>Feature sequence001 1345 2169 gene locus_tag LOCUS_00010 gene nhoA 1345 2169 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 protein_id gnl|my_center|LOCUS_00010 2218 2802 gene locus_tag LOCUS_00020 2218 2802 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_00020 3840 2854 gene locus_tag LOCUS_00030 3840 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4181 4939 gene locus_tag LOCUS_00040 4181 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_00040 5568 4951 gene locus_tag LOCUS_00050 5568 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_00050 6582 5758 gene locus_tag LOCUS_00060 6582 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6748 7728 gene locus_tag LOCUS_00070 gene cysK 6748 7728 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF5 protein_id gnl|my_center|LOCUS_00070 7945 8508 gene locus_tag LOCUS_00080 gene btuR 7945 8508 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278895.1 protein_id gnl|my_center|LOCUS_00080 8731 9381 gene locus_tag LOCUS_00090 8731 9381 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_00090 9695 9501 gene locus_tag LOCUS_00100 9695 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11028 10060 gene locus_tag LOCUS_00110 11028 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_00110 11427 11086 gene locus_tag LOCUS_00120 11427 11086 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 protein_id gnl|my_center|LOCUS_00120 12638 12015 gene locus_tag LOCUS_00130 12638 12015 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948650.1 protein_id gnl|my_center|LOCUS_00130 12933 13577 gene locus_tag LOCUS_00140 12933 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13581 14366 gene locus_tag LOCUS_00150 13581 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14874 14503 gene locus_tag LOCUS_00160 14874 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_00160 15047 16201 gene locus_tag LOCUS_00170 15047 16201 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268985.1 protein_id gnl|my_center|LOCUS_00170 16458 17933 gene locus_tag LOCUS_00180 16458 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18874 18059 gene locus_tag LOCUS_00190 18874 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19398 20120 gene locus_tag LOCUS_00200 19398 20120 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_00200 20294 20130 gene locus_tag LOCUS_00210 20294 20130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20479 21468 gene locus_tag LOCUS_00220 20479 21468 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256284.1 protein_id gnl|my_center|LOCUS_00220 22364 21642 gene locus_tag LOCUS_00230 22364 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22703 23545 gene locus_tag LOCUS_00240 22703 23545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24669 23767 gene locus_tag LOCUS_00250 24669 23767 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_00250 24794 25528 gene locus_tag LOCUS_00260 24794 25528 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_00260 26385 25633 gene locus_tag LOCUS_00270 26385 25633 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_00270 28898 26937 gene locus_tag LOCUS_00280 28898 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29496 28900 gene locus_tag LOCUS_00290 29496 28900 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870051.1 protein_id gnl|my_center|LOCUS_00290 29864 29502 gene locus_tag LOCUS_00300 gene cheY64H-1 29864 29502 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_00300 33470 30147 gene locus_tag LOCUS_00310 33470 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35122 33899 gene locus_tag LOCUS_00320 35122 33899 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_00320 35422 36948 gene locus_tag LOCUS_00330 35422 36948 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_00330 36926 38020 gene locus_tag LOCUS_00340 36926 38020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38023 40323 gene locus_tag LOCUS_00350 38023 40323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40307 41239 gene locus_tag LOCUS_00360 gene ubiA 40307 41239 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964118.1 protein_id gnl|my_center|LOCUS_00360 41227 43833 gene locus_tag LOCUS_00370 41227 43833 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_00370 43868 44920 gene locus_tag LOCUS_00380 43868 44920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44907 45527 gene locus_tag LOCUS_00390 44907 45527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45515 46354 gene locus_tag LOCUS_00400 45515 46354 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_00400 47337 46453 gene locus_tag LOCUS_00410 gene rlmF 47337 46453 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_00410 47532 48077 gene locus_tag LOCUS_00420 47532 48077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49852 48245 gene locus_tag LOCUS_00430 gene mcp40H-25 49852 48245 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941702.1 protein_id gnl|my_center|LOCUS_00430 49945 50328 gene locus_tag LOCUS_00440 49945 50328 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_00440 50360 50647 gene locus_tag LOCUS_00450 50360 50647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51699 50758 gene locus_tag LOCUS_00460 gene frmB 51699 50758 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_00460 52692 54293 gene locus_tag LOCUS_00470 52692 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54981 54619 gene locus_tag LOCUS_00480 54981 54619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55370 55729 gene locus_tag LOCUS_00490 55370 55729 CDS product putative pterin-4-alpha-carbinolamine dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM43 protein_id gnl|my_center|LOCUS_00490 55807 57705 gene locus_tag LOCUS_00500 gene speA 55807 57705 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 protein_id gnl|my_center|LOCUS_00500 57818 58489 gene locus_tag LOCUS_00510 gene yiaD 57818 58489 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_00510 58772 59116 gene locus_tag LOCUS_00520 58772 59116 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_00520 59173 59472 gene locus_tag LOCUS_00530 gene glpE 59173 59472 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J2 protein_id gnl|my_center|LOCUS_00530 59596 60180 gene locus_tag LOCUS_00540 gene gst 59596 60180 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124938.1 protein_id gnl|my_center|LOCUS_00540 60456 60223 gene locus_tag LOCUS_00550 60456 60223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61822 62340 gene locus_tag LOCUS_00560 61822 62340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62337 63188 gene locus_tag LOCUS_00570 62337 63188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63188 65482 gene locus_tag LOCUS_00580 63188 65482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65852 67426 gene locus_tag LOCUS_00590 65852 67426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68660 67575 gene locus_tag LOCUS_00600 68660 67575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69399 70166 gene locus_tag LOCUS_00610 69399 70166 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_00610 70297 72411 gene locus_tag LOCUS_00620 70297 72411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72661 72876 gene locus_tag LOCUS_00630 72661 72876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75026 73701 gene locus_tag LOCUS_00640 75026 73701 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 protein_id gnl|my_center|LOCUS_00640 76339 75026 gene locus_tag LOCUS_00650 76339 75026 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 protein_id gnl|my_center|LOCUS_00650 76882 77352 gene locus_tag LOCUS_00660 76882 77352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00660 77377 78726 gene locus_tag LOCUS_00670 77377 78726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00670 79238 79729 gene locus_tag LOCUS_00680 79238 79729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 81429 80401 gene locus_tag LOCUS_00690 81429 80401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81837 82829 gene locus_tag LOCUS_00700 81837 82829 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_00700 83014 83835 gene locus_tag LOCUS_00710 83014 83835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 84049 84987 gene locus_tag LOCUS_00720 84049 84987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 85157 85600 gene locus_tag LOCUS_00730 85157 85600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 85955 86824 gene locus_tag LOCUS_00740 85955 86824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 88218 87136 gene locus_tag LOCUS_00750 88218 87136 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_00750 88358 89239 gene locus_tag LOCUS_00760 88358 89239 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_00760 89973 90566 gene locus_tag LOCUS_00770 89973 90566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 91343 90603 gene locus_tag LOCUS_00780 91343 90603 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120197.1 protein_id gnl|my_center|LOCUS_00780 91434 91841 gene locus_tag LOCUS_00790 91434 91841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 92506 92051 gene locus_tag LOCUS_00800 92506 92051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 93505 93089 gene locus_tag LOCUS_00810 93505 93089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 93781 94350 gene locus_tag LOCUS_00820 93781 94350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95096 94611 gene locus_tag LOCUS_00830 95096 94611 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L10 protein_id gnl|my_center|LOCUS_00830 95254 96102 gene locus_tag LOCUS_00840 95254 96102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 96386 96961 gene locus_tag LOCUS_00850 96386 96961 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261123.1 protein_id gnl|my_center|LOCUS_00850 97029 97766 gene locus_tag LOCUS_00860 97029 97766 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532409.1 protein_id gnl|my_center|LOCUS_00860 97783 98064 gene locus_tag LOCUS_00870 97783 98064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 98137 98517 gene locus_tag LOCUS_00880 98137 98517 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462158.1 protein_id gnl|my_center|LOCUS_00880 100034 98724 gene locus_tag LOCUS_00890 100034 98724 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_00890 101205 100279 gene locus_tag LOCUS_00900 101205 100279 CDS product CAU/MBL1b family subclass B3 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920000.1 protein_id gnl|my_center|LOCUS_00900 101838 101293 gene locus_tag LOCUS_00910 gene rimL 101838 101293 CDS product ribosomal-protein-L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261942.1 protein_id gnl|my_center|LOCUS_00910 102420 102058 gene locus_tag LOCUS_00920 102420 102058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 102961 102590 gene locus_tag LOCUS_00930 102961 102590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 103152 103322 gene locus_tag LOCUS_00940 103152 103322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 104308 103772 gene locus_tag LOCUS_00950 104308 103772 CDS product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720561.1 protein_id gnl|my_center|LOCUS_00950 104765 104565 gene locus_tag LOCUS_00960 104765 104565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105605 104892 gene locus_tag LOCUS_00970 105605 104892 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464841.1 protein_id gnl|my_center|LOCUS_00970 106041 105598 gene locus_tag LOCUS_00980 106041 105598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106755 106261 gene locus_tag LOCUS_00990 106755 106261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107290 106880 gene locus_tag LOCUS_01000 107290 106880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 107766 109229 gene locus_tag LOCUS_01010 107766 109229 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_01010 109558 110052 gene locus_tag LOCUS_01020 109558 110052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110728 110225 gene locus_tag LOCUS_01030 110728 110225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111773 111372 gene locus_tag LOCUS_01040 111773 111372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 112340 111936 gene locus_tag LOCUS_01050 112340 111936 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089903.1 protein_id gnl|my_center|LOCUS_01050 113120 112485 gene locus_tag LOCUS_01060 gene rhtB 113120 112485 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_01060 113875 113294 gene locus_tag LOCUS_01070 113875 113294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 114099 113917 gene locus_tag LOCUS_01080 114099 113917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 114435 114229 gene locus_tag LOCUS_01090 114435 114229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 114948 114556 gene locus_tag LOCUS_01100 114948 114556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115419 115027 gene locus_tag LOCUS_01110 115419 115027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 116047 115661 gene locus_tag LOCUS_01120 116047 115661 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143050.1 protein_id gnl|my_center|LOCUS_01120 116892 116470 gene locus_tag LOCUS_01130 116892 116470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117325 119193 gene locus_tag LOCUS_01140 117325 119193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 120169 119306 gene locus_tag LOCUS_01150 120169 119306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120605 120303 gene locus_tag LOCUS_01160 120605 120303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 121190 120669 gene locus_tag LOCUS_01170 121190 120669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 121731 121324 gene locus_tag LOCUS_01180 121731 121324 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819820.1 protein_id gnl|my_center|LOCUS_01180 122300 121884 gene locus_tag LOCUS_01190 122300 121884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 122648 124789 gene locus_tag LOCUS_01200 122648 124789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 124798 125301 gene locus_tag LOCUS_01210 124798 125301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263212.1 protein_id gnl|my_center|LOCUS_01210 125799 125530 gene locus_tag LOCUS_01220 125799 125530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01220 126011 125862 gene locus_tag LOCUS_01230 126011 125862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 126682 127059 gene locus_tag LOCUS_01240 126682 127059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_01240 127603 127265 gene locus_tag LOCUS_01250 127603 127265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128183 127800 gene locus_tag LOCUS_01260 128183 127800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 128664 128497 gene locus_tag LOCUS_01270 128664 128497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 129569 128994 gene locus_tag LOCUS_01280 129569 128994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 130558 129926 gene locus_tag LOCUS_01290 130558 129926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 130821 130612 gene locus_tag LOCUS_01300 130821 130612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 133972 130997 gene locus_tag LOCUS_01310 133972 130997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 134797 134264 gene locus_tag LOCUS_01320 134797 134264 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096492.1 protein_id gnl|my_center|LOCUS_01320 135251 134880 gene locus_tag LOCUS_01330 135251 134880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136295 135597 gene locus_tag LOCUS_01340 136295 135597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136939 136433 gene locus_tag LOCUS_01350 136939 136433 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104186.1 protein_id gnl|my_center|LOCUS_01350 137420 138214 gene locus_tag LOCUS_01360 137420 138214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 138561 138274 gene locus_tag LOCUS_01370 138561 138274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 139336 138626 gene locus_tag LOCUS_01380 139336 138626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139415 140401 gene locus_tag LOCUS_01390 139415 140401 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 protein_id gnl|my_center|LOCUS_01390 141575 141087 gene locus_tag LOCUS_01400 141575 141087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence002 1502 2878 gene locus_tag LOCUS_01410 1502 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_01410 3326 4264 gene locus_tag LOCUS_01420 3326 4264 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225800.1 protein_id gnl|my_center|LOCUS_01420 4449 5171 gene locus_tag LOCUS_01430 4449 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6146 5523 gene locus_tag LOCUS_01440 6146 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6894 6307 gene locus_tag LOCUS_01450 6894 6307 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_01450 7355 6891 gene locus_tag LOCUS_01460 7355 6891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_01460 7732 8019 gene locus_tag LOCUS_01470 7732 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8338 9840 gene locus_tag LOCUS_01480 8338 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 10131 10403 gene locus_tag LOCUS_01490 10131 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035590.1 protein_id gnl|my_center|LOCUS_01490 11069 10521 gene locus_tag LOCUS_01500 11069 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12600 11275 gene locus_tag LOCUS_01510 gene cobB 12600 11275 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885X2 