag LOCUS_06510 157016 157684 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_06510 157681 159009 gene locus_tag LOCUS_06520 157681 159009 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_06520 159786 159190 gene locus_tag LOCUS_06530 159786 159190 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_06530 159667 159903 gene locus_tag LOCUS_06540 159667 159903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 162113 159969 gene locus_tag LOCUS_06550 162113 159969 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113383.1 protein_id gnl|my_center|LOCUS_06550 162392 163711 gene locus_tag LOCUS_06560 162392 163711 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_06560 163898 165580 gene locus_tag LOCUS_06570 163898 165580 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I6 protein_id gnl|my_center|LOCUS_06570 167236 165749 gene locus_tag LOCUS_06580 gene nuoN 167236 165749 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_06580 168787 167258 gene locus_tag LOCUS_06590 gene nuoM 168787 167258 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619067.1 protein_id gnl|my_center|LOCUS_06590 170674 168827 gene locus_tag LOCUS_06600 gene nuoL 170674 168827 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 protein_id gnl|my_center|LOCUS_06600 170979 170671 gene locus_tag LOCUS_06610 gene nuoK 170979 170671 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J2 protein_id gnl|my_center|LOCUS_06610 171485 170976 gene locus_tag LOCUS_06620 gene nuoJ 171485 170976 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J3 protein_id gnl|my_center|LOCUS_06620 172044 171496 gene locus_tag LOCUS_06630 gene nuoI 172044 171496 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_06630 173049 172057 gene locus_tag LOCUS_06640 gene nuoH 173049 172057 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ3 protein_id gnl|my_center|LOCUS_06640 175775 173046 gene locus_tag LOCUS_06650 gene nuoG 175775 173046 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J6 protein_id gnl|my_center|LOCUS_06650 177241 175868 gene locus_tag LOCUS_06660 gene nuoF 177241 175868 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J7 protein_id gnl|my_center|LOCUS_06660 177732 177238 gene locus_tag LOCUS_06670 gene nuoE 177732 177238 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J8 protein_id gnl|my_center|LOCUS_06670 179516 177735 gene locus_tag LOCUS_06680 gene nuoC 179516 177735 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ7 protein_id gnl|my_center|LOCUS_06680 180254 179577 gene locus_tag LOCUS_06690 gene nuoB 180254 179577 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ8 protein_id gnl|my_center|LOCUS_06690 180678 180265 gene locus_tag LOCUS_06700 gene nuoA 180678 180265 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ3 protein_id gnl|my_center|LOCUS_06700 181481 181146 gene locus_tag LOCUS_06710 181481 181146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 183732 181741 gene locus_tag LOCUS_06720 183732 181741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_06720 185596 184001 gene locus_tag LOCUS_06730 185596 184001 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_06730 186919 186110 gene locus_tag LOCUS_06740 186919 186110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_06740 187557 186916 gene locus_tag LOCUS_06750 187557 186916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113372.1 protein_id gnl|my_center|LOCUS_06750 187991 187566 gene locus_tag LOCUS_06760 187991 187566 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_06760 189150 187984 gene locus_tag LOCUS_06770 189150 187984 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_06770 190599 189229 gene locus_tag LOCUS_06780 190599 189229 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_06780 191532 190687 gene locus_tag LOCUS_06790 191532 190687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_06790 192167 191547 gene locus_tag LOCUS_06800 gene hflD 192167 191547 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ9 protein_id gnl|my_center|LOCUS_06800 193186 192164 gene locus_tag LOCUS_06810 gene mnmA 193186 192164 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR6 protein_id gnl|my_center|LOCUS_06810 193804 193358 gene locus_tag LOCUS_06820 193804 193358 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_06820 196153 193928 gene locus_tag LOCUS_06830 gene idh 196153 193928 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_06830 196510 197766 gene locus_tag LOCUS_06840 gene icd 196510 197766 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_06840 198101 197838 gene locus_tag LOCUS_06850 gene cspD 198101 197838 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_06850 198406 198693 gene locus_tag LOCUS_06860 gene clpS 198406 198693 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK6 protein_id gnl|my_center|LOCUS_06860 198723 200993 gene locus_tag LOCUS_06870 gene clpA 198723 200993 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104508.1 protein_id gnl|my_center|LOCUS_06870 201283 201065 gene locus_tag LOCUS_06880 gene infA 201283 201065 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_06880 202091 201384 gene locus_tag LOCUS_06890 gene ate 202091 201384 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK9 protein_id gnl|my_center|LOCUS_06890 202826 202146 gene locus_tag LOCUS_06900 gene aat 202826 202146 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_06900 203828 202878 gene locus_tag LOCUS_06910 gene trxB1 203828 202878 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_06910 204147 206474 gene locus_tag LOCUS_06920 gene ftsK 204147 206474 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 protein_id gnl|my_center|LOCUS_06920 206504 207130 gene locus_tag LOCUS_06930 gene lolA 206504 207130 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_06930 207150 208475 gene locus_tag LOCUS_06940 207150 208475 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_06940 208472 208846 gene locus_tag LOCUS_06950 gene crcB 208472 208846 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL4 protein_id gnl|my_center|LOCUS_06950 208863 210143 gene locus_tag LOCUS_06960 gene serS 208863 210143 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_06960 210262 211644 gene locus_tag LOCUS_06970 gene cysG 210262 211644 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_06970 212711 211710 gene locus_tag LOCUS_06980 212711 211710 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_06980 213791 212808 gene locus_tag LOCUS_06990 213791 212808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 protein_id gnl|my_center|LOCUS_06990 214123 213788 gene locus_tag LOCUS_07000 214123 213788 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_07000 214419 214120 gene locus_tag LOCUS_07010 214419 214120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090391.1 protein_id gnl|my_center|LOCUS_07010 214778 214419 gene locus_tag LOCUS_07020 gene tusC 214778 214419 CDS product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N2 protein_id gnl|my_center|LOCUS_07020 215172 214780 gene locus_tag LOCUS_07030 gene tusD 215172 214780 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_07030 215951 215283 gene locus_tag LOCUS_07040 215951 215283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03268 protein_id gnl|my_center|LOCUS_07040 216087 216176 gene locus_tag LOCUS_t00090 216087 216176 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 216392 216979 gene locus_tag LOCUS_07050 gene gacA 216392 216979 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 protein_id gnl|my_center|LOCUS_07050 216981 218804 gene locus_tag LOCUS_07060 gene uvrC 216981 218804 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_07060 218838 219398 gene locus_tag LOCUS_07070 gene pgsA 218838 219398 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_07070 219466 219541 gene locus_tag LOCUS_t00100 219466 219541 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 219581 219654 gene locus_tag LOCUS_t00110 219581 219654 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 219767 219853 gene locus_tag LOCUS_t00120 219767 219853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 220142 221503 gene locus_tag LOCUS_07080 gene udg 220142 221503 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86422 protein_id gnl|my_center|LOCUS_07080 221545 222384 gene locus_tag LOCUS_07090 gene galU 221545 222384 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_07090 222852 222430 gene locus_tag LOCUS_07100 222852 222430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_07100 222948 224306 gene locus_tag LOCUS_07110 gene gor 222948 224306 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_07110 224314 224937 gene locus_tag LOCUS_07120 224314 224937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_07120 224940 225350 gene locus_tag LOCUS_07130 224940 225350 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_07130 226264 225347 gene locus_tag LOCUS_07140 226264 225347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 227952 226588 gene locus_tag LOCUS_07150 gene yxlA 227952 226588 CDS product putative purine-cytosine permease YxlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94369 protein_id gnl|my_center|LOCUS_07150 228632 227958 gene locus_tag LOCUS_07160 gene rutB 228632 227958 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NLB5 protein_id gnl|my_center|LOCUS_07160 228915 228745 gene locus_tag LOCUS_07170 228915 228745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 230011 228968 gene locus_tag LOCUS_07180 230011 228968 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267558.1 protein_id gnl|my_center|LOCUS_07180 230764 230279 gene locus_tag LOCUS_07190 230764 230279 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405523.1 protein_id gnl|my_center|LOCUS_07190 232234 231080 gene locus_tag LOCUS_07200 232234 231080 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762690.1 protein_id gnl|my_center|LOCUS_07200 233061 232252 gene locus_tag LOCUS_07210 233061 232252 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104134.1 protein_id gnl|my_center|LOCUS_07210 233982 233068 gene locus_tag LOCUS_07220 233982 233068 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207615.1 protein_id gnl|my_center|LOCUS_07220 235009 233984 gene locus_tag LOCUS_07230 235009 233984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405534.1 protein_id gnl|my_center|LOCUS_07230 236461 235352 gene locus_tag LOCUS_07240 gene ribB 236461 235352 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTT1 protein_id gnl|my_center|LOCUS_07240 236555 236848 gene locus_tag LOCUS_07250 236555 236848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_07250 237424 236861 gene locus_tag LOCUS_07260 237424 236861 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267657.1 protein_id gnl|my_center|LOCUS_07260 238181 237429 gene locus_tag LOCUS_07270 238181 237429 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405525.1 protein_id gnl|my_center|LOCUS_07270 238649 238260 gene locus_tag LOCUS_07280 gene pcaC 238649 238260 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_07280 240125 238674 gene locus_tag LOCUS_07290 gene gabD 240125 238674 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206416.1 protein_id gnl|my_center|LOCUS_07290 240752 240267 gene locus_tag LOCUS_07300 240752 240267 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382778.1 protein_id gnl|my_center|LOCUS_07300 242269 240788 gene locus_tag LOCUS_07310 242269 240788 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_07310 243099 242266 gene locus_tag LOCUS_07320 243099 242266 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246008.1 protein_id gnl|my_center|LOCUS_07320 243716 243126 gene locus_tag LOCUS_07330 243716 243126 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762667.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence04 90 926 gene locus_tag LOCUS_07340 90 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1327 986 gene locus_tag LOCUS_07350 1327 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 protein_id gnl|my_center|LOCUS_07350 1589 3040 gene locus_tag LOCUS_07360 gene dacB 1589 3040 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765687.1 protein_id gnl|my_center|LOCUS_07360 5889 3091 gene locus_tag LOCUS_07370 5889 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8312 6042 gene locus_tag LOCUS_07380 gene rlmL 8312 6042 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883N9 protein_id gnl|my_center|LOCUS_07380 8740 8955 gene locus_tag LOCUS_07390 gene rmf 8740 8955 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883P0 protein_id gnl|my_center|LOCUS_07390 10079 9048 gene locus_tag LOCUS_07400 gene pyrD 10079 9048 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_07400 10510 10166 gene locus_tag LOCUS_07410 10510 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_07410 10625 11512 gene locus_tag LOCUS_07420 10625 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122457.1 protein_id gnl|my_center|LOCUS_07420 16850 11988 gene locus_tag LOCUS_07430 gene gdhB 16850 11988 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_07430 18478 17174 gene locus_tag LOCUS_07440 18478 17174 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811093.1 protein_id gnl|my_center|LOCUS_07440 19046 18540 gene locus_tag LOCUS_07450 19046 18540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_07450 20120 19128 gene locus_tag LOCUS_07460 20120 19128 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_07460 21416 20472 gene locus_tag LOCUS_07470 21416 20472 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102114.1 protein_id gnl|my_center|LOCUS_07470 21697 22917 gene locus_tag LOCUS_07480 gene opdO 21697 22917 CDS product pyroglutatmate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113624.1 protein_id gnl|my_center|LOCUS_07480 23064 24947 gene locus_tag LOCUS_07490 23064 24947 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383592.1 protein_id gnl|my_center|LOCUS_07490 25525 26277 gene locus_tag LOCUS_07500 25525 26277 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I203 protein_id gnl|my_center|LOCUS_07500 26274 26990 gene locus_tag LOCUS_07510 26274 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_07510 26987 27928 gene locus_tag LOCUS_07520 26987 27928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_07520 28081 29040 gene locus_tag LOCUS_07530 28081 29040 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_07530 29046 29987 gene locus_tag LOCUS_07540 29046 29987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_07540 29984 30478 gene locus_tag LOCUS_07550 29984 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267200.1 protein_id gnl|my_center|LOCUS_07550 30471 31502 gene locus_tag LOCUS_07560 30471 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_07560 31499 33253 gene locus_tag LOCUS_07570 31499 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_07570 33250 34893 gene locus_tag LOCUS_07580 33250 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_07580 37677 35299 gene locus_tag LOCUS_07590 37677 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_07590 38788 37697 gene locus_tag LOCUS_07600 38788 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_07600 40355 38985 gene locus_tag LOCUS_07610 40355 38985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_07610 42388 40421 gene locus_tag LOCUS_07620 gene gbt 42388 40421 CDS product glycine/betaine transmethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_07620 45566 42894 gene locus_tag LOCUS_07630 gene pepN 45566 42894 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_07630 46458 45631 gene locus_tag LOCUS_07640 46458 45631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245163.1 protein_id gnl|my_center|LOCUS_07640 46721 46458 gene locus_tag LOCUS_07650 46721 46458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554502.1 protein_id gnl|my_center|LOCUS_07650 47722 46862 gene locus_tag LOCUS_07660 47722 46862 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_07660 48693 47719 gene locus_tag LOCUS_07670 48693 47719 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104727.1 protein_id gnl|my_center|LOCUS_07670 49584 48694 gene locus_tag LOCUS_07680 gene nadK 49584 48694 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_07680 49680 50627 gene locus_tag LOCUS_07690 49680 50627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_07690 51954 50848 gene locus_tag LOCUS_07700 51954 50848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 52945 51977 gene locus_tag LOCUS_07710 52945 51977 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719763.1 protein_id gnl|my_center|LOCUS_07710 54319 52949 gene locus_tag LOCUS_07720 54319 52949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_07720 54972 54541 gene locus_tag LOCUS_07730 54972 54541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_07730 57073 55037 gene locus_tag LOCUS_07740 gene fadH1 57073 55037 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_07740 57259 58203 gene locus_tag LOCUS_07750 57259 58203 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267165.1 protein_id gnl|my_center|LOCUS_07750 58200 59237 gene locus_tag LOCUS_07760 58200 59237 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_07760 60171 59530 gene locus_tag LOCUS_07770 60171 59530 CDS product S-adenosylmethionine--2-demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267804.1 protein_id gnl|my_center|LOCUS_07770 60950 60168 gene locus_tag LOCUS_07780 60950 60168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 protein_id gnl|my_center|LOCUS_07780 61738 60947 gene locus_tag LOCUS_07790 61738 60947 CDS product iron-enterobactin transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372869.1 protein_id gnl|my_center|LOCUS_07790 62782 61751 gene locus_tag LOCUS_07800 62782 61751 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267802.1 protein_id gnl|my_center|LOCUS_07800 63764 62775 gene locus_tag LOCUS_07810 63764 62775 CDS product siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267801.1 protein_id gnl|my_center|LOCUS_07810 64642 63761 gene locus_tag LOCUS_07820 64642 63761 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267800.1 protein_id gnl|my_center|LOCUS_07820 66542 64674 gene locus_tag LOCUS_07830 66542 64674 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267799.1 protein_id gnl|my_center|LOCUS_07830 67320 66547 gene locus_tag LOCUS_07840 67320 66547 CDS product siderophore biosynthesis protein SbnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267798.1 protein_id gnl|my_center|LOCUS_07840 69179 67314 gene locus_tag LOCUS_07850 69179 67314 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267797.1 protein_id gnl|my_center|LOCUS_07850 70622 69204 gene locus_tag LOCUS_07860 70622 69204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 protein_id gnl|my_center|LOCUS_07860 71842 70619 gene locus_tag LOCUS_07870 71842 70619 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267795.1 protein_id gnl|my_center|LOCUS_07870 73619 71835 gene locus_tag LOCUS_07880 73619 71835 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267794.1 protein_id gnl|my_center|LOCUS_07880 75116 73881 gene locus_tag LOCUS_07890 75116 73881 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267793.1 protein_id gnl|my_center|LOCUS_07890 77870 75462 gene locus_tag LOCUS_07900 77870 75462 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 protein_id gnl|my_center|LOCUS_07900 78887 77937 gene locus_tag LOCUS_07910 78887 77937 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267791.1 protein_id gnl|my_center|LOCUS_07910 79381 78887 gene locus_tag LOCUS_07920 79381 78887 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 protein_id gnl|my_center|LOCUS_07920 79868 79792 gene locus_tag LOCUS_t00130 79868 79792 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 80044 79968 gene locus_tag LOCUS_t00140 80044 79968 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 80155 80080 gene locus_tag LOCUS_t00150 80155 80080 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 81091 80561 gene locus_tag LOCUS_07930 gene xcpZ 81091 80561 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25061 protein_id gnl|my_center|LOCUS_07930 82221 81088 gene locus_tag LOCUS_07940 gene xcpY 82221 81088 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_07940 83183 82218 gene locus_tag LOCUS_07950 gene xcpX 83183 82218 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_07950 83854 83180 gene locus_tag LOCUS_07960 gene xcpW 83854 83180 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_07960 84249 83860 gene locus_tag LOCUS_07970 gene xcpV 84249 83860 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_07970 84776 84246 gene locus_tag LOCUS_07980 gene xcpU 84776 84246 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_07980 85217 84783 gene locus_tag LOCUS_07990 gene xcpT 85217 84783 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_07990 86487 85270 gene locus_tag LOCUS_08000 gene xcpS 86487 85270 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_08000 87987 86500 gene locus_tag LOCUS_08010 gene xcpR 87987 86500 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_08010 88234 88878 gene locus_tag LOCUS_08020 gene xcpP 88234 88878 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51575 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 88883 90835 gene locus_tag LOCUS_08030 gene xcpQ 88883 90835 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_08030 93657 90907 gene locus_tag LOCUS_08040 93657 90907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 96445 93803 gene locus_tag LOCUS_08050 96445 93803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 97413 96619 gene locus_tag LOCUS_08060 97413 96619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415691.1 protein_id gnl|my_center|LOCUS_08060 98621 97410 gene locus_tag LOCUS_08070 gene metZ 98621 97410 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_08070 100172 98667 gene locus_tag LOCUS_08080 gene purF 100172 98667 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_08080 100772 100218 gene locus_tag LOCUS_08090 100772 100218 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770588.1 protein_id gnl|my_center|LOCUS_08090 101443 100841 gene locus_tag LOCUS_08100 101443 100841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_08100 102734 101427 gene locus_tag LOCUS_08110 gene folC 102734 101427 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_08110 103618 102731 gene locus_tag LOCUS_08120 gene accD 103618 102731 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW0 protein_id gnl|my_center|LOCUS_08120 104462 103839 gene locus_tag LOCUS_08130 gene trpF 104462 103839 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_08130 105372 104515 gene locus_tag LOCUS_08140 gene truA 105372 104515 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_08140 108210 105376 gene locus_tag LOCUS_08150 gene fimV 108210 105376 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_08150 109376 108366 gene locus_tag LOCUS_08160 gene asd-2 109376 108366 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104739.1 protein_id gnl|my_center|LOCUS_08160 110650 109538 gene locus_tag LOCUS_08170 gene asd-1 110650 109538 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884B9 protein_id gnl|my_center|LOCUS_08170 111788 110706 gene locus_tag LOCUS_08180 gene leuB 111788 110706 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_08180 112534 111887 gene locus_tag LOCUS_08190 gene leuD 112534 111887 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_08190 113974 112547 gene locus_tag LOCUS_08200 gene leuC 113974 112547 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58949 protein_id gnl|my_center|LOCUS_08200 114167 115072 gene locus_tag LOCUS_08210 114167 115072 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_08210 115165 118842 gene locus_tag LOCUS_08220 115165 118842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 119025 118903 gene locus_tag LOCUS_08230 119025 118903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 119188 119937 gene locus_tag LOCUS_08240 119188 119937 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_08240 120975 120001 gene locus_tag LOCUS_08250 gene dusC 120975 120001 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 protein_id gnl|my_center|LOCUS_08250 121125 121526 gene locus_tag LOCUS_08260 121125 121526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 121983 121534 gene locus_tag LOCUS_08270 121983 121534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_08270 122253 124115 gene locus_tag LOCUS_08280 122253 124115 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_08280 124924 124085 gene locus_tag LOCUS_08290 124924 124085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_08290 125475 124936 gene locus_tag LOCUS_08300 125475 124936 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 protein_id gnl|my_center|LOCUS_08300 125723 125648 gene locus_tag LOCUS_t00160 125723 125648 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 125859 125784 gene locus_tag LOCUS_t00170 125859 125784 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 125986 125911 gene locus_tag LOCUS_t00180 125986 125911 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 126126 126051 gene locus_tag LOCUS_t00190 126126 126051 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 127754 126273 gene locus_tag LOCUS_08310 gene gltX 127754 126273 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_08310 128822 127902 gene locus_tag LOCUS_08320 128822 127902 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_08320 128929 129978 gene locus_tag LOCUS_08330 128929 129978 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 protein_id gnl|my_center|LOCUS_08330 129968 131518 gene locus_tag LOCUS_08340 129968 131518 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130539.1 protein_id gnl|my_center|LOCUS_08340 131566 132465 gene locus_tag LOCUS_08350 131566 132465 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705986.1 protein_id gnl|my_center|LOCUS_08350 134673 132658 gene locus_tag LOCUS_08360 gene uvrB 134673 132658 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C9 protein_id gnl|my_center|LOCUS_08360 134908 136104 gene locus_tag LOCUS_08370 gene aspC 134908 136104 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72173 protein_id gnl|my_center|LOCUS_08370 136171 136246 gene locus_tag LOCUS_t00200 136171 136246 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 136839 136516 gene locus_tag LOCUS_08380 136839 136516 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766760.1 protein_id gnl|my_center|LOCUS_08380 137076 137300 gene locus_tag LOCUS_08390 137076 137300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091551.1 protein_id gnl|my_center|LOCUS_08390 137394 138956 gene locus_tag LOCUS_08400 gene ndvC 137394 138956 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_08400 139321 138944 gene locus_tag LOCUS_08410 139321 138944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 139448 139936 gene locus_tag LOCUS_08420 139448 139936 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_08420 140013 141311 gene locus_tag LOCUS_08430 140013 141311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114807.1 protein_id gnl|my_center|LOCUS_08430 141304 142080 gene locus_tag LOCUS_08440 141304 142080 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767596.1 protein_id gnl|my_center|LOCUS_08440 142599 142279 gene locus_tag LOCUS_08450 142599 142279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 143801 142596 gene locus_tag LOCUS_08460 gene cycH 143801 142596 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_08460 144283 143801 gene locus_tag LOCUS_08470 gene ccmH 144283 143801 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_08470 144816 144280 gene locus_tag LOCUS_08480 144816 144280 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_08480 146786 144813 gene locus_tag LOCUS_08490 gene ccmF 146786 144813 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_08490 147259 146783 gene locus_tag LOCUS_08500 gene ccmE 147259 146783 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_08500 147432 147256 gene locus_tag LOCUS_08510 gene ccmD 147432 147256 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N4 protein_id gnl|my_center|LOCUS_08510 148196 147429 gene locus_tag LOCUS_08520 gene ccmC 148196 147429 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_08520 149028 148357 gene locus_tag LOCUS_08530 gene ccmB 149028 148357 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 protein_id gnl|my_center|LOCUS_08530 149606 149025 gene locus_tag LOCUS_08540 gene ccmA 149606 149025 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_08540 149811 151355 gene locus_tag LOCUS_08550 149811 151355 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_08550 151438 151764 gene locus_tag LOCUS_08560 151438 151764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_08560 152366 151968 gene locus_tag LOCUS_08570 152366 151968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083101.1 protein_id gnl|my_center|LOCUS_08570 152849 152370 gene locus_tag LOCUS_08580 152849 152370 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083098.1 protein_id gnl|my_center|LOCUS_08580 153753 152947 gene locus_tag LOCUS_08590 153753 152947 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268431.1 protein_id gnl|my_center|LOCUS_08590 154629 153841 gene locus_tag LOCUS_08600 154629 153841 CDS product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_08600 155551 154682 gene locus_tag LOCUS_08610 gene motD 155551 154682 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_08610 156303 155563 gene locus_tag LOCUS_08620 gene motC 156303 155563 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_08620 157424 156303 gene locus_tag LOCUS_08630 gene cheB1 157424 156303 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_08630 159630 157468 gene locus_tag LOCUS_08640 gene cheA-2 159630 157468 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103790.1 protein_id gnl|my_center|LOCUS_08640 160430 159642 gene locus_tag LOCUS_08650 160430 159642 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_08650 160791 160450 gene locus_tag LOCUS_08660 gene cheY 160791 160450 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51455 protein_id gnl|my_center|LOCUS_08660 161793 161071 gene locus_tag LOCUS_08670 gene fliA 161793 161071 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV3 protein_id gnl|my_center|LOCUS_08670 162644 161814 gene locus_tag LOCUS_08680 gene fleN 162644 161814 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 protein_id gnl|my_center|LOCUS_08680 164060 162759 gene locus_tag LOCUS_08690 gene flhF 164060 162759 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_08690 166184 164076 gene locus_tag LOCUS_08700 gene flhA 166184 164076 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_08700 167560 166325 gene locus_tag LOCUS_08710 167560 166325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104023.1 protein_id gnl|my_center|LOCUS_08710 168185 167562 gene locus_tag LOCUS_08720 168185 167562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258300.1 protein_id gnl|my_center|LOCUS_08720 169792 168434 gene locus_tag LOCUS_08730 169792 168434 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 protein_id gnl|my_center|LOCUS_08730 171231 169777 gene locus_tag LOCUS_08740 171231 169777 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707850.1 protein_id gnl|my_center|LOCUS_08740 172415 171282 gene locus_tag LOCUS_08750 gene flhB 172415 171282 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_08750 173194 172418 gene locus_tag LOCUS_08760 gene fliR 173194 172418 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_08760 173465 173196 gene locus_tag LOCUS_08770 gene fliQ 173465 173196 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_08770 174223 173468 gene locus_tag LOCUS_08780 gene fliP 174223 173468 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W4 protein_id gnl|my_center|LOCUS_08780 174654 174223 gene locus_tag LOCUS_08790 gene fliO 174654 174223 CDS product flagellar protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51467 protein_id gnl|my_center|LOCUS_08790 175145 174675 gene locus_tag LOCUS_08800 175145 174675 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQU4 protein_id gnl|my_center|LOCUS_08800 176159 175188 gene locus_tag LOCUS_08810 gene fliM 176159 175188 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_08810 176698 176174 gene locus_tag LOCUS_08820 176698 176174 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_08820 178294 177020 gene locus_tag LOCUS_08830 178294 177020 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_08830 178730 178377 gene locus_tag LOCUS_08840 178730 178377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_08840 180458 178761 gene locus_tag LOCUS_08850 180458 178761 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_08850 180780 180475 gene locus_tag LOCUS_08860 180780 180475 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_08860 181346 180897 gene locus_tag LOCUS_08870 gene fliJ 181346 180897 CDS product flagellar protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_08870 182714 181350 gene locus_tag LOCUS_08880 gene fliI 182714 181350 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_08880 183510 182704 gene locus_tag LOCUS_08890 183510 182704 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_08890 184530 183514 gene locus_tag LOCUS_08900 gene fliG 184530 183514 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_08900 186310 184523 gene locus_tag LOCUS_08910 gene fliF 186310 184523 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884X8 protein_id gnl|my_center|LOCUS_08910 186656 186327 gene locus_tag LOCUS_08920 gene fliE 186656 186327 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT2 protein_id gnl|my_center|LOCUS_08920 188339 186936 gene locus_tag LOCUS_08930 gene fleR 188339 186936 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_08930 189558 188344 gene locus_tag LOCUS_08940 gene fleS 189558 188344 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_08940 191216 189741 gene locus_tag LOCUS_08950 gene fleQ 191216 189741 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_08950 191770 191474 gene locus_tag LOCUS_08960 191770 191474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082194.1 protein_id gnl|my_center|LOCUS_08960 192178 191798 gene locus_tag LOCUS_08970 gene fliS 192178 191798 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_08970 192715 192329 gene locus_tag LOCUS_08980 gene fliS 192715 192329 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3P3 protein_id gnl|my_center|LOCUS_08980 194158 192719 gene locus_tag LOCUS_08990 gene fliD 194158 192719 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_08990 194570 194181 gene locus_tag LOCUS_09000 194570 194181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 196118 194652 gene locus_tag LOCUS_09010 gene fliC 196118 194652 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_09010 197920 196673 gene locus_tag LOCUS_09020 gene flgL 197920 196673 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_09020 200055 198037 gene locus_tag LOCUS_09030 gene flgK 200055 198037 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_09030 201240 200065 gene locus_tag LOCUS_09040 gene flgJ 201240 200065 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P4 protein_id gnl|my_center|LOCUS_09040 202405 201254 gene locus_tag LOCUS_09050 gene flgI 202405 201254 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_09050 203130 202435 gene locus_tag LOCUS_09060 gene flgH 203130 202435 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_09060 203977 203192 gene locus_tag LOCUS_09070 gene flgG 203977 203192 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_09070 204764 204024 gene locus_tag LOCUS_09080 gene flgF 204764 204024 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_09080 206398 204971 gene locus_tag LOCUS_09090 gene flgE 206398 204971 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P9 protein_id gnl|my_center|LOCUS_09090 207117 206443 gene locus_tag LOCUS_09100 gene flgD 207117 206443 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_09100 207581 207138 gene locus_tag LOCUS_09110 gene flgC 207581 207138 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_09110 208003 207596 gene locus_tag LOCUS_09120 gene flgB 208003 207596 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_09120 209102 208254 gene locus_tag LOCUS_09130 209102 208254 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268461.1 protein_id gnl|my_center|LOCUS_09130 210185 209250 gene locus_tag LOCUS_09140 210185 209250 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_09140 210439 211020 gene locus_tag LOCUS_09150 gene flgA 210439 211020 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268462.1 protein_id gnl|my_center|LOCUS_09150 211164 211505 gene locus_tag LOCUS_09160 gene flgM 211164 211505 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_09160 211556 212023 gene locus_tag LOCUS_09170 211556 212023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113135.1 protein_id gnl|my_center|LOCUS_09170 212067 212855 gene locus_tag LOCUS_09180 212067 212855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_09180 213469 212852 gene locus_tag LOCUS_09190 213469 212852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_09190 214158 213466 gene locus_tag LOCUS_09200 214158 213466 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_09200 215477 214155 gene locus_tag LOCUS_09210 215477 214155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098737.1 protein_id gnl|my_center|LOCUS_09210 216937 215594 gene locus_tag LOCUS_09220 216937 215594 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103772.1 protein_id gnl|my_center|LOCUS_09220 217278 217688 gene locus_tag LOCUS_09230 217278 217688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 218433 217786 gene locus_tag LOCUS_09240 218433 217786 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTR4 protein_id gnl|my_center|LOCUS_09240 218718 219962 gene locus_tag LOCUS_09250 gene sstT 218718 219962 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I273 protein_id gnl|my_center|LOCUS_09250 220094 220020 gene locus_tag LOCUS_t00210 220094 220020 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 220217 220699 gene locus_tag LOCUS_09260 220217 220699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09260 221921 220869 gene locus_tag LOCUS_09270 gene ldh 221921 220869 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_09270 225654 222187 gene locus_tag LOCUS_09280 225654 222187 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_09280 225854 226321 gene locus_tag LOCUS_09290 225854 226321 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_09290 227022 226687 gene locus_tag LOCUS_09300 227022 226687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence05 3066 3374 gene locus_tag LOCUS_09310 3066 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3733 5091 gene locus_tag LOCUS_09320 gene aggA 3733 5091 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 protein_id gnl|my_center|LOCUS_09320 5115 7274 gene locus_tag LOCUS_09330 5115 7274 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_09330 7504 8862 gene locus_tag LOCUS_09340 7504 8862 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_09340 9613 9011 gene locus_tag LOCUS_09350 9613 9011 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_09350 10703 9951 gene locus_tag LOCUS_09360 10703 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 protein_id gnl|my_center|LOCUS_09360 11474 10728 gene locus_tag LOCUS_09370 11474 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 13195 11474 gene locus_tag LOCUS_09380 13195 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 14286 13369 gene locus_tag LOCUS_09390 14286 13369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_09390 14380 15822 gene locus_tag LOCUS_09400 14380 15822 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_09400 15834 16823 gene locus_tag LOCUS_09410 15834 16823 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_09410 16871 18433 gene locus_tag LOCUS_09420 16871 18433 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106258.1 protein_id gnl|my_center|LOCUS_09420 18505 18876 gene locus_tag LOCUS_09430 18505 18876 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_09430 19842 18949 gene locus_tag LOCUS_09440 gene gbuR 19842 18949 CDS product protein GbuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 protein_id gnl|my_center|LOCUS_09440 20150 21109 gene locus_tag LOCUS_09450 gene gbuA 20150 21109 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_09450 21245 22630 gene locus_tag LOCUS_09460 21245 22630 CDS product sodium:solute symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_09460 22743 24344 gene locus_tag LOCUS_09470 22743 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_09470 24663 26003 gene locus_tag LOCUS_09480 24663 26003 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_09480 26063 26800 gene locus_tag LOCUS_09490 26063 26800 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112427.1 protein_id gnl|my_center|LOCUS_09490 26990 26856 gene locus_tag LOCUS_09500 26990 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 29170 27128 gene locus_tag LOCUS_09510 29170 27128 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_09510 31111 29387 gene locus_tag LOCUS_09520 gene aceK 31111 29387 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_09520 31729 32634 gene locus_tag LOCUS_09530 31729 32634 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_09530 33720 32746 gene locus_tag LOCUS_09540 gene cysK 33720 32746 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0D3 protein_id gnl|my_center|LOCUS_09540 33973 34818 gene locus_tag LOCUS_09550 33973 34818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_09550 34961 36139 gene locus_tag LOCUS_09560 34961 36139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_09560 42563 36303 gene locus_tag LOCUS_09570 42563 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 43087 44550 gene locus_tag LOCUS_09580 43087 44550 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528673.1 protein_id gnl|my_center|LOCUS_09580 45249 44581 gene locus_tag LOCUS_09590 45249 44581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 protein_id gnl|my_center|LOCUS_09590 46564 45389 gene locus_tag LOCUS_09600 46564 45389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 55929 46579 gene locus_tag LOCUS_09610 55929 46579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09610 56628 58367 gene locus_tag LOCUS_09620 gene hasD 56628 58367 CDS product transporter HasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_09620 58374 59720 gene locus_tag LOCUS_09630 gene hasE 58374 59720 CDS product metalloprotease secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_09630 59722 61065 gene locus_tag LOCUS_09640 59722 61065 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405041.1 protein_id gnl|my_center|LOCUS_09640 61600 61076 gene locus_tag LOCUS_09650 61600 61076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_09650 62439 61666 gene locus_tag LOCUS_09660 62439 61666 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407244.1 protein_id gnl|my_center|LOCUS_09660 62888 62442 gene locus_tag LOCUS_09670 62888 62442 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895549.1 protein_id gnl|my_center|LOCUS_09670 63470 62970 gene locus_tag LOCUS_09680 63470 62970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086834.1 protein_id gnl|my_center|LOCUS_09680 63561 65597 gene locus_tag LOCUS_09690 63561 65597 CDS product oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112365.1 protein_id gnl|my_center|LOCUS_09690 65716 66189 gene locus_tag LOCUS_09700 65716 66189 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267105.1 protein_id gnl|my_center|LOCUS_09700 66864 66529 gene locus_tag LOCUS_09710 66864 66529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 66996 67370 gene locus_tag LOCUS_09720 66996 67370 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 protein_id gnl|my_center|LOCUS_09720 67445 67915 gene locus_tag LOCUS_09730 67445 67915 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245794.1 protein_id gnl|my_center|LOCUS_09730 69132 68041 gene locus_tag LOCUS_09740 gene potF 69132 68041 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM59 protein_id gnl|my_center|LOCUS_09740 70251 69142 gene locus_tag LOCUS_09750 gene aguA 70251 69142 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLK2 protein_id gnl|my_center|LOCUS_09750 71236 70349 gene locus_tag LOCUS_09760 71236 70349 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 protein_id gnl|my_center|LOCUS_09760 72488 71262 gene locus_tag LOCUS_09770 72488 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 73000 72551 gene locus_tag LOCUS_09780 73000 72551 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I445 protein_id gnl|my_center|LOCUS_09780 74128 73196 gene locus_tag LOCUS_09790 74128 73196 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267100.1 protein_id gnl|my_center|LOCUS_09790 74451 74158 gene locus_tag LOCUS_09800 74451 74158 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y82 protein_id gnl|my_center|LOCUS_09800 75581 74448 gene locus_tag LOCUS_09810 gene rnd 75581 74448 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 protein_id gnl|my_center|LOCUS_09810 75819 76880 gene locus_tag LOCUS_09820 75819 76880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_09820 77729 77049 gene locus_tag LOCUS_09830 77729 77049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_09830 79258 77921 gene locus_tag LOCUS_09840 gene gdhA 79258 77921 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_09840 79577 80431 gene locus_tag LOCUS_09850 gene sseA 79577 80431 CDS product putative 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I452 protein_id gnl|my_center|LOCUS_09850 80648 81127 gene locus_tag LOCUS_09860 80648 81127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_09860 81455 82717 gene locus_tag LOCUS_09870 81455 82717 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103685.1 protein_id gnl|my_center|LOCUS_09870 82786 83403 gene locus_tag LOCUS_09880 82786 83403 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 protein_id gnl|my_center|LOCUS_09880 85228 83453 gene locus_tag LOCUS_09890 85228 83453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 86344 85265 gene locus_tag LOCUS_09900 gene lifO 86344 85265 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_09900 87322 86396 gene locus_tag LOCUS_09910 87322 86396 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478884.1 protein_id gnl|my_center|LOCUS_09910 88003 87437 gene locus_tag LOCUS_09920 88003 87437 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ70 protein_id gnl|my_center|LOCUS_09920 89451 88243 gene locus_tag LOCUS_09930 89451 88243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_09930 89907 89494 gene locus_tag LOCUS_09940 89907 89494 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_09940 90824 89970 gene locus_tag LOCUS_09950 90824 89970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 91692 90967 gene locus_tag LOCUS_09960 gene cobS 91692 90967 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I463 protein_id gnl|my_center|LOCUS_09960 92264 91689 gene locus_tag LOCUS_09970 92264 91689 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_09970 93316 92261 gene locus_tag LOCUS_09980 gene cobT 93316 92261 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_09980 93834 93313 gene locus_tag LOCUS_09990 gene cobP 93834 93313 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_09990 95374 93923 gene locus_tag LOCUS_10000 gene cobQ 95374 93923 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885W8 protein_id gnl|my_center|LOCUS_10000 96363 95371 gene locus_tag LOCUS_10010 gene cobC 96363 95371 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_10010 97264 96356 gene locus_tag LOCUS_10020 gene cobD 97264 96356 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ62 protein_id gnl|my_center|LOCUS_10020 98058 97261 gene locus_tag LOCUS_10030 98058 97261 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_10030 99014 98355 gene locus_tag LOCUS_10040 99014 98355 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082592.1 protein_id gnl|my_center|LOCUS_10040 100318 99011 gene locus_tag LOCUS_10050 gene cobB 100318 99011 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I471 protein_id gnl|my_center|LOCUS_10050 100988 100377 gene locus_tag LOCUS_10060 gene cobO 100988 100377 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_10060 101557 100988 gene locus_tag LOCUS_10070 101557 100988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638412.2 protein_id gnl|my_center|LOCUS_10070 103507 101660 gene locus_tag LOCUS_10080 103507 101660 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_10080 104146 104547 gene locus_tag LOCUS_10090 104146 104547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 protein_id gnl|my_center|LOCUS_10090 104986 104666 gene locus_tag LOCUS_10100 104986 104666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_10100 105728 105066 gene locus_tag LOCUS_10110 105728 105066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_10110 106241 105810 gene locus_tag LOCUS_10120 106241 105810 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_10120 106975 106412 gene locus_tag LOCUS_10130 106975 106412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 107852 107073 gene locus_tag LOCUS_10140 gene cobB2 107852 107073 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_10140 108602 107931 gene locus_tag LOCUS_10150 108602 107931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_10150 109455 108631 gene locus_tag LOCUS_10160 gene ttcA 109455 108631 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_10160 109553 110149 gene locus_tag LOCUS_10170 109553 110149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_10170 110317 110916 gene locus_tag LOCUS_10180 110317 110916 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_10180 111030 111524 gene locus_tag LOCUS_10190 gene sprT 111030 111524 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ34 protein_id gnl|my_center|LOCUS_10190 112750 111569 gene locus_tag LOCUS_10200 112750 111569 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_10200 114512 112875 gene locus_tag LOCUS_10210 114512 112875 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_10210 115379 114549 gene locus_tag LOCUS_10220 115379 114549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_10220 116646 115507 gene locus_tag LOCUS_10230 116646 115507 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_10230 117344 118045 gene locus_tag LOCUS_10240 117344 118045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 119443 118124 gene locus_tag LOCUS_10250 gene dctA2 119443 118124 CDS product C4-dicarboxylate transport protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4F5 protein_id gnl|my_center|LOCUS_10250 119964 120962 gene locus_tag LOCUS_10260 119964 120962 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_10260 121026 122183 gene locus_tag LOCUS_10270 121026 122183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 124720 123344 gene locus_tag LOCUS_10280 gene phoQ 124720 123344 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082438.1 protein_id gnl|my_center|LOCUS_10280 125394 124717 gene locus_tag LOCUS_10290 gene phoP 125394 124717 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_10290 126203 125598 gene locus_tag LOCUS_10300 gene oprH 126203 125598 CDS product PhoP/Q and low Mg2+ inducible outer membrane protein H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 protein_id gnl|my_center|LOCUS_10300 127501 126317 gene locus_tag LOCUS_10310 127501 126317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_10310 127705 127875 gene locus_tag LOCUS_10320 gene napE 127705 127875 CDS product nitrate reductase NapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082429.1 protein_id gnl|my_center|LOCUS_10320 127909 128169 gene locus_tag LOCUS_10330 127909 128169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 128166 130670 gene locus_tag LOCUS_10340 gene napA 128166 130670 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G3 protein_id gnl|my_center|LOCUS_10340 130682 131167 gene locus_tag LOCUS_10350 gene napB 130682 131167 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G4 protein_id gnl|my_center|LOCUS_10350 131177 131773 gene locus_tag LOCUS_10360 gene napC 131177 131773 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_10360 131864 132859 gene locus_tag LOCUS_10370 131864 132859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263039.1 protein_id gnl|my_center|LOCUS_10370 133161 133868 gene locus_tag LOCUS_10380 133161 133868 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268601.1 protein_id gnl|my_center|LOCUS_10380 134089 135378 gene locus_tag LOCUS_10390 gene apeB 134089 135378 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW15 protein_id gnl|my_center|LOCUS_10390 136181 135465 gene locus_tag LOCUS_10400 136181 135465 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091585.1 protein_id gnl|my_center|LOCUS_10400 136656 137714 gene locus_tag LOCUS_10410 136656 137714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091586.1 protein_id gnl|my_center|LOCUS_10410 137842 138648 gene locus_tag LOCUS_10420 137842 138648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104767.1 protein_id gnl|my_center|LOCUS_10420 138645 139487 gene locus_tag LOCUS_10430 138645 139487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 protein_id gnl|my_center|LOCUS_10430 139474 140271 gene locus_tag LOCUS_10440 139474 140271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770465.1 protein_id gnl|my_center|LOCUS_10440 140309 141298 gene locus_tag LOCUS_10450 140309 141298 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267122.1 protein_id gnl|my_center|LOCUS_10450 141298 141951 gene locus_tag LOCUS_10460 141298 141951 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267121.1 protein_id gnl|my_center|LOCUS_10460 142675 142947 gene locus_tag LOCUS_10470 142675 142947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 143560 142976 gene locus_tag LOCUS_10480 143560 142976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_10480 143881 145119 gene locus_tag LOCUS_10490 gene hutI 143881 145119 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF84 protein_id gnl|my_center|LOCUS_10490 145109 146110 gene locus_tag LOCUS_10500 gene hutG 145109 146110 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF85 protein_id gnl|my_center|LOCUS_10500 146231 147556 gene locus_tag LOCUS_10510 146231 147556 CDS product histidine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970145.1 protein_id gnl|my_center|LOCUS_10510 147607 149283 gene locus_tag LOCUS_10520 gene hutU 147607 149283 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI08 protein_id gnl|my_center|LOCUS_10520 149286 150821 gene locus_tag LOCUS_10530 gene hutH 149286 150821 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU85 protein_id gnl|my_center|LOCUS_10530 150989 151699 gene locus_tag LOCUS_10540 gene hutC 150989 151699 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263318.1 protein_id gnl|my_center|LOCUS_10540 151828 152241 gene locus_tag LOCUS_10550 151828 152241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 152865 152428 gene locus_tag LOCUS_10560 gene cdd 152865 152428 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_10560 153556 152939 gene locus_tag LOCUS_10570 153556 152939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_10570 153828 155465 gene locus_tag LOCUS_10580 gene fan1 153828 155465 CDS product Fanconi-associated nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N0 protein_id gnl|my_center|LOCUS_10580 155462 157765 gene locus_tag LOCUS_10590 155462 157765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_10590 158391 157966 gene locus_tag LOCUS_10600 158391 157966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091632.1 protein_id gnl|my_center|LOCUS_10600 158948 158511 gene locus_tag LOCUS_10610 158948 158511 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113165.1 protein_id gnl|my_center|LOCUS_10610 159054 159572 gene locus_tag LOCUS_10620 159054 159572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10620 159576 159758 gene locus_tag LOCUS_10630 159576 159758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10630 159860 160432 gene locus_tag LOCUS_10640 159860 160432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093439.1 protein_id gnl|my_center|LOCUS_10640 161236 160436 gene locus_tag LOCUS_10650 161236 160436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 161427 162479 gene locus_tag LOCUS_10660 161427 162479 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391138.1 protein_id gnl|my_center|LOCUS_10660 162633 162959 gene locus_tag LOCUS_10670 162633 162959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 163742 163215 gene locus_tag LOCUS_10680 163742 163215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 167889 163825 gene locus_tag LOCUS_10690 167889 163825 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_10690 169665 167980 gene locus_tag LOCUS_10700 169665 167980 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I6 protein_id gnl|my_center|LOCUS_10700 171644 169956 gene locus_tag LOCUS_10710 gene fadD1 171644 169956 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_10710 173573 171885 gene locus_tag LOCUS_10720 gene fadD2 173573 171885 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_10720 173801 174763 gene