protein_id gnl|my_center|LOCUS_01510 13244 12600 gene locus_tag LOCUS_01520 gene cobO 13244 12600 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_01520 15688 13241 gene locus_tag LOCUS_01530 gene mrcB 15688 13241 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_01530 15921 18017 gene locus_tag LOCUS_01540 15921 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 18531 18842 gene locus_tag LOCUS_01550 gene rpsJ 18531 18842 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 protein_id gnl|my_center|LOCUS_01550 18939 19574 gene locus_tag LOCUS_01560 gene rplC 18939 19574 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_203618.2 protein_id gnl|my_center|LOCUS_01560 19578 20183 gene locus_tag LOCUS_01570 gene rplD 19578 20183 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY5 protein_id gnl|my_center|LOCUS_01570 20180 20476 gene locus_tag LOCUS_01580 gene rplW 20180 20476 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_01580 20491 21312 gene locus_tag LOCUS_01590 gene rplB 20491 21312 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_01590 21401 21676 gene locus_tag LOCUS_01600 gene rpsS 21401 21676 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQD1 protein_id gnl|my_center|LOCUS_01600 21691 22023 gene locus_tag LOCUS_01610 gene rplV 21691 22023 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_01610 22034 22720 gene locus_tag LOCUS_01620 gene rpsC 22034 22720 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_01620 22732 23145 gene locus_tag LOCUS_01630 gene rplP 22732 23145 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ1 protein_id gnl|my_center|LOCUS_01630 23145 23336 gene locus_tag LOCUS_01640 gene rpmC 23145 23336 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66171 protein_id gnl|my_center|LOCUS_01640 23338 23598 gene locus_tag LOCUS_01650 gene rpsQ 23338 23598 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_01650 23639 24007 gene locus_tag LOCUS_01660 gene rplN 23639 24007 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W1 protein_id gnl|my_center|LOCUS_01660 24042 24368 gene locus_tag LOCUS_01670 gene rplX 24042 24368 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE6 protein_id gnl|my_center|LOCUS_01670 24384 24926 gene locus_tag LOCUS_01680 gene rplE 24384 24926 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_01680 24932 25237 gene locus_tag LOCUS_01690 gene rpsN 24932 25237 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V8 protein_id gnl|my_center|LOCUS_01690 25315 25707 gene locus_tag LOCUS_01700 gene rpsH 25315 25707 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_01700 25719 26252 gene locus_tag LOCUS_01710 gene rplF 25719 26252 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E899 protein_id gnl|my_center|LOCUS_01710 26265 26615 gene locus_tag LOCUS_01720 gene rplR 26265 26615 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V5 protein_id gnl|my_center|LOCUS_01720 26627 27127 gene locus_tag LOCUS_01730 gene rpsE 26627 27127 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 protein_id gnl|my_center|LOCUS_01730 27134 27319 gene locus_tag LOCUS_01740 gene rpmD 27134 27319 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E896 protein_id gnl|my_center|LOCUS_01740 27322 27756 gene locus_tag LOCUS_01750 gene rplO 27322 27756 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP03 protein_id gnl|my_center|LOCUS_01750 27757 29136 gene locus_tag LOCUS_01760 gene secY 27757 29136 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_01760 29403 29762 gene locus_tag LOCUS_01770 gene rpsM 29403 29762 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_01770 29790 30182 gene locus_tag LOCUS_01780 gene rpsK 29790 30182 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59375 protein_id gnl|my_center|LOCUS_01780 30201 30821 gene locus_tag LOCUS_01790 gene rpsD 30201 30821 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_01790 30846 31847 gene locus_tag LOCUS_01800 gene rpoA 30846 31847 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_01800 31874 32260 gene locus_tag LOCUS_01810 gene rplQ 31874 32260 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_01810 33231 32323 gene locus_tag LOCUS_01820 33231 32323 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_01820 33331 34158 gene locus_tag LOCUS_01830 33331 34158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_01830 34393 34566 gene locus_tag LOCUS_01840 34393 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 34614 35648 gene locus_tag LOCUS_01850 gene mutY 34614 35648 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_01850 36628 35669 gene locus_tag LOCUS_01860 36628 35669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 37867 38463 gene locus_tag LOCUS_01870 37867 38463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 38508 39158 gene locus_tag LOCUS_01880 38508 39158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 39994 39164 gene locus_tag LOCUS_01890 39994 39164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 40112 41824 gene locus_tag LOCUS_01900 40112 41824 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578076.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence003 129 551 gene locus_tag LOCUS_01910 129 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1181 705 gene locus_tag LOCUS_01920 gene algQ 1181 705 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_01920 1464 1850 gene locus_tag LOCUS_01930 1464 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 2071 2145 gene locus_tag LOCUS_t00010 2071 2145 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2170 2243 gene locus_tag LOCUS_t00020 2170 2243 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2319 2404 gene locus_tag LOCUS_t00030 2319 2404 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2538 2623 gene locus_tag LOCUS_t00040 2538 2623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2781 4277 gene locus_tag LOCUS_01940 gene gltX 2781 4277 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV02 protein_id gnl|my_center|LOCUS_01940 4402 4477 gene locus_tag LOCUS_t00050 4402 4477 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6220 4625 gene locus_tag LOCUS_01950 6220 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_01950 7935 6214 gene locus_tag LOCUS_01960 7935 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8927 7932 gene locus_tag LOCUS_01970 8927 7932 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492076.1 protein_id gnl|my_center|LOCUS_01970 9396 8920 gene locus_tag LOCUS_01980 9396 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10383 9430 gene locus_tag LOCUS_01990 10383 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263513.1 protein_id gnl|my_center|LOCUS_01990 11356 10400 gene locus_tag LOCUS_02000 11356 10400 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 protein_id gnl|my_center|LOCUS_02000 12602 11505 gene locus_tag LOCUS_02010 12602 11505 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_02010 12920 15529 gene locus_tag LOCUS_02020 gene leuS 12920 15529 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE6 protein_id gnl|my_center|LOCUS_02020 15540 15791 gene locus_tag LOCUS_02030 15540 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198021.1 protein_id gnl|my_center|LOCUS_02030 16479 15877 gene locus_tag LOCUS_02040 16479 15877 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_02040 17675 16479 gene locus_tag LOCUS_02050 17675 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_02050 17778 19451 gene locus_tag LOCUS_02060 17778 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 19444 20133 gene locus_tag LOCUS_02070 19444 20133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_02070 22610 21579 gene locus_tag LOCUS_02080 22610 21579 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980959.1 protein_id gnl|my_center|LOCUS_02080 23639 22800 gene locus_tag LOCUS_02090 23639 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 24507 23713 gene locus_tag LOCUS_02100 gene cpdA 24507 23713 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44685 protein_id gnl|my_center|LOCUS_02100 25076 24627 gene locus_tag LOCUS_02110 25076 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 protein_id gnl|my_center|LOCUS_02110 25651 25064 gene locus_tag LOCUS_02120 gene aspP 25651 25064 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_02120 25750 27081 gene locus_tag LOCUS_02130 gene tolC 25750 27081 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345731.1 protein_id gnl|my_center|LOCUS_02130 29715 27136 gene locus_tag LOCUS_02140 gene mrcA 29715 27136 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_02140 29902 30972 gene locus_tag LOCUS_02150 gene pilM 29902 30972 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_02150 30959 31522 gene locus_tag LOCUS_02160 30959 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 31519 32127 gene locus_tag LOCUS_02170 gene pilO 31519 32127 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_02170 32141 32671 gene locus_tag LOCUS_02180 32141 32671 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_02180 32683 34902 gene locus_tag LOCUS_02190 gene pilQ 32683 34902 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_02190 34907 35440 gene locus_tag LOCUS_02200 gene aroK 34907 35440 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34003 protein_id gnl|my_center|LOCUS_02200 35415 36512 gene locus_tag LOCUS_02210 gene aroB 35415 36512 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_02210 36545 38032 gene locus_tag LOCUS_02220 36545 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946669.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence004 1474 338 gene locus_tag LOCUS_02230 gene ribB 1474 338 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_02230 2308 1493 gene locus_tag LOCUS_02240 2308 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02240 2623 2372 gene locus_tag LOCUS_02250 2623 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02250 3089 2616 gene locus_tag LOCUS_02260 gene nrdR 3089 2616 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMX9 protein_id gnl|my_center|LOCUS_02260 3842 3384 gene locus_tag LOCUS_02270 3842 3384 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_02270 6203 4074 gene locus_tag LOCUS_02280 6203 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957289.1 protein_id gnl|my_center|LOCUS_02280 6556 7218 gene locus_tag LOCUS_02290 6556 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8193 7375 gene locus_tag LOCUS_02300 8193 7375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 protein_id gnl|my_center|LOCUS_02300 8751 8521 gene locus_tag LOCUS_02310 8751 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 8666 9955 gene locus_tag LOCUS_02320 8666 9955 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262031.1 protein_id gnl|my_center|LOCUS_02320 11006 10062 gene locus_tag LOCUS_02330 11006 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035806.1 protein_id gnl|my_center|LOCUS_02330 11535 11969 gene locus_tag LOCUS_02340 11535 11969 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_02340 13074 12166 gene locus_tag LOCUS_02350 gene cyoE1 13074 12166 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR2 protein_id gnl|my_center|LOCUS_02350 14150 13071 gene locus_tag LOCUS_02360 gene ctaA 14150 13071 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_02360 14700 14164 gene locus_tag LOCUS_02370 14700 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 15548 14778 gene locus_tag LOCUS_02380 15548 14778 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q0 protein_id gnl|my_center|LOCUS_02380 16433 15558 gene locus_tag LOCUS_02390 gene coxC 16433 15558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_02390 17020 16433 gene locus_tag LOCUS_02400 gene ctaG 17020 16433 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_02400 18607 17045 gene locus_tag LOCUS_02410 gene coxA 18607 17045 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_02410 19758 18604 gene locus_tag LOCUS_02420 19758 18604 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IS0 protein_id gnl|my_center|LOCUS_02420 21020 20580 gene locus_tag LOCUS_02430 21020 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 21771 21091 gene locus_tag LOCUS_02440 21771 21091 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 protein_id gnl|my_center|LOCUS_02440 22211 21768 gene locus_tag LOCUS_02450 22211 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 22593 22246 gene locus_tag LOCUS_02460 22593 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 23800 22850 gene locus_tag LOCUS_02470 23800 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 24394 25494 gene locus_tag LOCUS_02480 24394 25494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 25750 25601 gene locus_tag LOCUS_02490 25750 25601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 25902 27161 gene locus_tag LOCUS_02500 25902 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 27313 27894 gene locus_tag LOCUS_02510 27313 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 28605 28243 gene locus_tag LOCUS_02520 gene gfaB 28605 28243 CDS product glutathione-dependent formaldehyde-activating enzyme GfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070494.1 protein_id gnl|my_center|LOCUS_02520 30187 28676 gene locus_tag LOCUS_02530 30187 28676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 31285 30269 gene locus_tag LOCUS_02540 31285 30269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090238.1 protein_id gnl|my_center|LOCUS_02540 31679 34135 gene locus_tag LOCUS_02550 31679 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 34370 34885 gene locus_tag LOCUS_02560 34370 34885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 35115 35324 gene locus_tag LOCUS_02570 35115 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 35368 35751 gene locus_tag LOCUS_02580 35368 35751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 37431 36211 gene locus_tag LOCUS_02590 gene vieA 37431 36211 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_02590 38511 37465 gene locus_tag LOCUS_02600 gene cheB-1 38511 37465 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH22 protein_id gnl|my_center|LOCUS_02600 39319 38501 gene locus_tag LOCUS_02610 gene cheR-1 39319 38501 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888V6 protein_id gnl|my_center|LOCUS_02610 40993 39323 gene locus_tag LOCUS_02620 40993 39323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence005 508 185 gene locus_tag LOCUS_02630 508 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1166 783 gene locus_tag LOCUS_02640 1166 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1393 1223 gene locus_tag LOCUS_02650 1393 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2721 1924 gene locus_tag LOCUS_02660 2721 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 3348 2902 gene locus_tag LOCUS_02670 3348 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 4282 3545 gene locus_tag LOCUS_02680 4282 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4479 5369 gene locus_tag LOCUS_02690 4479 5369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_02690 6157 5399 gene locus_tag LOCUS_02700 6157 5399 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120197.1 protein_id gnl|my_center|LOCUS_02700 6292 6612 gene locus_tag LOCUS_02710 6292 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6917 7243 gene locus_tag LOCUS_02720 6917 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7379 7771 gene locus_tag LOCUS_02730 7379 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10509 7810 gene locus_tag LOCUS_02740 10509 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 11183 10557 gene locus_tag LOCUS_02750 11183 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 11284 12396 gene locus_tag LOCUS_02760 gene pqsH 11284 12396 CDS product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q0 protein_id gnl|my_center|LOCUS_02760 12393 12758 gene locus_tag LOCUS_02770 12393 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12888 13502 gene locus_tag LOCUS_02780 12888 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 14785 13493 gene locus_tag LOCUS_02790 14785 13493 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_02790 14809 15072 gene locus_tag LOCUS_02800 14809 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 16855 15296 gene locus_tag LOCUS_02810 16855 15296 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705467.1 protein_id gnl|my_center|LOCUS_02810 18527 16848 gene locus_tag LOCUS_02820 18527 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 19522 18881 gene locus_tag LOCUS_02830 19522 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 21193 19907 gene locus_tag LOCUS_02840 21193 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 21726 21277 gene locus_tag LOCUS_02850 21726 21277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 22293 23084 gene locus_tag LOCUS_02860 22293 23084 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_02860 23519 23199 gene locus_tag LOCUS_02870 23519 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 25056 23644 gene locus_tag LOCUS_02880 25056 23644 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_02880 25413 25796 gene locus_tag LOCUS_02890 25413 25796 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964435.1 protein_id gnl|my_center|LOCUS_02890 27743 25923 gene locus_tag LOCUS_02900 27743 25923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 27845 28360 gene locus_tag LOCUS_02910 27845 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119352.1 protein_id gnl|my_center|LOCUS_02910 29717 28506 gene locus_tag LOCUS_02920 29717 