locus_tag LOCUS_10730 173801 174763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_10730 174760 175230 gene locus_tag LOCUS_10740 174760 175230 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402365.1 protein_id gnl|my_center|LOCUS_10740 175376 175882 gene locus_tag LOCUS_10750 175376 175882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_10750 176130 176786 gene locus_tag LOCUS_10760 176130 176786 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703860.1 protein_id gnl|my_center|LOCUS_10760 176788 177747 gene locus_tag LOCUS_10770 176788 177747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 protein_id gnl|my_center|LOCUS_10770 177734 178672 gene locus_tag LOCUS_10780 177734 178672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704458.1 protein_id gnl|my_center|LOCUS_10780 178669 179748 gene locus_tag LOCUS_10790 gene ybhS 178669 179748 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1B4 protein_id gnl|my_center|LOCUS_10790 180077 179895 gene locus_tag LOCUS_10800 180077 179895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 180326 180165 gene locus_tag LOCUS_10810 180326 180165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268687.1 protein_id gnl|my_center|LOCUS_10810 180925 180323 gene locus_tag LOCUS_10820 180925 180323 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_10820 181266 180970 gene locus_tag LOCUS_10830 181266 180970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091664.1 protein_id gnl|my_center|LOCUS_10830 181444 184287 gene locus_tag LOCUS_10840 gene rapA 181444 184287 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XS2 protein_id gnl|my_center|LOCUS_10840 185742 184414 gene locus_tag LOCUS_10850 185742 184414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104878.1 protein_id gnl|my_center|LOCUS_10850 186043 188220 gene locus_tag LOCUS_10860 186043 188220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 188426 190021 gene locus_tag LOCUS_10870 188426 190021 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706481.1 protein_id gnl|my_center|LOCUS_10870 190883 190089 gene locus_tag LOCUS_10880 gene hyi 190883 190089 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_10880 191770 190880 gene locus_tag LOCUS_10890 191770 190880 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_10890 191912 192763 gene locus_tag LOCUS_10900 191912 192763 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 protein_id gnl|my_center|LOCUS_10900 192760 193563 gene locus_tag LOCUS_10910 gene phnC1 192760 193563 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_10910 193557 194384 gene locus_tag LOCUS_10920 193557 194384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_10920 194381 195148 gene locus_tag LOCUS_10930 194381 195148 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266574.1 protein_id gnl|my_center|LOCUS_10930 195638 195270 gene locus_tag LOCUS_10940 195638 195270 CDS product DUF5064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082140.1 protein_id gnl|my_center|LOCUS_10940 196040 195723 gene locus_tag LOCUS_10950 196040 195723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_10950 196340 197467 gene locus_tag LOCUS_10960 196340 197467 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268692.1 protein_id gnl|my_center|LOCUS_10960 197591 198514 gene locus_tag LOCUS_10970 gene braD 197591 198514 CDS product high-affinity branched-chain amino acid transport system permease protein BraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21627 protein_id gnl|my_center|LOCUS_10970 198511 199779 gene locus_tag LOCUS_10980 198511 199779 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764931.1 protein_id gnl|my_center|LOCUS_10980 199776 200543 gene locus_tag LOCUS_10990 gene braF 199776 200543 CDS product high-affinity branched-chain amino acid transport ATP-binding protein BraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21629 protein_id gnl|my_center|LOCUS_10990 200543 201244 gene locus_tag LOCUS_11000 200543 201244 CDS product high-affinity branched-chain amino acid transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPP3 protein_id gnl|my_center|LOCUS_11000 201749 202459 gene locus_tag LOCUS_11010 201749 202459 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 protein_id gnl|my_center|LOCUS_11010 202531 202992 gene locus_tag LOCUS_11020 202531 202992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 protein_id gnl|my_center|LOCUS_11020 203112 203882 gene locus_tag LOCUS_11030 gene rhlG 203112 203882 CDS product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 protein_id gnl|my_center|LOCUS_11030 204007 204636 gene locus_tag LOCUS_11040 204007 204636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532425.1 protein_id gnl|my_center|LOCUS_11040 204639 205442 gene locus_tag LOCUS_11050 204639 205442 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_11050 205478 206203 gene locus_tag LOCUS_11060 205478 206203 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266991.1 protein_id gnl|my_center|LOCUS_11060 206402 207787 gene locus_tag LOCUS_11070 206402 207787 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_11070 208894 208115 gene locus_tag LOCUS_11080 208894 208115 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_11080 209037 209936 gene locus_tag LOCUS_11090 209037 209936 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_11090 210318 209953 gene locus_tag LOCUS_11100 210318 209953 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364775.1 protein_id gnl|my_center|LOCUS_11100 211043 210393 gene locus_tag LOCUS_11110 gene erdR 211043 210393 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_11110 211242 211571 gene locus_tag LOCUS_11120 211242 211571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 211572 212138 gene locus_tag LOCUS_11130 211572 212138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 212682 212143 gene locus_tag LOCUS_11140 212682 212143 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406193.1 protein_id gnl|my_center|LOCUS_11140 213043 213441 gene locus_tag LOCUS_11150 213043 213441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092248.1 protein_id gnl|my_center|LOCUS_11150 213643 213449 gene locus_tag LOCUS_11160 213643 213449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 214036 215118 gene locus_tag LOCUS_11170 214036 215118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092255.1 protein_id gnl|my_center|LOCUS_11170 215653 215189 gene locus_tag LOCUS_11180 gene recX 215653 215189 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_11180 216720 215665 gene locus_tag LOCUS_11190 gene recA 216720 215665 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_11190 217362 216808 gene locus_tag LOCUS_11200 217362 216808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_11200 217399 219972 gene locus_tag LOCUS_11210 gene mutS 217399 219972 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP5 protein_id gnl|my_center|LOCUS_11210 220116 220439 gene locus_tag LOCUS_11220 gene fdxA 220116 220439 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_11220 >Feature sequence06 160 1209 gene locus_tag LOCUS_11230 160 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2179 1322 gene locus_tag LOCUS_11240 2179 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2866 2183 gene locus_tag LOCUS_11250 2866 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3699 2863 gene locus_tag LOCUS_11260 3699 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3626 3853 gene locus_tag LOCUS_11270 3626 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3819 4058 gene locus_tag LOCUS_11280 3819 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5439 4357 gene locus_tag LOCUS_11290 gene nodX 5439 4357 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_11290 5823 5458 gene locus_tag LOCUS_11300 5823 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7228 5810 gene locus_tag LOCUS_11310 7228 5810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765108.1 protein_id gnl|my_center|LOCUS_11310 8077 7259 gene locus_tag LOCUS_11320 8077 7259 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268350.1 protein_id gnl|my_center|LOCUS_11320 9471 8074 gene locus_tag LOCUS_11330 gene pslJ 9471 8074 CDS product biofilm formation protein PslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089234.1 protein_id gnl|my_center|LOCUS_11330 10580 9468 gene locus_tag LOCUS_11340 gene pslI 10580 9468 CDS product biofilm formation protein PslI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113722.1 protein_id gnl|my_center|LOCUS_11340 11785 10574 gene locus_tag LOCUS_11350 gene pslH 11785 10574 CDS product biofilm formation protein PslH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_11350 13127 11790 gene locus_tag LOCUS_11360 13127 11790 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104602.1 protein_id gnl|my_center|LOCUS_11360 14307 13117 gene locus_tag LOCUS_11370 14307 13117 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104601.1 protein_id gnl|my_center|LOCUS_11370 16298 14307 gene locus_tag LOCUS_11380 gene pslE 16298 14307 CDS product biofilm formation protein PslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113719.1 protein_id gnl|my_center|LOCUS_11380 17089 16319 gene locus_tag LOCUS_11390 gene pslD 17089 16319 CDS product biofilm formation protein PslD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089227.1 protein_id gnl|my_center|LOCUS_11390 18030 17119 gene locus_tag LOCUS_11400 gene pslC 18030 17119 CDS product biofilm formation protein PslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_11400 19487 18030 gene locus_tag LOCUS_11410 19487 18030 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268344.1 protein_id gnl|my_center|LOCUS_11410 20923 19490 gene locus_tag LOCUS_11420 20923 19490 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765093.1 protein_id gnl|my_center|LOCUS_11420 21352 22422 gene locus_tag LOCUS_11430 21352 22422 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLL0 protein_id gnl|my_center|LOCUS_11430 22419 23285 gene locus_tag LOCUS_11440 gene rfbA 22419 23285 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E7 protein_id gnl|my_center|LOCUS_11440 23288 23833 gene locus_tag LOCUS_11450 gene rfbC-2 23288 23833 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_11450 23830 24699 gene locus_tag LOCUS_11460 23830 24699 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_11460 24864 26678 gene locus_tag LOCUS_11470 24864 26678 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269322.1 protein_id gnl|my_center|LOCUS_11470 26675 28063 gene locus_tag LOCUS_11480 26675 28063 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246574.1 protein_id gnl|my_center|LOCUS_11480 28408 29403 gene locus_tag LOCUS_11490 gene dctP 28408 29403 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_11490 29539 30183 gene locus_tag LOCUS_11500 gene dctQ 29539 30183 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU17 protein_id gnl|my_center|LOCUS_11500 30180 31463 gene locus_tag LOCUS_11510 gene dctM 30180 31463 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_11510 33247 31604 gene locus_tag LOCUS_11520 33247 31604 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_11520 33495 35420 gene locus_tag LOCUS_11530 gene fabY 33495 35420 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_11530 36345 35524 gene locus_tag LOCUS_11540 gene cysQ 36345 35524 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_11540 36908 36342 gene locus_tag LOCUS_11550 36908 36342 CDS product ADP-ribose diphosphatase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_11550 37115 37777 gene locus_tag LOCUS_11560 37115 37777 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_11560 37846 38730 gene locus_tag LOCUS_11570 37846 38730 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100042.1 protein_id gnl|my_center|LOCUS_11570 38984 39832 gene locus_tag LOCUS_11580 gene fdhD 38984 39832 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU09 protein_id gnl|my_center|LOCUS_11580 39829 42150 gene locus_tag LOCUS_11590 39829 42150 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114064.1 protein_id gnl|my_center|LOCUS_11590 42530 43024 gene locus_tag LOCUS_11600 42530 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 43203 43631 gene locus_tag LOCUS_11610 43203 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100051.1 protein_id gnl|my_center|LOCUS_11610 44718 43918 gene locus_tag LOCUS_11620 44718 43918 CDS product DUF4824 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114161.1 protein_id gnl|my_center|LOCUS_11620 45782 44715 gene locus_tag LOCUS_11630 45782 44715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 protein_id gnl|my_center|LOCUS_11630 45979 47034 gene locus_tag LOCUS_11640 45979 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 47471 47031 gene locus_tag LOCUS_11650 47471 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_11650 48737 47574 gene locus_tag LOCUS_11660 48737 47574 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_11660 50629 48839 gene locus_tag LOCUS_11670 50629 48839 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114060.1 protein_id gnl|my_center|LOCUS_11670 51894 50626 gene locus_tag LOCUS_11680 51894 50626 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114059.1 protein_id gnl|my_center|LOCUS_11680 51996 52895 gene locus_tag LOCUS_11690 51996 52895 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_11690 53113 52955 gene locus_tag LOCUS_11700 53113 52955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 54806 53313 gene locus_tag LOCUS_11710 54806 53313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_11710 55080 55547 gene locus_tag LOCUS_11720 55080 55547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 56608 55865 gene locus_tag LOCUS_11730 56608 55865 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_11730 56750 57655 gene locus_tag LOCUS_11740 56750 57655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 58353 58012 gene locus_tag LOCUS_11750 58353 58012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 protein_id gnl|my_center|LOCUS_11750 59477 59052 gene locus_tag LOCUS_11760 59477 59052 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764200.1 protein_id gnl|my_center|LOCUS_11760 61517 59580 gene locus_tag LOCUS_11770 61517 59580 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269325.1 protein_id gnl|my_center|LOCUS_11770 63335 61794 gene locus_tag LOCUS_11780 gene pckA 63335 61794 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_11780 64443 63496 gene locus_tag LOCUS_11790 gene hslO 64443 63496 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_11790 64921 64526 gene locus_tag LOCUS_11800 64921 64526 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_11800 65021 65488 gene locus_tag LOCUS_11810 65021 65488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401758.1 protein_id gnl|my_center|LOCUS_11810 65485 66390 gene locus_tag LOCUS_11820 gene rimK 65485 66390 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AZ9 protein_id gnl|my_center|LOCUS_11820 70408 66602 gene locus_tag LOCUS_11830 70408 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 71801 70488 gene locus_tag LOCUS_11840 gene envZ 71801 70488 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246751.1 protein_id gnl|my_center|LOCUS_11840 72630 71896 gene locus_tag LOCUS_11850 gene amgR 72630 71896 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 protein_id gnl|my_center|LOCUS_11850 72968 75295 gene locus_tag LOCUS_11860 72968 75295 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_11860 75299 75688 gene locus_tag LOCUS_11870 75299 75688 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 protein_id gnl|my_center|LOCUS_11870 75815 77395 gene locus_tag LOCUS_11880 gene gshA 75815 77395 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_11880 77536 77742 gene locus_tag LOCUS_11890 77536 77742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 79146 77818 gene locus_tag LOCUS_11900 gene argA 79146 77818 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_11900 80411 79260 gene locus_tag LOCUS_11910 80411 79260 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_11910 81802 80537 gene locus_tag LOCUS_11920 81802 80537 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_11920 82519 81842 gene locus_tag LOCUS_11930 82519 81842 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_11930 82632 83996 gene locus_tag LOCUS_11940 82632 83996 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103097.1 protein_id gnl|my_center|LOCUS_11940 84113 85897 gene locus_tag LOCUS_11950 84113 85897 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_11950 85999 86955 gene locus_tag LOCUS_11960 85999 86955 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 protein_id gnl|my_center|LOCUS_11960 86959 87408 gene locus_tag LOCUS_11970 86959 87408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107402.1 protein_id gnl|my_center|LOCUS_11970 87405 87995 gene locus_tag LOCUS_11980 87405 87995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 87995 88375 gene locus_tag LOCUS_11990 87995 88375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 91359 88483 gene locus_tag LOCUS_12000 gene gcvP2 91359 88483 CDS product glycine dehydrogenase (decarboxylating) 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX7 protein_id gnl|my_center|LOCUS_12000 91862 91476 gene locus_tag LOCUS_12010 gene gcvH2 91862 91476 CDS product glycine cleavage system H protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX6 protein_id gnl|my_center|LOCUS_12010 93045 91963 gene locus_tag LOCUS_12020 gene gcvT 93045 91963 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_12020 94881 93265 gene locus_tag LOCUS_12030 94881 93265 CDS product binding-protein-dependent transport system inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_12030 96051 95050 gene locus_tag LOCUS_12040 96051 95050 CDS product putative binding protein component of ABC iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX3 protein_id gnl|my_center|LOCUS_12040 97406 96189 gene locus_tag LOCUS_12050 97406 96189 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_12050 97898 97416 gene locus_tag LOCUS_12060 97898 97416 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_12060 99086 97902 gene locus_tag LOCUS_12070 gene ubiH 99086 97902 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_12070 100426 99092 gene locus_tag LOCUS_12080 gene pepP 100426 99092 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12080 101015 100461 gene locus_tag LOCUS_12090 101015 100461 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US2 protein_id gnl|my_center|LOCUS_12090 101162 101371 gene locus_tag LOCUS_12100 101162 101371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12100 101368 101682 gene locus_tag LOCUS_12110 gene zapA 101368 101682 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_12110 101943 102539 gene locus_tag LOCUS_12120 101943 102539 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_12120 102925 103374 gene locus_tag LOCUS_12130 102925 103374 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266315.1 protein_id gnl|my_center|LOCUS_12130 103426 105276 gene locus_tag LOCUS_12140 103426 105276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 105686 105273 gene locus_tag LOCUS_12150 105686 105273 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096328.1 protein_id gnl|my_center|LOCUS_12150 106122 107099 gene locus_tag LOCUS_12160 106122 107099 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_12160 108347 107379 gene locus_tag LOCUS_12170 108347 107379 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_12170 109917 108451 gene locus_tag LOCUS_12180 gene ubiD 109917 108451 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV3 protein_id gnl|my_center|LOCUS_12180 111310 110051 gene locus_tag LOCUS_12190 gene rho 111310 110051 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ4 protein_id gnl|my_center|LOCUS_12190 111919 111593 gene locus_tag LOCUS_12200 gene trxA 111919 111593 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_12200 112742 112035 gene locus_tag LOCUS_12210 112742 112035 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247319.1 protein_id gnl|my_center|LOCUS_12210 113027 113812 gene locus_tag LOCUS_12220 113027 113812 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266305.1 protein_id gnl|my_center|LOCUS_12220 113842 114507 gene locus_tag LOCUS_12230 113842 114507 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380046.1 protein_id gnl|my_center|LOCUS_12230 114507 115154 gene locus_tag LOCUS_12240 114507 115154 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105389.1 protein_id gnl|my_center|LOCUS_12240 115141 115872 gene locus_tag LOCUS_12250 115141 115872 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768429.1 protein_id gnl|my_center|LOCUS_12250 115875 116384 gene locus_tag LOCUS_12260 gene allA 115875 116384 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_12260 116510 118012 gene locus_tag LOCUS_12270 gene ppx 116510 118012 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_12270 120209 117999 gene locus_tag LOCUS_12280 gene ppk 120209 117999 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZQ6 protein_id gnl|my_center|LOCUS_12280 121241 120228 gene locus_tag LOCUS_12290 121241 120228 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZQ7 protein_id gnl|my_center|LOCUS_12290 121478 122032 gene locus_tag LOCUS_12300 121478 122032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 123260 122034 gene locus_tag LOCUS_12310 gene erg3 123260 122034 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_12310 123675 124334 gene locus_tag LOCUS_12320 123675 124334 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_12320 124470 124940 gene locus_tag LOCUS_12330 124470 124940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_12330 125539 125078 gene locus_tag LOCUS_12340 125539 125078 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU7 protein_id gnl|my_center|LOCUS_12340 127490 125601 gene locus_tag LOCUS_12350 127490 125601 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 protein_id gnl|my_center|LOCUS_12350 127612 128385 gene locus_tag LOCUS_12360 127612 128385 CDS product short-chain dehydrogenase/reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103227.1 protein_id gnl|my_center|LOCUS_12360 128724 128386 gene locus_tag LOCUS_12370 128724 128386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 129445 128813 gene locus_tag LOCUS_12380 129445 128813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 protein_id gnl|my_center|LOCUS_12380 130436 129678 gene locus_tag LOCUS_12390 130436 129678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_12390 131042 130443 gene locus_tag LOCUS_12400 131042 130443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 protein_id gnl|my_center|LOCUS_12400 132949 131039 gene locus_tag LOCUS_12410 132949 131039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_12410 133000 133464 gene locus_tag LOCUS_12420 133000 133464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719785.1 protein_id gnl|my_center|LOCUS_12420 134480 133461 gene locus_tag LOCUS_12430 134480 133461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12430 134607 135251 gene locus_tag LOCUS_12440 134607 135251 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B84 protein_id gnl|my_center|LOCUS_12440 135890 135414 gene locus_tag LOCUS_12450 gene algQ 135890 135414 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_12450 136705 136214 gene locus_tag LOCUS_12460 gene dsbB1 136705 136214 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_12460 138113 136875 gene locus_tag LOCUS_12470 138113 136875 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_12470 139261 138110 gene locus_tag LOCUS_12480 139261 138110 CDS product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103003.1 protein_id gnl|my_center|LOCUS_12480 140051 139278 gene locus_tag LOCUS_12490 gene hemD 140051 139278 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_12490 140986 140048 gene locus_tag LOCUS_12500 gene hemC 140986 140048 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500N6 protein_id gnl|my_center|LOCUS_12500 142171 141425 gene locus_tag LOCUS_12510 142171 141425 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_12510 143250 142168 gene locus_tag LOCUS_12520 gene algZ 143250 142168 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_12520 143505 144899 gene locus_tag LOCUS_12530 gene argH 143505 144899 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500N3 protein_id gnl|my_center|LOCUS_12530 145600 144935 gene locus_tag LOCUS_12540 145600 144935 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186572.1 protein_id gnl|my_center|LOCUS_12540 145743 146021 gene locus_tag LOCUS_12550 145743 146021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114340.1 protein_id gnl|my_center|LOCUS_12550 146166 146411 gene locus_tag LOCUS_12560 146166 146411 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_12560 146572 149427 gene locus_tag LOCUS_12570 gene cyaA 146572 149427 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_12570 150239 149439 gene locus_tag LOCUS_12580 150239 149439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 150731 150324 gene locus_tag LOCUS_12590 gene rnk 150731 150324 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246537.1 protein_id gnl|my_center|LOCUS_12590 151382 151050 gene locus_tag LOCUS_12600 gene cyaY 151382 151050 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B06 protein_id gnl|my_center|LOCUS_12600 152581 151544 gene locus_tag LOCUS_12610 152581 151544 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_12610 152563 152838 gene locus_tag LOCUS_12620 152563 152838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 152848 154095 gene locus_tag LOCUS_12630 gene lysA 152848 154095 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_12630 154101 154931 gene locus_tag LOCUS_12640 gene dapF 154101 154931 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B09 protein_id gnl|my_center|LOCUS_12640 154928 155626 gene locus_tag LOCUS_12650 154928 155626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_12650 155765 156661 gene locus_tag LOCUS_12660 gene xerC 155765 156661 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_12660 156658 157353 gene locus_tag LOCUS_12670 156658 157353 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_12670 157918 157592 gene locus_tag LOCUS_12680 157918 157592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 159403 158153 gene locus_tag LOCUS_12690 159403 158153 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_12690 160799 159483 gene locus_tag LOCUS_12700 gene amt-1 160799 159483 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_12700 161170 160832 gene locus_tag LOCUS_12710 gene glnK 161170 160832 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_12710 161582 161854 gene locus_tag LOCUS_12720 161582 161854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768515.1 protein_id gnl|my_center|LOCUS_12720 161889 163385 gene locus_tag LOCUS_12730 161889 163385 CDS product magnesium chelatase subunit ChlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413980.1 protein_id gnl|my_center|LOCUS_12730 163519 165510 gene locus_tag LOCUS_12740 163519 165510 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_12740 165524 166330 gene locus_tag LOCUS_12750 165524 166330 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_12750 167262 166336 gene locus_tag LOCUS_12760 167262 166336 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098255.1 protein_id gnl|my_center|LOCUS_12760 167402 168787 gene locus_tag LOCUS_12770 gene norM 167402 168787 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTR0 protein_id gnl|my_center|LOCUS_12770 170582 168906 gene locus_tag LOCUS_12780 170582 168906 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121292.1 protein_id gnl|my_center|LOCUS_12780 170883 172859 gene locus_tag LOCUS_12790 gene rep 170883 172859 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 protein_id gnl|my_center|LOCUS_12790 173151 173723 gene locus_tag LOCUS_12800 gene xpt 173151 173723 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ6 protein_id gnl|my_center|LOCUS_12800 175876 173744 gene locus_tag LOCUS_12810 175876 173744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 176538 176116 gene locus_tag LOCUS_12820 gene cycB 176538 176116 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_12820 177269 176721 gene locus_tag LOCUS_12830 177269 176721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_12830 178446 177373 gene locus_tag LOCUS_12840 gene dadX 178446 177373 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BB4 protein_id gnl|my_center|LOCUS_12840 178903 178553 gene locus_tag LOCUS_12850 178903 178553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098273.1 protein_id gnl|my_center|LOCUS_12850 180238 178940 gene locus_tag LOCUS_12860 gene dadA 180238 178940 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW4 protein_id gnl|my_center|LOCUS_12860 180394 180882 gene locus_tag LOCUS_12870 gene lrp 180394 180882 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004655323.1 protein_id gnl|my_center|LOCUS_12870 181659 181306 gene locus_tag LOCUS_12880 181659 181306 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 protein_id gnl|my_center|LOCUS_12880 181835 183148 gene locus_tag LOCUS_12890 181835 183148 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_12890 183422 183180 gene locus_tag LOCUS_12900 183422 183180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403956.1 protein_id gnl|my_center|LOCUS_12900 183604 185034 gene locus_tag LOCUS_12910 183604 185034 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088661.1 protein_id gnl|my_center|LOCUS_12910 186356 185184 gene locus_tag LOCUS_12920 186356 185184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114355.1 protein_id gnl|my_center|LOCUS_12920 188043 186550 gene locus_tag LOCUS_12930 188043 186550 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_12930 188275 189612 gene locus_tag LOCUS_12940 188275 189612 CDS product omega amino acid--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895702.1 protein_id gnl|my_center|LOCUS_12940 189637 190002 gene locus_tag LOCUS_12950 189637 190002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096551.1 protein_id gnl|my_center|LOCUS_12950 190618 190397 gene locus_tag LOCUS_12960 190618 190397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 190774 190619 gene locus_tag LOCUS_12970 gene rpmG 190774 190619 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_12970 191021 190785 gene locus_tag LOCUS_12980 gene rpmB 191021 190785 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_12980 191475 193064 gene locus_tag LOCUS_12990 191475 193064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102986.1 protein_id gnl|my_center|LOCUS_12990 193840 193166 gene locus_tag LOCUS_13000 193840 193166 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_13000 193980 195188 gene locus_tag LOCUS_13010 gene coaC 193980 195188 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_13010 195219 195674 gene locus_tag LOCUS_13020 gene dut 195219 195674 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD3 protein_id gnl|my_center|LOCUS_13020 195718 198309 gene locus_tag LOCUS_13030 195718 198309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 198337 199242 gene locus_tag LOCUS_13040 gene argB 198337 199242 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_13040 199363 199809 gene locus_tag LOCUS_13050 199363 199809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_13050 200406 199813 gene locus_tag LOCUS_13060 200406 199813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_13060 201075 200434 gene locus_tag LOCUS_13070 gene pyrE 201075 200434 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_13070 201168 201947 gene locus_tag LOCUS_13080 gene crc 201168 201947 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_13080 202374 202003 gene locus_tag LOCUS_13090 202374 202003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_13090 203122 202400 gene locus_tag LOCUS_13100 gene rph 203122 202400 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY6 protein_id gnl|my_center|LOCUS_13100 203376 204239 gene locus_tag LOCUS_13110 203376 204239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 protein_id gnl|my_center|LOCUS_13110 204345 204965 gene locus_tag LOCUS_13120 gene gmk 204345 204965 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_13120 205115 205378 gene locus_tag LOCUS_13130 gene rpoZ 205115 205378 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_13130 205439 207547 gene locus_tag LOCUS_13140 gene spoT 205439 207547 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_13140 207647 208027 gene locus_tag LOCUS_13150 207647 208027 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_13150 208081 208815 gene locus_tag LOCUS_13160 208081 208815 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313983.1 protein_id gnl|my_center|LOCUS_13160 209862 208990 gene locus_tag LOCUS_13170 209862 208990 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_13170 209958 210884 gene locus_tag LOCUS_13180 gene oxyR 209958 210884 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_13180 210894 212969 gene locus_tag LOCUS_13190 gene recG 210894 212969 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_13190 213064 214470 gene locus_tag LOCUS_13200 213064 214470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_13200 215425 214679 gene locus_tag LOCUS_13210 215425 214679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 215936 215505 gene locus_tag LOCUS_13220 215936 215505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096629.1 protein_id gnl|my_center|LOCUS_13220 216307 216035 gene locus_tag LOCUS_13230 gene hupA 216307 216035 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_13230 217643 216495 gene locus_tag LOCUS_13240 gene rubB 217643 216495 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 protein_id gnl|my_center|LOCUS_13240 217912 217745 gene locus_tag LOCUS_13250 gene rubA2 217912 217745 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_13250 >Feature sequence07 193 1173 gene locus_tag LOCUS_13260 193 1173 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266184.1 protein_id gnl|my_center|LOCUS_13260 1811 3136 gene locus_tag LOCUS_13270 1811 3136 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763528.1 protein_id gnl|my_center|LOCUS_13270 3356 3586 gene locus_tag LOCUS_13280 3356 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8140 5018 gene locus_tag LOCUS_13290 gene czcA 8140 5018 CDS product resistance-nodulation-cell division divalent metal cation efflux transporter CzcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_13290 8493 8152 gene locus_tag LOCUS_13300 gene glnB 8493 8152 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_13300 10058 8508 gene locus_tag LOCUS_13310 gene czcB 10058 8508 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197872.1 protein_id gnl|my_center|LOCUS_13310 11510 10227 gene locus_tag LOCUS_13320 11510 10227 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_13320 12066 12740 gene locus_tag LOCUS_13330 12066 12740 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382360.1 protein_id gnl|my_center|LOCUS_13330 12737 14140 gene locus_tag LOCUS_13340 12737 14140 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269233.1 protein_id gnl|my_center|LOCUS_13340 14271 15530 gene locus_tag LOCUS_13350 14271 15530 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_13350 15734 16663 gene locus_tag LOCUS_13360 15734 16663 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098443.1 protein_id gnl|my_center|LOCUS_13360 16875 18197 gene locus_tag LOCUS_13370 gene oprP 16875 18197 CDS product porin P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05695 protein_id gnl|my_center|LOCUS_13370 19747 18425 gene locus_tag LOCUS_13380 19747 18425 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269238.1 protein_id gnl|my_center|LOCUS_13380 20253 19921 gene locus_tag LOCUS_13390 20253 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20743 20447 gene locus_tag LOCUS_13400 20743 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13400 21430 21942 gene locus_tag LOCUS_13410 21430 21942 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 protein_id gnl|my_center|LOCUS_13410 22545 22826 gene locus_tag LOCUS_13420 22545 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 22823 23665 gene locus_tag LOCUS_13430 22823 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13430 23910 24548 gene locus_tag LOCUS_13440 23910 24548 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_13440 24536 24787 gene locus_tag LOCUS_13450 24536 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 24784 25311 gene locus_tag LOCUS_13460 24784 25311 CDS product chromosome segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_13460 25627 27576 gene locus_tag LOCUS_13470 25627 27576 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_13470 28448 27594 gene locus_tag LOCUS_13480 28448 27594 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 protein_id gnl|my_center|LOCUS_13480 28605 29837 gene locus_tag LOCUS_13490 28605 29837 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKP5 protein_id gnl|my_center|LOCUS_13490 29839 30342 gene locus_tag LOCUS_13500 29839 30342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 30339 31409 gene locus_tag LOCUS_13510 30339 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 31432 33285 gene locus_tag LOCUS_13520 gene asnB 31432 33285 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_13520 33373 34572 gene locus_tag LOCUS_13530 gene araJ 33373 34572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_13530 34595 35521 gene locus_tag LOCUS_13540 34595 35521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038904.1 protein_id gnl|my_center|LOCUS_13540 35521 35763 gene locus_tag LOCUS_13550 35521 35763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 35885 36289 gene locus_tag LOCUS_13560 35885 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 36310 36984 gene locus_tag LOCUS_13570 36310 36984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_13570 37720 37238 gene locus_tag LOCUS_13580 37720 37238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 37917 39908 gene locus_tag LOCUS_13590 37917 39908 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_13590 39905 40327 gene locus_tag LOCUS_13600 39905 40327 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_13600 40324 41331 gene locus_tag LOCUS_13610 gene trbB 40324 41331 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_13610 41382 41669 gene locus_tag LOCUS_13620 41382 41669 CDS product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 protein_id gnl|my_center|LOCUS_13620 41666 41938 gene locus_tag LOCUS_13630 41666 41938 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388564.1 protein_id gnl|my_center|LOCUS_13630 41950 44379 gene locus_tag LOCUS_13640 41950 44379 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_13640 44376 45110 gene locus_tag LOCUS_13650 44376 45110 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 protein_id gnl|my_center|LOCUS_13650 45312 46478 gene locus_tag LOCUS_13660 45312 46478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 46491 47198 gene locus_tag LOCUS_13670 gene trbF 46491 47198 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 protein_id gnl|my_center|LOCUS_13670 47195 48181 gene locus_tag LOCUS_13680 gene trbG 47195 48181 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_13680 48184 49449 gene locus_tag LOCUS_13690 48184 49449 CDS product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 protein_id gnl|my_center|LOCUS_13690 49446 49664 gene locus_tag LOCUS_13700 49446 49664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 49728 49967 gene locus_tag LOCUS_13710 49728 49967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 50255 50953 gene locus_tag LOCUS_13720 50255 50953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 52449 51136 gene locus_tag LOCUS_13730 52449 51136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 52787 53158 gene locus_tag LOCUS_13740 52787 53158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 53697 53173 gene locus_tag LOCUS_13750 53697 53173 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_13750 53977 53702 gene locus_tag LOCUS_13760 53977 53702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 55294 54038 gene locus_tag LOCUS_13770 55294 54038 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 protein_id gnl|my_center|LOCUS_13770 57175 55595 gene locus_tag LOCUS_13780 gene guaA 57175 55595 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_13780 58873 57404 gene locus_tag LOCUS_13790 gene guaB 58873 57404 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_13790 59958 59407 gene locus_tag LOCUS_13800 59958 59407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771002.1 protein_id gnl|my_center|LOCUS_13800 60570 60085 gene locus_tag LOCUS_13810 60570 60085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119853.1 protein_id gnl|my_center|LOCUS_13810 60914 60627 gene locus_tag LOCUS_13820 60914 60627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 60840 61544 gene locus_tag LOCUS_13830 60840 61544 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090978.1 protein_id gnl|my_center|LOCUS_13830 61587 62966 gene locus_tag LOCUS_13840 gene xseA 61587 62966 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_13840 63007 63831 gene locus_tag LOCUS_13850 63007 63831 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_13850 64282 63863 gene locus_tag LOCUS_13860 64282 63863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 64521 65777 gene locus_tag LOCUS_13870 64521 65777 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_13870 66113 67783 gene locus_tag LOCUS_13880 gene leuA 66113 67783 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXK5 protein_id gnl|my_center|LOCUS_13880 68300 67935 gene locus_tag LOCUS_13890 68300 67935 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860832.1 protein_id gnl|my_center|LOCUS_13890 68411 69514 gene locus_tag LOCUS_13900 gene nemA 68411 69514 CDS product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77258 protein_id gnl|my_center|LOCUS_13900 70354 69563 gene locus_tag LOCUS_13910 70354 69563 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_13910 71490 70342 gene locus_tag LOCUS_13920 71490 70342 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_13920 73113 71641 gene locus_tag LOCUS_13930 gene der 73113 71641 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y6 protein_id gnl|my_center|LOCUS_13930 74470 73319 gene locus_tag LOCUS_13940 gene bamB 74470 73319 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_13940 75107 74463 gene locus_tag LOCUS_13950 75107 74463 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_13950 76434 75145 gene locus_tag LOCUS_13960 gene hisS 76434 75145 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_13960 77581 76469 gene locus_tag LOCUS_13970 gene ispG 77581 76469 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z0 protein_id gnl|my_center|LOCUS_13970 78583 77585 gene locus_tag LOCUS_13980 78583 77585 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266909.1 protein_id gnl|my_center|LOCUS_13980 79341 78583 gene locus_tag LOCUS_13990 gene pilF 79341 78583 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_13990 80503 79355 gene locus_tag LOCUS_14000 gene rlmN 80503 79355 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_14000 80959 80528 gene locus_tag LOCUS_14010 gene ndk 80959 80528 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_14010 81258 81058 gene locus_tag LOCUS_14020 81258 81058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_14020 81614 81273 gene locus_tag LOCUS_14030 81614 81273 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406488.1 protein_id gnl|my_center|LOCUS_14030 83482 81617 gene locus_tag LOCUS_14040 gene hscA 83482 81617 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX30 protein_id gnl|my_center|LOCUS_14040 83994 83545 gene locus_tag LOCUS_14050 gene hscB 83994 83545 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z8 protein_id gnl|my_center|LOCUS_14050 84397 84074 gene locus_tag LOCUS_14060 gene iscA 84397 84074 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z9 protein_id gnl|my_center|LOCUS_14060 84796 84410 gene locus_tag LOCUS_14070 84796 84410 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX33 protein_id gnl|my_center|LOCUS_14070 86058 84844 gene locus_tag LOCUS_14080 gene iscS 86058 84844 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_14080 86597 86106 gene locus_tag LOCUS_14090 gene iscR 86597 86106 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_14090 87516 86737 gene locus_tag LOCUS_14100 gene cysE 87516 86737 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_14100 88207 87509 gene locus_tag LOCUS_14110 gene trmJ 88207 87509 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_14110 88434 89249 gene locus_tag LOCUS_14120 88434 89249 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_14120 89876 89340 gene locus_tag LOCUS_14130 89876 89340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_14130 90909 90004 gene locus_tag LOCUS_14140 gene secF 90909 90004 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A7 protein_id gnl|my_center|LOCUS_14140 92787 90919 gene locus_tag LOCUS_14150 gene secD 92787 90919 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_14150 93185 92850 gene locus_tag LOCUS_14160 gene yajC 93185 92850 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_14160 94358 93225 gene locus_tag LOCUS_14170 gene tgt 94358 93225 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_14170 95404 94355 gene locus_tag LOCUS_14180 gene queA 95404 94355 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L6W9 protein_id gnl|my_center|LOCUS_14180 95517 95601 gene locus_tag LOCUS_t00220 95517 95601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 95947 96159 gene locus_tag LOCUS_14190 95947 96159 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 protein_id gnl|my_center|LOCUS_14190 96272 96772 gene locus_tag LOCUS_14200 96272 96772 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_14200 97885 96824 gene locus_tag LOCUS_14210 97885 96824 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_14210 98999 97878 gene locus_tag LOCUS_14220 98999 97878 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_14220 99144 100634 gene locus_tag LOCUS_14230 gene pepA 99144 100634 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH7 protein_id gnl|my_center|LOCUS_14230 100738 101157 gene locus_tag LOCUS_14240 gene holC 100738 101157 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_14240 101158 101574 gene locus_tag LOCUS_14250 101158 101574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100590.1 protein_id gnl|my_center|LOCUS_14250 101758 104589 gene locus_tag LOCUS_14260 gene valS 101758 104589 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_14260 104768 105112 gene locus_tag LOCUS_14270 104768 105112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 105115 106491 gene locus_tag LOCUS_14280 105115 106491 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_14280 106548 106844 gene locus_tag LOCUS_14290 106548 106844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105269.1 protein_id gnl|my_center|LOCUS_14290 106859 107419 gene locus_tag LOCUS_14300 106859 107419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 107477 108463 gene locus_tag LOCUS_14310 gene rlmF 107477 108463 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_14310 109834 108590 gene locus_tag LOCUS_14320 109834 108590 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_14320 110745 109990 gene locus_tag LOCUS_14330 110745 109990 CDS product osmoprotectant uptake system permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 protein_id gnl|my_center|LOCUS_14330 111689 110742 gene locus_tag LOCUS_14340 111689 110742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_14340 112849 111686 gene locus_tag LOCUS_14350 112849 111686 CDS product osmoprotectant uptake system permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210801.1 protein_id gnl|my_center|LOCUS_14350 113798 112875 gene locus_tag LOCUS_14360 113798 112875 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168154.1 protein_id gnl|my_center|LOCUS_14360 115438 114071 gene locus_tag LOCUS_14370 115438 114071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 115672 116466 gene locus_tag LOCUS_14380 115672 116466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_14380 117769 116483 gene locus_tag LOCUS_14390 gene adcK4 117769 116483 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_14390 118281 117871 gene locus_tag LOCUS_14400 118281 117871 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_14400 121751 118326 gene locus_tag LOCUS_14410 121751 118326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 122980 121748 gene locus_tag LOCUS_14420 gene sbcD 122980 121748 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK53 protein_id gnl|my_center|LOCUS_14420 123396 122977 gene locus_tag LOCUS_14430 123396 122977 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 protein_id gnl|my_center|LOCUS_14430 123525 124814 gene locus_tag LOCUS_14440 123525 124814 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705120.1 protein_id gnl|my_center|LOCUS_14440 124913 126256 gene locus_tag LOCUS_14450 124913 126256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_14450 126358 127365 gene locus_tag LOCUS_14460 126358 127365 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI3 protein_id gnl|my_center|LOCUS_14460 127433 128323 gene locus_tag LOCUS_14470 127433 128323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 129284 128349 gene locus_tag LOCUS_14480 129284 128349 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_14480 129649 129350 gene locus_tag LOCUS_14490 129649 129350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764108.1 protein_id gnl|my_center|LOCUS_14490 130375 129665 gene locus_tag LOCUS_14500 gene pcs 130375 129665 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_14500 130983 130513 gene locus_tag LOCUS_14510 130983 130513 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_14510 131103 132065 gene locus_tag LOCUS_14520 131103 132065 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 protein_id gnl|my_center|LOCUS_14520 133223 132459 gene locus_tag LOCUS_14530 133223 132459 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 protein_id gnl|my_center|LOCUS_14530 134331 133234 gene locus_tag LOCUS_14540 134331 133234 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_14540 135525 134341 gene locus_tag LOCUS_14550 135525 134341 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 protein_id gnl|my_center|LOCUS_14550 136654 135626 gene locus_tag LOCUS_14560 136654 135626 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 protein_id gnl|my_center|LOCUS_14560 137135 137794 gene locus_tag LOCUS_14570 137135 137794 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266805.1 protein_id gnl|my_center|LOCUS_14570 138041 138976 gene locus_tag LOCUS_14580 138041 138976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 139049 140212 gene locus_tag LOCUS_14590 139049 140212 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_14590 140331 141809 gene locus_tag LOCUS_14600 gene rhlB 140331 141809 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ6 protein_id gnl|my_center|LOCUS_14600 141991 142953 gene locus_tag LOCUS_14610 gene dauB 141991 142953 CDS product NAD(P)H-dependent anabolic L-arginine dehydrogenase DauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE4 protein_id gnl|my_center|LOCUS_14610 142964 144088 gene locus_tag LOCUS_14620 gene dauA 142964 144088 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_14620 144178 144807 gene locus_tag LOCUS_14630 gene dauR 144178 144807 CDS product transcriptional regulator DauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE2 protein_id gnl|my_center|LOCUS_14630 145446 144832 gene locus_tag LOCUS_14640 145446 144832 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082476.1 protein_id gnl|my_center|LOCUS_14640 145741 146178 gene locus_tag LOCUS_14650 145741 146178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 146246 147412 gene locus_tag LOCUS_14660 146246 147412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_14660 148244 147468 gene locus_tag LOCUS_14670 148244 147468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767735.1 protein_id gnl|my_center|LOCUS_14670 148998 148543 gene locus_tag LOCUS_14680 gene moaE 148998 148543 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_14680 149293 149045 gene locus_tag LOCUS_14690 gene moaD 149293 149045 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX96 protein_id gnl|my_center|LOCUS_14690 149730 149290 gene locus_tag LOCUS_14700 gene moaC 149730 149290 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ9 protein_id gnl|my_center|LOCUS_14700 151299 149908 gene locus_tag LOCUS_14710 151299 149908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_14710 151894 152673 gene locus_tag LOCUS_14720 151894 152673 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 protein_id gnl|my_center|LOCUS_14720 153286 154596 gene locus_tag LOCUS_14730 gene algD 153286 154596 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11759 protein_id gnl|my_center|LOCUS_14730 154850 156331 gene locus_tag LOCUS_14740 gene alg8 154850 156331 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52463 protein_id gnl|my_center|LOCUS_14740 156364 157530 gene locus_tag LOCUS_14750 gene alg44 156364 157530 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY69 protein_id gnl|my_center|LOCUS_14750 157543 158943 gene locus_tag LOCUS_14760 gene algK 157543 158943 CDS product alginate biosynthesis protein AlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96956 protein_id gnl|my_center|LOCUS_14760 158940 160406 gene locus_tag LOCUS_14770 gene algE 158940 160406 CDS product alginate production protein AlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18895 protein_id gnl|my_center|LOCUS_14770 160531 162093 gene locus_tag LOCUS_14780 gene algG 160531 162093 CDS product poly(beta-D-mannuronate) C5 epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51371 protein_id gnl|my_center|LOCUS_14780 162105 163532 gene locus_tag LOCUS_14790 gene algX 162105 163532 CDS product alginate biosynthesis protein AlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51372 protein_id gnl|my_center|LOCUS_14790 163544 164632 gene locus_tag LOCUS_14800 gene algL 163544 164632 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q5 protein_id gnl|my_center|LOCUS_14800 164837 166339 gene locus_tag LOCUS_14810 gene algI 164837 166339 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51392 protein_id gnl|my_center|LOCUS_14810 166352 167494 gene locus_tag LOCUS_14820 166352 167494 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266794.1 protein_id gnl|my_center|LOCUS_14820 167660 168307 gene locus_tag LOCUS_14830 gene algF 167660 168307 CDS product alginate biosynthesis protein AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06062 protein_id gnl|my_center|LOCUS_14830 168718 170157 gene locus_tag LOCUS_14840 gene algA 168718 170157 CDS product alginate biosynthesis protein AlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07874 protein_id gnl|my_center|LOCUS_14840 170280 170744 gene locus_tag LOCUS_14850 170280 170744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092973.1 protein_id gnl|my_center|LOCUS_14850 170767 171597 gene locus_tag LOCUS_14860 170767 171597 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266791.1 protein_id gnl|my_center|LOCUS_14860 171629 172009 gene locus_tag LOCUS_14870 171629 172009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113771.1 protein_id gnl|my_center|LOCUS_14870 172209 173642 gene locus_tag LOCUS_14880 172209 173642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 174532 173639 gene locus_tag LOCUS_14890 174532 173639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 protein_id gnl|my_center|LOCUS_14890 175554 174604 gene locus_tag LOCUS_14900 175554 174604 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104060.1 protein_id gnl|my_center|LOCUS_14900 175925 176800 gene locus_tag LOCUS_14910 175925 176800 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266784.1 protein_id gnl|my_center|LOCUS_14910 176947 179580 gene locus_tag LOCUS_14920 176947 179580 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103848.1 protein_id gnl|my_center|LOCUS_14920 180221 179715 gene locus_tag LOCUS_14930 180221 179715 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_14930 181534 180356 gene locus_tag LOCUS_14940 181534 180356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 181916 182917 gene locus_tag LOCUS_14950 181916 182917 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_14950 183116 183376 gene locus_tag LOCUS_14960 183116 183376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_14960 184629 183520 gene locus_tag LOCUS_14970 184629 183520 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYJ0 protein_id gnl|my_center|LOCUS_14970 184531 184788 gene locus_tag LOCUS_14980 184531 184788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 185765 184779 gene locus_tag LOCUS_14990 185765 184779 CDS product pyruvate dehydrogenase E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114485.1 protein_id gnl|my_center|LOCUS_14990 186849 185758 gene locus_tag LOCUS_15000 186849 185758 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_15000 187973 186951 gene locus_tag LOCUS_15010 gene ldh 187973 186951 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_15010 188140 188943 gene locus_tag LOCUS_15020 188140 188943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768735.1 protein_id gnl|my_center|LOCUS_15020 191673 189133 gene locus_tag LOCUS_15030 191673 189133 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114487.1 protein_id gnl|my_center|LOCUS_15030 193473 192100 gene locus_tag LOCUS_15040 193473 192100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_15040 195265 193499 gene locus_tag LOCUS_15050 195265 193499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_15050 195543 196946 gene locus_tag LOCUS_15060 195543 196946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102335.1 protein_id gnl|my_center|LOCUS_15060 197253 197636 gene locus_tag LOCUS_15070 gene gcvH1 197253 197636 CDS product glycine cleavage system H protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I136 protein_id gnl|my_center|LOCUS_15070 197645 200500 gene locus_tag LOCUS_15080 gene gcvP 197645 200500 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887L5 protein_id gnl|my_center|LOCUS_15080 200787 202163 gene locus_tag LOCUS_15090 200787 202163 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_15090 202221 203474 gene locus_tag LOCUS_15100 gene glyA2 202221 203474 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I138 protein_id gnl|my_center|LOCUS_15100 203557 204933 gene locus_tag LOCUS_15110 gene sdaA 203557 204933 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_15110 205066 206190 gene locus_tag LOCUS_15120 205066 206190 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH3 protein_id gnl|my_center|LOCUS_15120 206432 206178 gene locus_tag LOCUS_15130 206432 206178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 206826 206458 gene locus_tag LOCUS_15140 206826 206458 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706716.