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 30502 29726 gene locus_tag LOCUS_02930 30502 29726 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083318.1 protein_id gnl|my_center|LOCUS_02930 31371 30499 gene locus_tag LOCUS_02940 31371 30499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 33613 31373 gene locus_tag LOCUS_02950 33613 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 35047 34103 gene locus_tag LOCUS_02960 gene trxB1 35047 34103 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_02960 35315 35749 gene locus_tag LOCUS_02970 35315 35749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 35830 36045 gene locus_tag LOCUS_02980 35830 36045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence006 1345 125 gene locus_tag LOCUS_02990 1345 125 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 protein_id gnl|my_center|LOCUS_02990 1812 3308 gene locus_tag LOCUS_03000 1812 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03000 3381 5264 gene locus_tag LOCUS_03010 3381 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03010 5261 6133 gene locus_tag LOCUS_03020 5261 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6948 6346 gene locus_tag LOCUS_03030 6948 6346 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946834.1 protein_id gnl|my_center|LOCUS_03030 8652 7711 gene locus_tag LOCUS_03040 8652 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8902 10413 gene locus_tag LOCUS_03050 8902 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10976 10572 gene locus_tag LOCUS_03060 10976 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 12085 11309 gene locus_tag LOCUS_03070 12085 11309 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_03070 12365 13111 gene locus_tag LOCUS_03080 12365 13111 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_03080 13919 13275 gene locus_tag LOCUS_03090 13919 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 14439 13909 gene locus_tag LOCUS_03100 14439 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 15400 14846 gene locus_tag LOCUS_03110 15400 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 15948 16415 gene locus_tag LOCUS_03120 15948 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 16491 17123 gene locus_tag LOCUS_03130 16491 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 18130 17348 gene locus_tag LOCUS_03140 18130 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 18872 18300 gene locus_tag LOCUS_03150 18872 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 21001 19073 gene locus_tag LOCUS_03160 gene htpG 21001 19073 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUW2 protein_id gnl|my_center|LOCUS_03160 21177 21503 gene locus_tag LOCUS_03170 21177 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 21757 22356 gene locus_tag LOCUS_03180 21757 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_03180 23131 22301 gene locus_tag LOCUS_03190 23131 22301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 23615 23926 gene locus_tag LOCUS_03200 23615 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 24192 24578 gene locus_tag LOCUS_03210 gene tusD 24192 24578 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_03210 24575 24922 gene locus_tag LOCUS_03220 gene tusC 24575 24922 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 protein_id gnl|my_center|LOCUS_03220 24919 25248 gene locus_tag LOCUS_03230 24919 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 25250 25561 gene locus_tag LOCUS_03240 25250 25561 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL9 protein_id gnl|my_center|LOCUS_03240 25558 26592 gene locus_tag LOCUS_03250 25558 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_03250 26896 26606 gene locus_tag LOCUS_03260 26896 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 27014 29479 gene locus_tag LOCUS_03270 27014 29479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 30278 29919 gene locus_tag LOCUS_03280 30278 29919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 34384 30521 gene locus_tag LOCUS_03290 34384 30521 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_03290 <35242 34396 gene locus_tag LOCUS_03300 <35242 34396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383105.1:ABC transporter substrate-binding protein >Feature sequence007 <1 1120 gene locus_tag LOCUS_03310 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:potassium transporter inner membrane associated protein 1130 2578 gene locus_tag LOCUS_03320 gene trkH 1130 2578 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_03320 2652 3992 gene locus_tag LOCUS_03330 2652 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4082 5014 gene locus_tag LOCUS_03340 gene glyQ 4082 5014 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_03340 5017 7086 gene locus_tag LOCUS_03350 gene glyS 5017 7086 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TP8 protein_id gnl|my_center|LOCUS_03350 7100 7831 gene locus_tag LOCUS_03360 gene lptA 7100 7831 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_03360 7833 8504 gene locus_tag LOCUS_03370 gene rpiA 7833 8504 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_03370 8796 9488 gene locus_tag LOCUS_03380 8796 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_03380 9565 10287 gene locus_tag LOCUS_03390 9565 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_03390 10339 11052 gene locus_tag LOCUS_03400 gene drrA 10339 11052 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_03400 11061 12545 gene locus_tag LOCUS_03410 11061 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03410 13370 12651 gene locus_tag LOCUS_03420 gene gph 13370 12651 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_03420 14909 14424 gene locus_tag LOCUS_03430 14909 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 15965 16171 gene locus_tag LOCUS_03440 15965 16171 CDS product putative cold shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701240.1 protein_id gnl|my_center|LOCUS_03440 16600 17208 gene locus_tag LOCUS_03450 16600 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 17218 17832 gene locus_tag LOCUS_03460 17218 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 18196 18462 gene locus_tag LOCUS_03470 18196 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 18685 19029 gene locus_tag LOCUS_03480 18685 19029 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_03480 19069 19422 gene locus_tag LOCUS_03490 19069 19422 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 protein_id gnl|my_center|LOCUS_03490 23170 19982 gene locus_tag LOCUS_03500 23170 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 24229 23753 gene locus_tag LOCUS_03510 24229 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_03510 24489 25079 gene locus_tag LOCUS_03520 gene wrn 24489 25079 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_03520 25179 25469 gene locus_tag LOCUS_03530 25179 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 25862 25680 gene locus_tag LOCUS_03540 25862 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 26576 27718 gene locus_tag LOCUS_03550 26576 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 28614 27835 gene locus_tag LOCUS_03560 28614 27835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 29611 30621 gene locus_tag LOCUS_03570 29611 30621 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 protein_id gnl|my_center|LOCUS_03570 30692 31876 gene locus_tag LOCUS_03580 30692 31876 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_03580 31888 32985 gene locus_tag LOCUS_03590 31888 32985 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence008 3879 775 gene locus_tag LOCUS_03600 3879 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5490 4318 gene locus_tag LOCUS_03610 5490 4318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_03610 6097 5480 gene locus_tag LOCUS_03620 gene yfcG 6097 5480 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_03620 6173 7084 gene locus_tag LOCUS_03630 6173 7084 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_03630 7218 8060 gene locus_tag LOCUS_03640 7218 8060 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_03640 8447 8124 gene locus_tag LOCUS_03650 8447 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9043 8558 gene locus_tag LOCUS_03660 9043 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9650 10432 gene locus_tag LOCUS_03670 9650 10432 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103136.1 protein_id gnl|my_center|LOCUS_03670 10969 11196 gene locus_tag LOCUS_03680 10969 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11205 11843 gene locus_tag LOCUS_03690 gene tpm 11205 11843 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC3 protein_id gnl|my_center|LOCUS_03690 13266 12112 gene locus_tag LOCUS_03700 13266 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14637 14368 gene locus_tag LOCUS_03710 14637 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03710 14987 14736 gene locus_tag LOCUS_03720 14987 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 16967 14997 gene locus_tag LOCUS_03730 16967 14997 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584099.1 protein_id gnl|my_center|LOCUS_03730 18032 17457 gene locus_tag LOCUS_03740 18032 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 19855 18626 gene locus_tag LOCUS_03750 19855 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20256 20011 gene locus_tag LOCUS_03760 20256 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21013 20453 gene locus_tag LOCUS_03770 21013 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 21563 21024 gene locus_tag LOCUS_03780 21563 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 24775 21959 gene locus_tag LOCUS_03790 24775 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 25393 25241 gene locus_tag LOCUS_03800 25393 25241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 25836 25411 gene locus_tag LOCUS_03810 25836 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 26933 25881 gene locus_tag LOCUS_03820 gene tas 26933 25881 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 protein_id gnl|my_center|LOCUS_03820 27078 27950 gene locus_tag LOCUS_03830 27078 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 28010 28732 gene locus_tag LOCUS_03840 28010 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 28826 29221 gene locus_tag LOCUS_03850 28826 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 30215 29280 gene locus_tag LOCUS_03860 30215 29280 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460932.1 protein_id gnl|my_center|LOCUS_03860 <32632 30212 gene locus_tag LOCUS_03870 <32632 30212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263825.1:hybrid sensor histidine kinase/response regulator >Feature sequence009 <1 629 gene locus_tag LOCUS_03880 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261453.1:minor lipoprotein 1400 1056 gene locus_tag LOCUS_03890 1400 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3253 2654 gene locus_tag LOCUS_03900 gene ubiX 3253 2654 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_03900 3585 5066 gene locus_tag LOCUS_03910 gene fleQ 3585 5066 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_03910 7277 5145 gene locus_tag LOCUS_03920 7277 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 7586 7320 gene locus_tag LOCUS_03930 7586 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8963 7599 gene locus_tag LOCUS_03940 8963 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9652 9161 gene locus_tag LOCUS_03950 9652 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 9870 10040 gene locus_tag LOCUS_03960 9870 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 10702 10019 gene locus_tag LOCUS_03970 10702 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12170 10695 gene locus_tag LOCUS_03980 gene ubiD 12170 10695 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_03980 12554 12180 gene locus_tag LOCUS_03990 12554 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 protein_id gnl|my_center|LOCUS_03990 13902 12583 gene locus_tag LOCUS_04000 gene hslU 13902 12583 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V00 protein_id gnl|my_center|LOCUS_04000 14434 13904 gene locus_tag LOCUS_04010 gene hslV 14434 13904 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_04010 15996 14581 gene locus_tag LOCUS_04020 15996 14581 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268469.1 protein_id gnl|my_center|LOCUS_04020 16657 16094 gene locus_tag LOCUS_04030 16657 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 18042 16678 gene locus_tag LOCUS_04040 18042 16678 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_04040 18521 18252 gene locus_tag LOCUS_04050 18521 18252 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_04050 19375 18524 gene locus_tag LOCUS_04060 19375 18524 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WT7 protein_id gnl|my_center|LOCUS_04060 19831 19382 gene locus_tag LOCUS_04070 gene ptsN 19831 19382 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_04070 21233 19854 gene locus_tag LOCUS_04080 gene rpoN 21233 19854 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_04080 21158 21334 gene locus_tag LOCUS_04090 21158 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 22075 21374 gene locus_tag LOCUS_04100 22075 21374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_04100 22614 22102 gene locus_tag LOCUS_04110 22614 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 23212 22616 gene locus_tag LOCUS_04120 23212 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 24180 23209 gene locus_tag LOCUS_04130 gene kdsD 24180 23209 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_04130 24276 24929 gene locus_tag LOCUS_04140 24276 24929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 25062 25283 gene locus_tag LOCUS_04150 25062 25283 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_04150 25293 26561 gene locus_tag LOCUS_04160 gene murA 25293 26561 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_04160 26740 28041 gene locus_tag LOCUS_04170 gene hisD 26740 28041 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_04170 28755 28150 gene locus_tag LOCUS_04180 28755 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 28918 30096 gene locus_tag LOCUS_04190 gene fabV 28918 30096 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 protein_id gnl|my_center|LOCUS_04190 30177 30896 gene locus_tag LOCUS_04200 30177 30896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 30957 32429 gene locus_tag LOCUS_04210 30957 32429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence010 1388 2293 gene locus_tag LOCUS_04220 1388 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2295 3038 gene locus_tag LOCUS_04230 gene tuaG 2295 3038 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_04230 4150 3140 gene locus_tag LOCUS_04240 4150 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5079 4147 gene locus_tag LOCUS_04250 5079 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6302 5076 gene locus_tag LOCUS_04260 6302 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7374 6295 gene locus_tag LOCUS_04270 7374 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8120 7371 gene locus_tag LOCUS_04280 8120 7371 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_04280 8956 8141 gene locus_tag LOCUS_04290 8956 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10374 8953 gene locus_tag LOCUS_04300 10374 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11330 10398 gene locus_tag LOCUS_04310 11330 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11786 11376 gene locus_tag LOCUS_04320 11786 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679039.1 protein_id gnl|my_center|LOCUS_04320 12657 11884 gene locus_tag LOCUS_04330 12657 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 13538 12666 gene locus_tag LOCUS_04340 gene rmlA 13538 12666 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECF6 protein_id gnl|my_center|LOCUS_04340 14611 13535 gene locus_tag LOCUS_04350 gene rffG 14611 13535 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_04350 15578 14619 gene locus_tag LOCUS_04360 gene wbcJ 15578 14619 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN61 protein_id gnl|my_center|LOCUS_04360 16890 15775 gene locus_tag LOCUS_04370 gene gmd 16890 15775 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 protein_id gnl|my_center|LOCUS_04370 18367 16922 gene locus_tag LOCUS_04380 gene cpsB 18367 16922 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_04380 19552 18371 gene locus_tag LOCUS_04390 19552 18371 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_04390 20004 19549 gene locus_tag LOCUS_04400 gene pyrI 20004 19549 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG1 protein_id gnl|my_center|LOCUS_04400 20932 19997 gene locus_tag LOCUS_04410 gene pyrB 20932 19997 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7U5 protein_id gnl|my_center|LOCUS_04410 21150 21488 gene locus_tag LOCUS_04420 gene comEA 21150 21488 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071934.1 protein_id gnl|my_center|LOCUS_04420 24849 21598 gene locus_tag LOCUS_04430 24849 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 26763 25348 gene locus_tag LOCUS_04440 26763 25348 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532272.1 protein_id gnl|my_center|LOCUS_04440 27557 26760 gene locus_tag LOCUS_04450 27557 26760 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_04450 28898 27666 gene locus_tag LOCUS_04460 28898 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 29249 31057 gene locus_tag LOCUS_04470 29249 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 31119 32084 gene locus_tag LOCUS_04480 