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence08 1195 347 gene locus_tag LOCUS_15150 1195 347 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_15150 2663 1203 gene locus_tag LOCUS_15160 2663 1203 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_15160 3621 2698 gene locus_tag LOCUS_15170 3621 2698 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_15170 3956 3618 gene locus_tag LOCUS_15180 3956 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5026 3965 gene locus_tag LOCUS_15190 gene mphP 5026 3965 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_15190 5396 5037 gene locus_tag LOCUS_15200 5396 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7021 5468 gene locus_tag LOCUS_15210 gene mphN 7021 5468 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_15210 7304 7032 gene locus_tag LOCUS_15220 gene mphM 7304 7032 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_15220 8302 7301 gene locus_tag LOCUS_15230 gene mphL 8302 7301 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_15230 8620 8351 gene locus_tag LOCUS_15240 8620 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 9041 10732 gene locus_tag LOCUS_15250 gene mphR 9041 10732 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_15250 11082 12104 gene locus_tag LOCUS_15260 11082 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 12116 14584 gene locus_tag LOCUS_15270 12116 14584 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_15270 14626 16524 gene locus_tag LOCUS_15280 14626 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 16544 17875 gene locus_tag LOCUS_15290 16544 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 20067 18232 gene locus_tag LOCUS_15300 gene glmS 20067 18232 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT8 protein_id gnl|my_center|LOCUS_15300 20850 20083 gene locus_tag LOCUS_15310 20850 20083 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269443.1 protein_id gnl|my_center|LOCUS_15310 22364 21006 gene locus_tag LOCUS_15320 gene glmU 22364 21006 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL26 protein_id gnl|my_center|LOCUS_15320 23066 22644 gene locus_tag LOCUS_15330 gene atpC 23066 22644 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT5 protein_id gnl|my_center|LOCUS_15330 24491 23115 gene locus_tag LOCUS_15340 gene atpD 24491 23115 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_15340 25382 24522 gene locus_tag LOCUS_15350 gene atpG 25382 24522 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL23 protein_id gnl|my_center|LOCUS_15350 26977 25433 gene locus_tag LOCUS_15360 gene atpA 26977 25433 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT2 protein_id gnl|my_center|LOCUS_15360 27535 26999 gene locus_tag LOCUS_15370 gene atpH 27535 26999 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 protein_id gnl|my_center|LOCUS_15370 28021 27551 gene locus_tag LOCUS_15380 gene atpF 28021 27551 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT0 protein_id gnl|my_center|LOCUS_15380 28336 28079 gene locus_tag LOCUS_15390 28336 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 29321 28452 gene locus_tag LOCUS_15400 gene atpB 29321 28452 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS8 protein_id gnl|my_center|LOCUS_15400 29743 29336 gene locus_tag LOCUS_15410 29743 29336 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555989.1 protein_id gnl|my_center|LOCUS_15410 30774 29902 gene locus_tag LOCUS_15420 gene spoOJ 30774 29902 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_15420 31574 30786 gene locus_tag LOCUS_15430 gene soj 31574 30786 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_15430 32234 31587 gene locus_tag LOCUS_15440 gene rsmG 32234 31587 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_15440 34126 32234 gene locus_tag LOCUS_15450 gene mnmG 34126 32234 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_15450 36129 34762 gene locus_tag LOCUS_15460 gene mnmE 36129 34762 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL12 protein_id gnl|my_center|LOCUS_15460 37947 36205 gene locus_tag LOCUS_15470 gene yidC 37947 36205 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_15470 38592 38188 gene locus_tag LOCUS_15480 gene rnpA 38592 38188 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TR9 protein_id gnl|my_center|LOCUS_15480 38834 38604 gene locus_tag LOCUS_15490 38834 38604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 39264 40721 gene locus_tag LOCUS_15500 gene dnaA 39264 40721 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 protein_id gnl|my_center|LOCUS_15500 40753 41856 gene locus_tag LOCUS_15510 40753 41856 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_15510 41864 42967 gene locus_tag LOCUS_15520 gene recF 41864 42967 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK1 protein_id gnl|my_center|LOCUS_15520 42972 45389 gene locus_tag LOCUS_15530 gene gyrB 42972 45389 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_15530 46533 45760 gene locus_tag LOCUS_15540 gene lptA 46533 45760 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_15540 47099 46569 gene locus_tag LOCUS_15550 gene gmhB 47099 46569 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_15550 49247 47193 gene locus_tag LOCUS_15560 gene glyS 49247 47193 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T7 protein_id gnl|my_center|LOCUS_15560 50200 49244 gene locus_tag LOCUS_15570 gene glyQ 50200 49244 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_15570 50538 51095 gene locus_tag LOCUS_15580 gene tag 50538 51095 CDS product DNA-3-methyladenine glycosidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097280.1 protein_id gnl|my_center|LOCUS_15580 51141 52028 gene locus_tag LOCUS_15590 51141 52028 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_15590 52149 52412 gene locus_tag LOCUS_15600 52149 52412 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_15600 52541 53191 gene locus_tag LOCUS_15610 52541 53191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097286.1 protein_id gnl|my_center|LOCUS_15610 53510 53199 gene locus_tag LOCUS_15620 53510 53199 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 protein_id gnl|my_center|LOCUS_15620 54898 53525 gene locus_tag LOCUS_15630 gene trkA 54898 53525 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_15630 56258 54960 gene locus_tag LOCUS_15640 gene rsmB 56258 54960 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B41 protein_id gnl|my_center|LOCUS_15640 57199 56255 gene locus_tag LOCUS_15650 gene fmt 57199 56255 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T0 protein_id gnl|my_center|LOCUS_15650 57759 57253 gene locus_tag LOCUS_15660 gene def 57759 57253 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_15660 57912 58937 gene locus_tag LOCUS_15670 57912 58937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_15670 59027 60136 gene locus_tag LOCUS_15680 59027 60136 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266134.1 protein_id gnl|my_center|LOCUS_15680 60138 60737 gene locus_tag LOCUS_15690 gene tsaC 60138 60737 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_15690 61878 60901 gene locus_tag LOCUS_15700 gene qor 61878 60901 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43903 protein_id gnl|my_center|LOCUS_15700 62070 62987 gene locus_tag LOCUS_15710 gene hemF 62070 62987 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S4 protein_id gnl|my_center|LOCUS_15710 63094 63912 gene locus_tag LOCUS_15720 gene aroE 63094 63912 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S3 protein_id gnl|my_center|LOCUS_15720 65592 64024 gene locus_tag LOCUS_15730 65592 64024 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266137.1 protein_id gnl|my_center|LOCUS_15730 66890 65982 gene locus_tag LOCUS_15740 66890 65982 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103015.1 protein_id gnl|my_center|LOCUS_15740 68487 66979 gene locus_tag LOCUS_15750 gene betC 68487 66979 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_15750 68600 69520 gene locus_tag LOCUS_15760 68600 69520 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 protein_id gnl|my_center|LOCUS_15760 69656 70564 gene locus_tag LOCUS_15770 gene pbpG 69656 70564 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 protein_id gnl|my_center|LOCUS_15770 71416 70607 gene locus_tag LOCUS_15780 gene trpA 71416 70607 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_15780 72630 71416 gene locus_tag LOCUS_15790 gene trpB 72630 71416 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07345 protein_id gnl|my_center|LOCUS_15790 72753 73643 gene locus_tag LOCUS_15800 gene trpI 72753 73643 CDS product HTH-type transcriptional regulator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11720 protein_id gnl|my_center|LOCUS_15800 73751 73966 gene locus_tag LOCUS_15810 73751 73966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_15810 74170 75165 gene locus_tag LOCUS_15820 74170 75165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768139.1 protein_id gnl|my_center|LOCUS_15820 75828 75415 gene locus_tag LOCUS_15830 75828 75415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 protein_id gnl|my_center|LOCUS_15830 76293 75880 gene locus_tag LOCUS_15840 76293 75880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083614.1 protein_id gnl|my_center|LOCUS_15840 76383 77537 gene locus_tag LOCUS_15850 76383 77537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_15850 77494 77724 gene locus_tag LOCUS_15860 77494 77724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114662.1 protein_id gnl|my_center|LOCUS_15860 78503 77841 gene locus_tag LOCUS_15870 78503 77841 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I767 protein_id gnl|my_center|LOCUS_15870 79045 78503 gene locus_tag LOCUS_15880 79045 78503 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_15880 79169 81217 gene locus_tag LOCUS_15890 gene prlC 79169 81217 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114658.1 protein_id gnl|my_center|LOCUS_15890 81372 81635 gene locus_tag LOCUS_15900 81372 81635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_15900 81729 82517 gene locus_tag LOCUS_15910 81729 82517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185048.1 protein_id gnl|my_center|LOCUS_15910 83484 82693 gene locus_tag LOCUS_15920 83484 82693 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 protein_id gnl|my_center|LOCUS_15920 83583 84581 gene locus_tag LOCUS_15930 83583 84581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 protein_id gnl|my_center|LOCUS_15930 84654 85712 gene locus_tag LOCUS_15940 84654 85712 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_15940 85845 86573 gene locus_tag LOCUS_15950 85845 86573 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_15950 87248 86592 gene locus_tag LOCUS_15960 87248 86592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719730.1 protein_id gnl|my_center|LOCUS_15960 87634 88734 gene locus_tag LOCUS_15970 gene coxB 87634 88734 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_15970 88739 90322 gene locus_tag LOCUS_15980 gene coxA 88739 90322 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_15980 90334 90885 gene locus_tag LOCUS_15990 90334 90885 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_15990 90897 91784 gene locus_tag LOCUS_16000 gene coIII 90897 91784 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_16000 91995 91792 gene locus_tag LOCUS_16010 91995 91792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_16010 92071 92802 gene locus_tag LOCUS_16020 92071 92802 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_16020 92777 93361 gene locus_tag LOCUS_16030 92777 93361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_16030 93417 94490 gene locus_tag LOCUS_16040 93417 94490 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_16040 94508 95407 gene locus_tag LOCUS_16050 gene cyoE1 94508 95407 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_16050 95420 96055 gene locus_tag LOCUS_16060 gene senC 95420 96055 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_16060 96554 96129 gene locus_tag LOCUS_16070 96554 96129 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_16070 96664 97539 gene locus_tag LOCUS_16080 96664 97539 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114205.1 protein_id gnl|my_center|LOCUS_16080 98679 97909 gene locus_tag LOCUS_16090 98679 97909 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_16090 99414 98737 gene locus_tag LOCUS_16100 99414 98737 CDS product D-methionine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_16100 100421 99414 gene locus_tag LOCUS_16110 gene metN1 100421 99414 CDS product methionine import ATP-binding protein MetN 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR8 protein_id gnl|my_center|LOCUS_16110 101491 100649 gene locus_tag LOCUS_16120 101491 100649 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247040.1 protein_id gnl|my_center|LOCUS_16120 102552 101764 gene locus_tag LOCUS_16130 gene znuB 102552 101764 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 protein_id gnl|my_center|LOCUS_16130 103378 102545 gene locus_tag LOCUS_16140 gene znuC 103378 102545 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_16140 103836 103351 gene locus_tag LOCUS_16150 103836 103351 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_16150 103903 104844 gene locus_tag LOCUS_16160 gene znuA 103903 104844 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105397.1 protein_id gnl|my_center|LOCUS_16160 106025 105075 gene locus_tag LOCUS_16170 gene thrB 106025 105075 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP1 protein_id gnl|my_center|LOCUS_16170 106329 106045 gene locus_tag LOCUS_16180 106329 106045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_16180 106404 109250 gene locus_tag LOCUS_16190 106404 109250 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 protein_id gnl|my_center|LOCUS_16190 110234 109596 gene locus_tag LOCUS_16200 gene engB 110234 109596 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 protein_id gnl|my_center|LOCUS_16200 110720 111010 gene locus_tag LOCUS_16210 110720 111010 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096979.1 protein_id gnl|my_center|LOCUS_16210 111057 111662 gene locus_tag LOCUS_16220 gene cc4 111057 111662 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_16220 111775 112446 gene locus_tag LOCUS_16230 gene dsbA 111775 112446 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_16230 112470 113348 gene locus_tag LOCUS_16240 112470 113348 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_16240 113345 115228 gene locus_tag LOCUS_16250 113345 115228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 116659 115241 gene locus_tag LOCUS_16260 gene cry 116659 115241 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_16260 117074 117667 gene locus_tag LOCUS_16270 117074 117667 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT85 protein_id gnl|my_center|LOCUS_16270 117664 118443 gene locus_tag LOCUS_16280 gene ampDh2 117664 118443 CDS product protein AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_16280 118752 120290 gene locus_tag LOCUS_16290 118752 120290 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 protein_id gnl|my_center|LOCUS_16290 122106 120331 gene locus_tag LOCUS_16300 122106 120331 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103101.1 protein_id gnl|my_center|LOCUS_16300 123449 122103 gene locus_tag LOCUS_16310 gene algB 123449 122103 CDS product alginate biosynthesis transcriptional regulatory protein AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AQ2 protein_id gnl|my_center|LOCUS_16310 123853 124689 gene locus_tag LOCUS_16320 123853 124689 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763472.1 protein_id gnl|my_center|LOCUS_16320 124789 125223 gene locus_tag LOCUS_16330 124789 125223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036511.1 protein_id gnl|my_center|LOCUS_16330 125473 125685 gene locus_tag LOCUS_16340 125473 125685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 125688 125915 gene locus_tag LOCUS_16350 125688 125915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 125962 126126 gene locus_tag LOCUS_16360 125962 126126 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT88 protein_id gnl|my_center|LOCUS_16360 126137 126598 gene locus_tag LOCUS_16370 126137 126598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT89 protein_id gnl|my_center|LOCUS_16370 126695 127924 gene locus_tag LOCUS_16380 126695 127924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_16380 129053 128040 gene locus_tag LOCUS_16390 129053 128040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114118.1 protein_id gnl|my_center|LOCUS_16390 129488 129141 gene locus_tag LOCUS_16400 129488 129141 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708326.1 protein_id gnl|my_center|LOCUS_16400 130911 129544 gene locus_tag LOCUS_16410 130911 129544 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102997.1 protein_id gnl|my_center|LOCUS_16410 131089 132036 gene locus_tag LOCUS_16420 131089 132036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_16420 133058 132033 gene locus_tag LOCUS_16430 133058 132033 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_16430 133240 134211 gene locus_tag LOCUS_16440 133240 134211 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704329.1 protein_id gnl|my_center|LOCUS_16440 134660 136738 gene locus_tag LOCUS_16450 134660 136738 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123230.1 protein_id gnl|my_center|LOCUS_16450 136783 137646 gene locus_tag LOCUS_16460 gene dinD 136783 137646 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_16460 137665 138846 gene locus_tag LOCUS_16470 137665 138846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 138839 142069 gene locus_tag LOCUS_16480 gene hsdR 138839 142069 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_16480 143723 142077 gene locus_tag LOCUS_16490 143723 142077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102996.1 protein_id gnl|my_center|LOCUS_16490 144006 144710 gene locus_tag LOCUS_16500 144006 144710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 144942 148217 gene locus_tag LOCUS_16510 gene recC 144942 148217 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_16510 148214 151759 gene locus_tag LOCUS_16520 gene recB 148214 151759 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY7 protein_id gnl|my_center|LOCUS_16520 151972 153834 gene locus_tag LOCUS_16530 gene recD 151972 153834 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR47 protein_id gnl|my_center|LOCUS_16530 154906 154136 gene locus_tag LOCUS_16540 154906 154136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096920.1 protein_id gnl|my_center|LOCUS_16540 156306 154999 gene locus_tag LOCUS_16550 156306 154999 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096918.1 protein_id gnl|my_center|LOCUS_16550 157668 156628 gene locus_tag LOCUS_16560 157668 156628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_16560 157654 158058 gene locus_tag LOCUS_16570 157654 158058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102545.1 protein_id gnl|my_center|LOCUS_16570 160138 158171 gene locus_tag LOCUS_16580 160138 158171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269381.1 protein_id gnl|my_center|LOCUS_16580 160455 160135 gene locus_tag LOCUS_16590 160455 160135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096910.1 protein_id gnl|my_center|LOCUS_16590 160967 160650 gene locus_tag LOCUS_16600 160967 160650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096907.1 protein_id gnl|my_center|LOCUS_16600 161358 162836 gene locus_tag LOCUS_16610 161358 162836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114108.1 protein_id gnl|my_center|LOCUS_16610 162833 164389 gene locus_tag LOCUS_16620 162833 164389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114108.1 protein_id gnl|my_center|LOCUS_16620 164386 165270 gene locus_tag LOCUS_16630 164386 165270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114110.1 protein_id gnl|my_center|LOCUS_16630 165314 166150 gene locus_tag LOCUS_16640 165314 166150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096902.1 protein_id gnl|my_center|LOCUS_16640 166165 167322 gene locus_tag LOCUS_16650 166165 167322 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_16650 167361 168206 gene locus_tag LOCUS_16660 167361 168206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112965.1 protein_id gnl|my_center|LOCUS_16660 168333 169238 gene locus_tag LOCUS_16670 gene rmd 168333 169238 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB6 protein_id gnl|my_center|LOCUS_16670 169238 170209 gene locus_tag LOCUS_16680 gene gmd 169238 170209 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51366 protein_id gnl|my_center|LOCUS_16680 170214 171653 gene locus_tag LOCUS_16690 gene wbpW 170214 171653 CDS product phosphomannose isomerase/mannose-1-phosphate guanylyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114106.1 protein_id gnl|my_center|LOCUS_16690 171653 172450 gene locus_tag LOCUS_16700 gene wzm 171653 172450 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_16700 172450 173700 gene locus_tag LOCUS_16710 gene wzt 172450 173700 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_16710 173709 175097 gene locus_tag LOCUS_16720 gene wbpX 173709 175097 CDS product glycosyltransferase WbpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096882.1 protein_id gnl|my_center|LOCUS_16720 175264 176217 gene locus_tag LOCUS_16730 gene wbpY 175264 176217 CDS product glycosyltransferase WbpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_16730 176217 177344 gene locus_tag LOCUS_16740 gene wbpZ 176217 177344 CDS product glycosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_16740 177590 177387 gene locus_tag LOCUS_16750 177590 177387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383123.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence09 876 169 gene locus_tag LOCUS_16760 876 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402882.1 protein_id gnl|my_center|LOCUS_16760 3283 1025 gene locus_tag LOCUS_16770 gene parC 3283 1025 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_16770 3818 3291 gene locus_tag LOCUS_16780 3818 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_16780 4798 3815 gene locus_tag LOCUS_16790 4798 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095689.1 protein_id gnl|my_center|LOCUS_16790 6702 4798 gene locus_tag LOCUS_16800 gene parE 6702 4798 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH3 protein_id gnl|my_center|LOCUS_16800 7337 6717 gene locus_tag LOCUS_16810 7337 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_16810 8231 7416 gene locus_tag LOCUS_16820 gene cpdA 8231 7416 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_16820 8815 8363 gene locus_tag LOCUS_16830 8815 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377111.1 protein_id gnl|my_center|LOCUS_16830 9405 8806 gene locus_tag LOCUS_16840 gene aspP 9405 8806 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_16840 11385 9493 gene locus_tag LOCUS_16850 gene thiC 11385 9493 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ08 protein_id gnl|my_center|LOCUS_16850 11946 13394 gene locus_tag LOCUS_16860 11946 13394 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_16860 14861 13572 gene locus_tag LOCUS_16870 gene waaA 14861 13572 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_16870 15952 15068 gene locus_tag LOCUS_16880 15952 15068 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 protein_id gnl|my_center|LOCUS_16880 16039 16371 gene locus_tag LOCUS_16890 16039 16371 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 protein_id gnl|my_center|LOCUS_16890 16436 17608 gene locus_tag LOCUS_16900 16436 17608 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_16900 17608 18426 gene locus_tag LOCUS_16910 17608 18426 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_16910 18526 19440 gene locus_tag LOCUS_16920 18526 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114542.1 protein_id gnl|my_center|LOCUS_16920 20843 19635 gene locus_tag LOCUS_16930 20843 19635 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_16930 22130 20856 gene locus_tag LOCUS_16940 22130 20856 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_16940 23771 22350 gene locus_tag LOCUS_16950 gene hldE 23771 22350 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF4 protein_id gnl|my_center|LOCUS_16950 25697 23811 gene locus_tag LOCUS_16960 gene msbA 25697 23811 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_16960 25850 26488 gene locus_tag LOCUS_16970 25850 26488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_16970 26504 27745 gene locus_tag LOCUS_16980 26504 27745 CDS product putative lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG6 protein_id gnl|my_center|LOCUS_16980 27723 28355 gene locus_tag LOCUS_16990 27723 28355 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244876.1 protein_id gnl|my_center|LOCUS_16990 29227 28334 gene locus_tag LOCUS_17000 gene wapR 29227 28334 CDS product alpha-1,3-rhamnosyltransferase WapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_17000 30111 29221 gene locus_tag LOCUS_17010 30111 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105261.1 protein_id gnl|my_center|LOCUS_17010 31095 30166 gene locus_tag LOCUS_17020 31095 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 32159 31095 gene locus_tag LOCUS_17030 32159 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 33901 32171 gene locus_tag LOCUS_17040 33901 32171 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 protein_id gnl|my_center|LOCUS_17040 35442 33985 gene locus_tag LOCUS_17050 35442 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_17050 36185 35439 gene locus_tag LOCUS_17060 36185 35439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_17060 36919 36182 gene locus_tag LOCUS_17070 36919 36182 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266463.1 protein_id gnl|my_center|LOCUS_17070 37730 36912 gene locus_tag LOCUS_17080 gene waaP 37730 36912 CDS product lipopolysaccharide core heptose(I) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VD9 protein_id gnl|my_center|LOCUS_17080 38896 37727 gene locus_tag LOCUS_17090 gene waaG 38896 37727 CDS product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_17090 39974 38970 gene locus_tag LOCUS_17100 gene waaC 39974 38970 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_17100 40978 39974 gene locus_tag LOCUS_17110 gene rfaF 40978 39974 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_17110 42193 41270 gene locus_tag LOCUS_17120 gene ilvE 42193 41270 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_17120 45208 42266 gene locus_tag LOCUS_17130 gene glnE 45208 42266 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_17130 45479 48124 gene locus_tag LOCUS_17140 45479 48124 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ34 protein_id gnl|my_center|LOCUS_17140 48136 49782 gene locus_tag LOCUS_17150 gene aceF 48136 49782 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VD3 protein_id gnl|my_center|LOCUS_17150 50733 50203 gene locus_tag LOCUS_17160 50733 50203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 50811 53507 gene locus_tag LOCUS_17170 50811 53507 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114559.1 protein_id gnl|my_center|LOCUS_17170 53576 54223 gene locus_tag LOCUS_17180 gene msrA 53576 54223 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 protein_id gnl|my_center|LOCUS_17180 55261 54416 gene locus_tag LOCUS_17190 gene rlmJ 55261 54416 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF0 protein_id gnl|my_center|LOCUS_17190 56197 55307 gene locus_tag LOCUS_17200 56197 55307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211958.1 protein_id gnl|my_center|LOCUS_17200 56306 57478 gene locus_tag LOCUS_17210 56306 57478 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389341.1 protein_id gnl|my_center|LOCUS_17210 57492 57713 gene locus_tag LOCUS_17220 57492 57713 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_17220 57825 59627 gene locus_tag LOCUS_17230 57825 59627 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_17230 59922 59710 gene locus_tag LOCUS_17240 59922 59710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 59828 61573 gene locus_tag LOCUS_17250 gene nhaP2 59828 61573 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE8 protein_id gnl|my_center|LOCUS_17250 61608 64967 gene locus_tag LOCUS_17260 61608 64967 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103675.1 protein_id gnl|my_center|LOCUS_17260 65065 66525 gene locus_tag LOCUS_17270 65065 66525 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE6 protein_id gnl|my_center|LOCUS_17270 67367 66672 gene locus_tag LOCUS_17280 67367 66672 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 protein_id gnl|my_center|LOCUS_17280 67599 69389 gene locus_tag LOCUS_17290 67599 69389 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_17290 69487 69921 gene locus_tag LOCUS_17300 gene trx 69487 69921 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_17300 70015 70458 gene locus_tag LOCUS_17310 70015 70458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_17310 70545 71342 gene locus_tag LOCUS_17320 70545 71342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_17320 71402 72202 gene locus_tag LOCUS_17330 71402 72202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 72998 72225 gene locus_tag LOCUS_17340 72998 72225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_17340 74211 73144 gene locus_tag LOCUS_17350 gene hemE 74211 73144 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_17350 75912 74494 gene locus_tag LOCUS_17360 gene gltD 75912 74494 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_17360 80394 75946 gene locus_tag LOCUS_17370 gene gltB 80394 75946 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105326.1 protein_id gnl|my_center|LOCUS_17370 82198 80636 gene locus_tag LOCUS_17380 82198 80636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 83387 82209 gene locus_tag LOCUS_17390 gene aroB 83387 82209 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_17390 83883 83365 gene locus_tag LOCUS_17400 gene aroK 83883 83365 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_17400 86026 83888 gene locus_tag LOCUS_17410 86026 83888 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 protein_id gnl|my_center|LOCUS_17410 86554 86027 gene locus_tag LOCUS_17420 gene pilP 86554 86027 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_17420 87171 86551 gene locus_tag LOCUS_17430 gene pilO 87171 86551 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_17430 87740 87168 gene locus_tag LOCUS_17440 gene pilN 87740 87168 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_17440 88804 87740 gene locus_tag LOCUS_17450 gene pilM 88804 87740 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_17450 88989 91424 gene locus_tag LOCUS_17460 88989 91424 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105330.1 protein_id gnl|my_center|LOCUS_17460 92851 91583 gene locus_tag LOCUS_17470 92851 91583 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_17470 94478 92955 gene locus_tag LOCUS_17480 94478 92955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_17480 95275 94475 gene locus_tag LOCUS_17490 95275 94475 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_17490 95517 95302 gene locus_tag LOCUS_17500 gene rpmE 95517 95302 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_17500 95685 97904 gene locus_tag LOCUS_17510 gene priA 95685 97904 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_17510 98165 99904 gene locus_tag LOCUS_17520 gene argS 98165 99904 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF5 protein_id gnl|my_center|LOCUS_17520 99905 100597 gene locus_tag LOCUS_17530 99905 100597 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_17530 100774 101304 gene locus_tag LOCUS_17540 gene hslV 100774 101304 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC6 protein_id gnl|my_center|LOCUS_17540 101332 102672 gene locus_tag LOCUS_17550 gene hslU 101332 102672 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF8 protein_id gnl|my_center|LOCUS_17550 102752 103126 gene locus_tag LOCUS_17560 102752 103126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_17560 103491 105170 gene locus_tag LOCUS_17570 gene phaC1 103491 105170 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_17570 105327 106184 gene locus_tag LOCUS_17580 gene phaD 105327 106184 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_17580 106376 108058 gene locus_tag LOCUS_17590 gene phaC2 106376 108058 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115652.1 protein_id gnl|my_center|LOCUS_17590 108138 108752 gene locus_tag LOCUS_17600 108138 108752 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103292.1 protein_id gnl|my_center|LOCUS_17600 109602 108814 gene locus_tag LOCUS_17610 109602 108814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17610 110053 109613 gene locus_tag LOCUS_17620 110053 109613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103463.1 protein_id gnl|my_center|LOCUS_17620 110459 110181 gene locus_tag LOCUS_17630 110459 110181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_17630 110560 111375 gene locus_tag LOCUS_17640 gene ubiE 110560 111375 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_17640 111375 111992 gene locus_tag LOCUS_17650 111375 111992 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105338.1 protein_id gnl|my_center|LOCUS_17650 111989 113578 gene locus_tag LOCUS_17660 gene ubiB 111989 113578 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_17660 113645 114046 gene locus_tag LOCUS_17670 gene hisI 113645 114046 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_17670 114039 114374 gene locus_tag LOCUS_17680 gene hisE 114039 114374 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_17680 114399 114659 gene locus_tag LOCUS_17690 gene tatA 114399 114659 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG8 protein_id gnl|my_center|LOCUS_17690 114669 115028 gene locus_tag LOCUS_17700 gene tatB 114669 115028 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB4 protein_id gnl|my_center|LOCUS_17700 115025 115825 gene locus_tag LOCUS_17710 gene tatC 115025 115825 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY5 protein_id gnl|my_center|LOCUS_17710 115822 116529 gene locus_tag LOCUS_17720 115822 116529 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_17720 117183 116680 gene locus_tag LOCUS_17730 117183 116680 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083753.1 protein_id gnl|my_center|LOCUS_17730 117378 118106 gene locus_tag LOCUS_17740 117378 118106 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_17740 118227 118814 gene locus_tag LOCUS_17750 118227 118814 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_17750 119350 118913 gene locus_tag LOCUS_17760 gene dtd 119350 118913 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX9 protein_id gnl|my_center|LOCUS_17760 120318 119347 gene locus_tag LOCUS_17770 gene pip 120318 119347 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX8 protein_id gnl|my_center|LOCUS_17770 120445 120879 gene locus_tag LOCUS_17780 120445 120879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 121487 120927 gene locus_tag LOCUS_17790 gene blc 121487 120927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114468.1 protein_id gnl|my_center|LOCUS_17790 121752 121498 gene locus_tag LOCUS_17800 121752 121498 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403102.1 protein_id gnl|my_center|LOCUS_17800 122439 121822 gene locus_tag LOCUS_17810 122439 121822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_17810 123450 122443 gene locus_tag LOCUS_17820 gene fbp 123450 122443 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU73 protein_id gnl|my_center|LOCUS_17820 125439 123538 gene locus_tag LOCUS_17830 gene estA 125439 123538 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33407 protein_id gnl|my_center|LOCUS_17830 127205 125553 gene locus_tag LOCUS_17840 127205 125553 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140374.1 protein_id gnl|my_center|LOCUS_17840 128942 127581 gene locus_tag LOCUS_17850 128942 127581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 protein_id gnl|my_center|LOCUS_17850 132532 128939 gene locus_tag LOCUS_17860 132532 128939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 protein_id gnl|my_center|LOCUS_17860 133023 133418 gene locus_tag LOCUS_17870 133023 133418 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551717.1 protein_id gnl|my_center|LOCUS_17870 135356 133536 gene locus_tag LOCUS_17880 gene typA 135356 133536 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737390.1 protein_id gnl|my_center|LOCUS_17880 136972 135518 gene locus_tag LOCUS_17890 gene thiI 136972 135518 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLX9 protein_id gnl|my_center|LOCUS_17890 137302 138708 gene locus_tag LOCUS_17900 gene glnA 137302 138708 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_17900 139093 138908 gene locus_tag LOCUS_17910 139093 138908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 139077 139631 gene locus_tag LOCUS_17920 139077 139631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269244.1 protein_id gnl|my_center|LOCUS_17920 139635 140255 gene locus_tag LOCUS_17930 139635 140255 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_17930 140450 141535 gene locus_tag LOCUS_17940 140450 141535 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_17940 141532 142968 gene locus_tag LOCUS_17950 141532 142968 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_17950 143947 143507 gene locus_tag LOCUS_17960 143947 143507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105424.1 protein_id gnl|my_center|LOCUS_17960 143946 144410 gene locus_tag LOCUS_17970 gene trmL 143946 144410 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR4 protein_id gnl|my_center|LOCUS_17970 145156 144665 gene locus_tag LOCUS_17980 gene secB 145156 144665 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_17980 145455 145201 gene locus_tag LOCUS_17990 145455 145201 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_17990 145870 145457 gene locus_tag LOCUS_18000 145870 145457 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397172.1 protein_id gnl|my_center|LOCUS_18000 146017 147552 gene locus_tag LOCUS_18010 gene gpmI 146017 147552 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_18010 147760 149004 gene locus_tag LOCUS_18020 147760 149004 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269286.1 protein_id gnl|my_center|LOCUS_18020 149039 150346 gene locus_tag LOCUS_18030 149039 150346 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767110.1 protein_id gnl|my_center|LOCUS_18030 151218 150463 gene locus_tag LOCUS_18040 151218 150463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096075.1 protein_id gnl|my_center|LOCUS_18040 152105 151350 gene locus_tag LOCUS_18050 152105 151350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_18050 153003 152233 gene locus_tag LOCUS_18060 gene hisF1 153003 152233 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_18060 153852 153115 gene locus_tag LOCUS_18070 gene hisA 153852 153115 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLQ1 protein_id gnl|my_center|LOCUS_18070 154146 153889 gene locus_tag LOCUS_18080 154146 153889 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 protein_id gnl|my_center|LOCUS_18080 154785 154147 gene locus_tag LOCUS_18090 gene hisH1 154785 154147 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_18090 155418 154786 gene locus_tag LOCUS_18100 gene hisB 155418 154786 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG0 protein_id gnl|my_center|LOCUS_18100 157181 155520 gene locus_tag LOCUS_18110 157181 155520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 protein_id gnl|my_center|LOCUS_18110 157343 157741 gene locus_tag LOCUS_18120 157343 157741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 protein_id gnl|my_center|LOCUS_18120 159076 157853 gene locus_tag LOCUS_18130 159076 157853 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947944.1 protein_id gnl|my_center|LOCUS_18130 159173 160285 gene locus_tag LOCUS_18140 159173 160285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_18140 160346 162577 gene locus_tag LOCUS_18150 160346 162577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_18150 162574 163638 gene locus_tag LOCUS_18160 gene mutY 162574 163638 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_18160 163638 163910 gene locus_tag LOCUS_18170 163638 163910 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_18170 164195 164270 gene locus_tag LOCUS_t00230 164195 164270 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 164366 166117 gene locus_tag LOCUS_18180 164366 166117 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391063.1 protein_id gnl|my_center|LOCUS_18180 167058 166342 gene locus_tag LOCUS_18190 167058 166342 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087771.1 protein_id gnl|my_center|LOCUS_18190 167372 167857 gene locus_tag LOCUS_18200 167372 167857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 168256 169029 gene locus_tag LOCUS_18210 168256 169029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096153.1 protein_id gnl|my_center|LOCUS_18210 169047 169799 gene locus_tag LOCUS_18220 169047 169799 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_18220 169850 170545 gene locus_tag LOCUS_18230 169850 170545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 protein_id gnl|my_center|LOCUS_18230 170542 171231 gene locus_tag LOCUS_18240 170542 171231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_18240 171259 172476 gene locus_tag LOCUS_18250 171259 172476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253843.2 protein_id gnl|my_center|LOCUS_18250 172769 172844 gene locus_tag LOCUS_t00240 172769 172844 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 173332 173625 gene locus_tag LOCUS_18260 173332 173625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 173868 173641 gene locus_tag LOCUS_18270 173868 173641 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_18270 174532 174879 gene locus_tag LOCUS_18280 174532 174879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 174931 175413 gene locus_tag LOCUS_18290 174931 175413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 175432 176178 gene locus_tag LOCUS_18300 175432 176178 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102956.1 protein_id gnl|my_center|LOCUS_18300 176188 176562 gene locus_tag LOCUS_18310 176188 176562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence10 1816 152 gene locus_tag LOCUS_18320 1816 152 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 protein_id gnl|my_center|LOCUS_18320 2131 6375 gene locus_tag LOCUS_18330 gene morA 2131 6375 CDS product motility regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_18330 6755 8011 gene locus_tag LOCUS_18340 gene glyA2 6755 8011 CDS product serine hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI7 protein_id gnl|my_center|LOCUS_18340 8578 8072 gene locus_tag LOCUS_18350 8578 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094862.1 protein_id gnl|my_center|LOCUS_18350 8801 9172 gene locus_tag LOCUS_18360 8801 9172 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI1 protein_id gnl|my_center|LOCUS_18360 10657 9293 gene locus_tag LOCUS_18370 gene radA 10657 9293 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG7 protein_id gnl|my_center|LOCUS_18370 11273 11025 gene locus_tag LOCUS_18380 11273 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_18380 11406 12149 gene locus_tag LOCUS_18390 11406 12149 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036286.1 protein_id gnl|my_center|LOCUS_18390 12218 12631 gene locus_tag LOCUS_18400 gene mscL 12218 12631 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH7 protein_id gnl|my_center|LOCUS_18400 14242 12689 gene locus_tag LOCUS_18410 14242 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082751.1 protein_id gnl|my_center|LOCUS_18410 15316 14540 gene locus_tag LOCUS_18420 15316 14540 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268934.1 protein_id gnl|my_center|LOCUS_18420 15390 16514 gene locus_tag LOCUS_18430 gene rlmG 15390 16514 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH4 protein_id gnl|my_center|LOCUS_18430 16756 16613 gene locus_tag LOCUS_18440 16756 16613 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555239.1 protein_id gnl|my_center|LOCUS_18440 18055 17048 gene locus_tag LOCUS_18450 gene cioB 18055 17048 CDS product cyanide insensitive terminal oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093053.1 protein_id gnl|my_center|LOCUS_18450 19497 18058 gene locus_tag LOCUS_18460 19497 18058 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 protein_id gnl|my_center|LOCUS_18460 19737 21155 gene locus_tag LOCUS_18470 19737 21155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_18470 21718 21164 gene locus_tag LOCUS_18480 gene thiJ 21718 21164 CDS product oxidative-stress-resistance chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816903.1 protein_id gnl|my_center|LOCUS_18480 21901 23193 gene locus_tag LOCUS_18490 21901 23193 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_18490 23262 24350 gene locus_tag LOCUS_18500 gene trmA 23262 24350 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV78 protein_id gnl|my_center|LOCUS_18500 24747 24361 gene locus_tag LOCUS_18510 24747 24361 CDS product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095105.1 protein_id gnl|my_center|LOCUS_18510 24867 25076 gene locus_tag LOCUS_18520 24867 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 25186 26535 gene locus_tag LOCUS_18530 25186 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071880.1 protein_id gnl|my_center|LOCUS_18530 26663 27097 gene locus_tag LOCUS_18540 26663 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_18540 27184 28059 gene locus_tag LOCUS_18550 27184 28059 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_18550 29151 28264 gene locus_tag LOCUS_18560 29151 28264 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_18560 29401 30444 gene locus_tag LOCUS_18570 29401 30444 CDS product bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706139.1 protein_id gnl|my_center|LOCUS_18570 32038 30761 gene locus_tag LOCUS_18580 32038 30761 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_18580 32201 33556 gene locus_tag LOCUS_18590 32201 33556 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112919.1 protein_id gnl|my_center|LOCUS_18590 34698 33706 gene locus_tag LOCUS_18600 34698 33706 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095270.1 protein_id gnl|my_center|LOCUS_18600 34881 35732 gene locus_tag LOCUS_18610 34881 35732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095272.1 protein_id gnl|my_center|LOCUS_18610 35781 36086 gene locus_tag LOCUS_18620 35781 36086 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102255.1 protein_id gnl|my_center|LOCUS_18620 36083 36832 gene locus_tag LOCUS_18630 gene cmoM 36083 36832 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV18 protein_id gnl|my_center|LOCUS_18630 36930 37547 gene locus_tag LOCUS_18640 36930 37547 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266533.1 protein_id gnl|my_center|LOCUS_18640 37607 38167 gene locus_tag LOCUS_18650 37607 38167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095282.1 protein_id gnl|my_center|LOCUS_18650 38219 38707 gene locus_tag LOCUS_18660 38219 38707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111411.1 protein_id gnl|my_center|LOCUS_18660 38793 39242 gene locus_tag LOCUS_18670 38793 39242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095321.1 protein_id gnl|my_center|LOCUS_18670 40238 39300 gene locus_tag LOCUS_18680 40238 39300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_18680 40588 41709 gene locus_tag LOCUS_18690 40588 41709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 41815 43779 gene locus_tag LOCUS_18700 41815 43779 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266362.1 protein_id gnl|my_center|LOCUS_18700 45779 43848 gene locus_tag LOCUS_18710 45779 43848 CDS product energy taxis-modulating methyl-accepting chemotaxis protein with Cache_1 sensory domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 protein_id gnl|my_center|LOCUS_18710 46535 47197 gene locus_tag LOCUS_18720 46535 47197 CDS product curli production assembly protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244036.1 protein_id gnl|my_center|LOCUS_18720 47217 47576 gene locus_tag LOCUS_18730 47217 47576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 47586 48257 gene locus_tag LOCUS_18740 47586 48257 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_18740 48744 48944 gene locus_tag LOCUS_18750 48744 48944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556012.1 protein_id gnl|my_center|LOCUS_18750 49375 49524 gene locus_tag LOCUS_18760 49375 49524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 49493 49825 gene locus_tag LOCUS_18770 49493 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 50491 50258 gene locus_tag LOCUS_18780 50491 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 51303 50854 gene locus_tag LOCUS_18790 51303 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 53630 51315 gene locus_tag LOCUS_18800 53630 51315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 53841 54116 gene locus_tag LOCUS_18810 53841 54116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_18810 54097 54357 gene locus_tag LOCUS_18820 54097 54357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_18820 54484 55377 gene locus_tag LOCUS_18830 54484 55377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 69808 55958 gene locus_tag LOCUS_18840 69808 55958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 71540 69849 gene locus_tag LOCUS_18850 71540 69849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147036.1 protein_id gnl|my_center|LOCUS_18850 73973 71646 gene locus_tag LOCUS_18860 73973 71646 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269001.1 protein_id gnl|my_center|LOCUS_18860 74354 74647 gene locus_tag LOCUS_18870 74354 74647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 protein_id gnl|my_center|LOCUS_18870 79825 74915 gene locus_tag LOCUS_18880 79825 74915 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_18880 80443 79979 gene locus_tag LOCUS_18890 80443 79979 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197880.1 protein_id gnl|my_center|LOCUS_18890 80616 81980 gene locus_tag LOCUS_18900 80616 81980 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 protein_id gnl|my_center|LOCUS_18900 81973 83016 gene locus_tag LOCUS_18910 81973 83016 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_18910 83035 83490 gene locus_tag LOCUS_18920 83035 83490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_18920 84443 83553 gene locus_tag LOCUS_18930 84443 83553 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_18930 86587 84674 gene locus_tag LOCUS_18940 gene speA 86587 84674 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VU3 protein_id gnl|my_center|LOCUS_18940 87243 86872 gene locus_tag LOCUS_18950 87243 86872 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_18950 88124 87588 gene locus_tag LOCUS_18960 88124 87588 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244663.1 protein_id gnl|my_center|LOCUS_18960 89198 88128 gene locus_tag LOCUS_18970 89198 88128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_18970 89455 91074 gene locus_tag LOCUS_18980 89455 91074 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_18980 91494 93458 gene locus_tag LOCUS_18990 gene ctpL 91494 93458 CDS product methyl-accepting chemotaxis protein CtpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW6 protein_id gnl|my_center|LOCUS_18990 93609 95381 gene locus_tag LOCUS_19000 gene dsbD 93609 95381 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_19000 95551 95994 gene locus_tag LOCUS_19010 gene aroQ 95551 95994 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS6 protein_id gnl|my_center|LOCUS_19010 96017 96478 gene locus_tag LOCUS_19020 gene accB 96017 96478 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_19020 96496 97845 gene locus_tag LOCUS_19030 gene accC 96496 97845 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_19030 98126 99004 gene locus_tag LOCUS_19040 gene prmA 98126 99004 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_19040 99076 100404 gene locus_tag LOCUS_19050 99076 100404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_19050 100565 101563 gene locus_tag LOCUS_19060 gene dusB 100565 101563 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_19060 101602 101880 gene locus_tag LOCUS_19070 gene fis 101602 101880 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS0 protein_id gnl|my_center|LOCUS_19070 101955 103562 gene locus_tag LOCUS_19080 gene purH 101955 103562 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_19080 103760 105052 gene locus_tag LOCUS_19090 gene purD 103760 105052 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV8 protein_id gnl|my_center|LOCUS_19090 105268 107943 gene locus_tag LOCUS_19100 105268 107943 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244646.1 protein_id gnl|my_center|LOCUS_19100 109032 107956 gene locus_tag LOCUS_19110 109032 107956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_19110 109319 109050 gene locus_tag LOCUS_19120 109319 109050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 109559 110155 gene locus_tag LOCUS_19130 109559 110155 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VR6 protein_id gnl|my_center|LOCUS_19130 110330 111598 gene locus_tag LOCUS_19140 110330 111598 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_19140 111836 113407 gene locus_tag LOCUS_19150 111836 113407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_19150 113407 114498 gene locus_tag LOCUS_19160 113407 114498 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 protein_id gnl|my_center|LOCUS_19160 114495 115346 gene locus_tag LOCUS_19170 114495 115346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_19170 115457 116155 gene locus_tag LOCUS_19180 115457 116155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763108.1 protein_id gnl|my_center|LOCUS_19180 116251 117102 gene locus_tag LOCUS_19190 gene ureD2 116251 117102 CDS product urease accessory protein UreD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN11 protein_id gnl|my_center|LOCUS_19190 117102 117404 gene locus_tag LOCUS_19200 gene ureA 117102 117404 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 protein_id gnl|my_center|LOCUS_19200 117561 118073 gene locus_tag LOCUS_19210 117561 118073 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269031.1 protein_id gnl|my_center|LOCUS_19210 118070 118375 gene locus_tag LOCUS_19220 gene ureB 118070 118375 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN07 protein_id gnl|my_center|LOCUS_19220 118530 120230 gene locus_tag LOCUS_19230 gene ureC 118530 120230 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP0 protein_id gnl|my_center|LOCUS_19230 120607 120341 gene locus_tag LOCUS_19240 120607 120341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_19240 121562 120690 gene locus_tag LOCUS_19250 121562 120690 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU1 protein_id gnl|my_center|LOCUS_19250 122623 121880 gene locus_tag LOCUS_19260 122623 121880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704580.1 protein_id gnl|my_center|LOCUS_19260 123664 122717 gene locus_tag LOCUS_19270 123664 122717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 123924 124652 gene locus_tag LOCUS_19280 123924 124652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_19280 124715 125152 gene locus_tag LOCUS_19290 124715 125152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_19290 125368 126321 gene locus_tag LOCUS_19300 125368 126321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388243.1 protein_id gnl|my_center|LOCUS_19300 126578 127843 gene locus_tag LOCUS_19310 126578 127843 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099398.1 protein_id gnl|my_center|LOCUS_19310 130207 127982 gene locus_tag LOCUS_19320 130207 127982 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW5 protein_id gnl|my_center|LOCUS_19320 130498 132405 gene locus_tag LOCUS_19330 130498 132405 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_19330 133552 132473 gene locus_tag LOCUS_19340 gene alr 133552 132473 CDS product alanine racemase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN4 protein_id gnl|my_center|LOCUS_19340 135050 133656 gene locus_tag LOCUS_19350 gene dnaB 135050 133656 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_19350 135757 135311 gene locus_tag LOCUS_19360 gene rplI 135757 135311 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_19360 136672 135779 gene locus_tag LOCUS_19370 136672 135779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_19370 136939 136709 gene locus_tag LOCUS_19380 gene rpsR 136939 136709 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK4 protein_id gnl|my_center|LOCUS_19380 137393 136968 gene locus_tag LOCUS_19390 gene rpsF 137393 136968 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX1 protein_id gnl|my_center|LOCUS_19390 138433 137681 gene locus_tag LOCUS_19400 gene rlmB 138433 137681 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_19400 141012 138430 gene locus_tag LOCUS_19410 gene rnr 141012 138430 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_19410 141219 141305 gene locus_tag LOCUS_t00250 141219 141305 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 143392 141458 gene locus_tag LOCUS_19420 143392 141458 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266498.1 protein_id gnl|my_center|LOCUS_19420 144831 143536 gene locus_tag LOCUS_19430 gene purA 144831 143536 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ9 protein_id gnl|my_center|LOCUS_19430 146085 144898 gene locus_tag LOCUS_19440 gene hisZ 146085 144898 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_19440 147284 146415 gene locus_tag LOCUS_19450 147284 146415 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_19450 148438 147284 gene locus_tag LOCUS_19460 148438 147284 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_19460 149837 148536 gene locus_tag LOCUS_19470 gene hflX 149837 148536 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX9 protein_id gnl|my_center|LOCUS_19470 150112 149852 gene locus_tag LOCUS_19480 gene hfq 150112 149852 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ4 protein_id gnl|my_center|LOCUS_19480 151191 150217 gene locus_tag LOCUS_19490 gene miaA 151191 150217 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_19490 153114 151243 gene locus_tag LOCUS_19500 gene mutL 153114 151243 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_19500 154541 153111 gene locus_tag LOCUS_19510 154541 153111 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_19510 155019 154552 gene locus_tag LOCUS_19520 155019 154552 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_19520 156506 155007 gene locus_tag LOCUS_19530 156506 155007 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_19530 156566 157630 gene locus_tag LOCUS_19540 gene queG 156566 157630 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_19540 158402 157860 gene locus_tag LOCUS_19550 gene orn 158402 157860 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_19550 159228 158443 gene locus_tag LOCUS_19560 159228 158443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 159345 160376 gene locus_tag LOCUS_19570 gene rsgA 159345 160376 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY9 protein_id gnl|my_center|LOCUS_19570 161448 160426 gene locus_tag LOCUS_19580 gene motB 161448 160426 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402902.1 protein_id gnl|my_center|LOCUS_19580 162310 161459 gene locus_tag LOCUS_19590 gene motA 162310 161459 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_19590 162429 163943 gene locus_tag LOCUS_19600 162429 163943 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105242.1 protein_id gnl|my_center|LOCUS_19600 163990 164805 gene locus_tag LOCUS_19610 gene rhdA 163990 164805 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_19610 164843 165694 gene locus_tag LOCUS_19620 gene psd 164843 165694 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_19620 165952 167757 gene locus_tag LOCUS_19630 165952 167757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_19630 167821 169890 gene locus_tag LOCUS_19640 gene fimX 167821 169890 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_19640 171164 169950 gene locus_tag LOCUS_19650 171164 169950 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_19650 171340 172866 gene locus_tag LOCUS_19660 171340 172866 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402883.