31119 32084 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH7 protein_id gnl|my_center|LOCUS_04480 >Feature sequence011 2855 1308 gene locus_tag LOCUS_04490 2855 1308 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_04490 3580 3080 gene locus_tag LOCUS_04500 3580 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3997 5964 gene locus_tag LOCUS_04510 3997 5964 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107506.1 protein_id gnl|my_center|LOCUS_04510 6608 6399 gene locus_tag LOCUS_04520 6608 6399 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_04520 7260 7027 gene locus_tag LOCUS_04530 7260 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 7681 9666 gene locus_tag LOCUS_04540 7681 9666 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458057.1 protein_id gnl|my_center|LOCUS_04540 9712 9837 gene locus_tag LOCUS_04550 9712 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 10537 9932 gene locus_tag LOCUS_04560 10537 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973888.1 protein_id gnl|my_center|LOCUS_04560 11266 10601 gene locus_tag LOCUS_04570 11266 10601 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_04570 11883 11314 gene locus_tag LOCUS_04580 11883 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948620.1 protein_id gnl|my_center|LOCUS_04580 12398 11988 gene locus_tag LOCUS_04590 12398 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461503.1 protein_id gnl|my_center|LOCUS_04590 12903 12427 gene locus_tag LOCUS_04600 gene ysnE 12903 12427 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_04600 13152 13958 gene locus_tag LOCUS_04610 13152 13958 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106282.1 protein_id gnl|my_center|LOCUS_04610 14049 14609 gene locus_tag LOCUS_04620 14049 14609 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710172.1 protein_id gnl|my_center|LOCUS_04620 14979 15395 gene locus_tag LOCUS_04630 14979 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 17999 16398 gene locus_tag LOCUS_04640 17999 16398 CDS product putative phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26024 protein_id gnl|my_center|LOCUS_04640 19022 18672 gene locus_tag LOCUS_04650 19022 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 20716 19319 gene locus_tag LOCUS_04660 20716 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 21297 20752 gene locus_tag LOCUS_04670 21297 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_04670 22897 21476 gene locus_tag LOCUS_04680 22897 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 25673 22899 gene locus_tag LOCUS_04690 25673 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 26153 25947 gene locus_tag LOCUS_04700 26153 25947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 26918 26217 gene locus_tag LOCUS_04710 26918 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 27968 27015 gene locus_tag LOCUS_04720 27968 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 29370 28126 gene locus_tag LOCUS_04730 29370 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence012 270 479 gene locus_tag LOCUS_04740 270 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 627 1007 gene locus_tag LOCUS_04750 627 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1808 3745 gene locus_tag LOCUS_04760 1808 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388240.1 protein_id gnl|my_center|LOCUS_04760 4247 3852 gene locus_tag LOCUS_04770 4247 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5316 4360 gene locus_tag LOCUS_04780 5316 4360 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_04780 6099 5449 gene locus_tag LOCUS_04790 6099 5449 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_04790 6273 6103 gene locus_tag LOCUS_04800 6273 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7151 6564 gene locus_tag LOCUS_04810 7151 6564 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_04810 7298 8233 gene locus_tag LOCUS_04820 7298 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9287 8349 gene locus_tag LOCUS_04830 9287 8349 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_04830 10306 9287 gene locus_tag LOCUS_04840 10306 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_04840 10918 10346 gene locus_tag LOCUS_04850 10918 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12019 10940 gene locus_tag LOCUS_04860 12019 10940 CDS product dinitrogenase reductase activating glycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_04860 12100 12837 gene locus_tag LOCUS_04870 12100 12837 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_04870 13478 13245 gene locus_tag LOCUS_04880 13478 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 14885 13824 gene locus_tag LOCUS_04890 14885 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948228.1 protein_id gnl|my_center|LOCUS_04890 15427 14882 gene locus_tag LOCUS_04900 15427 14882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_04900 16320 15484 gene locus_tag LOCUS_04910 16320 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496952.1 protein_id gnl|my_center|LOCUS_04910 16869 16390 gene locus_tag LOCUS_04920 16869 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_04920 17529 16921 gene locus_tag LOCUS_04930 17529 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_04930 19214 17628 gene locus_tag LOCUS_04940 19214 17628 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_04940 20177 19224 gene locus_tag LOCUS_04950 gene prs 20177 19224 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_04950 20354 21052 gene locus_tag LOCUS_04960 gene nrtR 20354 21052 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_04960 21567 22304 gene locus_tag LOCUS_04970 21567 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 23100 22504 gene locus_tag LOCUS_04980 23100 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 23836 23354 gene locus_tag LOCUS_04990 23836 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24249 24584 gene locus_tag LOCUS_05000 24249 24584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25243 26223 gene locus_tag LOCUS_05010 25243 26223 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_05010 26611 27282 gene locus_tag LOCUS_05020 26611 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 27818 27426 gene locus_tag LOCUS_05030 27818 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 28332 27937 gene locus_tag LOCUS_05040 28332 27937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 28772 28455 gene locus_tag LOCUS_05050 28772 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 30258 29116 gene locus_tag LOCUS_05060 30258 29116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05060 30654 30274 gene locus_tag LOCUS_05070 30654 30274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05070 31063 31575 gene locus_tag LOCUS_05080 31063 31575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05080 >Feature sequence013 268 2667 gene locus_tag LOCUS_05090 268 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2900 4288 gene locus_tag LOCUS_05100 2900 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4420 5163 gene locus_tag LOCUS_05110 4420 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5335 6315 gene locus_tag LOCUS_05120 5335 6315 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_05120 6708 11411 gene locus_tag LOCUS_05130 6708 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 11411 12688 gene locus_tag LOCUS_05140 11411 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13106 15427 gene locus_tag LOCUS_05150 13106 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 15612 16016 gene locus_tag LOCUS_05160 15612 16016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 16290 16796 gene locus_tag LOCUS_05170 16290 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16815 17483 gene locus_tag LOCUS_05180 16815 17483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17595 18035 gene locus_tag LOCUS_05190 17595 18035 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263463.1 protein_id gnl|my_center|LOCUS_05190 18150 18503 gene locus_tag LOCUS_05200 18150 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 18621 19094 gene locus_tag LOCUS_05210 18621 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19205 19363 gene locus_tag LOCUS_05220 19205 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 19394 19558 gene locus_tag LOCUS_05230 19394 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 19668 20057 gene locus_tag LOCUS_05240 19668 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 21025 20228 gene locus_tag LOCUS_05250 21025 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 21864 22280 gene locus_tag LOCUS_05260 21864 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 22528 23025 gene locus_tag LOCUS_05270 22528 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 24613 26976 gene locus_tag LOCUS_05280 24613 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 27511 28302 gene locus_tag LOCUS_05290 gene nagB 27511 28302 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC83 protein_id gnl|my_center|LOCUS_05290 28383 29291 gene locus_tag LOCUS_05300 gene nagK 28383 29291 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 protein_id gnl|my_center|LOCUS_05300 29382 30500 gene locus_tag LOCUS_05310 gene nagA 29382 30500 CDS product N-acetylgalactosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBK8 protein_id gnl|my_center|LOCUS_05310 >Feature sequence014 1163 540 gene locus_tag LOCUS_05320 gene azoR 1163 540 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 protein_id gnl|my_center|LOCUS_05320 3857 2166 gene locus_tag LOCUS_05330 3857 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4893 4381 gene locus_tag LOCUS_05340 4893 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5281 6456 gene locus_tag LOCUS_05350 5281 6456 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_05350 6453 7139 gene locus_tag LOCUS_05360 gene prfH 6453 7139 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_05360 8297 7245 gene locus_tag LOCUS_05370 8297 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9325 8798 gene locus_tag LOCUS_05380 9325 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 9736 10242 gene locus_tag LOCUS_05390 gene yegJ 9736 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76394 protein_id gnl|my_center|LOCUS_05390 10800 10477 gene locus_tag LOCUS_05400 10800 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 11296 10970 gene locus_tag LOCUS_05410 11296 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 11888 14875 gene locus_tag LOCUS_05420 11888 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 15620 17701 gene locus_tag LOCUS_05430 15620 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 18225 18584 gene locus_tag LOCUS_05440 18225 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 19034 20074 gene locus_tag LOCUS_05450 19034 20074 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021005.1 protein_id gnl|my_center|LOCUS_05450 20942 20190 gene locus_tag LOCUS_05460 20942 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 21921 21532 gene locus_tag LOCUS_05470 21921 21532 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_05470 22026 22799 gene locus_tag LOCUS_05480 22026 22799 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227633.1 protein_id gnl|my_center|LOCUS_05480 25945 22955 gene locus_tag LOCUS_05490 25945 22955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 26242 26493 gene locus_tag LOCUS_05500 26242 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27922 27164 gene locus_tag LOCUS_05510 27922 27164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939681.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence015 3 215 gene locus_tag LOCUS_05520 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 306 953 gene locus_tag LOCUS_05530 gene dut 306 953 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_05530 2164 1010 gene locus_tag LOCUS_05540 2164 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376590.1 protein_id gnl|my_center|LOCUS_05540 2425 3264 gene locus_tag LOCUS_05550 gene ada 2425 3264 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_05550 3261 3869 gene locus_tag LOCUS_05560 3261 3869 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_05560 4334 3885 gene locus_tag LOCUS_05570 4334 3885 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105462.1 protein_id gnl|my_center|LOCUS_05570 5269 4430 gene locus_tag LOCUS_05580 gene panC 5269 4430 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_05580 5434 6708 gene locus_tag LOCUS_05590 gene hemL 5434 6708 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9B4 protein_id gnl|my_center|LOCUS_05590 8109 6823 gene locus_tag LOCUS_05600 8109 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9675 8245 gene locus_tag LOCUS_05610 9675 8245 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_05610 9883 11085 gene locus_tag LOCUS_05620 gene tyrS 9883 11085 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM7 protein_id gnl|my_center|LOCUS_05620 11089 11928 gene locus_tag LOCUS_05630 gene prmC 11089 11928 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T2 protein_id gnl|my_center|LOCUS_05630 11982 13226 gene locus_tag LOCUS_05640 11982 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13613 13275 gene locus_tag LOCUS_05650 13613 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13743 14390 gene locus_tag LOCUS_05660 gene rnt 13743 14390 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMR6 protein_id gnl|my_center|LOCUS_05660 14468 15967 gene locus_tag LOCUS_05670 gene pcnB 14468 15967 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_05670 15964 16476 gene locus_tag LOCUS_05680 gene folK 15964 16476 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_05680 16805 17218 gene locus_tag LOCUS_05690 16805 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17332 17868 gene locus_tag LOCUS_05700 gene apt 17332 17868 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U6 protein_id gnl|my_center|LOCUS_05700 18058 18546 gene locus_tag LOCUS_05710 18058 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_05710 19948 19040 gene locus_tag LOCUS_05720 19948 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 21730 20114 gene locus_tag LOCUS_05730 gene pgi 21730 20114 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_05730 22182 21802 gene locus_tag LOCUS_05740 gene panD 22182 21802 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_05740 22535 22972 gene locus_tag LOCUS_05750 gene aroQ 22535 22972 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRC4 protein_id gnl|my_center|LOCUS_05750 23000 23455 gene locus_tag LOCUS_05760 23000 23455 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_05760 23465 24808 gene locus_tag LOCUS_05770 23465 24808 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_05770 24895 25788 gene locus_tag LOCUS_05780 gene prmA 24895 25788 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS3 protein_id gnl|my_center|LOCUS_05780 25818 27374 gene locus_tag LOCUS_05790 25818 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105208.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence016 <1 531 gene locus_tag LOCUS_05800 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VK7:replicative DNA helicase 528 1607 gene locus_tag LOCUS_05810 gene alr 528 1607 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E849 protein_id gnl|my_center|LOCUS_05810 1600 2268 gene locus_tag LOCUS_05820 gene ung 1600 2268 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 protein_id gnl|my_center|LOCUS_05820 3009 2305 gene locus_tag LOCUS_05830 3009 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4146 3343 gene locus_tag LOCUS_05840 gene speD 4146 3343 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_05840 4679 4266 gene locus_tag LOCUS_05850 4679 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_05850 5016 5660 gene locus_tag LOCUS_05860 gene vfr 5016 5660 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_05860 6107 5733 gene locus_tag LOCUS_05870 6107 5733 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_05870 6187 7251 gene locus_tag LOCUS_05880 6187 7251 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_05880 8205 7252 gene locus_tag LOCUS_05890 8205 7252 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_05890 8797 10458 gene locus_tag LOCUS_05900 gene cysI 8797 10458 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_05900 10442 10927 gene locus_tag LOCUS_05910 10442 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_05910 12656 11013 gene locus_tag LOCUS_05920 12656 11013 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_05920 13341 13030 gene locus_tag LOCUS_05930 13341 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 13481 14872 gene locus_tag LOCUS_05940 13481 14872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_05940 14875 15585 gene locus_tag LOCUS_05950 14875 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 15804 16577 gene locus_tag LOCUS_05960 15804 16577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_05960 16699 16971 gene locus_tag LOCUS_05970 16699 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 17608 17237 gene locus_tag LOCUS_05980 17608 17237 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y8Z0 protein_id gnl|my_center|LOCUS_05980 18019 17627 gene locus_tag LOCUS_05990 18019 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 19006 18101 gene locus_tag LOCUS_06000 19006 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 19201 20352 gene locus_tag LOCUS_06010 19201 20352 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 protein_id gnl|my_center|LOCUS_06010 20349 21272 gene locus_tag LOCUS_06020 20349 21272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271063.1 protein_id gnl|my_center|LOCUS_06020 21272 22042 gene locus_tag LOCUS_06030 21272 22042 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUD2 protein_id gnl|my_center|LOCUS_06030 22039 22863 gene locus_tag LOCUS_06040 gene queF 22039 22863 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLP9 protein_id gnl|my_center|LOCUS_06040 24344 23379 gene locus_tag LOCUS_06050 24344 23379 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_06050 24849 25190 gene locus_tag LOCUS_06060 24849 25190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 25290 25607 gene locus_tag LOCUS_06070 25290 25607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 25731 26051 gene locus_tag LOCUS_06080 25731 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 26518 26949 gene locus_tag LOCUS_06090 26518 26949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence017 594 22 gene locus_tag LOCUS_06100 594 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1131 598 gene locus_tag LOCUS_06110 1131 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2112 1303 gene locus_tag LOCUS_06120 2112 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2311 2778 gene locus_tag LOCUS_06130 2311 2778 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_06130 2894 3040 gene locus_tag LOCUS_06140 2894 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5110 3155 gene locus_tag LOCUS_06150 5110 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5793 5110 gene locus_tag LOCUS_06160 5793 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6714 5803 gene locus_tag LOCUS_06170 6714 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7218 7688 gene locus_tag LOCUS_06180 7218 7688 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_06180 8191 7808 gene locus_tag LOCUS_06190 8191 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8660 9115 gene locus_tag LOCUS_06200 8660 9115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074064.1 protein_id gnl|my_center|LOCUS_06200 9267 10259 gene locus_tag LOCUS_06210 9267 10259 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_06210 11297 10314 gene locus_tag LOCUS_06220 gene rnz 11297 10314 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_06220 16144 11699 gene locus_tag LOCUS_06230 16144 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 16423 17031 gene locus_tag LOCUS_06240 gene yqiA 16423 17031 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_06240 17251 17499 gene locus_tag LOCUS_06250 17251 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 17578 18039 gene locus_tag LOCUS_06260 17578 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 19978 18287 gene locus_tag LOCUS_06270 19978 18287 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_06270 20544 21695 gene locus_tag LOCUS_06280 20544 21695 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_06280 22646 21822 gene locus_tag LOCUS_06290 22646 21822 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266453.1 protein_id gnl|my_center|LOCUS_06290 23343 24323 gene locus_tag LOCUS_06300 23343 24323 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 protein_id gnl|my_center|LOCUS_06300 24565 25449 gene locus_tag LOCUS_06310 24565 25449 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_06310 26041 25454 gene locus_tag LOCUS_06320 26041 25454 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_06320 26803 26180 gene locus_tag LOCUS_06330 26803 26180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence018 507 4388 gene locus_tag LOCUS_06340 gene cobN 507 4388 CDS product aerobic cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ3 protein_id gnl|my_center|LOCUS_06340 4381 5871 gene locus_tag LOCUS_06350 gene cobQ 4381 5871 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ64 protein_id gnl|my_center|LOCUS_06350 5868 6881 gene locus_tag LOCUS_06360 gene cobD 5868 6881 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I469 protein_id gnl|my_center|LOCUS_06360 6881 7891 gene locus_tag LOCUS_06370 6881 7891 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268580.1 protein_id gnl|my_center|LOCUS_06370 8857 8078 gene locus_tag LOCUS_06380 8857 8078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073325.1 protein_id gnl|my_center|LOCUS_06380 10422 9856 gene locus_tag LOCUS_06390 10422 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 11630 10761 gene locus_tag LOCUS_06400 11630 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12399 11791 gene locus_tag LOCUS_06410 12399 11791 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 protein_id gnl|my_center|LOCUS_06410 12761 13135 gene locus_tag LOCUS_06420 12761 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13182 13361 gene locus_tag LOCUS_06430 13182 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13324 13818 gene locus_tag LOCUS_06440 13324 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06440 15797 13977 gene locus_tag LOCUS_06450 15797 13977 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_06450 16740 16294 gene locus_tag LOCUS_06460 16740 16294 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261186.1 protein_id gnl|my_center|LOCUS_06460 17431 16787 gene locus_tag LOCUS_06470 17431 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 18119 17463 gene locus_tag LOCUS_06480 gene nfsB 18119 17463 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 protein_id gnl|my_center|LOCUS_06480 19601 18927 gene locus_tag LOCUS_06490 gene fabG 19601 18927 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_06490 19813 20502 gene locus_tag LOCUS_06500 19813 20502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 21211 20984 gene locus_tag LOCUS_06510 21211 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 21186 22001 gene locus_tag LOCUS_06520 21186 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23952 22405 gene locus_tag LOCUS_06530 23952 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_06530 <25978 24502 gene locus_tag LOCUS_06540 <25978 24502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FR85:bifunctional protein PutA >Feature sequence019 892 1896 gene locus_tag LOCUS_06550 892 1896 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_06550 2021 4567 gene locus_tag LOCUS_06560 2021 4567 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 protein_id gnl|my_center|LOCUS_06560 7723 4655 gene locus_tag LOCUS_06570 7723 4655 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104207.1 protein_id gnl|my_center|LOCUS_06570 8622 8347 gene locus_tag LOCUS_06580 8622 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10135 8702 gene locus_tag LOCUS_06590 gene gatB 10135 8702 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_06590 11602 10148 gene locus_tag LOCUS_06600 gene gatA 11602 10148 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_06600 11905 11618 gene locus_tag LOCUS_06610 gene gatC 11905 11618 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_06610 12637 12080 gene locus_tag LOCUS_06620 12637 12080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 protein_id gnl|my_center|LOCUS_06620 12987 12912 gene locus_tag LOCUS_t00060 12987 12912 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13081 13006 gene locus_tag LOCUS_t00070 13081 13006 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14311 13256 gene locus_tag LOCUS_06630 14311 13256 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_06630 14447 14878 gene locus_tag LOCUS_06640 14447 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 16976 15441 gene locus_tag LOCUS_06650 gene nhaB 16976 15441 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_06650 17217 18884 gene locus_tag LOCUS_06660 gene fimL 17217 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_06660 18892 19413 gene locus_tag LOCUS_06670 18892 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 19733 21562 gene locus_tag LOCUS_06680 gene thiC 19733 21562 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_06680 21571 22668 gene locus_tag LOCUS_06690 21571 22668 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_06690 22661 22876 gene locus_tag LOCUS_06700 22661 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 22882 23670 gene locus_tag LOCUS_06710 gene thiG 22882 23670 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GC6 protein_id gnl|my_center|LOCUS_06710 23697 25118 gene locus_tag LOCUS_06720 gene thiDE 23697 25118 CDS product thiamine-phosphate pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957510.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence020 3571 227 gene locus_tag LOCUS_06730 3571 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5029 3938 gene locus_tag LOCUS_06740 gene purK 5029 3938 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U22 protein_id gnl|my_center|LOCUS_06740 5546 5034 gene locus_tag LOCUS_06750 gene purE 5546 5034 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72157 protein_id gnl|my_center|LOCUS_06750 5847 5605 gene locus_tag LOCUS_06760 5847 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_06760 7784 6216 gene locus_tag LOCUS_06770 7784 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8322 7798 gene locus_tag LOCUS_06780 8322 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8617 11223 gene locus_tag LOCUS_06790 8617 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 12398 11577 gene locus_tag LOCUS_06800 12398 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13103 12411 gene locus_tag LOCUS_06810 13103 12411 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_06810 13729 13217 gene locus_tag LOCUS_06820 gene folA 13729 13217 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_06820 13783 14337 gene locus_tag LOCUS_06830 13783 14337 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_06830 14337 15710 gene locus_tag LOCUS_06840 14337 15710 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_06840 15707 16300 gene locus_tag LOCUS_06850 15707 16300 CDS product D-ribitol-5-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A947 protein_id gnl|my_center|LOCUS_06850 16592 17860 gene locus_tag LOCUS_06860 gene rho 16592 17860 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_06860 18108 18644 gene locus_tag LOCUS_06870 18108 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 19218 18817 gene locus_tag LOCUS_06880 19218 18817 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 protein_id gnl|my_center|LOCUS_06880 19501 19310 gene locus_tag LOCUS_06890 19501 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 20143 22605 gene locus_tag LOCUS_06900 20143 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 22737 23363 gene locus_tag LOCUS_06910 22737 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 24029 24307 gene locus_tag LOCUS_06920 24029 24307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence021 390 1580 gene locus_tag LOCUS_06930 390 1580 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_06930 1586 1981 gene locus_tag LOCUS_06940 1586 1981 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406280.1 protein_id gnl|my_center|LOCUS_06940 2194 4275 gene locus_tag LOCUS_06950 2194 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 6131 4605 gene locus_tag LOCUS_06960 6131 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7044 6547 gene locus_tag LOCUS_06970 7044 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7439 7044 gene locus_tag LOCUS_06980 7439 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7636 7442 gene locus_tag LOCUS_06990 7636 7442 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_06990 7964 7626 gene locus_tag LOCUS_07000 7964 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9349 7976 gene locus_tag LOCUS_07010 gene cysS 9349 7976 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_07010 10246 9389 gene locus_tag LOCUS_07020 gene queD 10246 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_07020 10477 14475 gene locus_tag LOCUS_07030 10477 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 16575 14638 gene locus_tag LOCUS_07040 gene topB 16575 14638 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43704 protein_id gnl|my_center|LOCUS_07040 16863 17174 gene locus_tag LOCUS_07050 16863 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17559 17876 gene locus_tag LOCUS_07060 17559 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 18443 18841 gene locus_tag LOCUS_07070 18443 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21906 19141 gene locus_tag LOCUS_07080 21906 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 22865 22263 gene locus_tag LOCUS_07090 22865 22263 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454194.1 protein_id gnl|my_center|LOCUS_07090 22984 23244 gene locus_tag LOCUS_07100 22984 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_07100 23593 24375 gene locus_tag LOCUS_07110 23593 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 25195 24749 gene locus_tag LOCUS_07120 25195 24749 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence022 956 1873 gene locus_tag LOCUS_07130 956 1873 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110224.1 protein_id gnl|my_center|LOCUS_07130 1861 2484 gene locus_tag LOCUS_07140 1861 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2529 2978 gene locus_tag LOCUS_07150 2529 2978 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_07150 3058 5097 gene locus_tag LOCUS_07160 3058 5097 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_07160 6120 5266 gene locus_tag LOCUS_07170 gene speE 6120 5266 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_07170 8289 6154 gene locus_tag LOCUS_07180 gene spoT 8289 6154 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_07180 8382 9335 gene locus_tag LOCUS_07190 gene scrK 8382 9335 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 protein_id gnl|my_center|LOCUS_07190 10236 9442 gene locus_tag LOCUS_07200 10236 9442 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_07200 10707 10237 gene locus_tag LOCUS_07210 10707 10237 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_07210 10958 10713 gene locus_tag LOCUS_07220 gene moaD 10958 10713 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIM8 protein_id gnl|my_center|LOCUS_07220 11520 10972 gene locus_tag LOCUS_07230 11520 10972 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_07230 12064 11507 gene locus_tag LOCUS_07240 12064 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 13064 12066 gene locus_tag LOCUS_07250 gene moaA 13064 12066 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY0 protein_id gnl|my_center|LOCUS_07250 13425 13790 gene locus_tag LOCUS_07260 gene ybaN 13425 13790 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHX5 protein_id gnl|my_center|LOCUS_07260 15043 13850 gene locus_tag LOCUS_07270 gene purT 15043 13850 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q53 protein_id gnl|my_center|LOCUS_07270 15566 15123 gene locus_tag LOCUS_07280 15566 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 15748 15590 gene locus_tag LOCUS_07290 15748 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 17086 15878 gene locus_tag LOCUS_07300 gene ydcR 17086 15878 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263670.1 protein_id gnl|my_center|LOCUS_07300 17220 18086 gene locus_tag LOCUS_07310 17220 18086 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_07310 18837 20375 gene locus_tag LOCUS_07320 18837 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 20368 21426 gene locus_tag LOCUS_07330 20368 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 21468 21815 gene locus_tag LOCUS_07340 21468 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 21994 22272 gene locus_tag LOCUS_07350 21994 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 22421 22966 gene locus_tag LOCUS_07360 22421 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 23590 22979 gene locus_tag LOCUS_07370 gene fklB 23590 22979 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_07370 23756 25162 gene locus_tag LOCUS_07380 23756 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence023 <1 2664 gene locus_tag LOCUS_07390 <1 2664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein 3220 3798 gene locus_tag LOCUS_07400 3220 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3910 7032 gene locus_tag LOCUS_07410 3910 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7505 10879 gene locus_tag LOCUS_07420 7505 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11200 12219 gene locus_tag LOCUS_07430 11200 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 12585 12280 gene locus_tag LOCUS_07440 12585 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12959 12582 gene locus_tag LOCUS_07450 12959 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14943 12988 gene locus_tag LOCUS_07460 gene acsA 14943 12988 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_07460 17307 14950 gene locus_tag LOCUS_07470 17307 14950 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_07470 17714 18196 gene locus_tag LOCUS_07480 17714 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 18612 19043 gene locus_tag LOCUS_07490 18612 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 19047 19514 gene locus_tag LOCUS_07500 19047 19514 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159173.1 protein_id gnl|my_center|LOCUS_07500 19969 19592 gene locus_tag LOCUS_07510 19969 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082872.1 protein_id gnl|my_center|LOCUS_07510 20545 20081 gene locus_tag LOCUS_07520 gene trmL 20545 20081 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74Y93 protein_id gnl|my_center|LOCUS_07520 20792 21667 gene locus_tag LOCUS_07530 20792 