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence11 354 1151 gene locus_tag LOCUS_19670 354 1151 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105027.1 protein_id gnl|my_center|LOCUS_19670 1202 1810 gene locus_tag LOCUS_19680 1202 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084511.1 protein_id gnl|my_center|LOCUS_19680 1873 2550 gene locus_tag LOCUS_19690 1873 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3229 2495 gene locus_tag LOCUS_19700 gene mtgA 3229 2495 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF9 protein_id gnl|my_center|LOCUS_19700 3297 3668 gene locus_tag LOCUS_19710 3297 3668 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_19710 3771 3971 gene locus_tag LOCUS_19720 3771 3971 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_19720 4138 4929 gene locus_tag LOCUS_19730 gene thiG 4138 4929 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM55 protein_id gnl|my_center|LOCUS_19730 5110 5829 gene locus_tag LOCUS_19740 gene trmB 5110 5829 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B3 protein_id gnl|my_center|LOCUS_19740 6120 7463 gene locus_tag LOCUS_19750 6120 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_19750 8994 7585 gene locus_tag LOCUS_19760 8994 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_19760 10483 9068 gene locus_tag LOCUS_19770 10483 9068 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_19770 11000 10677 gene locus_tag LOCUS_19780 11000 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_19780 12234 11038 gene locus_tag LOCUS_19790 12234 11038 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_19790 12821 12231 gene locus_tag LOCUS_19800 12821 12231 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6A8 protein_id gnl|my_center|LOCUS_19800 13237 12818 gene locus_tag LOCUS_19810 13237 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100965.1 protein_id gnl|my_center|LOCUS_19810 13897 13277 gene locus_tag LOCUS_19820 13897 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_19820 15044 13905 gene locus_tag LOCUS_19830 gene metX 15044 13905 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_19830 15747 15136 gene locus_tag LOCUS_19840 15747 15136 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_19840 15934 15740 gene locus_tag LOCUS_19850 15934 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 17985 16003 gene locus_tag LOCUS_19860 17985 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_19860 18354 18178 gene locus_tag LOCUS_19870 18354 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 18944 18354 gene locus_tag LOCUS_19880 18944 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_19880 19800 18955 gene locus_tag LOCUS_19890 gene proC 19800 18955 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_19890 20518 19838 gene locus_tag LOCUS_19900 20518 19838 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_19900 20581 21615 gene locus_tag LOCUS_19910 gene pilT 20581 21615 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_19910 21724 22869 gene locus_tag LOCUS_19920 gene pilU 21724 22869 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_19920 23713 22835 gene locus_tag LOCUS_19930 23713 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267625.1 protein_id gnl|my_center|LOCUS_19930 24924 23713 gene locus_tag LOCUS_19940 24924 23713 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 protein_id gnl|my_center|LOCUS_19940 25083 25481 gene locus_tag LOCUS_19950 25083 25481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 protein_id gnl|my_center|LOCUS_19950 26898 25627 gene locus_tag LOCUS_19960 gene pyrC 26898 25627 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ71 protein_id gnl|my_center|LOCUS_19960 27908 26898 gene locus_tag LOCUS_19970 gene pyrB 27908 26898 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_19970 28425 27919 gene locus_tag LOCUS_19980 gene pyrR 28425 27919 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_19980 28951 28505 gene locus_tag LOCUS_19990 28951 28505 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_19990 29520 28951 gene locus_tag LOCUS_20000 gene algH 29520 28951 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_20000 30496 29600 gene locus_tag LOCUS_20010 30496 29600 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_20010 31515 30553 gene locus_tag LOCUS_20020 gene gshB 31515 30553 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_20020 31784 32161 gene locus_tag LOCUS_20030 gene pilG 31784 32161 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_20030 32210 32575 gene locus_tag LOCUS_20040 gene pilH 32210 32575 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_20040 32624 33160 gene locus_tag LOCUS_20050 gene pilI 32624 33160 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_20050 33245 35290 gene locus_tag LOCUS_20060 gene pilJ 33245 35290 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_20060 35335 36216 gene locus_tag LOCUS_20070 gene pilK 35335 36216 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_20070 36456 43793 gene locus_tag LOCUS_20080 36456 43793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 43790 44809 gene locus_tag LOCUS_20090 gene chpB 43790 44809 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_20090 44919 45389 gene locus_tag LOCUS_20100 gene chpC 44919 45389 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_20100 46254 45535 gene locus_tag LOCUS_20110 46254 45535 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_20110 47813 46407 gene locus_tag LOCUS_20120 gene bioA 47813 46407 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ98 protein_id gnl|my_center|LOCUS_20120 48108 48653 gene locus_tag LOCUS_20130 48108 48653 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266415.1 protein_id gnl|my_center|LOCUS_20130 48725 49303 gene locus_tag LOCUS_20140 48725 49303 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_20140 51290 49428 gene locus_tag LOCUS_20150 gene rhlE 51290 49428 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V71 protein_id gnl|my_center|LOCUS_20150 52248 51475 gene locus_tag LOCUS_20160 52248 51475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 protein_id gnl|my_center|LOCUS_20160 53761 52388 gene locus_tag LOCUS_20170 53761 52388 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268469.1 protein_id gnl|my_center|LOCUS_20170 54842 53997 gene locus_tag LOCUS_20180 54842 53997 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ93 protein_id gnl|my_center|LOCUS_20180 56354 54945 gene locus_tag LOCUS_20190 gene ahcY 56354 54945 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_20190 56660 57046 gene locus_tag LOCUS_20200 56660 57046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_20200 57159 56959 gene locus_tag LOCUS_20210 57159 56959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 57200 58789 gene locus_tag LOCUS_20220 57200 58789 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114783.1 protein_id gnl|my_center|LOCUS_20220 58898 59347 gene locus_tag LOCUS_20230 58898 59347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 protein_id gnl|my_center|LOCUS_20230 59756 59358 gene locus_tag LOCUS_20240 59756 59358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101589.1 protein_id gnl|my_center|LOCUS_20240 61759 60086 gene locus_tag LOCUS_20250 gene ligB 61759 60086 CDS product DNA ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLZ9 protein_id gnl|my_center|LOCUS_20250 63079 61889 gene locus_tag LOCUS_20260 gene metK 63079 61889 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_20260 64110 63097 gene locus_tag LOCUS_20270 64110 63097 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_20270 64333 66330 gene locus_tag LOCUS_20280 gene tktA 64333 66330 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_20280 66445 67500 gene locus_tag LOCUS_20290 gene epd 66445 67500 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_20290 67506 68669 gene locus_tag LOCUS_20300 gene pgk 67506 68669 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM05 protein_id gnl|my_center|LOCUS_20300 68717 69016 gene locus_tag LOCUS_20310 68717 69016 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003320832.1 protein_id gnl|my_center|LOCUS_20310 69127 70191 gene locus_tag LOCUS_20320 gene fba 69127 70191 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_20320 70462 70902 gene locus_tag LOCUS_20330 70462 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 70956 72056 gene locus_tag LOCUS_20340 70956 72056 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_20340 72122 72637 gene locus_tag LOCUS_20350 72122 72637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_20350 72883 72641 gene locus_tag LOCUS_20360 72883 72641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_20360 73019 73777 gene locus_tag LOCUS_20370 73019 73777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071686.1 protein_id gnl|my_center|LOCUS_20370 74270 73788 gene locus_tag LOCUS_20380 74270 73788 CDS product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404212.1 protein_id gnl|my_center|LOCUS_20380 74574 75431 gene locus_tag LOCUS_20390 74574 75431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 77668 75491 gene locus_tag LOCUS_20400 77668 75491 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_20400 77863 79251 gene locus_tag LOCUS_20410 77863 79251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_20410 79254 80006 gene locus_tag LOCUS_20420 79254 80006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_20420 80158 80838 gene locus_tag LOCUS_20430 gene ligE 80158 80838 CDS product beta-aryl ether-cleaving enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969082.1 protein_id gnl|my_center|LOCUS_20430 80962 82104 gene locus_tag LOCUS_20440 gene ald 80962 82104 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_20440 82836 83489 gene locus_tag LOCUS_20450 gene pcxB 82836 83489 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_20450 85447 83579 gene locus_tag LOCUS_20460 85447 83579 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_20460 86917 85733 gene locus_tag LOCUS_20470 86917 85733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_20470 88203 87319 gene locus_tag LOCUS_20480 88203 87319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532133.1 protein_id gnl|my_center|LOCUS_20480 88663 88301 gene locus_tag LOCUS_20490 88663 88301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 89031 88663 gene locus_tag LOCUS_20500 89031 88663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 89192 89482 gene locus_tag LOCUS_20510 89192 89482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 90236 89688 gene locus_tag LOCUS_20520 90236 89688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 90600 91340 gene locus_tag LOCUS_20530 90600 91340 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266453.1 protein_id gnl|my_center|LOCUS_20530 92589 91354 gene locus_tag LOCUS_20540 92589 91354 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_20540 94021 92642 gene locus_tag LOCUS_20550 gene dbpA 94021 92642 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762956.1 protein_id gnl|my_center|LOCUS_20550 96568 94886 gene locus_tag LOCUS_20560 gene betA 96568 94886 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 protein_id gnl|my_center|LOCUS_20560 98184 96712 gene locus_tag LOCUS_20570 gene betB 98184 96712 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ1 protein_id gnl|my_center|LOCUS_20570 99104 98514 gene locus_tag LOCUS_20580 gene betI 99104 98514 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ0 protein_id gnl|my_center|LOCUS_20580 99974 99276 gene locus_tag LOCUS_20590 99974 99276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 100217 101254 gene locus_tag LOCUS_20600 100217 101254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 102248 101388 gene locus_tag LOCUS_20610 102248 101388 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114808.1 protein_id gnl|my_center|LOCUS_20610 103423 102479 gene locus_tag LOCUS_20620 103423 102479 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533171.1 protein_id gnl|my_center|LOCUS_20620 104345 103461 gene locus_tag LOCUS_20630 104345 103461 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_20630 105543 104338 gene locus_tag LOCUS_20640 gene proV 105543 104338 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533427.1 protein_id gnl|my_center|LOCUS_20640 107154 106216 gene locus_tag LOCUS_20650 107154 106216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_20650 107515 108894 gene locus_tag LOCUS_20660 gene sdaB 107515 108894 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 protein_id gnl|my_center|LOCUS_20660 109498 110601 gene locus_tag LOCUS_20670 gene gbdR 109498 110601 CDS product protein GbdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_20670 111006 110761 gene locus_tag LOCUS_20680 111006 110761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 111907 111134 gene locus_tag LOCUS_20690 111907 111134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 protein_id gnl|my_center|LOCUS_20690 113228 112005 gene locus_tag LOCUS_20700 113228 112005 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_254087.2 protein_id gnl|my_center|LOCUS_20700 115323 113362 gene locus_tag LOCUS_20710 gene dgcB 115323 113362 CDS product dimethylglycine catabolism protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 protein_id gnl|my_center|LOCUS_20710 117526 115466 gene locus_tag LOCUS_20720 gene dgcA 117526 115466 CDS product dimethylglycine catabolism protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_20720 118154 117624 gene locus_tag LOCUS_20730 118154 117624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103127.1 protein_id gnl|my_center|LOCUS_20730 119323 118346 gene locus_tag LOCUS_20740 119323 118346 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405167.1 protein_id gnl|my_center|LOCUS_20740 120668 119715 gene locus_tag LOCUS_20750 gene cdhR 120668 119715 CDS product HTH-type transcriptional regulator CdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH5 protein_id gnl|my_center|LOCUS_20750 121182 122123 gene locus_tag LOCUS_20760 121182 122123 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268082.1 protein_id gnl|my_center|LOCUS_20760 122219 123106 gene locus_tag LOCUS_20770 gene cdhC 122219 123106 CDS product carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096716.1 protein_id gnl|my_center|LOCUS_20770 123254 124219 gene locus_tag LOCUS_20780 gene lcdH 123254 124219 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH8 protein_id gnl|my_center|LOCUS_20780 124197 124727 gene locus_tag LOCUS_20790 gene cdhB 124197 124727 CDS product carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_20790 126463 125171 gene locus_tag LOCUS_20800 126463 125171 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 protein_id gnl|my_center|LOCUS_20800 126749 127924 gene locus_tag LOCUS_20810 gene gbcB 126749 127924 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_20810 128555 128040 gene locus_tag LOCUS_20820 128555 128040 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_20820 129754 128711 gene locus_tag LOCUS_20830 gene ltaE 129754 128711 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTF1 protein_id gnl|my_center|LOCUS_20830 130096 130401 gene locus_tag LOCUS_20840 130096 130401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 130499 131239 gene locus_tag LOCUS_20850 130499 131239 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 protein_id gnl|my_center|LOCUS_20850 131515 132768 gene locus_tag LOCUS_20860 gene glyA1 131515 132768 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTE9 protein_id gnl|my_center|LOCUS_20860 132941 134191 gene locus_tag LOCUS_20870 gene soxB-1 132941 134191 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763688.1 protein_id gnl|my_center|LOCUS_20870 134389 134715 gene locus_tag LOCUS_20880 gene soxD 134389 134715 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 protein_id gnl|my_center|LOCUS_20880 134712 137729 gene locus_tag LOCUS_20890 134712 137729 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269189.1 protein_id gnl|my_center|LOCUS_20890 137806 138435 gene locus_tag LOCUS_20900 gene soxG-1 137806 138435 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 protein_id gnl|my_center|LOCUS_20900 138632 139495 gene locus_tag LOCUS_20910 gene purU2 138632 139495 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTE4 protein_id gnl|my_center|LOCUS_20910 139518 139694 gene locus_tag LOCUS_20920 139518 139694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 139684 140883 gene locus_tag LOCUS_20930 139684 140883 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316157.1 protein_id gnl|my_center|LOCUS_20930 141861 140968 gene locus_tag LOCUS_20940 141861 140968 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 protein_id gnl|my_center|LOCUS_20940 142074 143255 gene locus_tag LOCUS_20950 142074 143255 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_20950 143345 143848 gene locus_tag LOCUS_20960 143345 143848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613972.1 protein_id gnl|my_center|LOCUS_20960 144225 146255 gene locus_tag LOCUS_20970 144225 146255 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103405.1 protein_id gnl|my_center|LOCUS_20970 146525 147208 gene locus_tag LOCUS_20980 gene creB 146525 147208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_20980 147208 148632 gene locus_tag LOCUS_20990 gene creC 147208 148632 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_20990 148900 150555 gene locus_tag LOCUS_21000 148900 150555 CDS product site-specific DNA-methyltransferase type I modification inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_21000 151001 151804 gene locus_tag LOCUS_21010 151001 151804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 152492 151737 gene locus_tag LOCUS_21020 152492 151737 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_21020 154039 152510 gene locus_tag LOCUS_21030 154039 152510 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence12 2511 283 gene locus_tag LOCUS_21040 2511 283 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223350.1 protein_id gnl|my_center|LOCUS_21040 2966 5206 gene locus_tag LOCUS_21050 2966 5206 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082728.1 protein_id gnl|my_center|LOCUS_21050 5611 8133 gene locus_tag LOCUS_21060 5611 8133 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112851.1 protein_id gnl|my_center|LOCUS_21060 8220 8966 gene locus_tag LOCUS_21070 8220 8966 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVR0 protein_id gnl|my_center|LOCUS_21070 9997 9026 gene locus_tag LOCUS_21080 gene dppF 9997 9026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_21080 10965 9997 gene locus_tag LOCUS_21090 10965 9997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112857.1 protein_id gnl|my_center|LOCUS_21090 11973 11074 gene locus_tag LOCUS_21100 gene dppC 11973 11074 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243753.1 protein_id gnl|my_center|LOCUS_21100 13116 12106 gene locus_tag LOCUS_21110 13116 12106 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769384.1 protein_id gnl|my_center|LOCUS_21110 15018 13408 gene locus_tag LOCUS_21120 15018 13408 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112859.1 protein_id gnl|my_center|LOCUS_21120 16725 15124 gene locus_tag LOCUS_21130 16725 15124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112863.1 protein_id gnl|my_center|LOCUS_21130 17659 16949 gene locus_tag LOCUS_21140 17659 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268908.1 protein_id gnl|my_center|LOCUS_21140 18033 19286 gene locus_tag LOCUS_21150 gene roxS 18033 19286 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_21150 19348 19914 gene locus_tag LOCUS_21160 gene roxR 19348 19914 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_21160 20031 20972 gene locus_tag LOCUS_21170 20031 20972 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268873.1 protein_id gnl|my_center|LOCUS_21170 21449 21069 gene locus_tag LOCUS_21180 gene pcaC-2 21449 21069 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243700.1 protein_id gnl|my_center|LOCUS_21180 22558 21449 gene locus_tag LOCUS_21190 22558 21449 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_21190 22996 22658 gene locus_tag LOCUS_21200 22996 22658 CDS product rplA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105017.1 protein_id gnl|my_center|LOCUS_21200 22907 23092 gene locus_tag LOCUS_21210 22907 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 24643 23195 gene locus_tag LOCUS_21220 gene gatB 24643 23195 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_21220 26106 24655 gene locus_tag LOCUS_21230 gene gatA 26106 24655 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_21230 26410 26123 gene locus_tag LOCUS_21240 gene gatC 26410 26123 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_21240 26648 27685 gene locus_tag LOCUS_21250 26648 27685 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_21250 27810 28757 gene locus_tag LOCUS_21260 gene mreC 27810 28757 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_21260 28754 29242 gene locus_tag LOCUS_21270 28754 29242 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT1 protein_id gnl|my_center|LOCUS_21270 29284 29883 gene locus_tag LOCUS_21280 gene maf-2 29284 29883 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS4 protein_id gnl|my_center|LOCUS_21280 29970 31427 gene locus_tag LOCUS_21290 29970 31427 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364105.1 protein_id gnl|my_center|LOCUS_21290 31459 35286 gene locus_tag LOCUS_21300 31459 35286 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_21300 35353 36192 gene locus_tag LOCUS_21310 35353 36192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_21310 36487 37929 gene locus_tag LOCUS_21320 gene tldD 36487 37929 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105013.1 protein_id gnl|my_center|LOCUS_21320 38508 37990 gene locus_tag LOCUS_21330 38508 37990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364101.1 protein_id gnl|my_center|LOCUS_21330 38614 39960 gene locus_tag LOCUS_21340 gene pmbA 38614 39960 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 protein_id gnl|my_center|LOCUS_21340 40302 40030 gene locus_tag LOCUS_21350 gene ptsH 40302 40030 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_21350 41172 40315 gene locus_tag LOCUS_21360 41172 40315 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_21360 41648 41184 gene locus_tag LOCUS_21370 gene ptsN 41648 41184 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_21370 41972 41664 gene locus_tag LOCUS_21380 41972 41664 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_21380 43635 42166 gene locus_tag LOCUS_21390 gene rpoN 43635 42166 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_21390 44537 43812 gene locus_tag LOCUS_21400 44537 43812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_21400 45082 44540 gene locus_tag LOCUS_21410 gene lptA 45082 44540 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV7 protein_id gnl|my_center|LOCUS_21410 45638 45069 gene locus_tag LOCUS_21420 gene lptC 45638 45069 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU3 protein_id gnl|my_center|LOCUS_21420 46171 45647 gene locus_tag LOCUS_21430 46171 45647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_21430 47145 46171 gene locus_tag LOCUS_21440 47145 46171 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV0 protein_id gnl|my_center|LOCUS_21440 47393 48202 gene locus_tag LOCUS_21450 47393 48202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_21450 48202 48999 gene locus_tag LOCUS_21460 48202 48999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_21460 48999 49469 gene locus_tag LOCUS_21470 48999 49469 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_21470 49485 50117 gene locus_tag LOCUS_21480 49485 50117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_21480 50114 50422 gene locus_tag LOCUS_21490 50114 50422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112744.1 protein_id gnl|my_center|LOCUS_21490 50544 50783 gene locus_tag LOCUS_21500 50544 50783 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_21500 50806 52071 gene locus_tag LOCUS_21510 gene murA 50806 52071 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_21510 52165 52800 gene locus_tag LOCUS_21520 gene hisG 52165 52800 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_21520 52923 54233 gene locus_tag LOCUS_21530 gene hisD 52923 54233 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_21530 54295 55347 gene locus_tag LOCUS_21540 gene hisC1 54295 55347 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_21540 56139 55414 gene locus_tag LOCUS_21550 56139 55414 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 protein_id gnl|my_center|LOCUS_21550 58247 56154 gene locus_tag LOCUS_21560 58247 56154 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267526.1 protein_id gnl|my_center|LOCUS_21560 59467 58325 gene locus_tag LOCUS_21570 59467 58325 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_21570 59579 60337 gene locus_tag LOCUS_21580 59579 60337 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV9 protein_id gnl|my_center|LOCUS_21580 60479 61396 gene locus_tag LOCUS_21590 gene cysD 60479 61396 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50273 protein_id gnl|my_center|LOCUS_21590 61398 63296 gene locus_tag LOCUS_21600 gene C 61398 63296 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW1 protein_id gnl|my_center|LOCUS_21600 63926 63489 gene locus_tag LOCUS_21610 63926 63489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_21610 64067 64696 gene locus_tag LOCUS_21620 64067 64696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268854.1 protein_id gnl|my_center|LOCUS_21620 64737 66083 gene locus_tag LOCUS_21630 gene trpS 64737 66083 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX6 protein_id gnl|my_center|LOCUS_21630 66256 67350 gene locus_tag LOCUS_21640 gene zapE 66256 67350 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_21640 68447 67410 gene locus_tag LOCUS_21650 68447 67410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112749.1 protein_id gnl|my_center|LOCUS_21650 69506 68502 gene locus_tag LOCUS_21660 69506 68502 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 protein_id gnl|my_center|LOCUS_21660 69701 70837 gene locus_tag LOCUS_21670 69701 70837 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_21670 71921 70884 gene locus_tag LOCUS_21680 71921 70884 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_21680 72169 72597 gene locus_tag LOCUS_21690 gene rplM 72169 72597 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_21690 72612 73004 gene locus_tag LOCUS_21700 gene rpsI 72612 73004 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW8 protein_id gnl|my_center|LOCUS_21700 73259 73852 gene locus_tag LOCUS_21710 73259 73852 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_21710 73852 75063 gene locus_tag LOCUS_21720 73852 75063 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_21720 75099 75842 gene locus_tag LOCUS_21730 75099 75842 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_21730 75932 76549 gene locus_tag LOCUS_21740 gene sspA 75932 76549 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766548.1 protein_id gnl|my_center|LOCUS_21740 76567 76971 gene locus_tag LOCUS_21750 gene sspB 76567 76971 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_21750 77555 77022 gene locus_tag LOCUS_21760 77555 77022 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 protein_id gnl|my_center|LOCUS_21760 78145 77552 gene locus_tag LOCUS_21770 gene gmhA 78145 77552 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_21770 78550 78176 gene locus_tag LOCUS_21780 78550 78176 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_21780 80358 78547 gene locus_tag LOCUS_21790 80358 78547 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 protein_id gnl|my_center|LOCUS_21790 80622 81494 gene locus_tag LOCUS_21800 gene rsmI 80622 81494 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX5 protein_id gnl|my_center|LOCUS_21800 82308 82658 gene locus_tag LOCUS_21810 gene mraZ 82308 82658 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY1 protein_id gnl|my_center|LOCUS_21810 82661 83602 gene locus_tag LOCUS_21820 gene rsmH 82661 83602 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_21820 83599 83922 gene locus_tag LOCUS_21830 gene ftsL 83599 83922 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX8 protein_id gnl|my_center|LOCUS_21830 83919 85652 gene locus_tag LOCUS_21840 gene ftsI 83919 85652 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_21840 85652 87115 gene locus_tag LOCUS_21850 gene murE 85652 87115 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_21850 87108 88487 gene locus_tag LOCUS_21860 gene murF 87108 88487 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_21860 88488 89570 gene locus_tag LOCUS_21870 gene mraY 88488 89570 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_21870 89578 90924 gene locus_tag LOCUS_21880 gene murD 89578 90924 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 protein_id gnl|my_center|LOCUS_21880 90924 92180 gene locus_tag LOCUS_21890 gene ftsW 90924 92180 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_21890 92170 93240 gene locus_tag LOCUS_21900 gene murG 92170 93240 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_21900 93233 94690 gene locus_tag LOCUS_21910 gene murC 93233 94690 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ1 protein_id gnl|my_center|LOCUS_21910 94687 95637 gene locus_tag LOCUS_21920 gene ddl 94687 95637 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_21920 95641 96498 gene locus_tag LOCUS_21930 gene ftsQ 95641 96498 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY8 protein_id gnl|my_center|LOCUS_21930 96519 97766 gene locus_tag LOCUS_21940 gene ftsA 96519 97766 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_21940 97809 98993 gene locus_tag LOCUS_21950 gene ftsZ 97809 98993 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_21950 99106 100017 gene locus_tag LOCUS_21960 gene lpxC 99106 100017 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_21960 100582 100127 gene locus_tag LOCUS_21970 100582 100127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105002.1 protein_id gnl|my_center|LOCUS_21970 100664 101590 gene locus_tag LOCUS_21980 100664 101590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_21980 101709 104444 gene locus_tag LOCUS_21990 gene secA 101709 104444 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ3 protein_id gnl|my_center|LOCUS_21990 104583 105800 gene locus_tag LOCUS_22000 gene argJ 104583 105800 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_22000 105924 106556 gene locus_tag LOCUS_22010 105924 106556 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_22010 106553 107494 gene locus_tag LOCUS_22020 106553 107494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_22020 107564 108673 gene locus_tag LOCUS_22030 107564 108673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528269.1 protein_id gnl|my_center|LOCUS_22030 109593 108643 gene locus_tag LOCUS_22040 109593 108643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 protein_id gnl|my_center|LOCUS_22040 109660 110589 gene locus_tag LOCUS_22050 109660 110589 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_22050 111298 110552 gene locus_tag LOCUS_22060 111298 110552 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768589.1 protein_id gnl|my_center|LOCUS_22060 113267 111288 gene locus_tag LOCUS_22070 113267 111288 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_22070 113391 114074 gene locus_tag LOCUS_22080 113391 114074 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_22080 114064 115338 gene locus_tag LOCUS_22090 114064 115338 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_22090 115457 116146 gene locus_tag LOCUS_22100 115457 116146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094031.1 protein_id gnl|my_center|LOCUS_22100 116148 116864 gene locus_tag LOCUS_22110 gene inaA 116148 116864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094029.1 protein_id gnl|my_center|LOCUS_22110 116861 117256 gene locus_tag LOCUS_22120 gene dgkA 116861 117256 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 protein_id gnl|my_center|LOCUS_22120 117355 118218 gene locus_tag LOCUS_22130 117355 118218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_22130 118980 118396 gene locus_tag LOCUS_22140 118980 118396 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_22140 120992 118983 gene locus_tag LOCUS_22150 120992 118983 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 protein_id gnl|my_center|LOCUS_22150 121949 121041 gene locus_tag LOCUS_22160 gene panE 121949 121041 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW09 protein_id gnl|my_center|LOCUS_22160 122927 121962 gene locus_tag LOCUS_22170 122927 121962 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_22170 123076 123555 gene locus_tag LOCUS_22180 123076 123555 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP05 protein_id gnl|my_center|LOCUS_22180 123689 124522 gene locus_tag LOCUS_22190 123689 124522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_22190 126265 124721 gene locus_tag LOCUS_22200 126265 124721 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768580.1 protein_id gnl|my_center|LOCUS_22200 126623 126309 gene locus_tag LOCUS_22210 126623 126309 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 protein_id gnl|my_center|LOCUS_22210 126700 127698 gene locus_tag LOCUS_22220 126700 127698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120893.1 protein_id gnl|my_center|LOCUS_22220 127871 128821 gene locus_tag LOCUS_22230 127871 128821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_22230 129762 129004 gene locus_tag LOCUS_22240 gene speA 129762 129004 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_22240 129865 130596 gene locus_tag LOCUS_22250 129865 130596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_22250 130660 131124 gene locus_tag LOCUS_22260 130660 131124 CDS product phage exclusion suppressor FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_22260 131491 131784 gene locus_tag LOCUS_22270 gene groS 131491 131784 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X13 protein_id gnl|my_center|LOCUS_22270 131841 133490 gene locus_tag LOCUS_22280 gene groL 131841 133490 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_22280 134016 134240 gene locus_tag LOCUS_22290 134016 134240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268826.1 protein_id gnl|my_center|LOCUS_22290 137378 134325 gene locus_tag LOCUS_22300 137378 134325 CDS product MexW/MexI family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_22300 138554 137406 gene locus_tag LOCUS_22310 138554 137406 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_22310 140446 138824 gene locus_tag LOCUS_22320 140446 138824 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104059.1 protein_id gnl|my_center|LOCUS_22320 141731 140601 gene locus_tag LOCUS_22330 141731 140601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268825.1 protein_id gnl|my_center|LOCUS_22330 142796 141735 gene locus_tag LOCUS_22340 142796 141735 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268824.1 protein_id gnl|my_center|LOCUS_22340 144231 142807 gene locus_tag LOCUS_22350 144231 142807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_22350 145734 144400 gene locus_tag LOCUS_22360 145734 144400 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246223.1 protein_id gnl|my_center|LOCUS_22360 145951 146523 gene locus_tag LOCUS_22370 145951 146523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_22370 146527 147423 gene locus_tag LOCUS_22380 146527 147423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence13 284 54 gene locus_tag LOCUS_22390 284 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 371 973 gene locus_tag LOCUS_22400 371 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1299 928 gene locus_tag LOCUS_22410 1299 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3616 1907 gene locus_tag LOCUS_22420 3616 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3830 3630 gene locus_tag LOCUS_22430 3830 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4084 6009 gene locus_tag LOCUS_22440 4084 6009 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3T9 protein_id gnl|my_center|LOCUS_22440 6979 6062 gene locus_tag LOCUS_22450 6979 6062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 protein_id gnl|my_center|LOCUS_22450 7101 7898 gene locus_tag LOCUS_22460 7101 7898 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 protein_id gnl|my_center|LOCUS_22460 9112 7916 gene locus_tag LOCUS_22470 gene araJ 9112 7916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 protein_id gnl|my_center|LOCUS_22470 10025 9414 gene locus_tag LOCUS_22480 10025 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065048.1 protein_id gnl|my_center|LOCUS_22480 11259 10186 gene locus_tag LOCUS_22490 11259 10186 CDS product cell adhesion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966829.1 protein_id gnl|my_center|LOCUS_22490 12962 11352 gene locus_tag LOCUS_22500 12962 11352 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_22500 13346 14473 gene locus_tag LOCUS_22510 13346 14473 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_22510 14473 15084 gene locus_tag LOCUS_22520 14473 15084 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_22520 15078 15308 gene locus_tag LOCUS_22530 15078 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 15572 15865 gene locus_tag LOCUS_22540 15572 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 15866 16729 gene locus_tag LOCUS_22550 15866 16729 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYW0 protein_id gnl|my_center|LOCUS_22550 16726 17433 gene locus_tag LOCUS_22560 16726 17433 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_22560 17461 18057 gene locus_tag LOCUS_22570 17461 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_22570 18371 19669 gene locus_tag LOCUS_22580 gene oprO 18371 19669 CDS product porin O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32977 protein_id gnl|my_center|LOCUS_22580 19752 20141 gene locus_tag LOCUS_22590 19752 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22590 20166 20675 gene locus_tag LOCUS_22600 20166 20675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 20780 21904 gene locus_tag LOCUS_22610 20780 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_22610 22531 22031 gene locus_tag LOCUS_22620 22531 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_22620 24461 22629 gene locus_tag LOCUS_22630 24461 22629 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_22630 25133 24579 gene locus_tag LOCUS_22640 gene ppiA 25133 24579 CDS product peptidyl-prolyl cis-trans isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59641 protein_id gnl|my_center|LOCUS_22640 25952 25146 gene locus_tag LOCUS_22650 25952 25146 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_22650 26892 25966 gene locus_tag LOCUS_22660 26892 25966 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 protein_id gnl|my_center|LOCUS_22660 26978 27292 gene locus_tag LOCUS_22670 26978 27292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091533.1 protein_id gnl|my_center|LOCUS_22670 27467 28066 gene locus_tag LOCUS_22680 gene azoR3 27467 28066 CDS product FMN-dependent NADH-azoreductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ17 protein_id gnl|my_center|LOCUS_22680 28630 29523 gene locus_tag LOCUS_22690 gene rarD 28630 29523 CDS product chloramphenicol-sensitive protein RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68827 protein_id gnl|my_center|LOCUS_22690 29939 29526 gene locus_tag LOCUS_22700 29939 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 30114 31466 gene locus_tag LOCUS_22710 30114 31466 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402477.1 protein_id gnl|my_center|LOCUS_22710 32546 31566 gene locus_tag LOCUS_22720 32546 31566 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_22720 34608 32827 gene locus_tag LOCUS_22730 34608 32827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086721.1 protein_id gnl|my_center|LOCUS_22730 34794 34961 gene locus_tag LOCUS_22740 34794 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 35097 35819 gene locus_tag LOCUS_22750 35097 35819 CDS product polar amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_22750 35975 37123 gene locus_tag LOCUS_22760 35975 37123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_22760 39358 37145 gene locus_tag LOCUS_22770 39358 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112497.1 protein_id gnl|my_center|LOCUS_22770 39787 39599 gene locus_tag LOCUS_22780 39787 39599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719741.1 protein_id gnl|my_center|LOCUS_22780 40111 40953 gene locus_tag LOCUS_22790 40111 40953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 protein_id gnl|my_center|LOCUS_22790 41086 41161 gene locus_tag LOCUS_t00260 41086 41161 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41305 41622 gene locus_tag LOCUS_22800 41305 41622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 42103 41666 gene locus_tag LOCUS_22810 42103 41666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 42905 42225 gene locus_tag LOCUS_22820 gene msrA 42905 42225 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_22820 43432 42908 gene locus_tag LOCUS_22830 43432 42908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 43870 44181 gene locus_tag LOCUS_22840 43870 44181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_22840 44178 45836 gene locus_tag LOCUS_22850 44178 45836 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_22850 47035 45992 gene locus_tag LOCUS_22860 47035 45992 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_22860 47655 47227 gene locus_tag LOCUS_22870 47655 47227 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268641.1 protein_id gnl|my_center|LOCUS_22870 48187 48978 gene locus_tag LOCUS_22880 48187 48978 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_22880 49002 50534 gene locus_tag LOCUS_22890 49002 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 50646 51512 gene locus_tag LOCUS_22900 50646 51512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 51778 51542 gene locus_tag LOCUS_22910 51778 51542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 52593 51976 gene locus_tag LOCUS_22920 52593 51976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 53490 52789 gene locus_tag LOCUS_22930 53490 52789 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS10 protein_id gnl|my_center|LOCUS_22930 53941 53681 gene locus_tag LOCUS_22940 53941 53681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 54793 54059 gene locus_tag LOCUS_22950 54793 54059 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_22950 55370 55089 gene locus_tag LOCUS_22960 55370 55089 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_22960 55594 55935 gene locus_tag LOCUS_22970 55594 55935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 56409 56044 gene locus_tag LOCUS_22980 56409 56044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 56810 56511 gene locus_tag LOCUS_22990 56810 56511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 56995 57846 gene locus_tag LOCUS_23000 56995 57846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112483.1 protein_id gnl|my_center|LOCUS_23000 58588 58007 gene locus_tag LOCUS_23010 58588 58007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 protein_id gnl|my_center|LOCUS_23010 58742 59047 gene locus_tag LOCUS_23020 58742 59047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 59146 59745 gene locus_tag LOCUS_23030 59146 59745 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_23030 61782 60412 gene locus_tag LOCUS_23040 61782 60412 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_23040 62748 62062 gene locus_tag LOCUS_23050 62748 62062 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 protein_id gnl|my_center|LOCUS_23050 62919 63662 gene locus_tag LOCUS_23060 62919 63662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_23060 64787 64257 gene locus_tag LOCUS_23070 64787 64257 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_23070 65986 64934 gene locus_tag LOCUS_23080 65986 64934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 67195 68067 gene locus_tag LOCUS_23090 67195 68067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 69341 68091 gene locus_tag LOCUS_23100 69341 68091 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ19 protein_id gnl|my_center|LOCUS_23100 72704 69798 gene locus_tag LOCUS_23110 gene nrdA 72704 69798 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886B0 protein_id gnl|my_center|LOCUS_23110 73389 74156 gene locus_tag LOCUS_23120 73389 74156 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_23120 74153 75757 gene locus_tag LOCUS_23130 74153 75757 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_23130 76556 75921 gene locus_tag LOCUS_23140 gene rluA 76556 75921 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770474.1 protein_id gnl|my_center|LOCUS_23140 76986 76732 gene locus_tag LOCUS_23150 gene minE 76986 76732 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC6 protein_id gnl|my_center|LOCUS_23150 77798 76986 gene locus_tag LOCUS_23160 gene minD 77798 76986 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_23160 78638 77898 gene locus_tag LOCUS_23170 gene minC 78638 77898 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 protein_id gnl|my_center|LOCUS_23170 78773 79723 gene locus_tag LOCUS_23180 gene lpxL 78773 79723 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_23180 79768 80970 gene locus_tag LOCUS_23190 79768 80970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_23190 81312 82532 gene locus_tag LOCUS_23200 gene argD1 81312 82532 CDS product acetylornithine aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K0 protein_id gnl|my_center|LOCUS_23200 82668 83684 gene locus_tag LOCUS_23210 gene astA 82668 83684 CDS product arginine N-succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80357 protein_id gnl|my_center|LOCUS_23210 83694 84713 gene locus_tag LOCUS_23220 gene aruG 83694 84713 CDS product arginine N-succinyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80358 protein_id gnl|my_center|LOCUS_23220 84786 86249 gene locus_tag LOCUS_23230 gene astD 84786 86249 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50174 protein_id gnl|my_center|LOCUS_23230 86249 87595 gene locus_tag LOCUS_23240 gene astB 86249 87595 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50175 protein_id gnl|my_center|LOCUS_23240 87677 87964 gene locus_tag LOCUS_23250 87677 87964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314741.1 protein_id gnl|my_center|LOCUS_23250 87975 88985 gene locus_tag LOCUS_23260 gene astE 87975 88985 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885J4 protein_id gnl|my_center|LOCUS_23260 89166 90167 gene locus_tag LOCUS_23270 89166 90167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_23270 90353 92977 gene locus_tag LOCUS_23280 gene alaS 90353 92977 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_23280 93090 94328 gene locus_tag LOCUS_23290 93090 94328 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_23290 94514 94699 gene locus_tag LOCUS_23300 gene csrA 94514 94699 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_23300 94762 94852 gene locus_tag LOCUS_t00270 94762 94852 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 94962 95038 gene locus_tag LOCUS_t00280 94962 95038 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 95112 95188 gene locus_tag LOCUS_t00290 95112 95188 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 95737 95246 gene locus_tag LOCUS_23310 95737 95246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245069.1 protein_id gnl|my_center|LOCUS_23310 96062 97504 gene locus_tag LOCUS_23320 96062 97504 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI8 protein_id gnl|my_center|LOCUS_23320 97701 97952 gene locus_tag LOCUS_23330 97701 97952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 97978 99750 gene locus_tag LOCUS_23340 97978 99750 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_23340 99762 100898 gene locus_tag LOCUS_23350 99762 100898 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_23350 101306 100989 gene locus_tag LOCUS_23360 101306 100989 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554423.1 protein_id gnl|my_center|LOCUS_23360 101714 102547 gene locus_tag LOCUS_23370 gene phnC2 101714 102547 CDS product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882S0 protein_id gnl|my_center|LOCUS_23370 102603 103607 gene locus_tag LOCUS_23380 102603 103607 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_23380 103674 104468 gene locus_tag LOCUS_23390 gene phnE 103674 104468 CDS product phosphonate transporter PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_23390 104506 105210 gene locus_tag LOCUS_23400 104506 105210 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113121.1 protein_id gnl|my_center|LOCUS_23400 105225 105671 gene locus_tag LOCUS_23410 105225 105671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 protein_id gnl|my_center|LOCUS_23410 105671 106282 gene locus_tag LOCUS_23420 105671 106282 CDS product carbon-phosphorus lyase complex subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 protein_id gnl|my_center|LOCUS_23420 106282 107373 gene locus_tag LOCUS_23430 106282 107373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_23430 107370 108248 gene locus_tag LOCUS_23440 107370 108248 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM4 protein_id gnl|my_center|LOCUS_23440 108245 109054 gene locus_tag LOCUS_23450 108245 109054 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 protein_id gnl|my_center|LOCUS_23450 109171 109884 gene locus_tag LOCUS_23460 109171 109884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098702.1 protein_id gnl|my_center|LOCUS_23460 109874 111019 gene locus_tag LOCUS_23470 109874 111019 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104087.1 protein_id gnl|my_center|LOCUS_23470 111019 111612 gene locus_tag LOCUS_23480 gene phnN 111019 111612 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM8 protein_id gnl|my_center|LOCUS_23480 111603 112367 gene locus_tag LOCUS_23490 111603 112367 CDS product carbon-phosphorus lyase complex accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_23490 112364 113269 gene locus_tag LOCUS_23500 112364 113269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence14 6345 5779 gene locus_tag LOCUS_23510 6345 5779 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389207.1 protein_id gnl|my_center|LOCUS_23510 6806 6492 gene locus_tag LOCUS_23520 6806 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7422 6811 gene locus_tag LOCUS_23530 7422 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 9812 7716 gene locus_tag LOCUS_23540 9812 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 11132 9813 gene locus_tag LOCUS_23550 11132 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 11920 11129 gene locus_tag LOCUS_23560 11920 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 13034 12045 gene locus_tag LOCUS_23570 13034 12045 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_23570 15623 13320 gene locus_tag LOCUS_23580 gene metE 15623 13320 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_23580 15840 16757 gene locus_tag LOCUS_23590 gene metR 15840 16757 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764812.1 protein_id gnl|my_center|LOCUS_23590 18115 16793 gene locus_tag LOCUS_23600 18115 16793 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_23600 19048 18233 gene locus_tag LOCUS_23610 19048 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092205.1 protein_id gnl|my_center|LOCUS_23610 19198 19986 gene locus_tag LOCUS_23620 19198 19986 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092207.1 protein_id gnl|my_center|LOCUS_23620 20081 20821 gene locus_tag LOCUS_23630 20081 20821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 22012 21191 gene locus_tag LOCUS_23640 22012 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619515.1 protein_id gnl|my_center|LOCUS_23640 22517 22098 gene locus_tag LOCUS_23650 22517 22098 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087011.1 