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 21664 22398 gene locus_tag LOCUS_07540 21664 22398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22391 23041 gene locus_tag LOCUS_07550 22391 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 23034 23528 gene locus_tag LOCUS_07560 23034 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 23521 25089 gene locus_tag LOCUS_07570 gene mshL 23521 25089 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence024 482 6 gene locus_tag LOCUS_07580 482 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1591 971 gene locus_tag LOCUS_07590 1591 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2012 2488 gene locus_tag LOCUS_07600 2012 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3417 2956 gene locus_tag LOCUS_07610 gene ribH 3417 2956 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 protein_id gnl|my_center|LOCUS_07610 4612 4043 gene locus_tag LOCUS_07620 4612 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5935 4622 gene locus_tag LOCUS_07630 5935 4622 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_07630 6105 6389 gene locus_tag LOCUS_07640 6105 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 9063 6445 gene locus_tag LOCUS_07650 gene ppc 9063 6445 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU8 protein_id gnl|my_center|LOCUS_07650 9304 10851 gene locus_tag LOCUS_07660 gene gshA 9304 10851 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_07660 11725 10976 gene locus_tag LOCUS_07670 11725 10976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_07670 14573 11727 gene locus_tag LOCUS_07680 14573 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 16828 14732 gene locus_tag LOCUS_07690 16828 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 18185 16830 gene locus_tag LOCUS_07700 18185 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 18504 19532 gene locus_tag LOCUS_07710 gene flgJ 18504 19532 CDS product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262371.1 protein_id gnl|my_center|LOCUS_07710 19532 22552 gene locus_tag LOCUS_07720 19532 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 22581 23834 gene locus_tag LOCUS_07730 gene flgL 22581 23834 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_07730 23954 24523 gene locus_tag LOCUS_07740 23954 24523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07740 >Feature sequence025 686 3685 gene locus_tag LOCUS_07750 686 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3959 5302 gene locus_tag LOCUS_07760 3959 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5518 6858 gene locus_tag LOCUS_07770 5518 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7112 7534 gene locus_tag LOCUS_07780 7112 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7626 8762 gene locus_tag LOCUS_07790 7626 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8826 9749 gene locus_tag LOCUS_07800 8826 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9804 10424 gene locus_tag LOCUS_07810 9804 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10655 11167 gene locus_tag LOCUS_07820 10655 11167 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_07820 13336 11273 gene locus_tag LOCUS_07830 13336 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 13896 13336 gene locus_tag LOCUS_07840 13896 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 14611 13907 gene locus_tag LOCUS_07850 14611 13907 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_07850 15682 14651 gene locus_tag LOCUS_07860 15682 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 17271 15916 gene locus_tag LOCUS_07870 17271 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 19987 17288 gene locus_tag LOCUS_07880 19987 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 20573 19992 gene locus_tag LOCUS_07890 20573 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 20803 21021 gene locus_tag LOCUS_07900 20803 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 21570 20962 gene locus_tag LOCUS_07910 21570 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 22181 22759 gene locus_tag LOCUS_07920 22181 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 23464 22988 gene locus_tag LOCUS_07930 23464 22988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 24059 23466 gene locus_tag LOCUS_07940 24059 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence026 989 576 gene locus_tag LOCUS_07950 989 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2433 1051 gene locus_tag LOCUS_07960 2433 1051 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 protein_id gnl|my_center|LOCUS_07960 3623 2433 gene locus_tag LOCUS_07970 3623 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4238 3645 gene locus_tag LOCUS_07980 4238 3645 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_07980 4815 4240 gene locus_tag LOCUS_07990 gene gmhA 4815 4240 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_07990 5246 4824 gene locus_tag LOCUS_08000 5246 4824 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 protein_id gnl|my_center|LOCUS_08000 7020 5230 gene locus_tag LOCUS_08010 7020 5230 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948679.1 protein_id gnl|my_center|LOCUS_08010 7157 8011 gene locus_tag LOCUS_08020 gene rsmI 7157 8011 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45298 protein_id gnl|my_center|LOCUS_08020 8052 8474 gene locus_tag LOCUS_08030 8052 8474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_08030 8483 9382 gene locus_tag LOCUS_08040 8483 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 10190 9369 gene locus_tag LOCUS_08050 10190 9369 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_08050 12455 10215 gene locus_tag LOCUS_08060 gene relA 12455 10215 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_08060 13926 12559 gene locus_tag LOCUS_08070 gene rlmD 13926 12559 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP5 protein_id gnl|my_center|LOCUS_08070 14819 13923 gene locus_tag LOCUS_08080 14819 13923 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUI4 protein_id gnl|my_center|LOCUS_08080 15248 15787 gene locus_tag LOCUS_08090 15248 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 15947 17491 gene locus_tag LOCUS_08100 15947 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 17506 18120 gene locus_tag LOCUS_08110 17506 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 18122 19501 gene locus_tag LOCUS_08120 18122 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 19503 20216 gene locus_tag LOCUS_08130 gene rstA 19503 20216 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_08130 20516 20235 gene locus_tag LOCUS_08140 20516 20235 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN4 protein_id gnl|my_center|LOCUS_08140 20980 20549 gene locus_tag LOCUS_08150 gene yfjG 20980 20549 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_08150 22611 21010 gene locus_tag LOCUS_08160 22611 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22656 23132 gene locus_tag LOCUS_08170 gene smpB 22656 23132 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFP4 protein_id gnl|my_center|LOCUS_08170 23591 23208 gene locus_tag LOCUS_08180 23591 23208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 <24700 23655 gene locus_tag LOCUS_08190 <24700 23655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4N1:flagellum-specific ATP synthase >Feature sequence027 294 1001 gene locus_tag LOCUS_08200 294 1001 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 protein_id gnl|my_center|LOCUS_08200 1001 1972 gene locus_tag LOCUS_08210 1001 1972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_08210 1969 3624 gene locus_tag LOCUS_08220 1969 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_08220 3624 4868 gene locus_tag LOCUS_08230 3624 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4865 5950 gene locus_tag LOCUS_08240 4865 5950 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010219554.1 protein_id gnl|my_center|LOCUS_08240 5950 7245 gene locus_tag LOCUS_08250 5950 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8644 7370 gene locus_tag LOCUS_08260 8644 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 11365 8657 gene locus_tag LOCUS_08270 11365 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11609 12622 gene locus_tag LOCUS_08280 11609 12622 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247176.1 protein_id gnl|my_center|LOCUS_08280 12750 14306 gene locus_tag LOCUS_08290 12750 14306 CDS product binding-protein-dependent transport system inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_08290 15068 14607 gene locus_tag LOCUS_08300 15068 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 15189 16196 gene locus_tag LOCUS_08310 gene trpS 15189 16196 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYQ9 protein_id gnl|my_center|LOCUS_08310 17980 16328 gene locus_tag LOCUS_08320 gene fadD-1 17980 16328 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104873.1 protein_id gnl|my_center|LOCUS_08320 20660 18081 gene locus_tag LOCUS_08330 20660 18081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 21498 20824 gene locus_tag LOCUS_08340 21498 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 21965 22294 gene locus_tag LOCUS_08350 21965 22294 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV60 protein_id gnl|my_center|LOCUS_08350 22359 23039 gene locus_tag LOCUS_08360 22359 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 <24586 23643 gene locus_tag LOCUS_08370 <24586 23643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706973.1:methyl-accepting chemotaxis protein >Feature sequence028 2456 3241 gene locus_tag LOCUS_08380 2456 3241 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_08380 3252 3878 gene locus_tag LOCUS_08390 3252 3878 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_08390 5584 4064 gene locus_tag LOCUS_08400 5584 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6984 5983 gene locus_tag LOCUS_08410 gene add 6984 5983 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_08410 9259 7292 gene locus_tag LOCUS_08420 9259 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10800 9565 gene locus_tag LOCUS_08430 10800 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 11207 10800 gene locus_tag LOCUS_08440 11207 10800 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_08440 12247 11582 gene locus_tag LOCUS_08450 12247 11582 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_08450 13185 12481 gene locus_tag LOCUS_08460 13185 12481 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_08460 14519 13797 gene locus_tag LOCUS_08470 14519 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15366 14788 gene locus_tag LOCUS_08480 15366 14788 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_08480 15857 15429 gene locus_tag LOCUS_08490 15857 15429 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_08490 16480 16007 gene locus_tag LOCUS_08500 16480 16007 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933501.1 protein_id gnl|my_center|LOCUS_08500 19359 16477 gene locus_tag LOCUS_08510 19359 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 19969 19352 gene locus_tag LOCUS_08520 19969 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 21206 20274 gene locus_tag LOCUS_08530 gene secF 21206 20274 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI2 protein_id gnl|my_center|LOCUS_08530 23075 21216 gene locus_tag LOCUS_08540 gene secD 23075 21216 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX41 protein_id gnl|my_center|LOCUS_08540 23551 23165 gene locus_tag LOCUS_08550 gene yajC 23551 23165 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_08550 <24198 23626 gene locus_tag LOCUS_08560 <24198 23626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNY4:queuine tRNA-ribosyltransferase >Feature sequence029 415 822 gene locus_tag LOCUS_08570 415 822 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W2 protein_id gnl|my_center|LOCUS_08570 1089 2063 gene locus_tag LOCUS_08580 1089 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407109.1 protein_id gnl|my_center|LOCUS_08580 2162 4330 gene locus_tag LOCUS_08590 2162 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4420 5073 gene locus_tag LOCUS_08600 gene adk 4420 5073 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_08600 5582 6523 gene locus_tag LOCUS_08610 5582 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6692 8464 gene locus_tag LOCUS_08620 gene aspS 6692 8464 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_08620 9603 8662 gene locus_tag LOCUS_08630 9603 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9732 10241 gene locus_tag LOCUS_08640 gene vdlD 9732 10241 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_08640 10771 10220 gene locus_tag LOCUS_08650 10771 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 10917 11138 gene locus_tag LOCUS_08660 10917 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11229 12683 gene locus_tag LOCUS_08670 11229 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12964 14211 gene locus_tag LOCUS_08680 12964 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 14552 15400 gene locus_tag LOCUS_08690 14552 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 16637 15573 gene locus_tag LOCUS_08700 16637 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 18570 16675 gene locus_tag LOCUS_08710 18570 16675 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 protein_id gnl|my_center|LOCUS_08710 18662 19753 gene locus_tag LOCUS_08720 18662 19753 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017167.1 protein_id gnl|my_center|LOCUS_08720 19746 20570 gene locus_tag LOCUS_08730 gene hmuT 19746 20570 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969934.1 protein_id gnl|my_center|LOCUS_08730 20572 21588 gene locus_tag LOCUS_08740 gene hmuU 20572 21588 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536368.1 protein_id gnl|my_center|LOCUS_08740 21634 22434 gene locus_tag LOCUS_08750 gene hmuV 21634 22434 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_08750 >Feature sequence030 61 933 gene locus_tag LOCUS_08760 61 933 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FH3 protein_id gnl|my_center|LOCUS_08760 1064 1360 gene locus_tag LOCUS_08770 1064 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1929 1612 gene locus_tag LOCUS_08780 1929 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2246 1956 gene locus_tag LOCUS_08790 2246 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2778 2960 gene locus_tag LOCUS_08800 2778 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3218 3502 gene locus_tag LOCUS_08810 3218 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3499 3909 gene locus_tag LOCUS_08820 3499 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5910 4120 gene locus_tag LOCUS_08830 5910 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 6842 6018 gene locus_tag LOCUS_08840 6842 6018 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 protein_id gnl|my_center|LOCUS_08840 7118 10048 gene locus_tag LOCUS_08850 gene preP2 7118 10048 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_08850 10175 10489 gene locus_tag LOCUS_08860 10175 10489 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q67 protein_id gnl|my_center|LOCUS_08860 10925 11146 gene locus_tag LOCUS_08870 10925 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881297.1 protein_id gnl|my_center|LOCUS_08870 11435 12124 gene locus_tag LOCUS_08880 11435 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_08880 12752 13771 gene locus_tag LOCUS_08890 gene pyrD 12752 13771 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_08890 15027 13822 gene locus_tag LOCUS_08900 gene yuxH 15027 13822 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_08900 15105 16031 gene locus_tag LOCUS_08910 15105 16031 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_08910 16138 16986 gene locus_tag LOCUS_08920 16138 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 17048 19273 gene locus_tag LOCUS_08930 gene rlmL 17048 19273 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_08930 19282 20166 gene locus_tag LOCUS_08940 gene nadK 19282 20166 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_08940 20364 21233 gene locus_tag LOCUS_08950 20364 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 21287 21523 gene locus_tag LOCUS_08960 21287 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_08960 21536 22390 gene locus_tag LOCUS_08970 21536 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368470.