protein_id gnl|my_center|LOCUS_23650 23220 22534 gene locus_tag LOCUS_23660 23220 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 23362 26469 gene locus_tag LOCUS_23670 23362 26469 CDS product glycosyl transferase family 51 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104904.1 protein_id gnl|my_center|LOCUS_23670 26847 26626 gene locus_tag LOCUS_23680 26847 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 27350 27060 gene locus_tag LOCUS_23690 27350 27060 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_23690 29467 27968 gene locus_tag LOCUS_23700 gene putP 29467 27968 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_23700 32909 29730 gene locus_tag LOCUS_23710 gene putA 32909 29730 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F6 protein_id gnl|my_center|LOCUS_23710 34696 33143 gene locus_tag LOCUS_23720 34696 33143 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_23720 34883 36064 gene locus_tag LOCUS_23730 gene hmp 34883 36064 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H4 protein_id gnl|my_center|LOCUS_23730 36542 36123 gene locus_tag LOCUS_23740 36542 36123 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_23740 37405 36545 gene locus_tag LOCUS_23750 37405 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_23750 39752 37413 gene locus_tag LOCUS_23760 39752 37413 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 protein_id gnl|my_center|LOCUS_23760 40431 39739 gene locus_tag LOCUS_23770 40431 39739 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_23770 41381 40629 gene locus_tag LOCUS_23780 gene pruR 41381 40629 CDS product proline utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_23780 41615 44011 gene locus_tag LOCUS_23790 gene lon 41615 44011 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_23790 44127 44519 gene locus_tag LOCUS_23800 44127 44519 CDS product peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405351.1 protein_id gnl|my_center|LOCUS_23800 46293 44599 gene locus_tag LOCUS_23810 46293 44599 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036487.1 protein_id gnl|my_center|LOCUS_23810 46478 47131 gene locus_tag LOCUS_23820 46478 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 47201 47773 gene locus_tag LOCUS_23830 47201 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_23830 47830 48687 gene locus_tag LOCUS_23840 gene cmoA 47830 48687 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE6 protein_id gnl|my_center|LOCUS_23840 48684 49652 gene locus_tag LOCUS_23850 gene cmoB 48684 49652 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE5 protein_id gnl|my_center|LOCUS_23850 50491 49745 gene locus_tag LOCUS_23860 gene pdxJ 50491 49745 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG4 protein_id gnl|my_center|LOCUS_23860 51176 50484 gene locus_tag LOCUS_23870 gene recO 51176 50484 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE3 protein_id gnl|my_center|LOCUS_23870 52140 51238 gene locus_tag LOCUS_23880 gene era 52140 51238 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG2 protein_id gnl|my_center|LOCUS_23880 52822 52133 gene locus_tag LOCUS_23890 gene rnc 52822 52133 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG1 protein_id gnl|my_center|LOCUS_23890 53196 52819 gene locus_tag LOCUS_23900 53196 52819 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 protein_id gnl|my_center|LOCUS_23900 54157 53303 gene locus_tag LOCUS_23910 gene lepB 54157 53303 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_23910 55962 54163 gene locus_tag LOCUS_23920 gene lepA 55962 54163 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD8 protein_id gnl|my_center|LOCUS_23920 57543 56113 gene locus_tag LOCUS_23930 57543 56113 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_23930 58027 57575 gene locus_tag LOCUS_23940 gene mucC 58027 57575 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_23940 58977 58024 gene locus_tag LOCUS_23950 gene mucB 58977 58024 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_23950 59576 58986 gene locus_tag LOCUS_23960 59576 58986 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405339.1 protein_id gnl|my_center|LOCUS_23960 60189 59608 gene locus_tag LOCUS_23970 60189 59608 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_23970 60553 62184 gene locus_tag LOCUS_23980 60553 62184 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD3 protein_id gnl|my_center|LOCUS_23980 62605 62153 gene locus_tag LOCUS_23990 62605 62153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268756.1 protein_id gnl|my_center|LOCUS_23990 62843 62589 gene locus_tag LOCUS_24000 62843 62589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_24000 63040 63981 gene locus_tag LOCUS_24010 63040 63981 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD0 protein_id gnl|my_center|LOCUS_24010 64019 64855 gene locus_tag LOCUS_24020 64019 64855 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_24020 65026 65781 gene locus_tag LOCUS_24030 65026 65781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_24030 67173 65782 gene locus_tag LOCUS_24040 67173 65782 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_24040 67837 67166 gene locus_tag LOCUS_24050 67837 67166 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085524.1 protein_id gnl|my_center|LOCUS_24050 68075 69340 gene locus_tag LOCUS_24060 gene opdH 68075 69340 CDS product cis-aconitate porin Opd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 protein_id gnl|my_center|LOCUS_24060 69512 70489 gene locus_tag LOCUS_24070 69512 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_24070 70705 71148 gene locus_tag LOCUS_24080 70705 71148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114175.1 protein_id gnl|my_center|LOCUS_24080 71150 72658 gene locus_tag LOCUS_24090 71150 72658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_24090 72651 73685 gene locus_tag LOCUS_24100 72651 73685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 protein_id gnl|my_center|LOCUS_24100 73839 74705 gene locus_tag LOCUS_24110 73839 74705 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103617.1 protein_id gnl|my_center|LOCUS_24110 75394 74702 gene locus_tag LOCUS_24120 gene ung 75394 74702 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H9 protein_id gnl|my_center|LOCUS_24120 75695 76717 gene locus_tag LOCUS_24130 75695 76717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 76853 77056 gene locus_tag LOCUS_24140 76853 77056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 78199 77318 gene locus_tag LOCUS_24150 gene mmsR 78199 77318 CDS product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 protein_id gnl|my_center|LOCUS_24150 78497 79990 gene locus_tag LOCUS_24160 78497 79990 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_24160 80093 81340 gene locus_tag LOCUS_24170 80093 81340 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_24170 81347 82513 gene locus_tag LOCUS_24180 81347 82513 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 protein_id gnl|my_center|LOCUS_24180 82667 83485 gene locus_tag LOCUS_24190 82667 83485 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_24190 83678 84781 gene locus_tag LOCUS_24200 83678 84781 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_24200 84902 85786 gene locus_tag LOCUS_24210 84902 85786 CDS product NAD-dependent L-serine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5I6 protein_id gnl|my_center|LOCUS_24210 85894 86232 gene locus_tag LOCUS_24220 85894 86232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 86693 86454 gene locus_tag LOCUS_24230 86693 86454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085479.1 protein_id gnl|my_center|LOCUS_24230 88592 86805 gene locus_tag LOCUS_24240 88592 86805 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919414.1 protein_id gnl|my_center|LOCUS_24240 88689 89609 gene locus_tag LOCUS_24250 88689 89609 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_24250 90100 89639 gene locus_tag LOCUS_24260 90100 89639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 90552 91628 gene locus_tag LOCUS_24270 90552 91628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764738.1 protein_id gnl|my_center|LOCUS_24270 91999 93066 gene locus_tag LOCUS_24280 91999 93066 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_24280 93166 93981 gene locus_tag LOCUS_24290 93166 93981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_24290 93978 94760 gene locus_tag LOCUS_24300 93978 94760 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_24300 94771 95499 gene locus_tag LOCUS_24310 94771 95499 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_24310 95512 96147 gene locus_tag LOCUS_24320 95512 96147 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_24320 96391 100170 gene locus_tag LOCUS_24330 96391 100170 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 protein_id gnl|my_center|LOCUS_24330 100286 102091 gene locus_tag LOCUS_24340 100286 102091 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268766.1 protein_id gnl|my_center|LOCUS_24340 102266 103738 gene locus_tag LOCUS_24350 102266 103738 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_24350 104018 104710 gene locus_tag LOCUS_24360 gene rsuA 104018 104710 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5J6 protein_id gnl|my_center|LOCUS_24360 105120 106004 gene locus_tag LOCUS_24370 gene phaG 105120 106004 CDS product (R)-3-hydroxydecanoyl-ACP:CoA transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51553 protein_id gnl|my_center|LOCUS_24370 106103 106176 gene locus_tag LOCUS_t00300 106103 106176 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 106786 106487 gene locus_tag LOCUS_24380 106786 106487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 107108 106947 gene locus_tag LOCUS_24390 107108 106947 CDS product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266868.1 protein_id gnl|my_center|LOCUS_24390 107523 107227 gene locus_tag LOCUS_24400 107523 107227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 108177 109157 gene locus_tag LOCUS_24410 108177 109157 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266184.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence15 1552 479 gene locus_tag LOCUS_24420 1552 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2887 1556 gene locus_tag LOCUS_24430 gene dgt2 2887 1556 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG5 protein_id gnl|my_center|LOCUS_24430 3742 5421 gene locus_tag LOCUS_24440 gene cotA 3742 5421 CDS product spore coat protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07788 protein_id gnl|my_center|LOCUS_24440 5491 6111 gene locus_tag LOCUS_24450 5491 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 7165 6230 gene locus_tag LOCUS_24460 7165 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 8922 7759 gene locus_tag LOCUS_24470 gene rtn 8922 7759 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 protein_id gnl|my_center|LOCUS_24470 9344 9009 gene locus_tag LOCUS_24480 9344 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 9724 9341 gene locus_tag LOCUS_24490 9724 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091263.1 protein_id gnl|my_center|LOCUS_24490 10053 9736 gene locus_tag LOCUS_24500 10053 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091262.1 protein_id gnl|my_center|LOCUS_24500 10440 11648 gene locus_tag LOCUS_24510 10440 11648 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_24510 13179 11932 gene locus_tag LOCUS_24520 13179 11932 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_24520 14181 13315 gene locus_tag LOCUS_24530 14181 13315 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_24530 15113 14184 gene locus_tag LOCUS_24540 15113 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113965.1 protein_id gnl|my_center|LOCUS_24540 15731 15135 gene locus_tag LOCUS_24550 15731 15135 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_24550 15879 16436 gene locus_tag LOCUS_24560 15879 16436 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_24560 16615 17772 gene locus_tag LOCUS_24570 16615 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 17811 18053 gene locus_tag LOCUS_24580 17811 18053 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_24580 18163 19047 gene locus_tag LOCUS_24590 18163 19047 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408993.1 protein_id gnl|my_center|LOCUS_24590 19436 19360 gene locus_tag LOCUS_t00310 19436 19360 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19511 19732 gene locus_tag LOCUS_24600 19511 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 19870 19649 gene locus_tag LOCUS_24610 19870 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_24610 20542 19970 gene locus_tag LOCUS_24620 gene mobA 20542 19970 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUJ4 protein_id gnl|my_center|LOCUS_24620 20611 21150 gene locus_tag LOCUS_24630 gene moaB2 20611 21150 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_24630 21147 22361 gene locus_tag LOCUS_24640 21147 22361 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_24640 23461 22439 gene locus_tag LOCUS_24650 23461 22439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_24650 23591 25186 gene locus_tag LOCUS_24660 23591 25186 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_24660 25189 26772 gene locus_tag LOCUS_24670 25189 26772 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_24670 26827 28386 gene locus_tag LOCUS_24680 26827 28386 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_24680 29139 28441 gene locus_tag LOCUS_24690 29139 28441 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_24690 29397 30293 gene locus_tag LOCUS_24700 29397 30293 CDS product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI3 protein_id gnl|my_center|LOCUS_24700 30441 31376 gene locus_tag LOCUS_24710 30441 31376 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_24710 32036 31551 gene locus_tag LOCUS_24720 32036 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_24720 32035 32838 gene locus_tag LOCUS_24730 32035 32838 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268341.1 protein_id gnl|my_center|LOCUS_24730 34827 32899 gene locus_tag LOCUS_24740 34827 32899 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268340.1 protein_id gnl|my_center|LOCUS_24740 35145 37067 gene locus_tag LOCUS_24750 35145 37067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245346.1 protein_id gnl|my_center|LOCUS_24750 37131 37817 gene locus_tag LOCUS_24760 37131 37817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_24760 38303 37863 gene locus_tag LOCUS_24770 38303 37863 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_24770 38391 38828 gene locus_tag LOCUS_24780 38391 38828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109487.1 protein_id gnl|my_center|LOCUS_24780 39758 38937 gene locus_tag LOCUS_24790 39758 38937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119795.1 protein_id gnl|my_center|LOCUS_24790 40239 42386 gene locus_tag LOCUS_24800 gene fadB 40239 42386 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_24800 42417 43592 gene locus_tag LOCUS_24810 gene fadA 42417 43592 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ3 protein_id gnl|my_center|LOCUS_24810 43746 43982 gene locus_tag LOCUS_24820 43746 43982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_24820 44108 46717 gene locus_tag LOCUS_24830 gene topA 44108 46717 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA3 protein_id gnl|my_center|LOCUS_24830 46789 47307 gene locus_tag LOCUS_24840 46789 47307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113979.1 protein_id gnl|my_center|LOCUS_24840 47385 47618 gene locus_tag LOCUS_24850 47385 47618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109483.1 protein_id gnl|my_center|LOCUS_24850 48205 47732 gene locus_tag LOCUS_24860 48205 47732 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA6 protein_id gnl|my_center|LOCUS_24860 48827 48216 gene locus_tag LOCUS_24870 gene lexA1 48827 48216 CDS product LexA repressor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB9 protein_id gnl|my_center|LOCUS_24870 49096 49803 gene locus_tag LOCUS_24880 49096 49803 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_24880 49851 50375 gene locus_tag LOCUS_24890 49851 50375 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_24890 50397 51395 gene locus_tag LOCUS_24900 gene nagZ 50397 51395 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK0 protein_id gnl|my_center|LOCUS_24900 51407 52144 gene locus_tag LOCUS_24910 51407 52144 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_24910 52752 52213 gene locus_tag LOCUS_24920 52752 52213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_24920 56240 52764 gene locus_tag LOCUS_24930 gene mfd 56240 52764 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_24930 56429 57814 gene locus_tag LOCUS_24940 56429 57814 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK4 protein_id gnl|my_center|LOCUS_24940 58439 57879 gene locus_tag LOCUS_24950 58439 57879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_24950 58840 60051 gene locus_tag LOCUS_24960 gene nqrA 58840 60051 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_24960 60055 61266 gene locus_tag LOCUS_24970 gene nqrB 60055 61266 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_24970 61259 62047 gene locus_tag LOCUS_24980 gene nqrC 61259 62047 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_24980 62050 62718 gene locus_tag LOCUS_24990 gene nqrD 62050 62718 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_24990 62718 63326 gene locus_tag LOCUS_25000 gene nqrE 62718 63326 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_25000 63342 64568 gene locus_tag LOCUS_25010 gene nqrF 63342 64568 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_25010 64673 65596 gene locus_tag LOCUS_25020 64673 65596 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL2 protein_id gnl|my_center|LOCUS_25020 65593 65823 gene locus_tag LOCUS_25030 65593 65823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_25030 65947 67341 gene locus_tag LOCUS_25040 gene sthA 65947 67341 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884I6 protein_id gnl|my_center|LOCUS_25040 68237 67515 gene locus_tag LOCUS_25050 68237 67515 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405702.1 protein_id gnl|my_center|LOCUS_25050 68536 68234 gene locus_tag LOCUS_25060 68536 68234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 69129 68545 gene locus_tag LOCUS_25070 69129 68545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251679.2 protein_id gnl|my_center|LOCUS_25070 69367 70617 gene locus_tag LOCUS_25080 69367 70617 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_25080 70625 71308 gene locus_tag LOCUS_25090 gene lolD 70625 71308 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV73 protein_id gnl|my_center|LOCUS_25090 71308 72552 gene locus_tag LOCUS_25100 71308 72552 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405690.1 protein_id gnl|my_center|LOCUS_25100 73137 72610 gene locus_tag LOCUS_25110 73137 72610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_25110 73278 75503 gene locus_tag LOCUS_25120 73278 75503 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_25120 75576 76208 gene locus_tag LOCUS_25130 75576 76208 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_25130 76205 76633 gene locus_tag LOCUS_25140 76205 76633 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_25140 76647 77651 gene locus_tag LOCUS_25150 gene lpxK 76647 77651 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY9 protein_id gnl|my_center|LOCUS_25150 77725 77910 gene locus_tag LOCUS_25160 77725 77910 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_25160 77911 78675 gene locus_tag LOCUS_25170 gene kdsB 77911 78675 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF7 protein_id gnl|my_center|LOCUS_25170 78675 79139 gene locus_tag LOCUS_25180 gene ptpA 78675 79139 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_25180 79136 80155 gene locus_tag LOCUS_25190 gene murB 79136 80155 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 protein_id gnl|my_center|LOCUS_25190 83226 80248 gene locus_tag LOCUS_25200 83226 80248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25200 83802 84755 gene locus_tag LOCUS_25210 gene rluC 83802 84755 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_25210 84748 85443 gene locus_tag LOCUS_25220 84748 85443 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_25220 85433 86413 gene locus_tag LOCUS_25230 85433 86413 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_25230 87055 86477 gene locus_tag LOCUS_25240 87055 86477 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY2 protein_id gnl|my_center|LOCUS_25240 87165 87692 gene locus_tag LOCUS_25250 87165 87692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_25250 87706 87888 gene locus_tag LOCUS_25260 gene rpmF 87706 87888 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN4 protein_id gnl|my_center|LOCUS_25260 87892 88902 gene locus_tag LOCUS_25270 gene plsX 87892 88902 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN5 protein_id gnl|my_center|LOCUS_25270 89009 89947 gene locus_tag LOCUS_25280 gene fabD 89009 89947 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCZ6 protein_id gnl|my_center|LOCUS_25280 89964 90707 gene locus_tag LOCUS_25290 gene fabG 89964 90707 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_25290 90904 91137 gene locus_tag LOCUS_25300 gene acpP1 90904 91137 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_25300 91247 92491 gene locus_tag LOCUS_25310 gene fabF1 91247 92491 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_25310 92491 93306 gene locus_tag LOCUS_25320 92491 93306 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_25320 93310 94362 gene locus_tag LOCUS_25330 93310 94362 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 protein_id gnl|my_center|LOCUS_25330 94372 95004 gene locus_tag LOCUS_25340 gene tmk 94372 95004 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_25340 94997 95983 gene locus_tag LOCUS_25350 94997 95983 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_25350 96021 96377 gene locus_tag LOCUS_25360 gene pilZ 96021 96377 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_25360 96448 97230 gene locus_tag LOCUS_25370 96448 97230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_25370 98605 97427 gene locus_tag LOCUS_25380 98605 97427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_25380 98681 99319 gene locus_tag LOCUS_25390 98681 99319 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_25390 99410 100378 gene locus_tag LOCUS_25400 gene moaA 99410 100378 CDS product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ65 protein_id gnl|my_center|LOCUS_25400 101369 101052 gene locus_tag LOCUS_25410 101369 101052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 101418 102059 gene locus_tag LOCUS_25420 101418 102059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 102059 105559 gene locus_tag LOCUS_25430 102059 105559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 105552 105932 gene locus_tag LOCUS_25440 105552 105932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence16 1311 112 gene locus_tag LOCUS_25450 gene tyrS 1311 112 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM7 protein_id gnl|my_center|LOCUS_25450 1527 2966 gene locus_tag LOCUS_25460 1527 2966 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_25460 2972 4063 gene locus_tag LOCUS_25470 gene anmK 2972 4063 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z1 protein_id gnl|my_center|LOCUS_25470 4489 4139 gene locus_tag LOCUS_25480 gene erpA 4489 4139 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_25480 4977 4567 gene locus_tag LOCUS_25490 4977 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_25490 5718 4987 gene locus_tag LOCUS_25500 5718 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085249.1 protein_id gnl|my_center|LOCUS_25500 6752 5718 gene locus_tag LOCUS_25510 gene argC 6752 5718 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_25510 6886 7314 gene locus_tag LOCUS_25520 6886 7314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_25520 7346 8308 gene locus_tag LOCUS_25530 7346 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_25530 8305 9570 gene locus_tag LOCUS_25540 8305 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_25540 9802 10803 gene locus_tag LOCUS_25550 9802 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113171.1 protein_id gnl|my_center|LOCUS_25550 10894 11685 gene locus_tag LOCUS_25560 10894 11685 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_25560 13182 11701 gene locus_tag LOCUS_25570 13182 11701 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_25570 13267 13605 gene locus_tag LOCUS_25580 13267 13605 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_25580 13605 14417 gene locus_tag LOCUS_25590 13605 14417 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_25590 14484 15131 gene locus_tag LOCUS_25600 gene coq7 14484 15131 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_25600 15987 15193 gene locus_tag LOCUS_25610 gene speD 15987 15193 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_25610 16647 16225 gene locus_tag LOCUS_25620 16647 16225 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_25620 16894 17538 gene locus_tag LOCUS_25630 gene vfr 16894 17538 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_25630 18456 17620 gene locus_tag LOCUS_25640 gene trpC 18456 17620 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML3 protein_id gnl|my_center|LOCUS_25640 19499 18453 gene locus_tag LOCUS_25650 gene trpD 19499 18453 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_25650 20092 19496 gene locus_tag LOCUS_25660 gene trpG 20092 19496 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_25660 21603 20116 gene locus_tag LOCUS_25670 21603 20116 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_25670 22541 21852 gene locus_tag LOCUS_25680 gene gph1 22541 21852 CDS product phosphoglycolate phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S586 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25680 23212 22538 gene locus_tag LOCUS_25690 gene rpe 23212 22538 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_25690 24767 23307 gene locus_tag LOCUS_25700 gene puuC 24767 23307 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 protein_id gnl|my_center|LOCUS_25700 26209 24830 gene locus_tag LOCUS_25710 26209 24830 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_25710 27435 26287 gene locus_tag LOCUS_25720 27435 26287 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_25720 28983 27610 gene locus_tag LOCUS_25730 28983 27610 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_25730 29911 29084 gene locus_tag LOCUS_25740 29911 29084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_25740 31173 29926 gene locus_tag LOCUS_25750 31173 29926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_25750 32288 31254 gene locus_tag LOCUS_25760 32288 31254 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_25760 33459 32335 gene locus_tag LOCUS_25770 33459 32335 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T5 protein_id gnl|my_center|LOCUS_25770 34482 33853 gene locus_tag LOCUS_25780 34482 33853 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_25780 36911 34527 gene locus_tag LOCUS_25790 36911 34527 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113207.1 protein_id gnl|my_center|LOCUS_25790 37108 38142 gene locus_tag LOCUS_25800 37108 38142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099546.1 protein_id gnl|my_center|LOCUS_25800 38897 38139 gene locus_tag LOCUS_25810 38897 38139 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103191.1 protein_id gnl|my_center|LOCUS_25810 39570 38899 gene locus_tag LOCUS_25820 39570 38899 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_25820 40592 39567 gene locus_tag LOCUS_25830 40592 39567 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_25830 40889 43522 gene locus_tag LOCUS_25840 gene lptD 40889 43522 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 protein_id gnl|my_center|LOCUS_25840 43497 44795 gene locus_tag LOCUS_25850 gene surA 43497 44795 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_25850 45089 46081 gene locus_tag LOCUS_25860 gene pdxA1 45089 46081 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_25860 46258 47073 gene locus_tag LOCUS_25870 gene rsmA 46258 47073 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG5 protein_id gnl|my_center|LOCUS_25870 47157 47537 gene locus_tag LOCUS_25880 gene apaG 47157 47537 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_25880 47537 48361 gene locus_tag LOCUS_25890 gene apaH 47537 48361 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_25890 48358 48687 gene locus_tag LOCUS_25900 gene glpE 48358 48687 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A49 protein_id gnl|my_center|LOCUS_25900 48969 50891 gene locus_tag LOCUS_25910 48969 50891 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 protein_id gnl|my_center|LOCUS_25910 50950 52221 gene locus_tag LOCUS_25920 50950 52221 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A51 protein_id gnl|my_center|LOCUS_25920 52218 53798 gene locus_tag LOCUS_25930 52218 53798 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 protein_id gnl|my_center|LOCUS_25930 53812 54372 gene locus_tag LOCUS_25940 53812 54372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085071.1 protein_id gnl|my_center|LOCUS_25940 54440 55669 gene locus_tag LOCUS_25950 gene cca 54440 55669 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 protein_id gnl|my_center|LOCUS_25950 56247 55708 gene locus_tag LOCUS_25960 56247 55708 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085067.1 protein_id gnl|my_center|LOCUS_25960 56594 56238 gene locus_tag LOCUS_25970 56594 56238 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF6 protein_id gnl|my_center|LOCUS_25970 56661 57239 gene locus_tag LOCUS_25980 gene plsY 56661 57239 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V6 protein_id gnl|my_center|LOCUS_25980 58305 57280 gene locus_tag LOCUS_25990 gene tsaD 58305 57280 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_25990 58512 58727 gene locus_tag LOCUS_26000 gene rpsU 58512 58727 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_26000 58870 60840 gene locus_tag LOCUS_26010 gene dnaG 58870 60840 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF2 protein_id gnl|my_center|LOCUS_26010 60908 62755 gene locus_tag LOCUS_26020 gene rpoD 60908 62755 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A60 protein_id gnl|my_center|LOCUS_26020 62857 66591 gene locus_tag LOCUS_26030 62857 66591 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113216.1 protein_id gnl|my_center|LOCUS_26030 66607 66683 gene locus_tag LOCUS_t00320 66607 66683 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67525 67758 gene locus_tag LOCUS_26040 67525 67758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 67761 69095 gene locus_tag LOCUS_26050 67761 69095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_26050 69341 70102 gene locus_tag LOCUS_26060 69341 70102 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_26060 70186 71550 gene locus_tag LOCUS_26070 70186 71550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 71534 72367 gene locus_tag LOCUS_26080 71534 72367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 73131 72973 gene locus_tag LOCUS_26090 73131 72973 CDS product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 protein_id gnl|my_center|LOCUS_26090 73267 74724 gene locus_tag LOCUS_26100 73267 74724 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553906.1 protein_id gnl|my_center|LOCUS_26100 75997 77382 gene locus_tag LOCUS_26110 75997 77382 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_26110 77674 79239 gene locus_tag LOCUS_26120 77674 79239 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_26120 79428 80693 gene locus_tag LOCUS_26130 79428 80693 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_26130 81740 80784 gene locus_tag LOCUS_26140 gene speB 81740 80784 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_26140 82935 81862 gene locus_tag LOCUS_26150 gene potF 82935 81862 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WH82 protein_id gnl|my_center|LOCUS_26150 83126 84040 gene locus_tag LOCUS_26160 83126 84040 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 protein_id gnl|my_center|LOCUS_26160 84131 84691 gene locus_tag LOCUS_26170 84131 84691 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245223.1 protein_id gnl|my_center|LOCUS_26170 85149 85805 gene locus_tag LOCUS_26180 85149 85805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 87642 85864 gene locus_tag LOCUS_26190 87642 85864 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_26190 89608 87812 gene locus_tag LOCUS_26200 89608 87812 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 protein_id gnl|my_center|LOCUS_26200 91048 89726 gene locus_tag LOCUS_26210 91048 89726 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 protein_id gnl|my_center|LOCUS_26210 93238 91433 gene locus_tag LOCUS_26220 93238 91433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103162.1 protein_id gnl|my_center|LOCUS_26220 94167 93406 gene locus_tag LOCUS_26230 94167 93406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 94521 94222 gene locus_tag LOCUS_26240 94521 94222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113246.1 protein_id gnl|my_center|LOCUS_26240 95305 94616 gene locus_tag LOCUS_26250 gene bioD 95305 94616 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_26250 96196 95390 gene locus_tag LOCUS_26260 gene bioC 96196 95390 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB1 protein_id gnl|my_center|LOCUS_26260 96920 96189 gene locus_tag LOCUS_26270 gene bioH 96920 96189 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763768.1 protein_id gnl|my_center|LOCUS_26270 98100 96913 gene locus_tag LOCUS_26280 gene bioF 98100 96913 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_26280 99278 98223 gene locus_tag LOCUS_26290 gene bioB 99278 98223 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 protein_id gnl|my_center|LOCUS_26290 99359 100096 gene locus_tag LOCUS_26300 99359 100096 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_26300 100188 100952 gene locus_tag LOCUS_26310 100188 100952 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084796.1 protein_id gnl|my_center|LOCUS_26310 101049 102023 gene locus_tag LOCUS_26320 gene srkA 101049 102023 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_26320 102267 103157 gene locus_tag LOCUS_26330 gene rarD-1 102267 103157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763735.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence17 766 8 gene locus_tag LOCUS_26340 766 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1734 925 gene locus_tag LOCUS_26350 1734 925 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_26350 1907 1719 gene locus_tag LOCUS_26360 1907 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2288 1917 gene locus_tag LOCUS_26370 2288 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268629.1 protein_id gnl|my_center|LOCUS_26370 4400 2394 gene locus_tag LOCUS_26380 gene wbpM 4400 2394 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_26380 5841 4816 gene locus_tag LOCUS_26390 5841 4816 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_26390 6605 5838 gene locus_tag LOCUS_26400 6605 5838 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_26400 8053 6803 gene locus_tag LOCUS_26410 8053 6803 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_26410 9195 8062 gene locus_tag LOCUS_26420 gene wecB 9195 8062 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734455.1 protein_id gnl|my_center|LOCUS_26420 10337 9219 gene locus_tag LOCUS_26430 gene fnlB 10337 9219 CDS product UDP-2-acetamido-2,6-dideoxy-beta-L-talose 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261048.1 protein_id gnl|my_center|LOCUS_26430 11375 10341 gene locus_tag LOCUS_26440 gene fnlA 11375 10341 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261047.1 protein_id gnl|my_center|LOCUS_26440 11959 11735 gene locus_tag LOCUS_26450 11959 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 12873 11998 gene locus_tag LOCUS_26460 12873 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 15950 14532 gene locus_tag LOCUS_26470 15950 14532 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208049.1 protein_id gnl|my_center|LOCUS_26470 17077 15947 gene locus_tag LOCUS_26480 gene wecE 17077 15947 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERX1 protein_id gnl|my_center|LOCUS_26480 17636 17064 gene locus_tag LOCUS_26490 17636 17064 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084193.1 protein_id gnl|my_center|LOCUS_26490 18378 17641 gene locus_tag LOCUS_26500 18378 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26500 19526 18663 gene locus_tag LOCUS_26510 gene rmlA 19526 18663 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECF6 protein_id gnl|my_center|LOCUS_26510 20597 19539 gene locus_tag LOCUS_26520 gene rfbB-1 20597 19539 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E5 protein_id gnl|my_center|LOCUS_26520 21714 20602 gene locus_tag LOCUS_26530 gene wbpE 21714 20602 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ76 protein_id gnl|my_center|LOCUS_26530 22299 21715 gene locus_tag LOCUS_26540 gene wbpD 22299 21715 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_26540 23302 22355 gene locus_tag LOCUS_26550 gene wbpB 23302 22355 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD23 protein_id gnl|my_center|LOCUS_26550 24634 23321 gene locus_tag LOCUS_26560 gene wbpA 24634 23321 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD94 protein_id gnl|my_center|LOCUS_26560 26279 24681 gene locus_tag LOCUS_26570 26279 24681 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_26570 27829 26540 gene locus_tag LOCUS_26580 27829 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_26580 29442 28171 gene locus_tag LOCUS_26590 29442 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_26590 29943 29659 gene locus_tag LOCUS_26600 gene ihfB 29943 29659 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_26600 31948 30269 gene locus_tag LOCUS_26610 gene rpsA 31948 30269 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_26610 32789 32100 gene locus_tag LOCUS_26620 gene cmk 32789 32100 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T2 protein_id gnl|my_center|LOCUS_26620 35044 32786 gene locus_tag LOCUS_26630 gene aroA 35044 32786 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_26630 36150 35041 gene locus_tag LOCUS_26640 gene hisC2 36150 35041 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_26640 36984 36607 gene locus_tag LOCUS_26650 36984 36607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 38185 37079 gene locus_tag LOCUS_26660 38185 37079 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_26660 39270 38185 gene locus_tag LOCUS_26670 gene serC 39270 38185 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_26670 42208 39440 gene locus_tag LOCUS_26680 gene gyrA 42208 39440 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ93 protein_id gnl|my_center|LOCUS_26680 43677 42601 gene locus_tag LOCUS_26690 gene mtnA 43677 42601 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T7 protein_id gnl|my_center|LOCUS_26690 44033 43815 gene locus_tag LOCUS_26700 44033 43815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 43920 45173 gene locus_tag LOCUS_26710 43920 45173 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_26710 45312 46010 gene locus_tag LOCUS_26720 gene ubiG 45312 46010 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_26720 46065 46736 gene locus_tag LOCUS_26730 46065 46736 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_26730 46783 47523 gene locus_tag LOCUS_26740 46783 47523 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_26740 47748 48674 gene locus_tag LOCUS_26750 47748 48674 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_26750 50109 48892 gene locus_tag LOCUS_26760 gene rluB 50109 48892 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1GRJ9 protein_id gnl|my_center|LOCUS_26760 50419 50231 gene locus_tag LOCUS_26770 50419 50231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 51275 50481 gene locus_tag LOCUS_26780 51275 50481 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L8 protein_id gnl|my_center|LOCUS_26780 52105 51278 gene locus_tag LOCUS_26790 52105 51278 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_26790 53314 52127 gene locus_tag LOCUS_26800 gene trpS-1 53314 52127 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_26800 53539 53895 gene locus_tag LOCUS_26810 53539 53895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 54554 53928 gene locus_tag LOCUS_26820 54554 53928 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268524.1 protein_id gnl|my_center|LOCUS_26820 55431 54568 gene locus_tag LOCUS_26830 55431 54568 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_26830 55593 55892 gene locus_tag LOCUS_26840 55593 55892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_26840 55946 56347 gene locus_tag LOCUS_26850 55946 56347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 56355 57032 gene locus_tag LOCUS_26860 56355 57032 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 protein_id gnl|my_center|LOCUS_26860 57153 57572 gene locus_tag LOCUS_26870 57153 57572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114831.1 protein_id gnl|my_center|LOCUS_26870 57645 58970 gene locus_tag LOCUS_26880 57645 58970 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 protein_id gnl|my_center|LOCUS_26880 59654 59091 gene locus_tag LOCUS_26890 59654 59091 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404145.1 protein_id gnl|my_center|LOCUS_26890 60062 59805 gene locus_tag LOCUS_26900 60062 59805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 60333 61787 gene locus_tag LOCUS_26910 gene trkH 60333 61787 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_26910 61899 63353 gene locus_tag LOCUS_26920 gene trkH 61899 63353 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_26920 64456 63455 gene locus_tag LOCUS_26930 64456 63455 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_26930 64624 64941 gene locus_tag LOCUS_26940 64624 64941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_26940 64958 65542 gene locus_tag LOCUS_26950 64958 65542 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_26950 65718 67091 gene locus_tag LOCUS_26960 gene cyaB 65718 67091 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_26960 68189 67170 gene locus_tag LOCUS_26970 68189 67170 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_26970 69019 68195 gene locus_tag LOCUS_26980 69019 68195 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268528.1 protein_id gnl|my_center|LOCUS_26980 69049 69291 gene locus_tag LOCUS_26990 69049 69291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 69363 70115 gene locus_tag LOCUS_27000 69363 70115 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_27000 70197 70532 gene locus_tag LOCUS_27010 gene csaA 70197 70532 CDS product molecular chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109191.1 protein_id gnl|my_center|LOCUS_27010 70529 71380 gene locus_tag LOCUS_27020 70529 71380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_27020 71783 71493 gene locus_tag LOCUS_27030 71783 71493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767690.1 protein_id gnl|my_center|LOCUS_27030 74029 71951 gene locus_tag LOCUS_27040 74029 71951 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268620.1 protein_id gnl|my_center|LOCUS_27040 75703 74300 gene locus_tag LOCUS_27050 75703 74300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_27050 76137 75703 gene locus_tag LOCUS_27060 76137 75703 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 protein_id gnl|my_center|LOCUS_27060 77239 76223 gene locus_tag LOCUS_27070 77239 76223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_27070 78594 77434 gene locus_tag LOCUS_27080 78594 77434 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_27080 80825 78699 gene locus_tag LOCUS_27090 80825 78699 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402551.1 protein_id gnl|my_center|LOCUS_27090 80978 81565 gene locus_tag LOCUS_27100 80978 81565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_27100 81575 81973 gene locus_tag LOCUS_27110 81575 81973 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 protein_id gnl|my_center|LOCUS_27110 82227 82871 gene locus_tag LOCUS_27120 82227 82871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_27120 82881 84830 gene locus_tag LOCUS_27130 82881 84830 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_27130 <92137 85560 gene locus_tag LOCUS_27140 <92137 85560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706509.1:structural toxin protein RtxA >Feature sequence18 353 1357 gene locus_tag LOCUS_27150 gene gapA 353 1357 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_27150 1559 2776 gene locus_tag LOCUS_27160 1559 2776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880869.1 protein_id gnl|my_center|LOCUS_27160 3048 4400 gene locus_tag LOCUS_27170 3048 4400 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928587.1 protein_id gnl|my_center|LOCUS_27170 6886 4499 gene locus_tag LOCUS_27180 6886 4499 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTX2 protein_id gnl|my_center|LOCUS_27180 8106 7432 gene locus_tag LOCUS_27190 8106 7432 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105172.1 protein_id gnl|my_center|LOCUS_27190 8669 9562 gene locus_tag LOCUS_27200 8669 9562 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_27200 10541 9573 gene locus_tag LOCUS_27210 10541 9573 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865241.1 protein_id gnl|my_center|LOCUS_27210 11916 10714 gene locus_tag LOCUS_27220 11916 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 12958 11933 gene locus_tag LOCUS_27230 12958 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_27230 13087 13611 gene locus_tag LOCUS_27240 13087 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 14236 13739 gene locus_tag LOCUS_27250 14236 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269299.1 protein_id gnl|my_center|LOCUS_27250 15363 14437 gene locus_tag LOCUS_27260 15363 14437 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_27260 15591 16679 gene locus_tag LOCUS_27270 15591 16679 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528508.1 protein_id gnl|my_center|LOCUS_27270 17929 16907 gene locus_tag LOCUS_27280 17929 16907 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104374.1 protein_id gnl|my_center|LOCUS_27280 17892 18077 gene locus_tag LOCUS_27290 17892 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 18124 19005 gene locus_tag LOCUS_27300 18124 19005 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104375.1 protein_id gnl|my_center|LOCUS_27300 19266 19934 gene locus_tag LOCUS_27310 19266 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_27310 20814 19996 gene locus_tag LOCUS_27320 gene aroE 20814 19996 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369293.1 protein_id gnl|my_center|LOCUS_27320 22501 20876 gene locus_tag LOCUS_27330 22501 20876 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_27330 23484 22822 gene locus_tag LOCUS_27340 gene eda-1 23484 22822 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764046.1 protein_id gnl|my_center|LOCUS_27340 24217 23504 gene locus_tag LOCUS_27350 gene pgl 24217 23504 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764047.1 protein_id gnl|my_center|LOCUS_27350 25673 24204 gene locus_tag LOCUS_27360 gene zwf 25673 24204 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXE8 protein_id gnl|my_center|LOCUS_27360 25845 26714 gene locus_tag LOCUS_27370 25845 26714 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 protein_id gnl|my_center|LOCUS_27370 28161 26941 gene locus_tag LOCUS_27380 gene lamB 28161 26941 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_27380 29421 28264 gene locus_tag LOCUS_27390 gene gltK 29421 28264 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764049.1 protein_id gnl|my_center|LOCUS_27390 30258 29431 gene locus_tag LOCUS_27400 30258 29431 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406653.1 protein_id gnl|my_center|LOCUS_27400 31234 30326 gene locus_tag LOCUS_27410 31234 30326 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375907.1 protein_id gnl|my_center|LOCUS_27410 32644 31391 gene locus_tag LOCUS_27420 32644 31391 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_27420 34332 32878 gene locus_tag LOCUS_27430 34332 32878 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266832.1 protein_id gnl|my_center|LOCUS_27430 35053 34325 gene locus_tag LOCUS_27440 gene gltR 35053 34325 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091475.1 protein_id gnl|my_center|LOCUS_27440 36174 35209 gene locus_tag LOCUS_27450 gene glk 36174 35209 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887K3 protein_id gnl|my_center|LOCUS_27450 37997 36171 gene locus_tag LOCUS_27460 37997 36171 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_27460 38553 38116 gene locus_tag LOCUS_27470 gene cadR 38553 38116 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_27470 38617 39276 gene locus_tag LOCUS_27480 38617 39276 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_27480 39336 39680 gene locus_tag LOCUS_27490 39336 39680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 39809 41065 gene locus_tag LOCUS_27500 39809 41065 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_27500 41062 42546 gene locus_tag LOCUS_27510 41062 42546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 protein_id gnl|my_center|LOCUS_27510 42543 45734 gene locus_tag LOCUS_27520 gene cusA 42543 45734 CDS product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 protein_id gnl|my_center|LOCUS_27520 46578 45694 gene locus_tag LOCUS_27530 46578 45694 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 protein_id gnl|my_center|LOCUS_27530 47393 46980 gene locus_tag LOCUS_27540 47393 46980 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_27540 48050 47439 gene locus_tag LOCUS_27550 gene cysC1 48050 47439 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK5 protein_id gnl|my_center|LOCUS_27550 48229 49041 gene locus_tag LOCUS_27560 48229 49041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 49029 50060 gene locus_tag LOCUS_27570 49029 50060 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070577.1 protein_id gnl|my_center|LOCUS_27570 50142 51200 gene locus_tag LOCUS_27580 50142 51200 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064041.1 protein_id gnl|my_center|LOCUS_27580 53513 51558 gene locus_tag LOCUS_27590 53513 51558 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266362.1 protein_id gnl|my_center|LOCUS_27590 55673 54204 gene locus_tag LOCUS_27600 55673 54204 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_27600 56398 55757 gene locus_tag LOCUS_27610 56398 55757 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 protein_id gnl|my_center|LOCUS_27610 57493 56510 gene locus_tag LOCUS_27620 57493 56510 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_27620 58717 57578 gene locus_tag LOCUS_27630 gene hmgA 58717 57578 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_27630 59976 58879 gene locus_tag LOCUS_27640 gene hpd 59976 58879 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I576 protein_id gnl|my_center|LOCUS_27640 60452 61027 gene locus_tag LOCUS_27650 60452 61027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 62959 61181 gene locus_tag LOCUS_27660 62959 61181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268570.1 protein_id gnl|my_center|LOCUS_27660 63584 62952 gene locus_tag LOCUS_27670 63584 62952 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_27670 64525 63587 gene locus_tag LOCUS_27680 64525 63587 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_27680 65011 64706 gene locus_tag LOCUS_27690 gene bolA 65011 64706 CDS product morphogene protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114234.1 protein_id gnl|my_center|LOCUS_27690 65524 65024 gene locus_tag LOCUS_27700 65524 65024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 protein_id gnl|my_center|LOCUS_27700 65782 66792 gene locus_tag LOCUS_27710 65782 66792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114233.1 protein_id gnl|my_center|LOCUS_27710 66872 68266 gene locus_tag LOCUS_27720 gene fumC 66872 68266 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885V0 protein_id gnl|my_center|LOCUS_27720 68259 68879 gene locus_tag LOCUS_27730 68259 68879 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_27730 69955 68993 gene locus_tag LOCUS_27740 69955 68993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 protein_id gnl|my_center|LOCUS_27740 70249 70458 gene locus_tag LOCUS_27750 70249 70458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102301.1 protein_id gnl|my_center|LOCUS_27750 72015 70831 gene locus_tag LOCUS_27760 72015 70831 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_27760 73859 72372 gene locus_tag LOCUS_27770 73859 72372 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103643.1 protein_id gnl|my_center|LOCUS_27770 73983 75974 gene locus_tag LOCUS_27780 gene mnmC 73983 75974 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPZ9 protein_id gnl|my_center|LOCUS_27780 76524 76108 gene locus_tag LOCUS_27790 76524 76108 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_27790 76693 78462 gene locus_tag LOCUS_27800 gene asnB 76693 78462 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103637.1 protein_id gnl|my_center|LOCUS_27800 78651 80387 gene locus_tag LOCUS_27810 78651 80387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268627.1 protein_id gnl|my_center|LOCUS_27810 80519 81700 gene locus_tag LOCUS_27820 80519 81700 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767612.1 protein_id gnl|my_center|LOCUS_27820 81799 84549 gene locus_tag LOCUS_27830 81799 84549 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 protein_id gnl|my_center|LOCUS_27830 84612 84851 gene locus_tag LOCUS_27840 84612 84851 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPZ1 protein_id gnl|my_center|LOCUS_27840 85268 84936 gene locus_tag LOCUS_27850 85268 84936 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886F1 protein_id gnl|my_center|LOCUS_27850 85844 85395 gene locus_tag LOCUS_27860 85844 85395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_27860 86677 86126 gene locus_tag LOCUS_27870 86677 86126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence19 <1 822 gene locus_tag LOCUS_27880 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CU72:nickel/cobalt efflux system 827 1267 gene locus_tag LOCUS_27890 827 1267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_27890 1264 1980 gene locus_tag LOCUS_27900 1264 1980 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 protein_id gnl|my_center|LOCUS_27900 2225 2025 gene locus_tag LOCUS_27910 2225 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4749 2383 gene locus_tag LOCUS_27920 4749 2383 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_27920 5000 4755 gene locus_tag LOCUS_27930 5000 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946774.1 protein_id gnl|my_center|LOCUS_27930 5637 5104 gene locus_tag LOCUS_27940 5637 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 protein_id gnl|my_center|LOCUS_27940 6199 5786 gene locus_tag LOCUS_27950 6199 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27950 6866 6507 gene locus_tag LOCUS_27960 6866 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 7075 7758 gene locus_tag LOCUS_27970 7075 7758 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267054.1 protein_id gnl|my_center|LOCUS_27970 7755 9134 gene locus_tag LOCUS_27980 7755 9134 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_27980 9142 9339 gene locus_tag LOCUS_27990 9142 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381628.1 protein_id gnl|my_center|LOCUS_27990 9349 10083 gene locus_tag LOCUS_28000 9349 10083 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719734.1 protein_id gnl|my_center|LOCUS_28000 10213 11070 gene locus_tag LOCUS_28010 10213 11070 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_28010 11686 11390 gene locus_tag LOCUS_28020 11686 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 11954 11679 gene locus_tag LOCUS_28030 11954 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 12968 12462 gene locus_tag LOCUS_28040 12968 12462 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR57 protein_id gnl|my_center|LOCUS_28040 14101 13682 gene locus_tag LOCUS_28050 14101 13682 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_28050 14173 14523 gene locus_tag LOCUS_28060 14173 14523 CDS product mercuric transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_28060 14537 14881 gene locus_tag LOCUS_28070 gene merP 14537 14881 CDS product periplasmic mercury ion-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTS3 protein_id gnl|my_center|LOCUS_28070 14884 16302 gene locus_tag LOCUS_28080 gene merA 14884 16302 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQT0 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 19535 16374 gene locus_tag LOCUS_28090 gene cusA 19535 16374 CDS product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 protein_id gnl|my_center|LOCUS_28090 21043 19532 gene locus_tag LOCUS_28100 21043 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 protein_id