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence031 <1 2595 gene locus_tag LOCUS_08980 <1 2595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7J5:endoglucanase 3205 3828 gene locus_tag LOCUS_08990 gene msrA 3205 3828 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_08990 4315 5070 gene locus_tag LOCUS_09000 4315 5070 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 protein_id gnl|my_center|LOCUS_09000 5067 5387 gene locus_tag LOCUS_09010 5067 5387 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 protein_id gnl|my_center|LOCUS_09010 5953 6294 gene locus_tag LOCUS_09020 5953 6294 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_09020 6291 7238 gene locus_tag LOCUS_09030 6291 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 8308 7517 gene locus_tag LOCUS_09040 8308 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8723 8580 gene locus_tag LOCUS_09050 8723 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8800 11223 gene locus_tag LOCUS_09060 8800 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 11585 12178 gene locus_tag LOCUS_09070 11585 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 12178 12402 gene locus_tag LOCUS_09080 12178 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12622 13176 gene locus_tag LOCUS_09090 12622 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 13686 14663 gene locus_tag LOCUS_09100 gene yfbL 13686 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_09100 15371 14784 gene locus_tag LOCUS_09110 15371 14784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_09110 15505 16068 gene locus_tag LOCUS_09120 15505 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 16216 16935 gene locus_tag LOCUS_09130 16216 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_09130 18847 17435 gene locus_tag LOCUS_09140 18847 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 20634 19441 gene locus_tag LOCUS_09150 20634 19441 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261972.1 protein_id gnl|my_center|LOCUS_09150 20992 22110 gene locus_tag LOCUS_09160 20992 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 22293 23048 gene locus_tag LOCUS_09170 22293 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence032 2776 17 gene locus_tag LOCUS_09180 2776 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3061 2870 gene locus_tag LOCUS_09190 3061 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4135 3146 gene locus_tag LOCUS_09200 4135 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4506 5807 gene locus_tag LOCUS_09210 gene eno 4506 5807 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CD6 protein_id gnl|my_center|LOCUS_09210 6804 6010 gene locus_tag LOCUS_09220 6804 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7039 8199 gene locus_tag LOCUS_09230 7039 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8527 8739 gene locus_tag LOCUS_09240 8527 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8834 9445 gene locus_tag LOCUS_09250 8834 9445 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_09250 11390 9669 gene locus_tag LOCUS_09260 11390 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12099 11392 gene locus_tag LOCUS_09270 12099 11392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_09270 13744 12137 gene locus_tag LOCUS_09280 13744 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 14542 13868 gene locus_tag LOCUS_09290 gene queC 14542 13868 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_09290 15296 14532 gene locus_tag LOCUS_09300 15296 14532 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_09300 16043 15471 gene locus_tag LOCUS_09310 16043 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 17475 16174 gene locus_tag LOCUS_09320 gene tolB 17475 16174 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_09320 18380 17472 gene locus_tag LOCUS_09330 18380 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 18802 18380 gene locus_tag LOCUS_09340 gene tolR 18802 18380 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_09340 19479 18811 gene locus_tag LOCUS_09350 19479 18811 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_09350 19922 19515 gene locus_tag LOCUS_09360 19922 19515 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089947.1 protein_id gnl|my_center|LOCUS_09360 20086 19919 gene locus_tag LOCUS_09370 20086 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 21093 20083 gene locus_tag LOCUS_09380 gene ruvB 21093 20083 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_09380 21725 21117 gene locus_tag LOCUS_09390 gene ruvA 21725 21117 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL2 protein_id gnl|my_center|LOCUS_09390 22252 21722 gene locus_tag LOCUS_09400 gene ruvC 22252 21722 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR00 protein_id gnl|my_center|LOCUS_09400 >Feature sequence033 1148 144 gene locus_tag LOCUS_09410 1148 144 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475612.1 protein_id gnl|my_center|LOCUS_09410 1518 2855 gene locus_tag LOCUS_09420 1518 2855 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880613.1 protein_id gnl|my_center|LOCUS_09420 2852 3229 gene locus_tag LOCUS_09430 2852 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence034 352 666 gene locus_tag LOCUS_09440 352 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 690 1322 gene locus_tag LOCUS_09450 690 1322 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_09450 1440 1778 gene locus_tag LOCUS_09460 1440 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1814 2725 gene locus_tag LOCUS_09470 1814 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3651 2803 gene locus_tag LOCUS_09480 gene kdsA 3651 2803 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFK4 protein_id gnl|my_center|LOCUS_09480 3807 5828 gene locus_tag LOCUS_09490 gene dinG 3807 5828 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_09490 6522 6070 gene locus_tag LOCUS_09500 6522 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7040 6522 gene locus_tag LOCUS_09510 7040 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9590 7344 gene locus_tag LOCUS_09520 gene gidA 9590 7344 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_09520 9741 10403 gene locus_tag LOCUS_09530 9741 10403 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_09530 10415 10861 gene locus_tag LOCUS_09540 gene mgsA 10415 10861 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 protein_id gnl|my_center|LOCUS_09540 10892 11914 gene locus_tag LOCUS_09550 gene cobT 10892 11914 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_09550 11907 12440 gene locus_tag LOCUS_09560 gene gpmB 11907 12440 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_09560 12500 13084 gene locus_tag LOCUS_09570 12500 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 13892 13284 gene locus_tag LOCUS_09580 13892 13284 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 protein_id gnl|my_center|LOCUS_09580 14580 13987 gene locus_tag LOCUS_09590 gene azr 14580 13987 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 protein_id gnl|my_center|LOCUS_09590 14748 15362 gene locus_tag LOCUS_09600 gene azrR 14748 15362 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 protein_id gnl|my_center|LOCUS_09600 15965 15462 gene locus_tag LOCUS_09610 15965 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 16114 16233 gene locus_tag LOCUS_09620 16114 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 17269 16775 gene locus_tag LOCUS_09630 gene slyD 17269 16775 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 protein_id gnl|my_center|LOCUS_09630 17844 17365 gene locus_tag LOCUS_09640 gene greB 17844 17365 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883T5 protein_id gnl|my_center|LOCUS_09640 18730 17918 gene locus_tag LOCUS_09650 gene rsmJ 18730 17918 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG6 protein_id gnl|my_center|LOCUS_09650 18860 18681 gene locus_tag LOCUS_09660 18860 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19978 19139 gene locus_tag LOCUS_09670 gene uppP 19978 19139 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_09670 20696 20004 gene locus_tag LOCUS_09680 gene tsaB 20696 20004 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD1 protein_id gnl|my_center|LOCUS_09680 21308 20970 gene locus_tag LOCUS_09690 gene glnK 21308 20970 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_09690 <22238 21531 gene locus_tag LOCUS_09700 <22238 21531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262597.1:ammonium transporter >Feature sequence035 1042 758 gene locus_tag LOCUS_09710 1042 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09710 1708 1076 gene locus_tag LOCUS_09720 gene trpF 1708 1076 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW1 protein_id gnl|my_center|LOCUS_09720 2354 2109 gene locus_tag LOCUS_09730 2354 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 protein_id gnl|my_center|LOCUS_09730 2649 3437 gene locus_tag LOCUS_09740 gene ygdL 2649 3437 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 protein_id gnl|my_center|LOCUS_09740 4612 3770 gene locus_tag LOCUS_09750 gene apaH 4612 3770 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_09750 5024 4656 gene locus_tag LOCUS_09760 gene apaG 5024 4656 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_09760 5835 5014 gene locus_tag LOCUS_09770 gene rsmA 5835 5014 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_09770 6748 5828 gene locus_tag LOCUS_09780 6748 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7752 6760 gene locus_tag LOCUS_09790 gene pdxA 7752 6760 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EEW2 protein_id gnl|my_center|LOCUS_09790 9040 7742 gene locus_tag LOCUS_09800 gene surA 9040 7742 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_09800 11570 9042 gene locus_tag LOCUS_09810 11570 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11666 12505 gene locus_tag LOCUS_09820 gene djlA 11666 12505 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_09820 12612 13292 gene locus_tag LOCUS_09830 12612 13292 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_09830 13285 13686 gene locus_tag LOCUS_09840 13285 13686 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TD9 protein_id gnl|my_center|LOCUS_09840 13877 14734 gene locus_tag LOCUS_09850 gene hslO 13877 14734 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_09850 15142 17229 gene locus_tag LOCUS_09860 15142 17229 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 protein_id gnl|my_center|LOCUS_09860 17316 17630 gene locus_tag LOCUS_09870 17316 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 17897 18538 gene locus_tag LOCUS_09880 17897 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456632.1 protein_id gnl|my_center|LOCUS_09880 20136 18673 gene locus_tag LOCUS_09890 gene cpsB 20136 18673 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_09890 20415 20786 gene locus_tag LOCUS_09900 20415 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 21005 21283 gene locus_tag LOCUS_09910 21005 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence036 1531 941 gene locus_tag LOCUS_09920 gene recR 1531 941 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MQ4 protein_id gnl|my_center|LOCUS_09920 1918 1592 gene locus_tag LOCUS_09930 1918 1592 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_09930 4070 1932 gene locus_tag LOCUS_09940 gene dnaX 4070 1932 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_09940 5074 4223 gene locus_tag LOCUS_09950 5074 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09950 5320 5081 gene locus_tag LOCUS_09960 5320 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6039 5248 gene locus_tag LOCUS_09970 gene pabC 6039 5248 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262287.1 protein_id gnl|my_center|LOCUS_09970 7376 6132 gene locus_tag LOCUS_09980 gene fabF1 7376 6132 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_09980 7790 7557 gene locus_tag LOCUS_09990 gene acpP 7790 7557 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80923 protein_id gnl|my_center|LOCUS_09990 8862 8128 gene locus_tag LOCUS_10000 gene fabG 8862 8128 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH7 protein_id gnl|my_center|LOCUS_10000 9868 9002 gene locus_tag LOCUS_10010 9868 9002 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_10010 10692 10198 gene locus_tag LOCUS_10020 10692 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11108 10764 gene locus_tag LOCUS_10030 11108 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12210 11815 gene locus_tag LOCUS_10040 12210 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_10040 13218 12484 gene locus_tag LOCUS_10050 13218 12484 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_10050 14853 13405 gene locus_tag LOCUS_10060 14853 13405 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_10060 15924 15628 gene locus_tag LOCUS_10070 15924 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 17037 16063 gene locus_tag LOCUS_10080 17037 16063 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_10080 17818 17153 gene locus_tag LOCUS_10090 17818 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_10090 18311 18108 gene locus_tag LOCUS_10100 18311 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 18853 19377 gene locus_tag LOCUS_10110 18853 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 20071 19406 gene locus_tag LOCUS_10120 20071 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 21236 20241 gene locus_tag LOCUS_10130 21236 20241 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence037 1344 748 gene locus_tag LOCUS_10140 1344 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1454 2689 gene locus_tag LOCUS_10150 gene dinF 1454 2689 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_10150 5902 2819 gene locus_tag LOCUS_10160 gene sbcC 5902 2819 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 protein_id gnl|my_center|LOCUS_10160 7044 5899 gene locus_tag LOCUS_10170 gene sbcD 7044 5899 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HE2 protein_id gnl|my_center|LOCUS_10170 7368 8396 gene locus_tag LOCUS_10180 7368 8396 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_10180 8819 8478 gene locus_tag LOCUS_10190 8819 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9423 8941 gene locus_tag LOCUS_10200 9423 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9945 9523 gene locus_tag LOCUS_10210 9945 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10403 10053 gene locus_tag LOCUS_10220 10403 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 10906 10514 gene locus_tag LOCUS_10230 10906 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 11495 11025 gene locus_tag LOCUS_10240 11495 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 11967 11653 gene locus_tag LOCUS_10250 11967 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 12747 12289 gene locus_tag LOCUS_10260 12747 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 13392 12883 gene locus_tag LOCUS_10270 13392 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 14348 13494 gene locus_tag LOCUS_10280 14348 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14573 14352 gene locus_tag LOCUS_10290 14573 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 <21544 14794 gene locus_tag LOCUS_10300 <21544 14794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635825.2:nuclease >Feature sequence038 2097 1087 gene locus_tag LOCUS_10310 gene pspF 2097 1087 CDS product psp operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_707212.3 protein_id gnl|my_center|LOCUS_10310 2297 2467 gene locus_tag LOCUS_10320 2297 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2480 3148 gene locus_tag LOCUS_10330 gene pspA 2480 3148 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_10330 3179 3442 gene locus_tag LOCUS_10340 3179 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3432 3941 gene locus_tag LOCUS_10350 3432 3941 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881462.1 protein_id gnl|my_center|LOCUS_10350 4044 4937 gene locus_tag LOCUS_10360 4044 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5094 5438 gene locus_tag LOCUS_10370 5094 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5598 5747 gene locus_tag LOCUS_10380 5598 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5768 6064 gene locus_tag LOCUS_10390 5768 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 6160 6408 gene locus_tag LOCUS_10400 6160 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6420 7382 gene locus_tag LOCUS_10410 6420 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9190 7685 gene locus_tag LOCUS_10420 9190 7685 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_10420 10257 9520 gene locus_tag LOCUS_10430 gene fliC 10257 9520 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA6 protein_id gnl|my_center|LOCUS_10430 10992 10558 gene locus_tag LOCUS_10440 10992 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 12309 11233 gene locus_tag LOCUS_10450 gene recA 12309 11233 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_10450 12871 12386 gene locus_tag LOCUS_10460 12871 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870383.1 protein_id gnl|my_center|LOCUS_10460 13001 13324 gene locus_tag LOCUS_10470 gene fdxA 13001 13324 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_10470 14547 13579 gene locus_tag LOCUS_10480 14547 13579 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_10480 17859 14908 gene locus_tag LOCUS_10490 17859 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18928 17843 gene locus_tag LOCUS_10500 18928 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 20796 18928 gene locus_tag LOCUS_10510 20796 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 20942 20793 gene locus_tag LOCUS_10520 20942 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence039 331 1287 gene locus_tag LOCUS_10530 331 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2806 1910 gene locus_tag LOCUS_10540 2806 1910 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_10540 2949 3308 gene locus_tag LOCUS_10550 2949 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3305 4111 gene locus_tag LOCUS_10560 3305 4111 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_10560 4791 4141 gene locus_tag LOCUS_10570 4791 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5330 4818 gene locus_tag LOCUS_10580 5330 4818 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI5 protein_id gnl|my_center|LOCUS_10580 5884 5498 gene locus_tag LOCUS_10590 5884 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 9074 6096 gene locus_tag LOCUS_10600 9074 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 12281 9285 gene locus_tag LOCUS_10610 12281 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 15443 12459 gene locus_tag LOCUS_10620 15443 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 