gnl|my_center|LOCUS_28100 22296 21040 gene locus_tag LOCUS_28110 22296 21040 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_28110 23041 22802 gene locus_tag LOCUS_28120 23041 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 23449 23054 gene locus_tag LOCUS_28130 23449 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 23720 23535 gene locus_tag LOCUS_28140 23720 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28140 24053 24370 gene locus_tag LOCUS_28150 24053 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 24780 24583 gene locus_tag LOCUS_28160 24780 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 25014 25913 gene locus_tag LOCUS_28170 25014 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073998.1 protein_id gnl|my_center|LOCUS_28170 26310 27680 gene locus_tag LOCUS_28180 26310 27680 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 protein_id gnl|my_center|LOCUS_28180 27728 28165 gene locus_tag LOCUS_28190 gene tadA 27728 28165 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX04 protein_id gnl|my_center|LOCUS_28190 29636 28176 gene locus_tag LOCUS_28200 gene mltF 29636 28176 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_28200 29802 33698 gene locus_tag LOCUS_28210 gene purL 29802 33698 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX02 protein_id gnl|my_center|LOCUS_28210 34217 34534 gene locus_tag LOCUS_28220 34217 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_28220 35094 34591 gene locus_tag LOCUS_28230 35094 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092667.1 protein_id gnl|my_center|LOCUS_28230 35671 35114 gene locus_tag LOCUS_28240 35671 35114 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_28240 35842 36444 gene locus_tag LOCUS_28250 35842 36444 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_28250 36461 36991 gene locus_tag LOCUS_28260 36461 36991 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266928.1 protein_id gnl|my_center|LOCUS_28260 36991 37179 gene locus_tag LOCUS_28270 36991 37179 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_28270 37230 38411 gene locus_tag LOCUS_28280 gene purT 37230 38411 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_28280 38444 39151 gene locus_tag LOCUS_28290 38444 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_28290 40406 39120 gene locus_tag LOCUS_28300 40406 39120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111904.1 protein_id gnl|my_center|LOCUS_28300 41217 40417 gene locus_tag LOCUS_28310 41217 40417 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_28310 41375 42748 gene locus_tag LOCUS_28320 gene ffh 41375 42748 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ0 protein_id gnl|my_center|LOCUS_28320 42939 43190 gene locus_tag LOCUS_28330 gene rpsP 42939 43190 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_28330 43231 43734 gene locus_tag LOCUS_28340 gene rimM 43231 43734 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_28340 43740 44492 gene locus_tag LOCUS_28350 gene trmD 43740 44492 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY7 protein_id gnl|my_center|LOCUS_28350 44535 44885 gene locus_tag LOCUS_28360 gene rplS 44535 44885 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_28360 45894 45214 gene locus_tag LOCUS_28370 45894 45214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119314.1 protein_id gnl|my_center|LOCUS_28370 46151 47047 gene locus_tag LOCUS_28380 gene xerD 46151 47047 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U8 protein_id gnl|my_center|LOCUS_28380 47140 47865 gene locus_tag LOCUS_28390 gene dsbC 47140 47865 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_28390 47979 49283 gene locus_tag LOCUS_28400 47979 49283 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_28400 49295 50704 gene locus_tag LOCUS_28410 gene thrC 49295 50704 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_28410 51583 50867 gene locus_tag LOCUS_28420 gene endA 51583 50867 CDS product DNA-specific endonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_28420 52872 51673 gene locus_tag LOCUS_28430 52872 51673 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129868.1 protein_id gnl|my_center|LOCUS_28430 52972 53511 gene locus_tag LOCUS_28440 52972 53511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_28440 53611 55323 gene locus_tag LOCUS_28450 gene recJ 53611 55323 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_28450 56043 55333 gene locus_tag LOCUS_28460 56043 55333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_28460 56402 57139 gene locus_tag LOCUS_28470 56402 57139 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266944.1 protein_id gnl|my_center|LOCUS_28470 57297 58949 gene locus_tag LOCUS_28480 57297 58949 CDS product GMC-type oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113843.1 protein_id gnl|my_center|LOCUS_28480 60612 58942 gene locus_tag LOCUS_28490 60612 58942 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390495.1 protein_id gnl|my_center|LOCUS_28490 60724 61878 gene locus_tag LOCUS_28500 gene prfB 60724 61878 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E1JGJ8 protein_id gnl|my_center|LOCUS_28500 62037 63554 gene locus_tag LOCUS_28510 gene lysS 62037 63554 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886S6 protein_id gnl|my_center|LOCUS_28510 63672 64385 gene locus_tag LOCUS_28520 63672 64385 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_28520 64470 65021 gene locus_tag LOCUS_28530 64470 65021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103725.1 protein_id gnl|my_center|LOCUS_28530 65054 66349 gene locus_tag LOCUS_28540 65054 66349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_28540 66541 67287 gene locus_tag LOCUS_28550 66541 67287 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_28550 67287 68168 gene locus_tag LOCUS_28560 67287 68168 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_28560 68165 68485 gene locus_tag LOCUS_28570 68165 68485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_28570 69414 68626 gene locus_tag LOCUS_28580 69414 68626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 protein_id gnl|my_center|LOCUS_28580 69898 69464 gene locus_tag LOCUS_28590 69898 69464 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765928.1 protein_id gnl|my_center|LOCUS_28590 70543 70199 gene locus_tag LOCUS_28600 70543 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_28600 70732 73368 gene locus_tag LOCUS_28610 gene ppc 70732 73368 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWV3 protein_id gnl|my_center|LOCUS_28610 73618 74265 gene locus_tag LOCUS_28620 gene adk 73618 74265 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_28620 74505 75185 gene locus_tag LOCUS_28630 74505 75185 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_28630 75300 75641 gene locus_tag LOCUS_28640 75300 75641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098661.1 protein_id gnl|my_center|LOCUS_28640 75641 76501 gene locus_tag LOCUS_28650 75641 76501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_28650 76498 77205 gene locus_tag LOCUS_28660 76498 77205 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_28660 77586 78374 gene locus_tag LOCUS_28670 gene rsmJ 77586 78374 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_28670 79067 78417 gene locus_tag LOCUS_28680 79067 78417 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_28680 79159 80262 gene locus_tag LOCUS_28690 79159 80262 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_28690 80268 83348 gene locus_tag LOCUS_28700 80268 83348 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_28700 83895 85334 gene locus_tag LOCUS_28710 gene cht1 83895 85334 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence20 1507 176 gene locus_tag LOCUS_28720 1507 176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267250.1 protein_id gnl|my_center|LOCUS_28720 2060 1557 gene locus_tag LOCUS_28730 gene allA 2060 1557 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J9 protein_id gnl|my_center|LOCUS_28730 3186 2191 gene locus_tag LOCUS_28740 gene alc 3186 2191 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVG8 protein_id gnl|my_center|LOCUS_28740 3903 3373 gene locus_tag LOCUS_28750 3903 3373 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_28750 4829 3900 gene locus_tag LOCUS_28760 4829 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_28760 5250 5603 gene locus_tag LOCUS_28770 5250 5603 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J5 protein_id gnl|my_center|LOCUS_28770 6573 5947 gene locus_tag LOCUS_28780 6573 5947 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 protein_id gnl|my_center|LOCUS_28780 7992 6643 gene locus_tag LOCUS_28790 7992 6643 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_28790 8681 9448 gene locus_tag LOCUS_28800 8681 9448 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_28800 10951 9647 gene locus_tag LOCUS_28810 10951 9647 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_28810 11935 11090 gene locus_tag LOCUS_28820 11935 11090 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_28820 14633 12237 gene locus_tag LOCUS_28830 gene xdhB 14633 12237 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_28830 16080 14626 gene locus_tag LOCUS_28840 gene xdhA 16080 14626 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_28840 17590 16454 gene locus_tag LOCUS_28850 gene alkB2 17590 16454 CDS product alkane 1-monooxygenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6H941 protein_id gnl|my_center|LOCUS_28850 17831 18490 gene locus_tag LOCUS_28860 17831 18490 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_28860 18494 21982 gene locus_tag LOCUS_28870 gene smc 18494 21982 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVF8 protein_id gnl|my_center|LOCUS_28870 22265 23092 gene locus_tag LOCUS_28880 gene zipA 22265 23092 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YY5 protein_id gnl|my_center|LOCUS_28880 23153 25525 gene locus_tag LOCUS_28890 gene ligA 23153 25525 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I4 protein_id gnl|my_center|LOCUS_28890 26467 25589 gene locus_tag LOCUS_28900 26467 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 27056 27250 gene locus_tag LOCUS_28910 27056 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 27280 27798 gene locus_tag LOCUS_28920 27280 27798 CDS product pilus assembly-related outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_28920 27814 29151 gene locus_tag LOCUS_28930 27814 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529404.1 protein_id gnl|my_center|LOCUS_28930 29192 30013 gene locus_tag LOCUS_28940 29192 30013 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_28940 30152 31621 gene locus_tag LOCUS_28950 30152 31621 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 protein_id gnl|my_center|LOCUS_28950 31692 31964 gene locus_tag LOCUS_28960 31692 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 31987 33324 gene locus_tag LOCUS_28970 31987 33324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106056.1 protein_id gnl|my_center|LOCUS_28970 33333 33821 gene locus_tag LOCUS_28980 33333 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 33821 34321 gene locus_tag LOCUS_28990 33821 34321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 34315 35535 gene locus_tag LOCUS_29000 34315 35535 CDS product Flp pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 protein_id gnl|my_center|LOCUS_29000 35539 36990 gene locus_tag LOCUS_29010 35539 36990 CDS product Flp pilus assembly protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_29010 36971 37957 gene locus_tag LOCUS_29020 36971 37957 CDS product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_29020 37988 38956 gene locus_tag LOCUS_29030 37988 38956 CDS product pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 protein_id gnl|my_center|LOCUS_29030 39015 39986 gene locus_tag LOCUS_29040 39015 39986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456611.1 protein_id gnl|my_center|LOCUS_29040 40397 40119 gene locus_tag LOCUS_29050 40397 40119 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_29050 40746 42380 gene locus_tag LOCUS_29060 40746 42380 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_29060 43016 42729 gene locus_tag LOCUS_29070 43016 42729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719769.1 protein_id gnl|my_center|LOCUS_29070 43310 43089 gene locus_tag LOCUS_29080 43310 43089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 43778 45889 gene locus_tag LOCUS_29090 gene dnaX 43778 45889 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_29090 45908 46234 gene locus_tag LOCUS_29100 45908 46234 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_29100 46434 47033 gene locus_tag LOCUS_29110 gene recR 46434 47033 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H9 protein_id gnl|my_center|LOCUS_29110 47258 48406 gene locus_tag LOCUS_29120 47258 48406 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_29120 48761 48549 gene locus_tag LOCUS_29130 48761 48549 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315566.1 protein_id gnl|my_center|LOCUS_29130 49842 48916 gene locus_tag LOCUS_29140 49842 48916 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_29140 50138 50875 gene locus_tag LOCUS_29150 50138 50875 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_29150 50901 51179 gene locus_tag LOCUS_29160 50901 51179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 51710 51282 gene locus_tag LOCUS_29170 51710 51282 CDS product osmotic/stress-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_29170 52644 52192 gene locus_tag LOCUS_29180 gene ohrR 52644 52192 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090940.1 protein_id gnl|my_center|LOCUS_29180 53650 52769 gene locus_tag LOCUS_29190 53650 52769 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_29190 55200 53647 gene locus_tag LOCUS_29200 55200 53647 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_29200 55317 56039 gene locus_tag LOCUS_29210 55317 56039 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114671.1 protein_id gnl|my_center|LOCUS_29210 56062 56460 gene locus_tag LOCUS_29220 56062 56460 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186426.1 protein_id gnl|my_center|LOCUS_29220 62225 56469 gene locus_tag LOCUS_29230 62225 56469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 62805 62272 gene locus_tag LOCUS_29240 62805 62272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 64142 62802 gene locus_tag LOCUS_29250 64142 62802 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_29250 65422 64139 gene locus_tag LOCUS_29260 65422 64139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 65587 66288 gene locus_tag LOCUS_29270 65587 66288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 67196 66366 gene locus_tag LOCUS_29280 67196 66366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_29280 68555 67755 gene locus_tag LOCUS_29290 68555 67755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 69217 68669 gene locus_tag LOCUS_29300 gene apt 69217 68669 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04633 protein_id gnl|my_center|LOCUS_29300 69980 69246 gene locus_tag LOCUS_29310 gene anr 69980 69246 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_29310 70130 70582 gene locus_tag LOCUS_29320 70130 70582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 72067 70685 gene locus_tag LOCUS_29330 gene hemN 72067 70685 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_29330 73030 72347 gene locus_tag LOCUS_29340 73030 72347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_29340 73241 73023 gene locus_tag LOCUS_29350 73241 73023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_29350 75772 73364 gene locus_tag LOCUS_29360 75772 73364 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_29360 76287 75781 gene locus_tag LOCUS_29370 76287 75781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_29370 77719 76307 gene locus_tag LOCUS_29380 77719 76307 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_29380 78847 77858 gene locus_tag LOCUS_29390 gene ccoP1 78847 77858 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_29390 79029 78844 gene locus_tag LOCUS_29400 gene ccoQ1 79029 78844 CDS product cytochrome C oxidase cbb3-type subunit CcoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087298.1 protein_id gnl|my_center|LOCUS_29400 79643 79035 gene locus_tag LOCUS_29410 gene ccoO2 79643 79035 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_29410 81085 79643 gene locus_tag LOCUS_29420 gene ccoN1 81085 79643 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 protein_id gnl|my_center|LOCUS_29420 81686 82231 gene locus_tag LOCUS_29430 81686 82231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_29430 82787 82320 gene locus_tag LOCUS_29440 82787 82320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence21 451 375 gene locus_tag LOCUS_t00330 451 375 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1629 529 gene locus_tag LOCUS_29450 gene ychF 1629 529 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C9 protein_id gnl|my_center|LOCUS_29450 2253 1663 gene locus_tag LOCUS_29460 gene pth 2253 1663 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_29460 2931 2323 gene locus_tag LOCUS_29470 gene rplY 2931 2323 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_29470 4067 3048 gene locus_tag LOCUS_29480 gene prs 4067 3048 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C6 protein_id gnl|my_center|LOCUS_29480 4110 4036 gene locus_tag LOCUS_t00340 4110 4036 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4243 4169 gene locus_tag LOCUS_t00350 4243 4169 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5122 4262 gene locus_tag LOCUS_29490 gene ispE 5122 4262 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_29490 5751 5134 gene locus_tag LOCUS_29500 gene lolB 5751 5134 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX0 protein_id gnl|my_center|LOCUS_29500 7391 5751 gene locus_tag LOCUS_29510 7391 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266732.1 protein_id gnl|my_center|LOCUS_29510 7814 9094 gene locus_tag LOCUS_29520 gene hemA 7814 9094 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW8 protein_id gnl|my_center|LOCUS_29520 9091 10173 gene locus_tag LOCUS_29530 gene prfA 9091 10173 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_29530 10288 11121 gene locus_tag LOCUS_29540 gene prmC 10288 11121 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_29540 11126 11899 gene locus_tag LOCUS_29550 gene moeB 11126 11899 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_29550 11889 12677 gene locus_tag LOCUS_29560 gene murI 11889 12677 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_29560 12794 13309 gene locus_tag LOCUS_29570 12794 13309 CDS product lipid A deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW3 protein_id gnl|my_center|LOCUS_29570 13679 13458 gene locus_tag LOCUS_29580 13679 13458 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266737.1 protein_id gnl|my_center|LOCUS_29580 13642 13821 gene locus_tag LOCUS_29590 13642 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 14486 13959 gene locus_tag LOCUS_29600 14486 13959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_29600 15753 14479 gene locus_tag LOCUS_29610 gene cfa 15753 14479 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_29610 16540 15740 gene locus_tag LOCUS_29620 16540 15740 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_29620 17799 16540 gene locus_tag LOCUS_29630 17799 16540 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_29630 18560 17796 gene locus_tag LOCUS_29640 18560 17796 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_29640 18979 18557 gene locus_tag LOCUS_29650 18979 18557 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_29650 20421 18976 gene locus_tag LOCUS_29660 gene phrB 20421 18976 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_29660 21374 20430 gene locus_tag LOCUS_29670 21374 20430 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768834.1 protein_id gnl|my_center|LOCUS_29670 22339 21371 gene locus_tag LOCUS_29680 22339 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_29680 22727 22482 gene locus_tag LOCUS_29690 22727 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_29690 23716 22724 gene locus_tag LOCUS_29700 23716 22724 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_29700 23915 24817 gene locus_tag LOCUS_29710 23915 24817 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_29710 24830 25852 gene locus_tag LOCUS_29720 gene hemH 24830 25852 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU9 protein_id gnl|my_center|LOCUS_29720 26009 27340 gene locus_tag LOCUS_29730 26009 27340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_29730 28791 27523 gene locus_tag LOCUS_29740 gene uraA 28791 27523 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094970.1 protein_id gnl|my_center|LOCUS_29740 29433 28795 gene locus_tag LOCUS_29750 gene upp 29433 28795 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU7 protein_id gnl|my_center|LOCUS_29750 29730 30287 gene locus_tag LOCUS_29760 gene hpt 29730 30287 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768820.1 protein_id gnl|my_center|LOCUS_29760 30291 30764 gene locus_tag LOCUS_29770 30291 30764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_29770 32601 30877 gene locus_tag LOCUS_29780 32601 30877 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706363.1 protein_id gnl|my_center|LOCUS_29780 32801 33088 gene locus_tag LOCUS_29790 32801 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_29790 34578 33247 gene locus_tag LOCUS_29800 34578 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_29800 35671 34604 gene locus_tag LOCUS_29810 35671 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_29810 36873 35668 gene locus_tag LOCUS_29820 36873 35668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 protein_id gnl|my_center|LOCUS_29820 38459 36870 gene locus_tag LOCUS_29830 38459 36870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_29830 39426 38446 gene locus_tag LOCUS_29840 39426 38446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_29840 40163 39423 gene locus_tag LOCUS_29850 40163 39423 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_29850 40476 41915 gene locus_tag LOCUS_29860 40476 41915 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP72 protein_id gnl|my_center|LOCUS_29860 42421 42047 gene locus_tag LOCUS_29870 42421 42047 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 protein_id gnl|my_center|LOCUS_29870 42794 43645 gene locus_tag LOCUS_29880 gene purU-3 42794 43645 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X74 protein_id gnl|my_center|LOCUS_29880 43692 44117 gene locus_tag LOCUS_29890 43692 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 44172 44357 gene locus_tag LOCUS_29900 44172 44357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719777.1 protein_id gnl|my_center|LOCUS_29900 46286 44409 gene locus_tag LOCUS_29910 gene pctA 46286 44409 CDS product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD24 protein_id gnl|my_center|LOCUS_29910 46849 46556 gene locus_tag LOCUS_29920 46849 46556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 46739 48079 gene locus_tag LOCUS_29930 46739 48079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 protein_id gnl|my_center|LOCUS_29930 48517 48293 gene locus_tag LOCUS_29940 48517 48293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554967.1 protein_id gnl|my_center|LOCUS_29940 49989 49117 gene locus_tag LOCUS_29950 49989 49117 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103395.1 protein_id gnl|my_center|LOCUS_29950 50104 50859 gene locus_tag LOCUS_29960 50104 50859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_29960 51789 50881 gene locus_tag LOCUS_29970 51789 50881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 protein_id gnl|my_center|LOCUS_29970 53138 51858 gene locus_tag LOCUS_29980 53138 51858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_29980 53665 53138 gene locus_tag LOCUS_29990 53665 53138 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770954.1 protein_id gnl|my_center|LOCUS_29990 54704 53730 gene locus_tag LOCUS_30000 gene dctP 54704 53730 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_30000 55671 54781 gene locus_tag LOCUS_30010 55671 54781 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266702.1 protein_id gnl|my_center|LOCUS_30010 56533 55706 gene locus_tag LOCUS_30020 gene udh 56533 55706 CDS product uronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H1 protein_id gnl|my_center|LOCUS_30020 57767 56862 gene locus_tag LOCUS_30030 57767 56862 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267910.1 protein_id gnl|my_center|LOCUS_30030 57898 59049 gene locus_tag LOCUS_30040 57898 59049 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_30040 60619 59099 gene locus_tag LOCUS_30050 60619 59099 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_30050 61119 60631 gene locus_tag LOCUS_30060 61119 60631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 62153 61182 gene locus_tag LOCUS_30070 62153 61182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_30070 63567 62206 gene locus_tag LOCUS_30080 63567 62206 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_30080 64231 65142 gene locus_tag LOCUS_30090 64231 65142 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WJ7 protein_id gnl|my_center|LOCUS_30090 65198 66640 gene locus_tag LOCUS_30100 65198 66640 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_30100 66879 68234 gene locus_tag LOCUS_30110 66879 68234 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_30110 68487 70040 gene locus_tag LOCUS_30120 68487 70040 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 protein_id gnl|my_center|LOCUS_30120 70142 71080 gene locus_tag LOCUS_30130 70142 71080 CDS product D-isomer specific 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 protein_id gnl|my_center|LOCUS_30130 71462 71815 gene locus_tag LOCUS_30140 71462 71815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_30140 71860 72306 gene locus_tag LOCUS_30150 71860 72306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 72347 72877 gene locus_tag LOCUS_30160 72347 72877 CDS product potassium-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_30160 73652 73092 gene locus_tag LOCUS_30170 73652 73092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 73847 75136 gene locus_tag LOCUS_30180 73847 75136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101571.1 protein_id gnl|my_center|LOCUS_30180 75749 75662 gene locus_tag LOCUS_t00360 75749 75662 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75898 77250 gene locus_tag LOCUS_30190 75898 77250 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389008.1 protein_id gnl|my_center|LOCUS_30190 77527 78525 gene locus_tag LOCUS_30200 77527 78525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_30200 78629 78922 gene locus_tag LOCUS_30210 78629 78922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 79022 80152 gene locus_tag LOCUS_30220 79022 80152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268162.1 protein_id gnl|my_center|LOCUS_30220 81418 80756 gene locus_tag LOCUS_30230 81418 80756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence22 261 470 gene locus_tag LOCUS_30240 gene slyX 261 470 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL9 protein_id gnl|my_center|LOCUS_30240 1129 527 gene locus_tag LOCUS_30250 1129 527 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_249652.2 protein_id gnl|my_center|LOCUS_30250 2366 1299 gene locus_tag LOCUS_30260 gene vdcA 2366 1299 CDS product diguanylate cyclase VdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKZ4 protein_id gnl|my_center|LOCUS_30260 2949 2479 gene locus_tag LOCUS_30270 2949 2479 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_30270 3901 3083 gene locus_tag LOCUS_30280 3901 3083 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_30280 5127 4009 gene locus_tag LOCUS_30290 5127 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30290 5435 7210 gene locus_tag LOCUS_30300 gene aspS 5435 7210 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_30300 7313 8062 gene locus_tag LOCUS_30310 gene pmpR 7313 8062 CDS product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 protein_id gnl|my_center|LOCUS_30310 8196 8762 gene locus_tag LOCUS_30320 gene ruvC 8196 8762 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL3 protein_id gnl|my_center|LOCUS_30320 8784 9389 gene locus_tag LOCUS_30330 gene ruvA 8784 9389 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_30330 9396 10448 gene locus_tag LOCUS_30340 gene ruvB 9396 10448 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_30340 10501 10953 gene locus_tag LOCUS_30350 10501 10953 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378990.1 protein_id gnl|my_center|LOCUS_30350 10956 11651 gene locus_tag LOCUS_30360 gene tolQ 10956 11651 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_30360 11841 12293 gene locus_tag LOCUS_30370 11841 12293 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 protein_id gnl|my_center|LOCUS_30370 12293 13243 gene locus_tag LOCUS_30380 gene tolA 12293 13243 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50600 protein_id gnl|my_center|LOCUS_30380 13240 14538 gene locus_tag LOCUS_30390 gene tolB 13240 14538 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_30390 14592 15089 gene locus_tag LOCUS_30400 gene pal 14592 15089 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 protein_id gnl|my_center|LOCUS_30400 15096 15917 gene locus_tag LOCUS_30410 15096 15917 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_30410 16003 16683 gene locus_tag LOCUS_30420 gene queE 16003 16683 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_30420 16664 17359 gene locus_tag LOCUS_30430 gene queC 16664 17359 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_30430 17417 17492 gene locus_tag LOCUS_t00370 17417 17492 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17688 18746 gene locus_tag LOCUS_30440 gene nadA 17688 18746 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 protein_id gnl|my_center|LOCUS_30440 20237 18804 gene locus_tag LOCUS_30450 20237 18804 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y51 protein_id gnl|my_center|LOCUS_30450 20505 20756 gene locus_tag LOCUS_30460 20505 20756 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_30460 20805 21872 gene locus_tag LOCUS_30470 20805 21872 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245780.1 protein_id gnl|my_center|LOCUS_30470 22403 21930 gene locus_tag LOCUS_30480 gene bcp 22403 21930 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_30480 22974 22414 gene locus_tag LOCUS_30490 22974 22414 CDS product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368263.1 protein_id gnl|my_center|LOCUS_30490 23201 24079 gene locus_tag LOCUS_30500 gene dapA 23201 24079 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_30500 24097 25215 gene locus_tag LOCUS_30510 24097 25215 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406091.1 protein_id gnl|my_center|LOCUS_30510 25428 26297 gene locus_tag LOCUS_30520 gene purC 25428 26297 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_30520 26552 26641 gene locus_tag LOCUS_t00380 26552 26641 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27239 26892 gene locus_tag LOCUS_30530 27239 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_30530 27442 27251 gene locus_tag LOCUS_30540 27442 27251 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_30540 30083 27471 gene locus_tag LOCUS_30550 30083 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895700.1 protein_id gnl|my_center|LOCUS_30550 30227 30595 gene locus_tag LOCUS_30560 30227 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 30698 31450 gene locus_tag LOCUS_30570 30698 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_30570 32109 32480 gene locus_tag LOCUS_30580 32109 32480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 32545 34023 gene locus_tag LOCUS_30590 32545 34023 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404259.1 protein_id gnl|my_center|LOCUS_30590 35006 34116 gene locus_tag LOCUS_30600 35006 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113144.1 protein_id gnl|my_center|LOCUS_30600 35965 35021 gene locus_tag LOCUS_30610 35965 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 36747 37217 gene locus_tag LOCUS_30620 36747 37217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 37227 37403 gene locus_tag LOCUS_30630 37227 37403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 37622 37921 gene locus_tag LOCUS_30640 37622 37921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 37947 38801 gene locus_tag LOCUS_30650 37947 38801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 38906 40228 gene locus_tag LOCUS_30660 38906 40228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 40398 41150 gene locus_tag LOCUS_30670 40398 41150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941135.1 protein_id gnl|my_center|LOCUS_30670 41641 42426 gene locus_tag LOCUS_30680 41641 42426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_30680 45988 42512 gene locus_tag LOCUS_30690 45988 42512 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_30690 46239 46808 gene locus_tag LOCUS_30700 46239 46808 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119682.1 protein_id gnl|my_center|LOCUS_30700 46812 47045 gene locus_tag LOCUS_30710 46812 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 47372 48085 gene locus_tag LOCUS_30720 47372 48085 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_30720 48085 48414 gene locus_tag LOCUS_30730 48085 48414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 48604 50478 gene locus_tag LOCUS_30740 48604 50478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_30740 50845 50531 gene locus_tag LOCUS_30750 50845 50531 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 protein_id gnl|my_center|LOCUS_30750 51939 50992 gene locus_tag LOCUS_30760 51939 50992 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_30760 52938 52018 gene locus_tag LOCUS_30770 gene rdgC 52938 52018 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW36 protein_id gnl|my_center|LOCUS_30770 53257 53332 gene locus_tag LOCUS_t00390 53257 53332 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53355 53431 gene locus_tag LOCUS_t00400 53355 53431 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 53882 54607 gene locus_tag LOCUS_30780 53882 54607 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_30780 54975 55424 gene locus_tag LOCUS_30790 54975 55424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408555.1 protein_id gnl|my_center|LOCUS_30790 55921 56235 gene locus_tag LOCUS_30800 55921 56235 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267116.1 protein_id gnl|my_center|LOCUS_30800 56232 56597 gene locus_tag LOCUS_30810 56232 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267117.1 protein_id gnl|my_center|LOCUS_30810 56598 57065 gene locus_tag LOCUS_30820 56598 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 protein_id gnl|my_center|LOCUS_30820 58920 57145 gene locus_tag LOCUS_30830 58920 57145 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_30830 61133 59019 gene locus_tag LOCUS_30840 gene prc 61133 59019 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_30840 61228 62190 gene locus_tag LOCUS_30850 61228 62190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_30850 62483 63046 gene locus_tag LOCUS_30860 gene ahpC 62483 63046 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_30860 63347 64903 gene locus_tag LOCUS_30870 gene ahpF 63347 64903 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z2 protein_id gnl|my_center|LOCUS_30870 65116 65910 gene locus_tag LOCUS_30880 65116 65910 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095350.1 protein_id gnl|my_center|LOCUS_30880 66609 66046 gene locus_tag LOCUS_30890 66609 66046 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_30890 67227 66688 gene locus_tag LOCUS_30900 67227 66688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_30900 67359 68579 gene locus_tag LOCUS_30910 67359 68579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205419.1 protein_id gnl|my_center|LOCUS_30910 68598 69998 gene locus_tag LOCUS_30920 gene lpd3 68598 69998 CDS product dihydrolipoyl dehydrogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUY1 protein_id gnl|my_center|LOCUS_30920 70187 70041 gene locus_tag LOCUS_30930 70187 70041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 70630 70286 gene locus_tag LOCUS_30940 70630 70286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 71423 71908 gene locus_tag LOCUS_30950 71423 71908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 72244 73557 gene locus_tag LOCUS_30960 72244 73557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 73554 73877 gene locus_tag LOCUS_30970 73554 73877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 74425 74664 gene locus_tag LOCUS_30980 74425 74664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 74820 75137 gene locus_tag LOCUS_30990 74820 75137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence23 341 2272 gene locus_tag LOCUS_31000 341 2272 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_31000 2885 2277 gene locus_tag LOCUS_31010 gene attY 2885 2277 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_31010 2769 3017 gene locus_tag LOCUS_31020 2769 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3550 3155 gene locus_tag LOCUS_31030 3550 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929801.1 protein_id gnl|my_center|LOCUS_31030 3691 4611 gene locus_tag LOCUS_31040 3691 4611 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101343.1 protein_id gnl|my_center|LOCUS_31040 5390 5314 gene locus_tag LOCUS_t00410 5390 5314 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5762 7210 gene locus_tag LOCUS_31050 gene davD 5762 7210 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_31050 7388 8668 gene locus_tag LOCUS_31060 7388 8668 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401617.1 protein_id gnl|my_center|LOCUS_31060 8990 10204 gene locus_tag LOCUS_31070 8990 10204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_31070 13090 10193 gene locus_tag LOCUS_31080 13090 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 13614 13180 gene locus_tag LOCUS_31090 13614 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 14047 13631 gene locus_tag LOCUS_31100 14047 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 14196 15173 gene locus_tag LOCUS_31110 14196 15173 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_31110 15183 16562 gene locus_tag LOCUS_31120 15183 16562 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_31120 16559 17527 gene locus_tag LOCUS_31130 16559 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_31130 17524 19665 gene locus_tag LOCUS_31140 17524 19665 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_31140 19665 20378 gene locus_tag LOCUS_31150 19665 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 21541 20471 gene locus_tag LOCUS_31160 21541 20471 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_31160 21641 22654 gene locus_tag LOCUS_31170 21641 22654 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 protein_id gnl|my_center|LOCUS_31170 22651 23727 gene locus_tag LOCUS_31180 22651 23727 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_31180 24146 25714 gene locus_tag LOCUS_31190 24146 25714 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_31190 25907 26983 gene locus_tag LOCUS_31200 25907 26983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 27352 28716 gene locus_tag LOCUS_31210 27352 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106001.1 protein_id gnl|my_center|LOCUS_31210 28915 30228 gene locus_tag LOCUS_31220 28915 30228 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114273.1 protein_id gnl|my_center|LOCUS_31220 32362 30368 gene locus_tag LOCUS_31230 32362 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_31230 33184 32501 gene locus_tag LOCUS_31240 33184 32501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_31240 33276 33800 gene locus_tag LOCUS_31250 33276 33800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_31250 34640 33897 gene locus_tag LOCUS_31260 34640 33897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_31260 35826 34837 gene locus_tag LOCUS_31270 gene cysA 35826 34837 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6L0 protein_id gnl|my_center|LOCUS_31270 36702 35830 gene locus_tag LOCUS_31280 36702 35830 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266174.1 protein_id gnl|my_center|LOCUS_31280 37531 36713 gene locus_tag LOCUS_31290 37531 36713 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 protein_id gnl|my_center|LOCUS_31290 38742 37735 gene locus_tag LOCUS_31300 gene sbp 38742 37735 CDS product sulfate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_31300 39087 38911 gene locus_tag LOCUS_31310 39087 38911 CDS product DUF2292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084246.1 protein_id gnl|my_center|LOCUS_31310 39348 39926 gene locus_tag LOCUS_31320 39348 39926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105376.1 protein_id gnl|my_center|LOCUS_31320 40196 41014 gene locus_tag LOCUS_31330 40196 41014 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266324.1 protein_id gnl|my_center|LOCUS_31330 42256 41123 gene locus_tag LOCUS_31340 gene modC 42256 41123 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_31340 42933 42253 gene locus_tag LOCUS_31350 gene modB 42933 42253 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_31350 43695 42943 gene locus_tag LOCUS_31360 gene modA 43695 42943 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104307.1 protein_id gnl|my_center|LOCUS_31360 44461 43835 gene locus_tag LOCUS_31370 44461 43835 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_31370 44737 46086 gene locus_tag LOCUS_31380 44737 46086 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_31380 46097 46426 gene locus_tag LOCUS_31390 46097 46426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 48779 46500 gene locus_tag LOCUS_31400 48779 46500 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_31400 48950 50137 gene locus_tag LOCUS_31410 48950 50137 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103089.1 protein_id gnl|my_center|LOCUS_31410 50303 51274 gene locus_tag LOCUS_31420 50303 51274 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266178.1 protein_id gnl|my_center|LOCUS_31420 51764 53032 gene locus_tag LOCUS_31430 51764 53032 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_31430 54590 53415 gene locus_tag LOCUS_31440 gene aguA 54590 53415 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_31440 55529 54651 gene locus_tag LOCUS_31450 55529 54651 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372277.1 protein_id gnl|my_center|LOCUS_31450 56492 55851 gene locus_tag LOCUS_31460 56492 55851 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205950.1 protein_id gnl|my_center|LOCUS_31460 57738 56671 gene locus_tag LOCUS_31470 57738 56671 CDS product polyamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107781.1 protein_id gnl|my_center|LOCUS_31470 59208 57940 gene locus_tag LOCUS_31480 59208 57940 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413528.1 protein_id gnl|my_center|LOCUS_31480 59593 60345 gene locus_tag LOCUS_31490 gene spuA 59593 60345 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_31490 60390 61748 gene locus_tag LOCUS_31500 gene spuB 60390 61748 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 protein_id gnl|my_center|LOCUS_31500 61813 63186 gene locus_tag LOCUS_31510 61813 63186 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 protein_id gnl|my_center|LOCUS_31510 63348 64442 gene locus_tag LOCUS_31520 gene spuD 63348 64442 CDS product putrescine-binding periplasmic protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J1 protein_id gnl|my_center|LOCUS_31520 64707 65801 gene locus_tag LOCUS_31530 64707 65801 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_31530 65855 66997 gene locus_tag LOCUS_31540 gene potG 65855 66997 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UJ3 protein_id gnl|my_center|LOCUS_31540 66994 67905 gene locus_tag LOCUS_31550 66994 67905 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372160.1 protein_id gnl|my_center|LOCUS_31550 67902 68801 gene locus_tag LOCUS_31560 gene potI 67902 68801 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767071.1 protein_id gnl|my_center|LOCUS_31560 69136 71082 gene locus_tag LOCUS_31570 gene topB 69136 71082 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882Z4 protein_id gnl|my_center|LOCUS_31570 >Feature sequence24 1258 380 gene locus_tag LOCUS_31580 1258 380 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103368.1 protein_id gnl|my_center|LOCUS_31580 3337 1400 gene locus_tag LOCUS_31590 gene acsA2 3337 1400 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_31590 5230 3566 gene locus_tag LOCUS_31600 gene pgi 5230 3566 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY88 protein_id gnl|my_center|LOCUS_31600 5713 5333 gene locus_tag LOCUS_31610 gene panD 5713 5333 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_31610 6656 5796 gene locus_tag LOCUS_31620 gene panC 6656 5796 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_31620 7453 6653 gene locus_tag LOCUS_31630 gene panB 7453 6653 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_31630 8112 7633 gene locus_tag LOCUS_31640 gene folK 8112 7633 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV71 protein_id gnl|my_center|LOCUS_31640 9516 8113 gene locus_tag LOCUS_31650 gene pcnB 9516 8113 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q3 protein_id gnl|my_center|LOCUS_31650 11634 10216 gene locus_tag LOCUS_31660 gene cbrB 11634 10216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_31660 14623 11669 gene locus_tag LOCUS_31670 14623 11669 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246100.1 protein_id gnl|my_center|LOCUS_31670 15004 14828 gene locus_tag LOCUS_31680 15004 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_31680 15188 16414 gene locus_tag LOCUS_31690 15188 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 16411 17523 gene locus_tag LOCUS_31700 16411 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 18921 17965 gene locus_tag LOCUS_31710 18921 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_31710 19640 19053 gene locus_tag LOCUS_31720 19640 19053 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_31720 20793 19897 gene locus_tag LOCUS_31730 20793 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 22276 21365 gene locus_tag LOCUS_31740 22276 21365 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_31740 23029 22457 gene locus_tag LOCUS_31750 23029 22457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112304.1 protein_id gnl|my_center|LOCUS_31750 23676 23062 gene locus_tag LOCUS_31760 gene ureG-2 23676 23062 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VM5 protein_id gnl|my_center|LOCUS_31760 24466 23792 gene locus_tag LOCUS_31770 gene ureF 24466 23792 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMZ0 protein_id gnl|my_center|LOCUS_31770 25217 24717 gene locus_tag LOCUS_31780 gene ureE 25217 24717 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS2 protein_id gnl|my_center|LOCUS_31780 26021 25389 gene locus_tag LOCUS_31790 26021 25389 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 protein_id gnl|my_center|LOCUS_31790 26163 27263 gene locus_tag LOCUS_31800 26163 27263 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112305.1 protein_id gnl|my_center|LOCUS_31800 27321 28403 gene locus_tag LOCUS_31810 gene desB 27321 28403 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121132.1 protein_id gnl|my_center|LOCUS_31810 28827 28459 gene locus_tag LOCUS_31820 28827 28459 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317036.1 protein_id gnl|my_center|LOCUS_31820 29028 29924 gene locus_tag LOCUS_31830 29028 29924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_31830 30249 29971 gene locus_tag LOCUS_31840 30249 29971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 30597 31487 gene locus_tag LOCUS_31850 30597 31487 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170261.1 protein_id gnl|my_center|LOCUS_31850 31604 32551 gene locus_tag LOCUS_31860 31604 32551 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_31860 32654 33160 gene locus_tag LOCUS_31870 32654 33160 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_31870 33160 34485 gene locus_tag LOCUS_31880 33160 34485 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_31880 34657 35709 gene locus_tag LOCUS_31890 34657 35709 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_31890 36051 37424 gene locus_tag LOCUS_31900 36051 37424 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_31900 37535 38923 gene locus_tag LOCUS_31910 37535 38923 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_31910 38932 40101 gene locus_tag LOCUS_31920 38932 40101 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_31920 40710 40177 gene locus_tag LOCUS_31930 40710 40177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114836.1 protein_id gnl|my_center|LOCUS_31930 41285 40803 gene locus_tag LOCUS_31940 41285 40803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931296.1 protein_id gnl|my_center|LOCUS_31940 41645 41289 gene locus_tag LOCUS_31950 41645 41289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808351.1 protein_id gnl|my_center|LOCUS_31950 42624 41737 gene locus_tag LOCUS_31960 gene gluQ 42624 41737 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P9 protein_id gnl|my_center|LOCUS_31960 43180 42737 gene locus_tag LOCUS_31970 gene dksA 43180 42737 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_31970 43387 44568 gene locus_tag LOCUS_31980 43387 44568 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV76 protein_id gnl|my_center|LOCUS_31980 44558 45265 gene locus_tag LOCUS_31990 gene sfsA 44558 45265 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY77 protein_id gnl|my_center|LOCUS_31990 45772 45455 gene locus_tag LOCUS_32000 45772 45455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_32000 48083 45870 gene locus_tag LOCUS_32010 gene phuR 48083 45870 CDS product heme/hemoglobin uptake outer membrane receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 protein_id gnl|my_center|LOCUS_32010 48214 48861 gene locus_tag LOCUS_32020 48214 48861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 48883 49953 gene locus_tag LOCUS_32030 48883 49953 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_32030 49976 50596 gene locus_tag LOCUS_32040 49976 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 50593 51012 gene locus_tag LOCUS_32050 gene exbD 50593 51012 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073467.1 protein_id gnl|my_center|LOCUS_32050 51009 51908 gene locus_tag LOCUS_32060 gene phuT 51009 51908 CDS product heme-transporter PhuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 protein_id gnl|my_center|LOCUS_32060 51905 52942 gene locus_tag LOCUS_32070 51905 52942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_32070 52942 53709 gene locus_tag LOCUS_32080 gene hmuV 52942 53709 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_32080 53719 54600 gene locus_tag LOCUS_32090 53719 54600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_32090 55974 55177 gene locus_tag LOCUS_32100 gene cbpA 55974 55177 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_32100 56353 56081 gene locus_tag LOCUS_32110 56353 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_32110 57136 56621 gene locus_tag LOCUS_32120 57136 56621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32120 57483 57139 gene locus_tag LOCUS_32130 57483 57139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_32130 59132 57570 gene locus_tag LOCUS_32140 59132 57570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_32140 59349 61568 gene locus_tag LOCUS_32150 gene mrcB 59349 61568 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_32150 61585 62307 gene locus_tag LOCUS_32160 61585 62307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246094.1 protein_id gnl|my_center|LOCUS_32160 62307 62636 gene locus_tag LOCUS_32170 62307 62636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_32170 63087 62653 gene locus_tag LOCUS_32180 63087 62653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_32180 63515 65215 gene locus_tag LOCUS_32190 gene ilvI 63515 65215 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_32190 65218 65709 gene locus_tag LOCUS_32200 gene ilvH 65218 65709 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_32200 65756 66772 gene locus_tag LOCUS_32210 gene ilvC 65756 66772 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY66 protein_id gnl|my_center|LOCUS_32210 66930 67745 gene locus_tag LOCUS_32220 gene pssA 66930 67745 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence25 1625 204 gene locus_tag LOCUS_32230 1625 204 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039738.1 protein_id gnl|my_center|LOCUS_32230 1809 1630 gene locus_tag LOCUS_32240 1809 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2612 1821 gene locus_tag LOCUS_32250 2612 1821 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_32250 2985 2614 gene locus_tag LOCUS_32260 2985 2614 CDS product conjugal transfer relaxosome component TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205281.1 protein_id gnl|my_center|LOCUS_32260 4103 4360 gene locus_tag LOCUS_32270 4103 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 6235 5924 gene locus_tag LOCUS_32280 6235 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 6522 6737 gene locus_tag LOCUS_32290 6522 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 7898 6852 gene locus_tag LOCUS_32300 gene oruR 7898 6852 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_32300 8046 8879 gene locus_tag LOCUS_32310 8046 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_32310 9093 9923 gene locus_tag LOCUS_32320 9093 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_32320 11039 10098 gene locus_tag LOCUS_32330 11039 10098 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_32330 11801 11133 gene locus_tag LOCUS_32340 11801 11133 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114215.1 protein_id gnl|my_center|LOCUS_32340 11886 12767 gene locus_tag LOCUS_32350 11886 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109435.1 protein_id gnl|my_center|LOCUS_32350 15497 12756 gene locus_tag LOCUS_32360 15497 12756 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266756.1 protein_id gnl|my_center|LOCUS_32360 17111 15744 gene locus_tag LOCUS_32370 17111 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_32370 18909 17143 gene locus_tag LOCUS_32380 18909 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_32380 20822 19140 gene locus_tag LOCUS_32390 20822 19140 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_32390 21021 22196 gene locus_tag LOCUS_32400 21021 22196 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_32400 22874 22245 gene locus_tag LOCUS_32410 22874 22245 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_32410 22955 23920 gene locus_tag LOCUS_32420 gene hprA 22955 23920 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_32420 23948 24946 gene locus_tag LOCUS_32430 gene rsmC 23948 24946 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVG4 protein_id gnl|my_center|LOCUS_32430 25201 25785 gene locus_tag LOCUS_32440 25201 25785 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_32440 25897 26340 gene locus_tag LOCUS_32450 25897 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_32450 27345 26356 gene locus_tag LOCUS_32460 27345 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121034.1 protein_id gnl|my_center|LOCUS_32460 28257 27430 gene locus_tag LOCUS_32470 28257 27430 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266752.1 protein_id gnl|my_center|LOCUS_32470 28437 30587 gene locus_tag LOCUS_32480 28437 30587 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 protein_id gnl|my_center|LOCUS_32480 31424 30807 gene locus_tag LOCUS_32490 31424 30807 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266751.1 protein_id gnl|my_center|LOCUS_32490 31798 31538 gene locus_tag LOCUS_32500 31798 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318203.1 protein_id gnl|my_center|LOCUS_32500 31980 31798 gene locus_tag LOCUS_32510 31980 31798 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318204.1 protein_id gnl|my_center|LOCUS_32510 32089 33252 gene locus_tag LOCUS_32520 32089 33252 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768804.1 protein_id gnl|my_center|LOCUS_32520 33591 33304 gene locus_tag LOCUS_32530 33591 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114705.1 protein_id gnl|my_center|LOCUS_32530 33978 34184 gene locus_tag LOCUS_32540 33978 34184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244109.1 protein_id gnl|my_center|LOCUS_32540 34832 34248 gene locus_tag LOCUS_32550 34832 34248 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406899.1 protein_id gnl|my_center|LOCUS_32550 35702 37204 gene locus_tag LOCUS_32560 gene mqo2 35702 37204 CDS product putative malate:quinone oxidoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVF1 protein_id gnl|my_center|LOCUS_32560 37630 37274 gene locus_tag LOCUS_32570 37630 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 protein_id gnl|my_center|LOCUS_32570 38113 37691 gene locus_tag LOCUS_32580 38113 37691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_32580 38560 38186 gene locus_tag LOCUS_32590 38560 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120855.1 protein_id gnl|my_center|LOCUS_32590 38709 39515 gene locus_tag LOCUS_32600 38709 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101159.1 protein_id gnl|my_center|LOCUS_32600 39665 41116 gene locus_tag LOCUS_32610 39665 41116 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP63 protein_id gnl|my_center|LOCUS_32610 42077 41304 gene locus_tag LOCUS_32620 42077 41304 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_32620 43057 42116 gene locus_tag LOCUS_32630 43057 42116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268798.1 protein_id gnl|my_center|LOCUS_32630 44177 43050 gene locus_tag LOCUS_32640 44177 43050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_32640 44497 46020 gene locus_tag LOCUS_32650 44497 46020 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_32650 46900 46289 gene locus_tag LOCUS_32660 46900 46289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101143.1 protein_id gnl|my_center|LOCUS_32660 48147 46990 gene locus_tag LOCUS_32670 48147 46990 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_32670 48380 48147 gene locus_tag LOCUS_32680 48380 48147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 48801 48463 gene locus_tag LOCUS_32690 48801 48463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 protein_id gnl|my_center|LOCUS_32690 49919 48798 gene locus_tag LOCUS_32700 49919 48798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_32700 50817 50032 gene locus_tag LOCUS_32710 50817 50032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_32710 51936 51046 gene locus_tag LOCUS_32720 51936 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 protein_id gnl|my_center|LOCUS_32720 52082 52840 gene locus_tag LOCUS_32730 52082 52840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_32730 53005 53799 gene locus_tag LOCUS_32740 53005 53799 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_32740 54550 53969 gene locus_tag LOCUS_32750 54550 53969 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_32750 54678 54980 gene locus_tag LOCUS_32760 54678 54980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093978.1 protein_id gnl|my_center|LOCUS_32760 55027 56208 gene locus_tag LOCUS_32770 55027 56208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268814.1 protein_id gnl|my_center|LOCUS_32770 56205 57254 gene locus_tag LOCUS_32780 56205 57254 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104980.1 protein_id gnl|my_center|LOCUS_32780 58256 57408 gene locus_tag LOCUS_32790 58256 57408 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 protein_id gnl|my_center|LOCUS_32790 58573 58890 gene locus_tag LOCUS_32800 58573 58890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 59889 58897 gene locus_tag LOCUS_32810 59889 58897 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268818.1 protein_id gnl|my_center|LOCUS_32810 60061 61119 gene locus_tag LOCUS_32820 60061 61119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_32820 62030 61134 gene locus_tag LOCUS_32830 gene argP 62030 61134 CDS product HTH-type transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW38 protein_id gnl|my_center|LOCUS_32830 62131 62532 gene locus_tag LOCUS_32840 62131 62532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_32840 62538 63149 gene locus_tag LOCUS_32850 62538 63149 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_32850 63347 63928 gene locus_tag LOCUS_32860 gene sodB 63347 63928 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X27 protein_id gnl|my_center|LOCUS_32860 64300 66363 gene locus_tag LOCUS_32870 gene bifA 64300 66363 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence26 99 866 gene locus_tag LOCUS_32880 99 866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_32880 897 2678 gene locus_tag LOCUS_32890 897 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3483 2806 gene locus_tag LOCUS_32900 3483 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_32900 3819 3604 gene locus_tag LOCUS_32910 3819 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349483.1 protein_id gnl|my_center|LOCUS_32910 6515 4032 gene locus_tag LOCUS_32920 gene plsB 6515 4032 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU3 protein_id gnl|my_center|LOCUS_32920 6977 7900 gene locus_tag LOCUS_32930 6977 7900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_32930 7897 8631 gene locus_tag LOCUS_32940 7897 8631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32940 8640 10475 gene locus_tag LOCUS_32950 8640 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_32950 10772 10981 gene locus_tag LOCUS_32960 10772 10981 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_32960 12047 11676 gene locus_tag LOCUS_32970 12047 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765957.1 protein_id gnl|my_center|LOCUS_32970 13152 12349 gene locus_tag LOCUS_32980 13152 12349 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_32980 14443 13289 gene locus_tag LOCUS_32990 gene dapE 14443 13289 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4H5 protein_id gnl|my_center|LOCUS_32990 17137 14543 gene locus_tag LOCUS_33000 gene ndvB 17137 14543 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_33000 18541 17369 gene locus_tag LOCUS_33010 18541 17369 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703503.1 protein_id gnl|my_center|LOCUS_33010 18701 19504 gene locus_tag LOCUS_33020 18701 19504 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406281.1 protein_id gnl|my_center|LOCUS_33020 19993 19583 gene locus_tag LOCUS_33030 19993 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092439.1 protein_id gnl|my_center|LOCUS_33030 21243 19990 gene locus_tag LOCUS_33040 gene csdA 21243 19990 CDS product cysteine sulfinate desulfinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103589.1 protein_id gnl|my_center|LOCUS_33040 21155 21478 gene locus_tag LOCUS_33050 21155 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 22541 21507 gene locus_tag LOCUS_33060 gene dapD 22541 21507 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_33060 22928 22581 gene locus_tag LOCUS_33070 22928 22581 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314287.1 protein_id gnl|my_center|LOCUS_33070 24127 22931 gene locus_tag LOCUS_33080 24127 22931 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_33080 26899 24197 gene locus_tag LOCUS_33090 gene glnD 26899 24197 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P5 protein_id gnl|my_center|LOCUS_33090 27714 26932 gene locus_tag LOCUS_33100 gene map 27714 26932 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_33100 28020 28763 gene locus_tag LOCUS_33110 gene rpsB 28020 28763 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P3 protein_id gnl|my_center|LOCUS_33110 28951 29820 gene locus_tag LOCUS_33120 gene tsf 28951 29820 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P2 protein_id gnl|my_center|LOCUS_33120 30019 30768 gene locus_tag LOCUS_33130 gene pyrH 30019 30768 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_33130 30758 31315 gene locus_tag LOCUS_33140 gene frr 30758 31315 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P0 protein_id gnl|my_center|LOCUS_33140 31332 32087 gene locus_tag LOCUS_33150 gene uppS 31332 32087 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_33150 32087 32902 gene locus_tag LOCUS_33160 gene cdsA 32087 32902 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_33160 32899 34086 gene locus_tag LOCUS_33170 gene dxr 32899 34086 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 protein_id gnl|my_center|LOCUS_33170 34105 35457 gene locus_tag LOCUS_33180 34105 35457 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_33180 35548 37941 gene locus_tag LOCUS_33190 gene opr86 35548 37941 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_33190 37989 38492 gene locus_tag LOCUS_33200 37989 38492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_33200 38495 39553 gene locus_tag LOCUS_33210 gene lpxD 38495 39553 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_33210 39602 40042 gene locus_tag LOCUS_33220 gene fabZ 39602 40042 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_33220 40039 40815 gene locus_tag LOCUS_33230 gene lpxA 40039 40815 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_33230 40818 41951 gene locus_tag LOCUS_33240 gene lpxB 40818 41951 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_33240 41951 42547 gene locus_tag LOCUS_33250 gene rnhB 41951 42547 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_33250 42757 44166 gene locus_tag LOCUS_33260 42757 44166 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092370.1 protein_id gnl|my_center|LOCUS_33260 44316 47837 gene locus_tag LOCUS_33270 gene dnaE 44316 47837 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_33270 47973 48923 gene locus_tag LOCUS_33280 gene accA 47973 48923 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR2 protein_id gnl|my_center|LOCUS_33280 48924 50237 gene locus_tag LOCUS_33290 gene tilS 48924 50237 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ3 protein_id gnl|my_center|LOCUS_33290 50515 52038 gene locus_tag LOCUS_33300 gene pyrG 50515 52038 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M5 protein_id gnl|my_center|LOCUS_33300 52043 52888 gene locus_tag LOCUS_33310 gene kdsA 52043 52888 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_33310 53034 54323 gene locus_tag LOCUS_33320 gene eno 53034 54323 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_33320 54506 54784 gene locus_tag LOCUS_33330 gene ftsB 54506 54784 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ6 protein_id gnl|my_center|LOCUS_33330 54781 55506 gene locus_tag LOCUS_33340 gene ispD 54781 55506 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M1 protein_id gnl|my_center|LOCUS_33340 55845 55531 gene locus_tag LOCUS_33350 55845 55531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 56913 56026 gene locus_tag LOCUS_33360 56913 56026 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 protein_id gnl|my_center|LOCUS_33360 57049 58161 gene locus_tag LOCUS_33370 gene adhC 57049 58161 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY01 protein_id gnl|my_center|LOCUS_33370 58170 59015 gene locus_tag LOCUS_33380 58170 59015 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ3 protein_id gnl|my_center|LOCUS_33380 59115 59588 gene locus_tag LOCUS_33390 gene ispF 59115 59588 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ2 protein_id gnl|my_center|LOCUS_33390 59585 60643 gene locus_tag LOCUS_33400 gene truD 59585 60643 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ1 protein_id gnl|my_center|LOCUS_33400 60631 61380 gene locus_tag LOCUS_33410 gene surE 60631 61380 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ0 protein_id gnl|my_center|LOCUS_33410 61380 62057 gene locus_tag LOCUS_33420 gene pcm 61380 62057 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_33420 62077 63015 gene locus_tag LOCUS_33430 62077 63015 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_33430 63310 63077 gene locus_tag LOCUS_33440 63310 63077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 63674 63913 gene locus_tag LOCUS_33450 63674 63913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 64019 65026 gene locus_tag LOCUS_33460 gene rpoS 64019 65026 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_33460 >Feature sequence27 353 1666 gene locus_tag LOCUS_33470 gene braB 353 1666 CDS product branched-chain amino acid transport system 2 carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19072 protein_id gnl|my_center|LOCUS_33470 1767 2501 gene locus_tag LOCUS_33480 1767 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_33480 2498 2890 gene locus_tag LOCUS_33490 2498 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3238 2948 gene locus_tag LOCUS_33500 3238 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3428 3904 gene locus_tag LOCUS_33510 3428 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_33510 3901 4347 gene locus_tag LOCUS_33520 3901 4347 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_33520 4377 5633 gene locus_tag LOCUS_33530 4377 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114261.1 protein_id gnl|my_center|LOCUS_33530 5737 7299 gene locus_tag LOCUS_33540 gene htpG 5737 7299 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33540 7335 7637 gene locus_tag LOCUS_33550 7335 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33550 7742 8524 gene locus_tag LOCUS_33560 7742 8524 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390585.1 protein_id gnl|my_center|LOCUS_33560 9361 8570 gene locus_tag LOCUS_33570 9361 8570 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_33570 10252 9533 gene locus_tag LOCUS_33580 10252 9533 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_33580 10797 10249 gene locus_tag LOCUS_33590 10797 10249 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_33590 11761 10901 gene locus_tag LOCUS_33600 11761 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522639.1 protein_id gnl|my_center|LOCUS_33600 12159 11758 gene locus_tag LOCUS_33610 12159 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 13619 12228 gene locus_tag LOCUS_33620 13619 12228 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545572.1 protein_id gnl|my_center|LOCUS_33620 13877 14899 gene locus_tag LOCUS_33630 13877 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_33630 14963 15427 gene locus_tag LOCUS_33640 14963 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087466.1 protein_id gnl|my_center|LOCUS_33640 15580 15885 gene locus_tag LOCUS_33650 15580 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33650 16121 17746 gene locus_tag LOCUS_33660 16121 17746 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_33660 19155 17935 gene locus_tag LOCUS_33670 gene fabB 19155 17935 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_33670 19683 19168 gene locus_tag LOCUS_33680 gene fabA 19683 19168 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_33680 19898 19680 gene locus_tag LOCUS_33690 19898 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 21819 19891 gene locus_tag LOCUS_33700 21819 19891 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_33700 22697 21816 gene locus_tag LOCUS_33710 22697 21816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895578.1 protein_id gnl|my_center|LOCUS_33710 24900 22744 gene locus_tag LOCUS_33720 24900 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_33720 25042 26064 gene locus_tag LOCUS_33730 gene gpsA 25042 26064 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y4 protein_id gnl|my_center|LOCUS_33730 26094 26441 gene locus_tag LOCUS_33740 26094 26441 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_33740 26452 26916 gene locus_tag LOCUS_33750 26452 26916 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_33750 27031 28698 gene locus_tag LOCUS_33760 27031 28698 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_33760 28802 29248 gene locus_tag LOCUS_33770 28802 29248 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_33770 29527 30336 gene locus_tag LOCUS_33780 29527 30336 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_33780 30333 31196 gene locus_tag LOCUS_33790 30333 31196 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_33790 31248 31910 gene locus_tag LOCUS_33800 31248 31910 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_33800 31910 32722 gene locus_tag LOCUS_33810 31910 32722 CDS product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267384.1 protein_id gnl|my_center|LOCUS_33810 32897 33976 gene locus_tag LOCUS_33820 32897 33976 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_33820 34310 36010 gene locus_tag LOCUS_33830 gene kdpA 34310 36010 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57683 protein_id gnl|my_center|LOCUS_33830 36167 38227 gene locus_tag LOCUS_33840 gene kdpB 36167 38227 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57698 protein_id gnl|my_center|LOCUS_33840 38287 38937 gene locus_tag LOCUS_33850 gene kdpC 38287 38937 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57686 protein_id gnl|my_center|LOCUS_33850 38943 41594 gene locus_tag LOCUS_33860 gene kdpD 38943 41594 CDS product two-component sensor KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114597.1 protein_id gnl|my_center|LOCUS_33860 41644 42342 gene locus_tag LOCUS_33870 gene kdpE 41644 42342 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_33870 42475 43617 gene locus_tag LOCUS_33880 42475 43617 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_33880 43614 44297 gene locus_tag LOCUS_33890 43614 44297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_33890 44297 45511 gene locus_tag LOCUS_33900 44297 45511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583105.1 protein_id gnl|my_center|LOCUS_33900 45511 46707 gene locus_tag LOCUS_33910 45511 46707 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_33910 47765 46716 gene locus_tag LOCUS_33920 47765 46716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_33920 47875 48909 gene locus_tag LOCUS_33930 gene selD 47875 48909 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I383 protein_id gnl|my_center|LOCUS_33930 48909 50009 gene locus_tag LOCUS_33940 gene selU 48909 50009 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_33940 50099 50377 gene locus_tag LOCUS_33950 50099 50377 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316607.1 protein_id gnl|my_center|LOCUS_33950 50377 50985 gene locus_tag LOCUS_33960 50377 50985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_33960 51176 53140 gene locus_tag LOCUS_33970 51176 53140 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 protein_id gnl|my_center|LOCUS_33970 53243 54160 gene locus_tag LOCUS_33980 53243 54160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_33980 54193 55113 gene locus_tag LOCUS_33990 54193 55113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_33990 55110 57125 gene locus_tag LOCUS_34000 gene tgpA 55110 57125 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_34000 57190 57966 gene locus_tag LOCUS_34010 57190 57966 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103916.1 protein_id gnl|my_center|LOCUS_34010 58073 58870 gene locus_tag LOCUS_34020 58073 58870 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_34020 59233 58886 gene locus_tag LOCUS_34030 59233 58886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101677.1 protein_id gnl|my_center|LOCUS_34030 60147 59335 gene locus_tag LOCUS_34040 60147 59335 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_34040 60385 61800 gene locus_tag LOCUS_34050 60385 61800 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114749.1 protein_id gnl|my_center|LOCUS_34050 61905 62339 gene locus_tag LOCUS_34060 61905 62339 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765767.1 protein_id gnl|my_center|LOCUS_34060 63418 62387 gene locus_tag LOCUS_34070 gene lifO 63418 62387 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_34070 64297 63494 gene locus_tag LOCUS_34080 gene lip 64297 63494 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_34080 >Feature sequence28 1318 209 gene locus_tag LOCUS_34090 1318 209 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_34090 2010 1330 gene locus_tag LOCUS_34100 gene piuC 2010 1330 CDS product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 protein_id gnl|my_center|LOCUS_34100 5178 2875 gene locus_tag LOCUS_34110 5178 2875 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_34110 6813 5650 gene locus_tag LOCUS_34120 6813 5650 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_34120 7287 8870 gene locus_tag LOCUS_34130 gene prfC 7287 8870 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI9 protein_id gnl|my_center|LOCUS_34130 9501 9103 gene locus_tag LOCUS_34140 9501 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 11378 9636 gene locus_tag LOCUS_34150 11378 9636 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103366.1 protein_id gnl|my_center|LOCUS_34150 12328 11393 gene locus_tag LOCUS_34160 12328 11393 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY92 protein_id gnl|my_center|LOCUS_34160 15198 12328 gene locus_tag LOCUS_34170 gene fruI 15198 12328 CDS product PTS fructose transporter subunit FruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_34170 15378 16382 gene locus_tag LOCUS_34180 gene fruR 15378 16382 CDS product FruR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_34180 16464 17249 gene locus_tag LOCUS_34190 16464 17249 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_34190 18287 17253 gene locus_tag LOCUS_34200 gene amiB 18287 17253 CDS product ATP-dependent protease ATP-binding subunit-like protein AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51416 protein_id gnl|my_center|LOCUS_34200 19422 18382 gene locus_tag LOCUS_34210 gene amiE 19422 18382 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 protein_id gnl|my_center|LOCUS_34210 19846 19499 gene locus_tag LOCUS_34220 19846 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_34220 21162 19933 gene locus_tag LOCUS_34230 gene fmdA 21162 19933 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_34230 22078 21389 gene locus_tag LOCUS_34240 22078 21389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_34240 22906 22145 gene locus_tag LOCUS_34250 22906 22145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_34250 24075 22903 gene locus_tag LOCUS_34260 24075 22903 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_34260 25004 24087 gene locus_tag LOCUS_34270 25004 24087 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104864.1 protein_id gnl|my_center|LOCUS_34270 26335 25106 gene locus_tag LOCUS_34280 26335 25106 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_34280 26615 30013 gene locus_tag LOCUS_34290 26615 30013 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104865.1 protein_id gnl|my_center|LOCUS_34290 29988 30695 gene locus_tag LOCUS_34300 29988 30695 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_34300 32928 30898 gene locus_tag LOCUS_34310 32928 30898 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_34310 34217 33381 gene locus_tag LOCUS_34320 34217 33381 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 protein_id gnl|my_center|LOCUS_34320 34777 34214 gene locus_tag LOCUS_34330 34777 34214 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_34330 37534 35216 gene locus_tag LOCUS_34340 37534 35216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_34340 38167 39015 gene locus_tag LOCUS_34350 38167 39015 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_34350 39569 39174 gene locus_tag LOCUS_34360 gene pilE 39569 39174 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_34360 39793 41496 gene locus_tag LOCUS_34370 gene pilB 39793 41496 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_34370 41500 42717 gene locus_tag LOCUS_34380 gene pilC 41500 42717 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_34380 42721 43593 gene locus_tag LOCUS_34390 gene pilD 42721 43593 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 protein_id gnl|my_center|LOCUS_34390 43678 44286 gene locus_tag LOCUS_34400 gene coaE 43678 44286 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_34400 44283 44483 gene locus_tag LOCUS_34410 gene yacG 44283 44483 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_34410 45338 44649 gene locus_tag LOCUS_34420 45338 44649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_34420 45558 46187 gene locus_tag LOCUS_34430 45558 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266631.1 protein_id gnl|my_center|LOCUS_34430 46184 46678 gene locus_tag LOCUS_34440 46184 46678 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406554.1 protein_id gnl|my_center|LOCUS_34440 46766 46939 gene locus_tag LOCUS_34450 46766 46939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 47003 48304 gene locus_tag LOCUS_34460 gene ndH 47003 48304 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614782.1 protein_id gnl|my_center|LOCUS_34460 48666 49526 gene locus_tag LOCUS_34470 48666 49526 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 protein_id gnl|my_center|LOCUS_34470 49528 50271 gene locus_tag LOCUS_34480 49528 50271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267080.1 protein_id gnl|my_center|LOCUS_34480 50271 50969 gene locus_tag LOCUS_34490 50271 50969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267079.1 protein_id gnl|my_center|LOCUS_34490 50966 52315 gene locus_tag LOCUS_34500 50966 52315 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW91 protein_id gnl|my_center|LOCUS_34500 52312 52500 gene locus_tag LOCUS_34510 52312 52500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 52490 53011 gene locus_tag LOCUS_34520 52490 53011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 53008 53322 gene locus_tag LOCUS_34530 53008 53322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 53319 55094 gene locus_tag LOCUS_34540 53319 55094 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267075.1 protein_id gnl|my_center|LOCUS_34540 55123 55830 gene locus_tag LOCUS_34550 55123 55830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267074.1 protein_id gnl|my_center|LOCUS_34550 55827 57158 gene locus_tag LOCUS_34560 55827 57158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267073.1 protein_id gnl|my_center|LOCUS_34560 57199 57567 gene locus_tag LOCUS_34570 57199 57567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 58120 58854 gene locus_tag LOCUS_34580 58120 58854 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895544.1 protein_id gnl|my_center|LOCUS_34580 58860 59399 gene locus_tag LOCUS_34590 58860 59399 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_34590 59413 59874 gene locus_tag LOCUS_34600 59413 59874 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWA0 protein_id gnl|my_center|LOCUS_34600 60534 62438 gene locus_tag LOCUS_34610 60534 62438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 62570 62728 gene locus_tag LOCUS_34620 62570 62728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 62725 64122 gene locus_tag LOCUS_34630 62725 64122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence29 968 312 gene locus_tag LOCUS_34640 gene dhcB 968 312 CDS product dehydrocarnitine CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_34640 1701 1003 gene locus_tag LOCUS_34650 gene dhcA 1701 1003 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_34650 1826 2737 gene locus_tag LOCUS_34660 gene dhcR 1826 2737 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_34660 3451 2747 gene locus_tag LOCUS_34670 3451 2747 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_34670 4539 3448 gene locus_tag LOCUS_34680 4539 3448 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_34680 5721 4675 gene locus_tag LOCUS_34690 5721 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 protein_id gnl|my_center|LOCUS_34690 5932 6990 gene locus_tag LOCUS_34700 gene purM 5932 6990 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_34700 6990 7640 gene locus_tag LOCUS_34710 gene purN 6990 7640 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_34710 7649 8365 gene locus_tag LOCUS_34720 7649 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_34720 8461 8736 gene locus_tag LOCUS_34730 8461 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112586.1 protein_id gnl|my_center|LOCUS_34730 9409 8870 gene locus_tag LOCUS_34740 9409 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616372.1 protein_id gnl|my_center|LOCUS_34740 10351 9518 gene locus_tag LOCUS_34750 gene mazG 10351 9518 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_34750 12830 10587 gene locus_tag LOCUS_34760 12830 10587 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 protein_id gnl|my_center|LOCUS_34760 14354 13002 gene locus_tag LOCUS_34770 gene rlmD 14354 13002 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y8 protein_id gnl|my_center|LOCUS_34770 15259 14354 gene locus_tag LOCUS_34780 gene cysM 15259 14354 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_34780 16698 15349 gene locus_tag LOCUS_34790 16698 15349 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_34790 17410 16700 gene locus_tag LOCUS_34800 17410 16700 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102425.1 protein_id gnl|my_center|LOCUS_34800 17529 20282 gene locus_tag LOCUS_34810 17529 20282 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ42 protein_id gnl|my_center|LOCUS_34810 20366 20803 gene locus_tag LOCUS_34820 20366 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112592.1 protein_id gnl|my_center|LOCUS_34820 20800 21204 gene locus_tag LOCUS_34830 20800 21204 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103672.1 protein_id gnl|my_center|LOCUS_34830 22440 21379 gene locus_tag LOCUS_34840 gene dinB 22440 21379 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM4 protein_id gnl|my_center|LOCUS_34840 22590 22468 gene locus_tag LOCUS_34850 22590 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 22937 23013 gene locus_tag LOCUS_t00420 22937 23013 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23134 23210 gene locus_tag LOCUS_t00430 23134 23210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23345 23893 gene locus_tag LOCUS_34860 23345 23893 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_34860 24054 25376 gene locus_tag LOCUS_34870 gene rimO 24054 25376 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_34870 25561 25932 gene locus_tag LOCUS_34880 25561 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 26089 26400 gene locus_tag LOCUS_34890 26089 26400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 26835 26413 gene locus_tag LOCUS_34900 26835 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 protein_id gnl|my_center|LOCUS_34900 26876 27547 gene locus_tag LOCUS_34910 26876 27547 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268696.1 protein_id gnl|my_center|LOCUS_34910 27679 28677 gene locus_tag LOCUS_34920 gene gap 27679 28677 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU5 protein_id gnl|my_center|LOCUS_34920 28836 30452 gene locus_tag LOCUS_34930 28836 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_34930 31409 30486 gene locus_tag LOCUS_34940 31409 30486 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112652.1 protein_id gnl|my_center|LOCUS_34940 31553 32305 gene locus_tag LOCUS_34950 31553 32305 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771315.1 protein_id gnl|my_center|LOCUS_34950 32738 32466 gene locus_tag LOCUS_34960 32738 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 32920 32711 gene locus_tag LOCUS_34970 32920 32711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 33927 33019 gene locus_tag LOCUS_34980 33927 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_34980 34543 34211 gene locus_tag LOCUS_34990 34543 34211 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_34990 34822 34553 gene locus_tag LOCUS_35000 34822 34553 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_35000 35310 34807 gene locus_tag LOCUS_35010 35310 34807 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_35010 36812 35307 gene locus_tag LOCUS_35020 36812 35307 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_35020 37138 36809 gene locus_tag LOCUS_35030 37138 36809 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_35030 39932 37140 gene locus_tag LOCUS_35040 39932 37140 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_35040 40742 40278 gene locus_tag LOCUS_35050 40742 40278 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_35050 41980 40838 gene locus_tag LOCUS_35060 41980 40838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_35060 43392 42034 gene locus_tag LOCUS_35070 43392 42034 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_35070 44646 43537 gene locus_tag LOCUS_35080 44646 43537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112517.1 protein_id gnl|my_center|LOCUS_35080 45382 44735 gene locus_tag LOCUS_35090 gene pdxH 45382 44735 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPN9 protein_id gnl|my_center|LOCUS_35090 46125 45415 gene locus_tag LOCUS_35100 46125 45415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 47367 46222 gene locus_tag LOCUS_35110 47367 46222 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_35110 49657 47465 gene locus_tag LOCUS_35120 49657 47465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_35120 52139 49995 gene locus_tag LOCUS_35130 52139 49995 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_35130 52291 52755 gene locus_tag LOCUS_35140 52291 52755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_35140 53742 52981 gene locus_tag LOCUS_35150 53742 52981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268703.1 protein_id gnl|my_center|LOCUS_35150 54034 53735 gene locus_tag LOCUS_35160 54034 53735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082018.1 protein_id gnl|my_center|LOCUS_35160 54843 54190 gene locus_tag LOCUS_35170 54843 54190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082015.1 protein_id gnl|my_center|LOCUS_35170 55622 55224 gene locus_tag LOCUS_35180 55622 55224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 56017 56514 gene locus_tag LOCUS_35190 56017 56514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381502.1 protein_id gnl|my_center|LOCUS_35190 56636 57007 gene locus_tag LOCUS_35200 56636 57007 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPM9 protein_id gnl|my_center|LOCUS_35200 57593 57036 gene locus_tag LOCUS_35210 57593 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_35210 57706 58203 gene locus_tag LOCUS_35220 57706 58203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_35220 58427 58891 gene locus_tag LOCUS_35230 58427 58891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 59053 61590 gene locus_tag LOCUS_35240 gene quiP 59053 61590 CDS product acyl-homoserine lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U2 protein_id gnl|my_center|LOCUS_35240 62342 61776 gene locus_tag LOCUS_35250 gene dcd 62342 61776 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_35250 62666 62875 gene locus_tag LOCUS_35260 gene capB 62666 62875 CDS product cold shock protein CapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A105 protein_id gnl|my_center|LOCUS_35260 >Feature sequence30 557 159 gene locus_tag LOCUS_35270 557 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 994 563 gene locus_tag LOCUS_35280 994 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 1523 1320 gene locus_tag LOCUS_35290 1523 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1848 2621 gene locus_tag LOCUS_35300 1848 2621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_35300 2688 3290 gene locus_tag LOCUS_35310 2688 3290 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770603.1 protein_id gnl|my_center|LOCUS_35310 3301 3867 gene locus_tag LOCUS_35320 3301 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_35320 5700 4036 gene locus_tag LOCUS_35330 5700 4036 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_35330 6019 6768 gene locus_tag LOCUS_35340 gene etfB 6019 6768 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_35340 6769 7713 gene locus_tag LOCUS_35350 6769 7713 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_35350 8931 7999 gene locus_tag LOCUS_35360 8931 7999 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_35360 9047 9877 gene locus_tag LOCUS_35370 9047 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_35370 9887 10240 gene locus_tag LOCUS_35380 9887 10240 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409835.1 protein_id gnl|my_center|LOCUS_35380 10237 11049 gene locus_tag LOCUS_35390 10237 11049 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267374.1 protein_id gnl|my_center|LOCUS_35390 11400 12839 gene locus_tag LOCUS_35400 11400 12839 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_35400 13075 14793 gene locus_tag LOCUS_35410 13075 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638263.2 protein_id gnl|my_center|LOCUS_35410 14790 15392 gene locus_tag LOCUS_35420 14790 15392 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_35420 15389 16030 gene locus_tag LOCUS_35430 15389 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 16100 16588 gene locus_tag LOCUS_35440 16100 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 18431 16605 gene locus_tag LOCUS_35450 gene atuH 18431 16605 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_35450 19544 18696 gene locus_tag LOCUS_35460 gene atuG 19544 18696 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_35460 21639 19651 gene locus_tag LOCUS_35470 gene atuF 21639 19651 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_35470 22554 21754 gene locus_tag LOCUS_35480 gene atuE 22554 21754 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_35480 23893 22736 gene locus_tag LOCUS_35490 gene atuD 23893 22736 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_35490 25601 23985 gene locus_tag LOCUS_35500 gene atuC 25601 23985 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_35500 26484 25606 gene locus_tag LOCUS_35510 gene atuB 26484 25606 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_35510 28356 26569 gene locus_tag LOCUS_35520 gene atuA 28356 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_35520 28625 29221 gene locus_tag LOCUS_35530 gene atuR 28625 29221 CDS product atu genes repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_35530 29337 30122 gene locus_tag LOCUS_35540 29337 30122 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103807.1 protein_id gnl|my_center|LOCUS_35540 30279 31013 gene locus_tag LOCUS_35550 30279 31013 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103807.1 protein_id gnl|my_center|LOCUS_35550 31722 30964 gene locus_tag LOCUS_35560 31722 30964 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090986.1 protein_id gnl|my_center|LOCUS_35560 33142 31772 gene locus_tag LOCUS_35570 33142 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 33320 33144 gene locus_tag LOCUS_35580 33320 33144 CDS product DUF2897 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766904.1 protein_id gnl|my_center|LOCUS_35580 34183 33374 gene locus_tag LOCUS_35590 gene eutC 34183 33374 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFC6 protein_id gnl|my_center|LOCUS_35590 35589 34195 gene locus_tag LOCUS_35600 gene eutB 35589 34195 CDS product ethanolamine ammonia-lyase heavy chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_35600 35908 35651 gene locus_tag LOCUS_35610 35908 35651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 36216 37532 gene locus_tag LOCUS_35620 36216 37532 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_35620 37534 38448 gene locus_tag LOCUS_35630 37534 38448 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_35630 39934 38588 gene locus_tag LOCUS_35640 39934 38588 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q9 protein_id gnl|my_center|LOCUS_35640 40768 40037 gene locus_tag LOCUS_35650 40768 40037 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV9 protein_id gnl|my_center|LOCUS_35650 41550 40768 gene locus_tag LOCUS_35660 41550 40768 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_35660 42476 41547 gene locus_tag LOCUS_35670 42476 41547 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_35670 43800 42457 gene locus_tag LOCUS_35680 43800 42457 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_35680 43967 44740 gene locus_tag LOCUS_35690 43967 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404195.1 protein_id gnl|my_center|LOCUS_35690 45634 44843 gene locus_tag LOCUS_35700 45634 44843 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_35700 46020 47702 gene locus_tag LOCUS_35710 gene deaD 46020 47702 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q6 protein_id gnl|my_center|LOCUS_35710 48533 47766 gene locus_tag LOCUS_35720 48533 47766 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 protein_id gnl|my_center|LOCUS_35720 49848 48628 gene locus_tag LOCUS_35730 49848 48628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 49932 50591 gene locus_tag LOCUS_35740 gene tpm 49932 50591 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_35740 51628 50756 gene locus_tag LOCUS_35750 gene htpX 51628 50756 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I013 protein_id gnl|my_center|LOCUS_35750 52170 51718 gene locus_tag LOCUS_35760 52170 51718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_35760 52918 52175 gene locus_tag LOCUS_35770 52918 52175 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097194.1 protein_id gnl|my_center|LOCUS_35770 54142 52931 gene locus_tag LOCUS_35780 54142 52931 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004657364.1 protein_id gnl|my_center|LOCUS_35780 54382 54777 gene locus_tag LOCUS_35790 gene msrB 54382 54777 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_35790 54958 55443 gene locus_tag LOCUS_35800 54958 55443 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I017 protein_id gnl|my_center|LOCUS_35800 55440 55910 gene locus_tag LOCUS_35810 gene ospR 55440 55910 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114767.1 protein_id gnl|my_center|LOCUS_35810 58215 55894 gene locus_tag LOCUS_35820 58215 55894 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114768.1 protein_id gnl|my_center|LOCUS_35820 58318 59208 gene locus_tag LOCUS_35830 58318 59208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098802.1 protein_id gnl|my_center|LOCUS_35830 59205 59687 gene locus_tag LOCUS_35840 59205 59687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 protein_id gnl|my_center|LOCUS_35840 60393 59731 gene locus_tag LOCUS_35850 60393 59731 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_35850 61214 60444 gene locus_tag LOCUS_35860 61214 60444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114771.1 protein_id gnl|my_center|LOCUS_35860 61439 61514 gene locus_tag LOCUS_t00440 61439 61514 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 61538 61613 gene locus_tag LOCUS_t00450 61538 61613 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61685 61760 gene locus_tag LOCUS_t00460 61685 61760 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 61787 61862 gene locus_tag LOCUS_t00470 61787 61862 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62086 62745 gene locus_tag LOCUS_35870 62086 62745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence31 473 1303 gene locus_tag LOCUS_35880 473 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1321 3885 gene locus_tag LOCUS_35890 1321 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4919 3918 gene locus_tag LOCUS_35900 4919 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 6412 5141 gene locus_tag LOCUS_35910 gene ampG4 6412 5141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_35910 6640 7545 gene locus_tag LOCUS_35920 6640 7545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268374.1 protein_id gnl|my_center|LOCUS_35920 8227 7553 gene locus_tag LOCUS_35930 8227 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 11370 8491 gene locus_tag LOCUS_35940 11370 8491 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 protein_id gnl|my_center|LOCUS_35940 11604 13811 gene locus_tag LOCUS_35950 gene uvrD 11604 13811 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_35950 14025 15116 gene locus_tag LOCUS_35960 14025 15116 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_35960 15300 15881 gene locus_tag LOCUS_35970 15300 15881 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_35970 16526 15891 gene locus_tag LOCUS_35980 16526 15891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_35980 16677 17519 gene locus_tag LOCUS_35990 16677 17519 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269406.1 protein_id gnl|my_center|LOCUS_35990 17688 18098 gene locus_tag LOCUS_36000 17688 18098 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316056.1 protein_id gnl|my_center|LOCUS_36000 19922 18159 gene locus_tag LOCUS_36010 19922 18159 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_36010 20766 20119 gene locus_tag LOCUS_36020 20766 20119 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_36020 21031 22422 gene locus_tag LOCUS_36030 21031 22422 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 protein_id gnl|my_center|LOCUS_36030 22513 23880 gene locus_tag LOCUS_36040 22513 23880 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_36040 24053 24568 gene locus_tag LOCUS_36050 24053 24568 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_36050 24732 26420 gene locus_tag LOCUS_36060 24732 26420 CDS product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114136.1 protein_id gnl|my_center|LOCUS_36060 26490 26900 gene locus_tag LOCUS_36070 26490 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 protein_id gnl|my_center|LOCUS_36070 27293 26952 gene locus_tag LOCUS_36080 27293 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 28178 27297 gene locus_tag LOCUS_36090 gene poxA 28178 27297 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_36090 28672 28517 gene locus_tag LOCUS_36100 28672 28517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36100 29833 28718 gene locus_tag LOCUS_36110 29833 28718 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971260.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36110 30028 30387 gene locus_tag LOCUS_36120 30028 30387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 31376 30411 gene locus_tag LOCUS_36130 31376 30411 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269408.1 protein_id gnl|my_center|LOCUS_36130 31604 31957 gene locus_tag LOCUS_36140 31604 31957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099679.1 protein_id gnl|my_center|LOCUS_36140 32736 32092 gene locus_tag LOCUS_36150 32736 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_36150 33941 32736 gene locus_tag LOCUS_36160 33941 32736 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 protein_id gnl|my_center|LOCUS_36160 34372 33968 gene locus_tag LOCUS_36170 gene dksA 34372 33968 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT38 protein_id gnl|my_center|LOCUS_36170 34859 36298 gene locus_tag LOCUS_36180 gene clsA 34859 36298 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH0 protein_id gnl|my_center|LOCUS_36180 36635 37372 gene locus_tag LOCUS_36190 36635 37372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 38686 37466 gene locus_tag LOCUS_36200 38686 37466 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_36200 40865 38748 gene locus_tag LOCUS_36210 gene fpvA1 40865 38748 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_36210 41749 41222 gene locus_tag LOCUS_36220 41749 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105545.1 protein_id gnl|my_center|LOCUS_36220 42345 41842 gene locus_tag LOCUS_36230 42345 41842 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_36230 42727 44010 gene locus_tag LOCUS_36240 42727 44010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_36240 44007 44291 gene locus_tag LOCUS_36250 44007 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 44230 44442 gene locus_tag LOCUS_36260 44230 44442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36260 44994 44575 gene locus_tag LOCUS_36270 44994 44575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_36270 47018 44991 gene locus_tag LOCUS_36280 47018 44991 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_36280 48124 47171 gene locus_tag LOCUS_36290 48124 47171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_36290 48039 48269 gene locus_tag LOCUS_36300 48039 48269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 49932 48589 gene locus_tag LOCUS_36310 gene mifR 49932 48589 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_36310 51818 50136 gene locus_tag LOCUS_36320 gene mifS 51818 50136 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114131.1 protein_id gnl|my_center|LOCUS_36320 53131 51947 gene locus_tag LOCUS_36330 53131 51947 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 protein_id gnl|my_center|LOCUS_36330 53998 53213 gene locus_tag LOCUS_36340 53998 53213 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_36340 54834 53989 gene locus_tag LOCUS_36350 54834 53989 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_36350 55142 54888 gene locus_tag LOCUS_36360 55142 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_36360 57174 55267 gene locus_tag LOCUS_36370 57174 55267 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088479.1 protein_id gnl|my_center|LOCUS_36370 57474 58850 gene locus_tag LOCUS_36380 gene nrtA 57474 58850 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_36380 58850 59686 gene locus_tag LOCUS_36390 gene nrtB 58850 59686 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 protein_id gnl|my_center|LOCUS_36390 59691 60605 gene locus_tag LOCUS_36400 gene nrtC 59691 60605 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_36400 60598 61038 gene locus_tag LOCUS_36410 gene cynS 60598 61038 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R365 protein_id gnl|my_center|LOCUS_36410 61271 61107 gene locus_tag LOCUS_36420 61271 61107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 61909 61616 gene locus_tag LOCUS_36430 61909 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 62255 62064 gene locus_tag LOCUS_36440 62255 62064 CDS product putative tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y491 protein_id gnl|my_center|LOCUS_36440 >Feature sequence32 203 1717 gene locus_tag LOCUS_36450 203 1717 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_36450 3210 2110 gene locus_tag LOCUS_36460 3210 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_36460 7037 3207 gene locus_tag LOCUS_36470 7037 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 protein_id gnl|my_center|LOCUS_36470 7801 7034 gene locus_tag LOCUS_36480 7801 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 protein_id gnl|my_center|LOCUS_36480 9115 7820 gene locus_tag LOCUS_36490 9115 7820 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_36490 9771 9223 gene locus_tag LOCUS_36500 9771 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_36500 9910 10488 gene locus_tag LOCUS_36510 9910 10488 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_36510 10518 12005 gene locus_tag LOCUS_36520 10518 12005 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_36520 12082 12579 gene locus_tag LOCUS_36530 12082 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_36530 12670 13047 gene locus_tag LOCUS_36540 12670 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114519.1 protein_id gnl|my_center|LOCUS_36540 13031 14824 gene locus_tag LOCUS_36550 13031 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_36550 14788 15807 gene locus_tag LOCUS_36560 14788 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 protein_id gnl|my_center|LOCUS_36560 15885 18359 gene locus_tag LOCUS_36570 15885 18359 CDS product ClpA/B-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114516.1 protein_id gnl|my_center|LOCUS_36570 18535 19314 gene locus_tag LOCUS_36580 18535 19314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 19510 20298 gene locus_tag LOCUS_36590 19510 20298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 20365 22371 gene locus_tag LOCUS_36600 20365 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_36600 22382 22927 gene locus_tag LOCUS_36610 22382 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114514.1 protein_id gnl|my_center|LOCUS_36610 23328 22933 gene locus_tag LOCUS_36620 23328 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_36620 24372 23365 gene locus_tag LOCUS_36630 24372 23365 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113302.1 protein_id gnl|my_center|LOCUS_36630 24677 25594 gene locus_tag LOCUS_36640 24677 25594 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_36640 25836 27077 gene locus_tag LOCUS_36650 gene mexE 25836 27077 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_36650 27092 30271 gene locus_tag LOCUS_36660 gene mexF 27092 30271 CDS product resistance-nodulation-cell division multidrug efflux transporter MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_36660 30268 31671 gene locus_tag LOCUS_36670 gene oprN 30268 31671 CDS product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_36670 31947 33224 gene locus_tag LOCUS_36680 31947 33224 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267685.1 protein_id gnl|my_center|LOCUS_36680 33967 33233 gene locus_tag LOCUS_36690 33967 33233 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 protein_id gnl|my_center|LOCUS_36690 34461 35468 gene locus_tag LOCUS_36700 34461 35468 CDS product c4-dicarboxylate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_36700 36896 35682 gene locus_tag LOCUS_36710 36896 35682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113304.1 protein_id gnl|my_center|LOCUS_36710 38985 36898 gene locus_tag LOCUS_36720 38985 36898 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104176.1 protein_id gnl|my_center|LOCUS_36720 40676 39183 gene locus_tag LOCUS_36730 40676 39183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_36730 43780 40673 gene locus_tag LOCUS_36740 43780 40673 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104174.1 protein_id gnl|my_center|LOCUS_36740 46979 43887 gene locus_tag LOCUS_36750 46979 43887 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_36750 48190 46976 gene locus_tag LOCUS_36760 48190 46976 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267712.1 protein_id gnl|my_center|LOCUS_36760 48848 48348 gene locus_tag LOCUS_36770 gene tpx 48848 48348 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 protein_id gnl|my_center|LOCUS_36770 50569 49226 gene locus_tag LOCUS_36780 50569 49226 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_36780 54455 50787 gene locus_tag LOCUS_36790 54455 50787 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104171.1 protein_id gnl|my_center|LOCUS_36790 56182 54452 gene locus_tag LOCUS_36800 56182 54452 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 protein_id gnl|my_center|LOCUS_36800 56914 56273 gene locus_tag LOCUS_36810 56914 56273 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345438.1 protein_id gnl|my_center|LOCUS_36810 57051 57863 gene locus_tag LOCUS_36820 gene xthA 57051 57863 CDS product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_36820 58068 59450 gene locus_tag LOCUS_36830 58068 59450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_36830 59625 60623 gene locus_tag LOCUS_36840 59625 60623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_36840 60620 60814 gene locus_tag LOCUS_36850 60620 60814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence33 2157 304 gene locus_tag LOCUS_36860 2157 304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 protein_id gnl|my_center|LOCUS_36860 2319 2642 gene locus_tag LOCUS_36870 2319 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112819.1 protein_id gnl|my_center|LOCUS_36870 2733 5204 gene locus_tag LOCUS_36880 2733 5204 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 protein_id gnl|my_center|LOCUS_36880 5372 5713 gene locus_tag LOCUS_36890 5372 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094775.1 protein_id gnl|my_center|LOCUS_36890 5917 6411 gene locus_tag LOCUS_36900 5917 6411 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL0 protein_id gnl|my_center|LOCUS_36900 6551 6856 gene locus_tag LOCUS_36910 6551 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268921.1 protein_id gnl|my_center|LOCUS_36910 6982 8517 gene locus_tag LOCUS_36920 6982 8517 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_36920 8729 9346 gene locus_tag LOCUS_36930 8729 9346 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WG9 protein_id gnl|my_center|LOCUS_36930 9665 9438 gene locus_tag LOCUS_36940 9665 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094765.1 protein_id gnl|my_center|LOCUS_36940 10791 9814 gene locus_tag LOCUS_36950 10791 9814 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_36950 11028 11339 gene locus_tag LOCUS_36960 gene rplU 11028 11339 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK3 protein_id gnl|my_center|LOCUS_36960 11379 11636 gene locus_tag LOCUS_36970 gene rpmA 11379 11636 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F2 protein_id gnl|my_center|LOCUS_36970 11950 13173 gene locus_tag LOCUS_36980 gene obg 11950 13173 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK1 protein_id gnl|my_center|LOCUS_36980 13243 14361 gene locus_tag LOCUS_36990 gene proB 13243 14361 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_36990 14372 14836 gene locus_tag LOCUS_37000 14372 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_37000 15267 14989 gene locus_tag LOCUS_37010 gene rpsT 15267 14989 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E8 protein_id gnl|my_center|LOCUS_37010 15462 17000 gene locus_tag LOCUS_37020 15462 17000 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ6 protein_id gnl|my_center|LOCUS_37020 17175 16978 gene locus_tag LOCUS_37030 17175 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 17185 18021 gene locus_tag LOCUS_37040 gene ribF 17185 18021 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_37040 18032 20863 gene locus_tag LOCUS_37050 gene ileS 18032 20863 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E4 protein_id gnl|my_center|LOCUS_37050 20856 21365 gene locus_tag LOCUS_37060 gene lspA 20856 21365 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ3 protein_id gnl|my_center|LOCUS_37060 21358 21795 gene locus_tag LOCUS_37070 21358 21795 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_37070 21998 22942 gene locus_tag LOCUS_37080 gene ispH 21998 22942 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_37080 23624 24127 gene locus_tag LOCUS_37090 23624 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 24124 24570 gene locus_tag LOCUS_37100 gene pilV 24124 24570 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704648.1 protein_id gnl|my_center|LOCUS_37100 24581 25600 gene locus_tag LOCUS_37110 24581 25600 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_37110 25603 26142 gene locus_tag LOCUS_37120 25603 26142 CDS product pilus assembly protein PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266585.1 protein_id gnl|my_center|LOCUS_37120 26154 29570 gene locus_tag LOCUS_37130 26154 29570 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_37130 29567 29977 gene locus_tag LOCUS_37140 29567 29977 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_37140 30116 31126 gene locus_tag LOCUS_37150 30116 31126 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_37150 32676 31339 gene locus_tag LOCUS_37160 gene pilR 32676 31339 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_37160 34271 32679 gene locus_tag LOCUS_37170 gene pilS 34271 32679 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_37170 34497 34261 gene locus_tag LOCUS_37180 34497 34261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 34673 36304 gene locus_tag LOCUS_37190 gene nadE 34673 36304 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_37190 37622 36606 gene locus_tag LOCUS_37200 gene bamD 37622 36606 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_37200 37770 38744 gene locus_tag LOCUS_37210 gene rluD 37770 38744 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI4 protein_id gnl|my_center|LOCUS_37210 38741 39478 gene locus_tag LOCUS_37220 38741 39478 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 protein_id gnl|my_center|LOCUS_37220 39752 42316 gene locus_tag LOCUS_37230 gene clpB 39752 42316 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889C2 protein_id gnl|my_center|LOCUS_37230 42912 42580 gene locus_tag LOCUS_37240 42912 42580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 45255 42922 gene locus_tag LOCUS_37250 45255 42922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638601.2 protein_id gnl|my_center|LOCUS_37250 45466 45541 gene locus_tag LOCUS_t00480 45466 45541 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 45552 45628 gene locus_tag LOCUS_t00490 45552 45628 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45634 45709 gene locus_tag LOCUS_t00500 45634 45709 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 47372 46077 gene locus_tag LOCUS_37260 47372 46077 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267003.1 protein_id gnl|my_center|LOCUS_37260 48991 47372 gene locus_tag LOCUS_37270 48991 47372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103304.1 protein_id gnl|my_center|LOCUS_37270 48941 49150 gene locus_tag LOCUS_37280 48941 49150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 50332 50586 gene locus_tag LOCUS_37290 50332 50586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 52833 50743 gene locus_tag LOCUS_37300 52833 50743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350638.1 protein_id gnl|my_center|LOCUS_37300 53711 52941 gene locus_tag LOCUS_37310 53711 52941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 57697 54419 gene locus_tag LOCUS_37320 57697 54419 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_37320 58295 57699 gene locus_tag LOCUS_37330 58295 57699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence34 620 1630 gene locus_tag LOCUS_37340 620 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 1627 2517 gene locus_tag LOCUS_37350 1627 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 2651 3466 gene locus_tag LOCUS_37360 2651 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3553 3681 gene locus_tag LOCUS_37370 3553 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087614.1 protein_id gnl|my_center|LOCUS_37370 3701 4900 gene locus_tag LOCUS_37380 3701 4900 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105483.1 protein_id gnl|my_center|LOCUS_37380 4906 5388 gene locus_tag LOCUS_37390 4906 5388 CDS product type VI secretion lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114612.1 protein_id gnl|my_center|LOCUS_37390 5392 6723 gene locus_tag LOCUS_37400 5392 6723 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105481.1 protein_id gnl|my_center|LOCUS_37400 6726 7607 gene locus_tag LOCUS_37410 6726 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105480.1 protein_id gnl|my_center|LOCUS_37410 7604 11143 gene locus_tag LOCUS_37420 7604 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114614.1 protein_id gnl|my_center|LOCUS_37420 11143 11871 gene locus_tag LOCUS_37430 11143 11871 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105478.1 protein_id gnl|my_center|LOCUS_37430 11882 12862 gene locus_tag LOCUS_37440 11882 12862 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105477.1 protein_id gnl|my_center|LOCUS_37440 12939 14987 gene locus_tag LOCUS_37450 12939 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147991.1 protein_id gnl|my_center|LOCUS_37450 15025 17394 gene locus_tag LOCUS_37460 15025 17394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211929.1 protein_id gnl|my_center|LOCUS_37460 18042 19145 gene locus_tag LOCUS_37470 18042 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37470 19218 19901 gene locus_tag LOCUS_37480 19218 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37480 19898 20557 gene locus_tag LOCUS_37490 19898 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 20641 21204 gene locus_tag LOCUS_37500 20641 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 21683 22150 gene locus_tag LOCUS_37510 21683 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 22184 22663 gene locus_tag LOCUS_37520 22184 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 22935 23282 gene locus_tag LOCUS_37530 22935 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37530 23293 23694 gene locus_tag LOCUS_37540 23293 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105374.1 protein_id gnl|my_center|LOCUS_37540 23768 24829 gene locus_tag LOCUS_37550 23768 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 25114 25269 gene locus_tag LOCUS_37560 25114 25269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 25869 25336 gene locus_tag LOCUS_37570 25869 25336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401267.1 protein_id gnl|my_center|LOCUS_37570 26202 25957 gene locus_tag LOCUS_37580 26202 25957 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378385.1 protein_id gnl|my_center|LOCUS_37580 27420 26335 gene locus_tag LOCUS_37590 gene purK 27420 26335 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U22 protein_id gnl|my_center|LOCUS_37590 28059 27568 gene locus_tag LOCUS_37600 gene purE 28059 27568 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL97 protein_id gnl|my_center|LOCUS_37600 28357 29349 gene locus_tag LOCUS_37610 28357 29349 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_37610 29544 30578 gene locus_tag LOCUS_37620 gene aphA 29544 30578 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_37620 30685 31797 gene locus_tag LOCUS_37630 30685 31797 CDS product spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082943.1 protein_id gnl|my_center|LOCUS_37630 32209 33117 gene locus_tag LOCUS_37640 32209 33117 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_37640 33568 34314 gene locus_tag LOCUS_37650 33568 34314 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_37650 34314 34979 gene locus_tag LOCUS_37660 34314 34979 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_37660 34976 35710 gene locus_tag LOCUS_37670 34976 35710 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268728.1 protein_id gnl|my_center|LOCUS_37670 35959 37887 gene locus_tag LOCUS_37680 35959 37887 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115580.1 protein_id gnl|my_center|LOCUS_37680 37880 39205 gene locus_tag LOCUS_37690 37880 39205 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268730.1 protein_id gnl|my_center|LOCUS_37690 40236 39325 gene locus_tag LOCUS_37700 40236 39325 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 protein_id gnl|my_center|LOCUS_37700 40587 42011 gene locus_tag LOCUS_37710 gene aspA 40587 42011 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTD7 protein_id gnl|my_center|LOCUS_37710 42313 43758 gene locus_tag LOCUS_37720 42313 43758 CDS product AGCS sodium/alanine/glycine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 protein_id gnl|my_center|LOCUS_37720 43809 44801 gene locus_tag LOCUS_37730 gene ansA 43809 44801 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113732.1 protein_id gnl|my_center|LOCUS_37730 44880 45335 gene locus_tag LOCUS_37740 44880 45335 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_37740 45740 45351 gene locus_tag LOCUS_37750 45740 45351 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_37750 46728 45820 gene locus_tag LOCUS_37760 gene glsA 46728 45820 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I387 protein_id gnl|my_center|LOCUS_37760 48958 47150 gene locus_tag LOCUS_37770 gene oadA 48958 47150 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_37770 50385 48970 gene locus_tag LOCUS_37780 50385 48970 CDS product pyruvate carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_37780 50608 51567 gene locus_tag LOCUS_37790 50608 51567 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_37790 51733 51512 gene locus_tag LOCUS_37800 51733 51512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719786.1 protein_id gnl|my_center|LOCUS_37800 52778 51912 gene locus_tag LOCUS_37810 52778 51912 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 protein_id gnl|my_center|LOCUS_37810 52935 54377 gene locus_tag LOCUS_37820 gene zwf 52935 54377 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTC7 protein_id gnl|my_center|LOCUS_37820 54679 55197 gene locus_tag LOCUS_37830 gene hcpB 54679 55197 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253954.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence35 914 1774 gene locus_tag LOCUS_37840 914 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 protein_id gnl|my_center|LOCUS_37840 2595 3332 gene locus_tag LOCUS_37850 2595 3332 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406417.1 protein_id gnl|my_center|LOCUS_37850 3451 4812 gene locus_tag LOCUS_37860 3451 4812 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_37860 4976 6454 gene locus_tag LOCUS_37870 4976 6454 CDS product transport-related membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535997.1 protein_id gnl|my_center|LOCUS_37870 7130 6681 gene locus_tag LOCUS_37880 7130 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_37880 7193 7372 gene locus_tag LOCUS_37890 7193 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 8156 7335 gene locus_tag LOCUS_37900 8156 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 9219 8224 gene locus_tag LOCUS_37910 gene moaA2 9219 8224 CDS product GTP 3',8-cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3K7 protein_id gnl|my_center|LOCUS_37910 9442 10086 gene locus_tag LOCUS_37920 9442 10086 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376205.1 protein_id gnl|my_center|LOCUS_37920 10704 10264 gene locus_tag LOCUS_37930 10704 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_37930 11021 12796 gene locus_tag LOCUS_37940 gene gcl 11021 12796 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 protein_id gnl|my_center|LOCUS_37940 12942 13724 gene locus_tag LOCUS_37950 12942 13724 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L1 protein_id gnl|my_center|LOCUS_37950 13780 14670 gene locus_tag LOCUS_37960 13780 14670 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_37960 14899 16164 gene locus_tag LOCUS_37970 14899 16164 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_37970 16170 17585 gene locus_tag LOCUS_37980 gene pykF 16170 17585 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3L4 protein_id gnl|my_center|LOCUS_37980 17722 18627 gene locus_tag LOCUS_37990 17722 18627 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114298.1 protein_id gnl|my_center|LOCUS_37990 18766 19602 gene locus_tag LOCUS_38000 18766 19602 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_38000 20690 19710 gene locus_tag LOCUS_38010 gene argR 20690 19710 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103717.1 protein_id gnl|my_center|LOCUS_38010 21668 20904 gene locus_tag LOCUS_38020 gene aotP 21668 20904 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30506 protein_id gnl|my_center|LOCUS_38020 22799 21687 gene locus_tag LOCUS_38030 22799 21687 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767739.1 protein_id gnl|my_center|LOCUS_38030 23508 22810 gene locus_tag LOCUS_38040 gene aotM 23508 22810 CDS product arginine/ornithine transporter AotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_38040 24214 23525 gene locus_tag LOCUS_38050 24214 23525 CDS product histidine/lysine/arginine/ornithine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369874.1 protein_id gnl|my_center|LOCUS_38050 25111 24332 gene locus_tag LOCUS_38060 25111 24332 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404105.1 protein_id gnl|my_center|LOCUS_38060 27589 25634 gene locus_tag LOCUS_38070 gene acsA 27589 25634 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K7 protein_id gnl|my_center|LOCUS_38070 28953 27961 gene locus_tag LOCUS_38080 gene dctP 28953 27961 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_38080 29966 29073 gene locus_tag LOCUS_38090 29966 29073 CDS product acyl-CoA lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 protein_id gnl|my_center|LOCUS_38090 31206 30001 gene locus_tag LOCUS_38100 31206 30001 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_38100 32685 31333 gene locus_tag LOCUS_38110 32685 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_38110 34003 32840 gene locus_tag LOCUS_38120 34003 32840 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_38120 34949 34122 gene locus_tag LOCUS_38130 34949 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 protein_id gnl|my_center|LOCUS_38130 35176 36096 gene locus_tag LOCUS_38140 35176 36096 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_38140 37837 36284 gene locus_tag LOCUS_38150 gene phhR 37837 36284 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 protein_id gnl|my_center|LOCUS_38150 38095 38880 gene locus_tag LOCUS_38160 gene phhA 38095 38880 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_38160 39108 39461 gene locus_tag LOCUS_38170 gene phhB 39108 39461 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43335 protein_id gnl|my_center|LOCUS_38170 39458 40651 gene locus_tag LOCUS_38180 gene phhC 39458 40651 CDS product aromatic-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43336 protein_id gnl|my_center|LOCUS_38180 40938 42197 gene locus_tag LOCUS_38190 gene ycaD 40938 42197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_38190 42312 44564 gene locus_tag LOCUS_38200 42312 44564 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 protein_id gnl|my_center|LOCUS_38200 45057 44638 gene locus_tag LOCUS_38210 45057 44638 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_38210 45575 45150 gene locus_tag LOCUS_38220 45575 45150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_38220 46247 45978 gene locus_tag LOCUS_38230 46247 45978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 46504 46926 gene locus_tag LOCUS_38240 46504 46926 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_38240 46933 47289 gene locus_tag LOCUS_38250 46933 47289 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 protein_id gnl|my_center|LOCUS_38250 47320 47790 gene locus_tag LOCUS_38260 gene arsC 47320 47790 CDS product low molecular weight phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_38260 47807 48868 gene locus_tag LOCUS_38270 47807 48868 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_38270 48873 49589 gene locus_tag LOCUS_38280 48873 49589 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113752.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence36 716 1060 gene locus_tag LOCUS_38290 716 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 3957 1576 gene locus_tag LOCUS_38300 3957 1576 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_38300 4085 5155 gene locus_tag LOCUS_38310 4085 5155 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112941.1 protein_id gnl|my_center|LOCUS_38310 6601 5102 gene locus_tag LOCUS_38320 6601 5102 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266221.1 protein_id gnl|my_center|LOCUS_38320 7405 6824 gene locus_tag LOCUS_38330 7405 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_38330 7528 8475 gene locus_tag LOCUS_38340 7528 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_38340 9302 8535 gene locus_tag LOCUS_38350 9302 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 protein_id gnl|my_center|LOCUS_38350 9389 10012 gene locus_tag LOCUS_38360 9389 10012 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105413.1 protein_id gnl|my_center|LOCUS_38360 10857 10300 gene locus_tag LOCUS_38370 10857 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084327.1 protein_id gnl|my_center|LOCUS_38370 11271 11759 gene locus_tag LOCUS_38380 11271 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 protein_id gnl|my_center|LOCUS_38380 13130 11901 gene locus_tag LOCUS_38390 gene serA 13130 11901 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_38390 13320 14714 gene locus_tag LOCUS_38400 13320 14714 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_38400 14922 15587 gene locus_tag LOCUS_38410 14922 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_38410 15684 16613 gene locus_tag LOCUS_38420 15684 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121726.1 protein_id gnl|my_center|LOCUS_38420 16712 17059 gene locus_tag LOCUS_38430 16712 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084357.1 protein_id gnl|my_center|LOCUS_38430 17180 18103 gene locus_tag LOCUS_38440 17180 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_38440 18462 18130 gene locus_tag LOCUS_38450 18462 18130 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G2 protein_id gnl|my_center|LOCUS_38450 19251 18577 gene locus_tag LOCUS_38460 gene rpiA 19251 18577 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK7 protein_id gnl|my_center|LOCUS_38460 19558 21072 gene locus_tag LOCUS_38470 gene ilvA 19558 21072 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLU9 protein_id gnl|my_center|LOCUS_38470 21100 21540 gene locus_tag LOCUS_38480 21100 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 22323 21670 gene locus_tag LOCUS_38490 22323 21670 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_38490 22468 22947 gene locus_tag LOCUS_38500 gene rppH 22468 22947 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL1 protein_id gnl|my_center|LOCUS_38500 22968 25247 gene locus_tag LOCUS_38510 22968 25247 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_38510 26023 25277 gene locus_tag LOCUS_38520 26023 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_38520 26355 27137 gene locus_tag LOCUS_38530 26355 27137 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_38530 27148 27948 gene locus_tag LOCUS_38540 gene lgt 27148 27948 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL3 protein_id gnl|my_center|LOCUS_38540 27948 28742 gene locus_tag LOCUS_38550 gene thyA 27948 28742 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_38550 30213 28846 gene locus_tag LOCUS_38560 30213 28846 CDS product GTPase SAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103141.1 protein_id gnl|my_center|LOCUS_38560 31713 30331 gene locus_tag LOCUS_38570 31713 30331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_38570 32934 31786 gene locus_tag LOCUS_38580 gene glpQ 32934 31786 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_38580 33090 33614 gene locus_tag LOCUS_38590 gene folA 33090 33614 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E3 protein_id gnl|my_center|LOCUS_38590 34120 33656 gene locus_tag LOCUS_38600 34120 33656 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_38600 36047 34200 gene locus_tag LOCUS_38610 gene ilvD 36047 34200 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_38610 37500 36304 gene locus_tag LOCUS_38620 37500 36304 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_38620 37714 38526 gene locus_tag LOCUS_38630 gene mutM 37714 38526 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_38630 38598 39176 gene locus_tag LOCUS_38640 38598 39176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_38640 39253 39591 gene locus_tag LOCUS_38650 39253 39591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_38650 40078 39650 gene locus_tag LOCUS_38660 40078 39650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 42026 40332 gene locus_tag LOCUS_38670 42026 40332 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_38670 42280 42029 gene locus_tag LOCUS_38680 42280 42029 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_38680 42885 42406 gene locus_tag LOCUS_38690 gene coaD 42885 42406 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_38690 43347 42964 gene locus_tag LOCUS_38700 43347 42964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 44964 43369 gene locus_tag LOCUS_38710 44964 43369 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_38710 45632 45087 gene locus_tag LOCUS_38720 45632 45087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_38720 47138 45696 gene locus_tag LOCUS_38730 gene calB 47138 45696 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 protein_id gnl|my_center|LOCUS_38730 47555 48214 gene locus_tag LOCUS_38740 47555 48214 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_38740 >Feature sequence37 384 217 gene locus_tag LOCUS_38750 gene rubA1 384 217 CDS product Rubredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK7 protein_id gnl|my_center|LOCUS_38750 2296 593 gene locus_tag LOCUS_38760 2296 593 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_38760 4735 2558 gene locus_tag LOCUS_38770 gene glcB2 4735 2558 CDS product malate synthase G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z72 protein_id gnl|my_center|LOCUS_38770 5240 4839 gene locus_tag LOCUS_38780 5240 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098332.1 protein_id gnl|my_center|LOCUS_38780 6473 5256 gene locus_tag LOCUS_38790 6473 5256 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR57 protein_id gnl|my_center|LOCUS_38790 7541 6477 gene locus_tag LOCUS_38800 gene glcE 7541 6477 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268366.1 protein_id gnl|my_center|LOCUS_38800 9040 7541 gene locus_tag LOCUS_38810 9040 7541 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_38810 9298 10071 gene locus_tag LOCUS_38820 gene glcC 9298 10071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_38820 10230 10781 gene locus_tag LOCUS_38830 gene ubiC 10230 10781 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_38830 10946 11839 gene locus_tag LOCUS_38840 gene ubiA 10946 11839 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 protein_id gnl|my_center|LOCUS_38840 11994 12683 gene locus_tag LOCUS_38850 gene phoB 11994 12683 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_38850 12759 14084 gene locus_tag LOCUS_38860 gene phoR 12759 14084 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_38860 14166 15506 gene locus_tag LOCUS_38870 14166 15506 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383143.1 protein_id gnl|my_center|LOCUS_38870 16535 15639 gene locus_tag LOCUS_38880 16535 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_38880 17580 16675 gene locus_tag LOCUS_38890 17580 16675 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 protein_id gnl|my_center|LOCUS_38890 18417 17686 gene locus_tag LOCUS_38900 gene phoU 18417 17686 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_38900 19379 18546 gene locus_tag LOCUS_38910 gene pstB 19379 18546 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_38910 21124 19448 gene locus_tag LOCUS_38920 21124 19448 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U30 protein_id gnl|my_center|LOCUS_38920 23425 21140 gene locus_tag LOCUS_38930 23425 21140 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_38930 24573 23605 gene locus_tag LOCUS_38940 gene pstS 24573 23605 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_38940 24904 25374 gene locus_tag LOCUS_38950 24904 25374 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_38950 26554 25454 gene locus_tag LOCUS_38960 26554 25454 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_38960 26750 27295 gene locus_tag LOCUS_38970 26750 27295 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_38970 27288 28664 gene locus_tag LOCUS_38980 27288 28664 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_38980 28785 29690 gene locus_tag LOCUS_38990 28785 29690 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_38990 30172 31734 gene locus_tag LOCUS_39000 30172 31734 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097814.1 protein_id gnl|my_center|LOCUS_39000 31787 32293 gene locus_tag LOCUS_39010 31787 32293 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 protein_id gnl|my_center|LOCUS_39010 32319 33794 gene locus_tag LOCUS_39020 32319 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087596.1 protein_id gnl|my_center|LOCUS_39020 33803 34210 gene locus_tag LOCUS_39030 33803 34210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097809.1 protein_id gnl|my_center|LOCUS_39030 34223 34741 gene locus_tag LOCUS_39040 34223 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413692.1 protein_id gnl|my_center|LOCUS_39040 34734 35645 gene locus_tag LOCUS_39050 34734 35645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 35726 36079 gene locus_tag LOCUS_39060 35726 36079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 36547 38337 gene locus_tag LOCUS_39070 36547 38337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120358.1 protein_id gnl|my_center|LOCUS_39070 38334 39386 gene locus_tag LOCUS_39080 38334 39386 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 protein_id gnl|my_center|LOCUS_39080 39399 41993 gene locus_tag LOCUS_39090 39399 41993 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105486.1 protein_id gnl|my_center|LOCUS_39090 41980 43515 gene locus_tag LOCUS_39100 41980 43515 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105485.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence38 1056 169 gene locus_tag LOCUS_39110 1056 169 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUW6 protein_id gnl|my_center|LOCUS_39110 2222 1056 gene locus_tag LOCUS_39120 gene sucC 2222 1056 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_39120 3868 2432 gene locus_tag LOCUS_39130 gene lpdG 3868 2432 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_39130 5301 4075 gene locus_tag LOCUS_39140 gene sucB 5301 4075 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_39140 8203 5372 gene locus_tag LOCUS_39150 gene sucA 8203 5372 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_39150 9150 8446 gene locus_tag LOCUS_39160 gene sdhB 9150 8446 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_39160 10934 9162 gene locus_tag LOCUS_39170 gene sdhA 10934 9162 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_39170 11306 10938 gene locus_tag LOCUS_39180 gene sdhD 11306 10938 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D6 protein_id gnl|my_center|LOCUS_39180 11560 11300 gene locus_tag LOCUS_39190 11560 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 12037 13311 gene locus_tag LOCUS_39200 gene gltA 12037 13311 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A2 protein_id gnl|my_center|LOCUS_39200 13982 13377 gene locus_tag LOCUS_39210 13982 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769634.1 protein_id gnl|my_center|LOCUS_39210 16221 14380 gene locus_tag LOCUS_39220 16221 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 18497 16278 gene locus_tag LOCUS_39230 18497 16278 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_39230 19580 18702 gene locus_tag LOCUS_39240 19580 18702 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_39240 19674 20216 gene locus_tag LOCUS_39250 19674 20216 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_39250 20381 20662 gene locus_tag LOCUS_39260 20381 20662 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_39260 20862 20659 gene locus_tag LOCUS_39270 20862 20659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20792 21604 gene locus_tag LOCUS_39280 20792 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 protein_id gnl|my_center|LOCUS_39280 23473 21695 gene locus_tag LOCUS_39290 23473 21695 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_39290 24191 23757 gene locus_tag LOCUS_39300 24191 23757 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_39300 25349 24234 gene locus_tag LOCUS_39310 25349 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895577.1 protein_id gnl|my_center|LOCUS_39310 25528 25698 gene locus_tag LOCUS_39320 25528 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 27060 25918 gene locus_tag LOCUS_39330 gene pdxB 27060 25918 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_39330 27209 28600 gene locus_tag LOCUS_39340 gene pmpM 27209 28600 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_39340 28597 29676 gene locus_tag LOCUS_39350 28597 29676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240016.1 protein_id gnl|my_center|LOCUS_39350 30089 29637 gene locus_tag LOCUS_39360 30089 29637 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_39360 30340 30089 gene locus_tag LOCUS_39370 gene tusA 30340 30089 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_39370 30493 32043 gene locus_tag LOCUS_39380 30493 32043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 33636 32581 gene locus_tag LOCUS_39390 gene rlmM 33636 32581 CDS product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQY7 protein_id gnl|my_center|LOCUS_39390 33934 36678 gene locus_tag LOCUS_39400 gene acnA 33934 36678 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F5 protein_id gnl|my_center|LOCUS_39400 36849 38414 gene locus_tag LOCUS_39410 36849 38414 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268416.1 protein_id gnl|my_center|LOCUS_39410 38765 39442 gene locus_tag LOCUS_39420 38765 39442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 39645 40313 gene locus_tag LOCUS_39430 39645 40313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence39 1244 153 gene locus_tag LOCUS_39440 1244 153 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC8 protein_id gnl|my_center|LOCUS_39440 1459 3501 gene locus_tag LOCUS_39450 gene metG 1459 3501 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_39450 3661 4245 gene locus_tag LOCUS_39460 3661 4245 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC0 protein_id gnl|my_center|LOCUS_39460 4242 4817 gene locus_tag LOCUS_39470 4242 4817 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_39470 4814 7294 gene locus_tag LOCUS_39480 4814 7294 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB8 protein_id gnl|my_center|LOCUS_39480 5277 5189 gene locus_tag LOCUS_t00510 5277 5189 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7455 8486 gene locus_tag LOCUS_39490 7455 8486 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_39490 8483 9127 gene locus_tag LOCUS_39500 8483 9127 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_39500 9120 9827 gene locus_tag LOCUS_39510 9120 9827 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_39510 9824 10462 gene locus_tag LOCUS_39520 gene nth 9824 10462 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM8 protein_id gnl|my_center|LOCUS_39520 10570 10749 gene locus_tag LOCUS_39530 10570 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092052.1 protein_id gnl|my_center|LOCUS_39530 11355 10963 gene locus_tag LOCUS_39540 gene gloA1 11355 10963 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY85 protein_id gnl|my_center|LOCUS_39540 12667 11450 gene locus_tag LOCUS_39550 gene argG 12667 11450 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_39550 13720 12788 gene locus_tag LOCUS_39560 13720 12788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268722.1 protein_id gnl|my_center|LOCUS_39560 13888 14934 gene locus_tag LOCUS_39570 gene pyrC 13888 14934 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_39570 14931 15608 gene locus_tag LOCUS_39580 gene rnt 14931 15608 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_39580 16374 16592 gene locus_tag LOCUS_39590 16374 16592 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003350768.1 protein_id gnl|my_center|LOCUS_39590 16790 17260 gene locus_tag LOCUS_39600 gene bfrB 16790 17260 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_39600 17715 17389 gene locus_tag LOCUS_39610 17715 17389 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_39610 19923 17815 gene locus_tag LOCUS_39620 19923 17815 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_39620 20259 21179 gene locus_tag LOCUS_39630 gene argF 20259 21179 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ1 protein_id gnl|my_center|LOCUS_39630 21188 22285 gene locus_tag LOCUS_39640 21188 22285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_39640 23090 22290 gene locus_tag LOCUS_39650 23090 22290 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_39650 23431 24660 gene locus_tag LOCUS_39660 23431 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_39660 25423 24710 gene locus_tag LOCUS_39670 25423 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 27035 25548 gene locus_tag LOCUS_39680 gene glpK1 27035 25548 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_39680 27564 27094 gene locus_tag LOCUS_39690 27564 27094 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL2 protein_id gnl|my_center|LOCUS_39690 27661 28419 gene locus_tag LOCUS_39700 gene glpR 27661 28419 CDS product glycerol-3-phosphate regulon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51391 protein_id gnl|my_center|LOCUS_39700 28614 30155 gene locus_tag LOCUS_39710 gene glpD 28614 30155 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 protein_id gnl|my_center|LOCUS_39710 32378 30879 gene locus_tag LOCUS_39720 32378 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence40 603 2327 gene locus_tag LOCUS_39730 gene pslM 603 2327 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 protein_id gnl|my_center|LOCUS_39730 3005 2610 gene locus_tag LOCUS_39740 gene pcaC 3005 2610 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112676.1 protein_id gnl|my_center|LOCUS_39740 3808 3020 gene locus_tag LOCUS_39750 gene pcaD 3808 3020 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_39750 5171 3819 gene locus_tag LOCUS_39760 gene pcaB 5171 3819 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Q8 protein_id gnl|my_center|LOCUS_39760 6569 5364 gene locus_tag LOCUS_39770 gene pcaF 6569 5364 CDS product beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6R0 protein_id gnl|my_center|LOCUS_39770 7348 6566 gene locus_tag LOCUS_39780 7348 6566 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_39780 8220 7348 gene locus_tag LOCUS_39790 8220 7348 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_39790 9214 8339 gene locus_tag LOCUS_39800 9214 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 10541 9261 gene locus_tag LOCUS_39810 10541 9261 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115516.1 protein_id gnl|my_center|LOCUS_39810 11890 10646 gene locus_tag LOCUS_39820 gene benE 11890 10646 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_39820 12962 12030 gene locus_tag LOCUS_39830 gene catA 12962 12030 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_39830 13297 13007 gene locus_tag LOCUS_39840 gene catC 13297 13007 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0X4 protein_id gnl|my_center|LOCUS_39840 14435 13314 gene locus_tag LOCUS_39850 gene catB 14435 13314 CDS product muconate cycloisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_39850 15804 14464 gene locus_tag LOCUS_39860 gene benK 15804 14464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_39860 16632 15868 gene locus_tag LOCUS_39870 gene xylL 16632 15868 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_39870 17747 16737 gene locus_tag LOCUS_39880 gene xylZ 17747 16737 CDS product toluate 1,2-dioxygenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_39880 18348 17860 gene locus_tag LOCUS_39890 gene xylY 18348 17860 CDS product toluate 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113314.1 protein_id gnl|my_center|LOCUS_39890 19707 18349 gene locus_tag LOCUS_39900 gene xylX 19707 18349 CDS product toluate 1,2-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113315.1 protein_id gnl|my_center|LOCUS_39900 20907 19954 gene locus_tag LOCUS_39910 gene xylS 20907 19954 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_39910 21972 21127 gene locus_tag LOCUS_39920 21972 21127 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363842.1 protein_id gnl|my_center|LOCUS_39920 23172 22225 gene locus_tag LOCUS_39930 gene mdcF 23172 22225 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_39930 24203 23166 gene locus_tag LOCUS_39940 24203 23166 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 protein_id gnl|my_center|LOCUS_39940 24816 24208 gene locus_tag LOCUS_39950 gene pcaG 24816 24208 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_39950 25548 24829 gene locus_tag LOCUS_39960 25548 24829 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 protein_id gnl|my_center|LOCUS_39960 26583 25651 gene locus_tag LOCUS_39970 gene pcaQ 26583 25651 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 protein_id gnl|my_center|LOCUS_39970 26793 26717 gene locus_tag LOCUS_t00520 26793 26717 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27239 26883 gene locus_tag LOCUS_39980 27239 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_39980 27522 27220 gene locus_tag LOCUS_39990 gene ihfA 27522 27220 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_39990 29904 27526 gene locus_tag LOCUS_40000 gene pheT 29904 27526 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_40000 30958 29942 gene locus_tag LOCUS_40010 gene pheS 30958 29942 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_40010 31550 31194 gene locus_tag LOCUS_40020 gene rplT 31550 31194 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG4 protein_id gnl|my_center|LOCUS_40020 31770 31576 gene locus_tag LOCUS_40030 gene rpmI 31770 31576 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG5 protein_id gnl|my_center|LOCUS_40030 32364 31831 gene locus_tag LOCUS_40040 gene infC 32364 31831 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A132 protein_id gnl|my_center|LOCUS_40040 34304 32382 gene locus_tag LOCUS_40050 gene thrS 34304 32382 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG7 protein_id gnl|my_center|LOCUS_40050 34661 35170 gene locus_tag LOCUS_40060 34661 35170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence41 501 2456 gene locus_tag LOCUS_40070 501 2456 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_40070 2736 3710 gene locus_tag LOCUS_40080 2736 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 5161 3947 gene locus_tag LOCUS_40090 5161 3947 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_40090 5321 5587 gene locus_tag LOCUS_40100 gene ppiC-2 5321 5587 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880W6 protein_id gnl|my_center|LOCUS_40100 6972 5749 gene locus_tag LOCUS_40110 6972 5749 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_40110 8304 7048 gene locus_tag LOCUS_40120 8304 7048 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_40120 8447 8914 gene locus_tag LOCUS_40130 8447 8914 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532463.1 protein_id gnl|my_center|LOCUS_40130 9389 10975 gene locus_tag LOCUS_40140 9389 10975 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267725.1 protein_id gnl|my_center|LOCUS_40140 11656 11048 gene locus_tag LOCUS_40150 gene azoR2 11656 11048 CDS product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 protein_id gnl|my_center|LOCUS_40150 11779 12678 gene locus_tag LOCUS_40160 11779 12678 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 protein_id gnl|my_center|LOCUS_40160 13190 12684 gene locus_tag LOCUS_40170 13190 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_40170 13304 13657 gene locus_tag LOCUS_40180 13304 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 protein_id gnl|my_center|LOCUS_40180 14374 13661 gene locus_tag LOCUS_40190 14374 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_40190 15383 14406 gene locus_tag LOCUS_40200 15383 14406 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731041.1 protein_id gnl|my_center|LOCUS_40200 16324 15494 gene locus_tag LOCUS_40210 gene uppP 16324 15494 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E5 protein_id gnl|my_center|LOCUS_40210 16571 18202 gene locus_tag LOCUS_40220 16571 18202 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_40220 18251 19885 gene locus_tag LOCUS_40230 18251 19885 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 protein_id gnl|my_center|LOCUS_40230 19894 20508 gene locus_tag LOCUS_40240 19894 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_40240 20704 21174 gene locus_tag LOCUS_40250 20704 21174 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_40250 21171 21722 gene locus_tag LOCUS_40260 21171 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113477.1 protein_id gnl|my_center|LOCUS_40260 22157 21690 gene locus_tag LOCUS_40270 22157 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_40270 23491 22289 gene locus_tag LOCUS_40280 23491 22289 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 protein_id gnl|my_center|LOCUS_40280 23879 25753 gene locus_tag LOCUS_40290 23879 25753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_40290 25825 27021 gene locus_tag LOCUS_40300 25825 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_40300 27130 27486 gene locus_tag LOCUS_40310 27130 27486 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H2 protein_id gnl|my_center|LOCUS_40310 >Feature sequence42 687 169 gene locus_tag LOCUS_40320 687 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_40320 1159 713 gene locus_tag LOCUS_40330 1159 713 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_40330 1472 3649 gene locus_tag LOCUS_40340 gene glcB 1472 3649 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_40340 4032 5963 gene locus_tag LOCUS_40350 4032 5963 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_40350 5960 6664 gene locus_tag LOCUS_40360 5960 6664 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103148.1 protein_id gnl|my_center|LOCUS_40360 6960 7445 gene locus_tag LOCUS_40370 6960 7445 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084762.1 protein_id gnl|my_center|LOCUS_40370 7442 8383 gene locus_tag LOCUS_40380 7442 8383 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_40380 8611 11007 gene locus_tag LOCUS_40390 8611 11007 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 protein_id gnl|my_center|LOCUS_40390 11086 12216 gene locus_tag LOCUS_40400 11086 12216 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 protein_id gnl|my_center|LOCUS_40400 12213 12395 gene locus_tag LOCUS_40410 12213 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 12978 12472 gene locus_tag LOCUS_40420 12978 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 14831 13062 gene locus_tag LOCUS_40430 14831 13062 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_40430 15095 14835 gene locus_tag LOCUS_40440 15095 14835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_40440 15805 15500 gene locus_tag LOCUS_40450 15805 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 17377 16019 gene locus_tag LOCUS_40460 gene creD 17377 16019 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_40460 17572 18078 gene locus_tag LOCUS_40470 17572 18078 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707040.1 protein_id gnl|my_center|LOCUS_40470 18107 18394 gene locus_tag LOCUS_40480 18107 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 18911 18477 gene locus_tag LOCUS_40490 18911 18477 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112686.1 protein_id gnl|my_center|LOCUS_40490 22274 19083 gene locus_tag LOCUS_40500 22274 19083 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_40500 23236 22271 gene locus_tag LOCUS_40510 23236 22271 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_40510 24180 23248 gene locus_tag LOCUS_40520 24180 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932364.1 protein_id gnl|my_center|LOCUS_40520 24749 24177 gene locus_tag LOCUS_40530 24749 24177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932363.1 protein_id gnl|my_center|LOCUS_40530 25071 24793 gene locus_tag LOCUS_40540 25071 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 >Feature sequence43 293 871 gene locus_tag LOCUS_40550 293 871 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719783.1 protein_id gnl|my_center|LOCUS_40550 858 1481 gene locus_tag LOCUS_40560 858 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719782.1 protein_id gnl|my_center|LOCUS_40560 1474 3774 gene locus_tag LOCUS_40570 1474 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_40570 6662 3828 gene locus_tag LOCUS_40580 6662 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_40580 7354 6659 gene locus_tag LOCUS_40590 7354 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095041.1 protein_id gnl|my_center|LOCUS_40590 8601 7351 gene locus_tag LOCUS_40600 8601 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404706.1 protein_id gnl|my_center|LOCUS_40600 8995 10092 gene locus_tag LOCUS_40610 8995 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_40610 10095 11666 gene locus_tag LOCUS_40620 10095 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 11678 12178 gene locus_tag LOCUS_40630 11678 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113522.1 protein_id gnl|my_center|LOCUS_40630 12343 13890 gene locus_tag LOCUS_40640 gene leuA 12343 13890 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_40640 13890 14690 gene locus_tag LOCUS_40650 13890 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266672.1 protein_id gnl|my_center|LOCUS_40650 14687 15139 gene locus_tag LOCUS_40660 gene rimI 14687 15139 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB7 protein_id gnl|my_center|LOCUS_40660 15344 17284 gene locus_tag LOCUS_40670 15344 17284 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_40670 17298 18542 gene locus_tag LOCUS_40680 17298 18542 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_40680 18619 19263 gene locus_tag LOCUS_40690 18619 19263 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB9 protein_id gnl|my_center|LOCUS_40690 19273 20184 gene locus_tag LOCUS_40700 19273 20184 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 protein_id gnl|my_center|LOCUS_40700 20919 20341 gene locus_tag LOCUS_40710 gene gfa 20919 20341 CDS product glutathione-dependent formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WX6 protein_id gnl|my_center|LOCUS_40710 21391 21675 gene locus_tag LOCUS_40720 21391 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 22100 21852 gene locus_tag LOCUS_40730 22100 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 22325 22167 gene locus_tag LOCUS_40740 22325 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence44 237 1529 gene locus_tag LOCUS_40750 237 1529 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_40750 1590 1778 gene locus_tag LOCUS_40760 1590 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 1972 4659 gene locus_tag LOCUS_40770 1972 4659 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_40770 4868 5179 gene locus_tag LOCUS_40780 4868 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 6540 7625 gene locus_tag LOCUS_40790 6540 7625 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225636.1 protein_id gnl|my_center|LOCUS_40790 7703 9751 gene locus_tag LOCUS_40800 7703 9751 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_40800 9751 11103 gene locus_tag LOCUS_40810 9751 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_40810 12145 11156 gene locus_tag LOCUS_40820 12145 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_40820 12881 12288 gene locus_tag LOCUS_40830 12881 12288 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_40830 14362 12881 gene locus_tag LOCUS_40840 14362 12881 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_40840 15710 14355 gene locus_tag LOCUS_40850 15710 14355 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 protein_id gnl|my_center|LOCUS_40850 15915 17294 gene locus_tag LOCUS_40860 gene ftsY 15915 17294 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 protein_id gnl|my_center|LOCUS_40860 17291 17959 gene locus_tag LOCUS_40870 17291 17959 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 protein_id gnl|my_center|LOCUS_40870 17959 18975 gene locus_tag LOCUS_40880 17959 18975 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_40880 19147 19941 gene locus_tag LOCUS_40890 gene rpoH 19147 19941 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG0 protein_id gnl|my_center|LOCUS_40890 >Feature sequence45 287 1627 gene locus_tag LOCUS_40900 287 1627 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_40900 2399 1989 gene locus_tag LOCUS_40910 2399 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_40910 2997 2392 gene locus_tag LOCUS_40920 2997 2392 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_40920 3347 2994 gene locus_tag LOCUS_40930 3347 2994 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_40930 3543 4763 gene locus_tag LOCUS_40940 3543 4763 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_40940 4930 5145 gene locus_tag LOCUS_40950 4930 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 5627 5235 gene locus_tag LOCUS_40960 5627 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109947.1 protein_id gnl|my_center|LOCUS_40960 7164 5755 gene locus_tag LOCUS_40970 7164 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 7231 7674 gene locus_tag LOCUS_40980 7231 7674 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739010.1 protein_id gnl|my_center|LOCUS_40980 7679 7954 gene locus_tag LOCUS_40990 gene acyP 7679 7954 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I504 protein_id gnl|my_center|LOCUS_40990 8563 7994 gene locus_tag LOCUS_41000 8563 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 9524 8571 gene locus_tag LOCUS_41010 9524 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102379.1 protein_id gnl|my_center|LOCUS_41010 11265 9550 gene locus_tag LOCUS_41020 gene proS 11265 9550 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM2 protein_id gnl|my_center|LOCUS_41020 11371 11787 gene locus_tag LOCUS_41030 11371 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_41030 13155 11869 gene locus_tag LOCUS_41040 gene oprD 13155 11869 CDS product porin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32722 protein_id gnl|my_center|LOCUS_41040 13904 14257 gene locus_tag LOCUS_41050 13904 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 >Feature sequence46 870 199 gene locus_tag LOCUS_41060 870 199 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416207.1 protein_id gnl|my_center|LOCUS_41060 2919 1012 gene locus_tag LOCUS_41070 2919 1012 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 protein_id gnl|my_center|LOCUS_41070 3688 5031 gene locus_tag LOCUS_41080 3688 5031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267450.1 protein_id gnl|my_center|LOCUS_41080 5985 5104 gene locus_tag LOCUS_41090 5985 5104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267449.1 protein_id gnl|my_center|LOCUS_41090 6979 6164 gene locus_tag LOCUS_41100 6979 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_41100 8083 7034 gene locus_tag LOCUS_41110 8083 7034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_41110 9107 8331 gene locus_tag LOCUS_41120 9107 8331 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 protein_id gnl|my_center|LOCUS_41120 9760 10230 gene locus_tag LOCUS_41130 9760 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 10244 11758 gene locus_tag LOCUS_41140 10244 11758 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_41140 11777 12829 gene locus_tag LOCUS_41150 11777 12829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence47 1192 29 gene locus_tag LOCUS_41160 1192 29 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_41160 1623 1222 gene locus_tag LOCUS_41170 1623 1222 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318521.1 protein_id gnl|my_center|LOCUS_41170 1928 3052 gene locus_tag LOCUS_41180 1928 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 3095 4393 gene locus_tag LOCUS_41190 3095 4393 CDS product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706103.1 protein_id gnl|my_center|LOCUS_41190 4533 5546 gene locus_tag LOCUS_41200 4533 5546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_41200 5663 6682 gene locus_tag LOCUS_41210 gene gntR 5663 6682 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 protein_id gnl|my_center|LOCUS_41210 8077 7145 gene locus_tag LOCUS_41220 8077 7145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_41220 8249 9478 gene locus_tag LOCUS_41230 8249 9478 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_41230 >Feature sequence48 260 730 gene locus_tag LOCUS_41240 260 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 851 1867 gene locus_tag LOCUS_41250 851 1867 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 protein_id gnl|my_center|LOCUS_41250 2094 1864 gene locus_tag LOCUS_41260 2094 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 1984 4860 gene locus_tag LOCUS_41270 1984 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268876.1 protein_id gnl|my_center|LOCUS_41270 4871 5170 gene locus_tag LOCUS_41280 4871 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100541.1 protein_id gnl|my_center|LOCUS_41280 5228 5524 gene locus_tag LOCUS_41290 5228 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253425.2 protein_id gnl|my_center|LOCUS_41290 5707 7161 gene locus_tag LOCUS_41300 5707 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 7696 7499 gene locus_tag LOCUS_41310 7696 7499 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV61 protein_id gnl|my_center|LOCUS_41310 8199 7762 gene locus_tag LOCUS_41320 8199 7762 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095177.1 protein_id gnl|my_center|LOCUS_41320 >Feature sequence49 55 915 gene locus_tag LOCUS_41330 55 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 980 1243 gene locus_tag LOCUS_41340 980 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41340 1250 1429 gene locus_tag LOCUS_41350 1250 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41350 1556 1786 gene locus_tag LOCUS_41360 1556 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2621 2397 gene locus_tag LOCUS_41370 2621 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 3339 2680 gene locus_tag LOCUS_41380 3339 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 4596 3418 gene locus_tag LOCUS_41390 gene atoB 4596 3418 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A8 protein_id gnl|my_center|LOCUS_41390 5346 4735 gene locus_tag LOCUS_41400 5346 4735 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_41400 6068 5370 gene locus_tag LOCUS_41410 6068 5370 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_41410 >Feature sequence50 292 113 gene locus_tag LOCUS_41420 292 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 624 289 gene locus_tag LOCUS_41430 624 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 968 621 gene locus_tag LOCUS_41440 968 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 1125 961 gene locus_tag LOCUS_41450 1125 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 1640 1389 gene locus_tag LOCUS_41460 1640 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 1961 1722 gene locus_tag LOCUS_41470 1961 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2263 1958 gene locus_tag LOCUS_41480 2263 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 2920 2267 gene locus_tag LOCUS_41490 2920 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 3216 2917 gene locus_tag LOCUS_41500 3216 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 3571 3768 gene locus_tag LOCUS_41510 3571 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 5037 3850 gene locus_tag LOCUS_41520 gene int 5037 3850 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_41520 >Feature sequence51 2155 164 gene locus_tag LOCUS_41530 gene liuD 2155 164 CDS product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 protein_id gnl|my_center|LOCUS_41530 2952 2152 gene locus_tag LOCUS_41540 2952 2152 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267705.1 protein_id gnl|my_center|LOCUS_41540 4596 2989 gene locus_tag LOCUS_41550 4596 2989 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762555.1 protein_id gnl|my_center|LOCUS_41550 >Feature sequence52 2125 164 gene locus_tag LOCUS_41560 2125 164 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267704.1 protein_id gnl|my_center|LOCUS_41560 2984 2190 gene locus_tag LOCUS_41570 2984 2190 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267705.1 protein_id gnl|my_center|LOCUS_41570 4698 3091 gene locus_tag LOCUS_41580 4698 3091 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762555.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence53 2275 80 gene locus_tag LOCUS_41590 2275 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590