15653 16741 gene locus_tag LOCUS_10630 gene dinB 15653 16741 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_10630 17392 16778 gene locus_tag LOCUS_10640 17392 16778 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882612.1 protein_id gnl|my_center|LOCUS_10640 17391 18089 gene locus_tag LOCUS_10650 17391 18089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_10650 18086 20590 gene locus_tag LOCUS_10660 18086 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence040 <1 1581 gene locus_tag LOCUS_10670 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266704.1:methyl-accepting chemotaxis protein 1889 1614 gene locus_tag LOCUS_10680 1889 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2323 2676 gene locus_tag LOCUS_10690 2323 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2745 3284 gene locus_tag LOCUS_10700 gene folE2 2745 3284 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_10700 3281 4036 gene locus_tag LOCUS_10710 3281 4036 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974981.1 protein_id gnl|my_center|LOCUS_10710 4009 4359 gene locus_tag LOCUS_10720 gene folB 4009 4359 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XXJ9 protein_id gnl|my_center|LOCUS_10720 4359 5069 gene locus_tag LOCUS_10730 4359 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5069 5326 gene locus_tag LOCUS_10740 5069 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6765 5881 gene locus_tag LOCUS_10750 6765 5881 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_10750 6941 7264 gene locus_tag LOCUS_10760 gene trxA 6941 7264 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_10760 8778 7402 gene locus_tag LOCUS_10770 8778 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9011 9607 gene locus_tag LOCUS_10780 9011 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9635 12421 gene locus_tag LOCUS_10790 gene cyaA 9635 12421 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_10790 13016 12486 gene locus_tag LOCUS_10800 13016 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 14435 13020 gene locus_tag LOCUS_10810 14435 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 14688 15422 gene locus_tag LOCUS_10820 gene modA 14688 15422 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_10820 15415 16101 gene locus_tag LOCUS_10830 gene modC 15415 16101 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_10830 16098 17135 gene locus_tag LOCUS_10840 gene modC 16098 17135 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAN3 protein_id gnl|my_center|LOCUS_10840 18040 17132 gene locus_tag LOCUS_10850 18040 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 18533 19336 gene locus_tag LOCUS_10860 gene cbpA 18533 19336 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_10860 <20779 19837 gene locus_tag LOCUS_10870 <20779 19837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNG7:DNA repair protein RadA >Feature sequence041 2040 271 gene locus_tag LOCUS_10880 2040 271 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_10880 3305 2037 gene locus_tag LOCUS_10890 3305 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3823 3434 gene locus_tag LOCUS_10900 3823 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4570 5376 gene locus_tag LOCUS_10910 4570 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5556 6083 gene locus_tag LOCUS_10920 5556 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6213 6581 gene locus_tag LOCUS_10930 6213 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10930 6591 7202 gene locus_tag LOCUS_10940 6591 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10940 7206 8177 gene locus_tag LOCUS_10950 7206 8177 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_10950 8440 8874 gene locus_tag LOCUS_10960 8440 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8937 9935 gene locus_tag LOCUS_10970 gene hemB 8937 9935 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_10970 10744 10136 gene locus_tag LOCUS_10980 10744 10136 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619239.1 protein_id gnl|my_center|LOCUS_10980 11901 10741 gene locus_tag LOCUS_10990 11901 10741 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919033.1 protein_id gnl|my_center|LOCUS_10990 12684 11932 gene locus_tag LOCUS_11000 12684 11932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646283.1 protein_id gnl|my_center|LOCUS_11000 13762 12698 gene locus_tag LOCUS_11010 13762 12698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 protein_id gnl|my_center|LOCUS_11010 13897 14118 gene locus_tag LOCUS_11020 13897 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 14548 16086 gene locus_tag LOCUS_11030 14548 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 16295 18010 gene locus_tag LOCUS_11040 16295 18010 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_11040 18332 18562 gene locus_tag LOCUS_11050 18332 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 18659 19297 gene locus_tag LOCUS_11060 18659 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 19725 19591 gene locus_tag LOCUS_11070 19725 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 20603 19728 gene locus_tag LOCUS_11080 20603 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 20769 20614 gene locus_tag LOCUS_11090 20769 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence042 787 32 gene locus_tag LOCUS_11100 787 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4887 970 gene locus_tag LOCUS_11110 gene purL 4887 970 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_11110 5088 5306 gene locus_tag LOCUS_11120 5088 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5510 6478 gene locus_tag LOCUS_11130 5510 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8056 6602 gene locus_tag LOCUS_11140 8056 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8267 9130 gene locus_tag LOCUS_11150 8267 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 9317 9829 gene locus_tag LOCUS_11160 9317 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9976 11436 gene locus_tag LOCUS_11170 9976 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 12142 11519 gene locus_tag LOCUS_11180 12142 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12282 13661 gene locus_tag LOCUS_11190 12282 13661 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_11190 14036 14500 gene locus_tag LOCUS_11200 gene mraZ 14036 14500 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY1 protein_id gnl|my_center|LOCUS_11200 14497 15474 gene locus_tag LOCUS_11210 gene rsmH 14497 15474 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_11210 15475 15753 gene locus_tag LOCUS_11220 15475 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 15750 17393 gene locus_tag LOCUS_11230 gene ftsI 15750 17393 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_11230 17390 18877 gene locus_tag LOCUS_11240 gene murE 17390 18877 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 protein_id gnl|my_center|LOCUS_11240 18864 20261 gene locus_tag LOCUS_11250 gene murF 18864 20261 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_11250 >Feature sequence043 264 1085 gene locus_tag LOCUS_11260 264 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1089 1796 gene locus_tag LOCUS_11270 1089 1796 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457782.1 protein_id gnl|my_center|LOCUS_11270 1797 2204 gene locus_tag LOCUS_11280 1797 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2784 2227 gene locus_tag LOCUS_11290 2784 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_11290 3111 2836 gene locus_tag LOCUS_11300 gene hupA 3111 2836 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_11300 3441 4847 gene locus_tag LOCUS_11310 3441 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4861 5625 gene locus_tag LOCUS_11320 4861 5625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896767.1 protein_id gnl|my_center|LOCUS_11320 5647 6804 gene locus_tag LOCUS_11330 5647 6804 CDS product sodium ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_11330 6801 8264 gene locus_tag LOCUS_11340 6801 8264 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_11340 8334 8897 gene locus_tag LOCUS_11350 8334 8897 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882398.1 protein_id gnl|my_center|LOCUS_11350 9009 9287 gene locus_tag LOCUS_11360 9009 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10278 9664 gene locus_tag LOCUS_11370 10278 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11175 12308 gene locus_tag LOCUS_11380 11175 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12295 12513 gene locus_tag LOCUS_11390 12295 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13152 12598 gene locus_tag LOCUS_11400 gene pgsA 13152 12598 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104334.1 protein_id gnl|my_center|LOCUS_11400 14293 13235 gene locus_tag LOCUS_11410 14293 13235 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_11410 15396 14290 gene locus_tag LOCUS_11420 15396 14290 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 protein_id gnl|my_center|LOCUS_11420 15654 17099 gene locus_tag LOCUS_11430 gene pepA 15654 17099 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E1 protein_id gnl|my_center|LOCUS_11430 18134 17160 gene locus_tag LOCUS_11440 gene cysB 18134 17160 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_11440 18471 18247 gene locus_tag LOCUS_11450 18471 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 18377 19117 gene locus_tag LOCUS_11460 18377 19117 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_11460 >Feature sequence044 3212 2679 gene locus_tag LOCUS_11470 3212 2679 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_11470 5303 3240 gene locus_tag LOCUS_11480 5303 3240 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_11480 5693 5331 gene locus_tag LOCUS_11490 gene cheY 5693 5331 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_11490 5994 5707 gene locus_tag LOCUS_11500 5994 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7158 6217 gene locus_tag LOCUS_11510 gene dusC 7158 6217 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG7 protein_id gnl|my_center|LOCUS_11510 8202 7246 gene locus_tag LOCUS_11520 8202 7246 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_11520 8391 8726 gene locus_tag LOCUS_11530 8391 8726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 protein_id gnl|my_center|LOCUS_11530 8811 9287 gene locus_tag LOCUS_11540 gene arsC2 8811 9287 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_11540 9288 10292 gene locus_tag LOCUS_11550 9288 10292 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_11550 12794 10440 gene locus_tag LOCUS_11560 12794 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 14060 16840 gene locus_tag LOCUS_11570 14060 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 16842 17993 gene locus_tag LOCUS_11580 16842 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 20138 18582 gene locus_tag LOCUS_11590 20138 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence045 377 1306 gene locus_tag LOCUS_11600 gene mhpF 377 1306 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JB0 protein_id gnl|my_center|LOCUS_11600 2684 1434 gene locus_tag LOCUS_11610 gene moeA 2684 1434 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_11610 3149 3015 gene locus_tag LOCUS_11620 3149 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3591 3310 gene locus_tag LOCUS_11630 gene ppiC1 3591 3310 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2B3 protein_id gnl|my_center|LOCUS_11630 4967 3591 gene locus_tag LOCUS_11640 gene dbpA 4967 3591 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_11640 5567 5088 gene locus_tag LOCUS_11650 5567 5088 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_11650 6094 5690 gene locus_tag LOCUS_11660 gene fur 6094 5690 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_11660 6211 6534 gene locus_tag LOCUS_11670 6211 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7992 6595 gene locus_tag LOCUS_11680 gene sthA 7992 6595 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_11680 8306 8055 gene locus_tag LOCUS_11690 8306 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 9356 8325 gene locus_tag LOCUS_11700 9356 8325 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_11700 10668 9442 gene locus_tag LOCUS_11710 gene nqrF 10668 9442 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_11710 11293 10679 gene locus_tag LOCUS_11720 gene nqrE 11293 10679 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_11720 11934 11293 gene locus_tag LOCUS_11730 gene nqrD 11934 11293 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_11730 12731 11937 gene locus_tag LOCUS_11740 gene nqrC 12731 11937 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_11740 13956 12724 gene locus_tag LOCUS_11750 gene nqrB 13956 12724 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_11750 15296 13959 gene locus_tag LOCUS_11760 gene nqrA 15296 13959 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_11760 15882 17381 gene locus_tag LOCUS_11770 gene xcpR 15882 17381 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_11770 17381 18601 gene locus_tag LOCUS_11780 gene xcpS 17381 18601 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_11780 18598 18990 gene locus_tag LOCUS_11790 gene gspG 18598 18990 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097349.1 protein_id gnl|my_center|LOCUS_11790 18995 19645 gene locus_tag LOCUS_11800 18995 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 19645 19998 gene locus_tag LOCUS_11810 19645 19998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence046 1469 429 gene locus_tag LOCUS_11820 1469 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3450 1663 gene locus_tag LOCUS_11830 3450 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3698 6007 gene locus_tag LOCUS_11840 3698 6007 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881592.1 protein_id gnl|my_center|LOCUS_11840 7998 6496 gene locus_tag LOCUS_11850 gene fadD 7998 6496 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 protein_id gnl|my_center|LOCUS_11850 8362 9834 gene locus_tag LOCUS_11860 8362 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 9852 11063 gene locus_tag LOCUS_11870 9852 11063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531965.1 protein_id gnl|my_center|LOCUS_11870 11098 12741 gene locus_tag LOCUS_11880 11098 12741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 protein_id gnl|my_center|LOCUS_11880 12734 13372 gene locus_tag LOCUS_11890 12734 13372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577794.1 protein_id gnl|my_center|LOCUS_11890 13362 13976 gene locus_tag LOCUS_11900 13362 13976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887115.1 protein_id gnl|my_center|LOCUS_11900 15811 14066 gene locus_tag LOCUS_11910 gene argS 15811 14066 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5V7 protein_id gnl|my_center|LOCUS_11910 16224 15895 gene locus_tag LOCUS_11920 16224 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 16526 16332 gene locus_tag LOCUS_11930 16526 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 <19926 16797 gene locus_tag LOCUS_11940 <19926 16797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein >Feature sequence047 1168 599 gene locus_tag LOCUS_11950 1168 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3050 1374 gene locus_tag LOCUS_11960 3050 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3138 3896 gene locus_tag LOCUS_11970 3138 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3937 4905 gene locus_tag LOCUS_11980 3937 4905 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_11980 4955 6046 gene locus_tag LOCUS_11990 4955 6046 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_11990 6889 6086 gene locus_tag LOCUS_12000 6889 6086 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_12000 10824 6886 gene locus_tag LOCUS_12010 10824 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 12331 10871 gene locus_tag LOCUS_12020 gene cafA 12331 10871 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_12020 12922 12350 gene locus_tag LOCUS_12030 12922 12350 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7X6 protein_id gnl|my_center|LOCUS_12030 13411 12923 gene locus_tag LOCUS_12040 gene mreD 13411 12923 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83Q00 protein_id gnl|my_center|LOCUS_12040 14162 13401 gene locus_tag LOCUS_12050 14162 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 15302 14265 gene locus_tag LOCUS_12060 15302 14265 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_12060 15512 16033 gene locus_tag LOCUS_12070 15512 16033 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_12070 16287 16069 gene locus_tag LOCUS_12080 16287 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16461 17204 gene locus_tag LOCUS_12090 gene yccA 16461 17204 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 protein_id gnl|my_center|LOCUS_12090 17441 17920 gene locus_tag LOCUS_12100 17441 17920 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_12100 18627 18160 gene locus_tag LOCUS_12110 gene secB 18627 18160 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU56 protein_id gnl|my_center|LOCUS_12110 18905 18657 gene locus_tag LOCUS_12120 18905 18657 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_12120 19258 18905 gene locus_tag LOCUS_12130 19258 18905 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence048 858 25 gene locus_tag LOCUS_12140 858 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_12140 997 1686 gene locus_tag LOCUS_12150 997 1686 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_12150 2084 1764 gene locus_tag LOCUS_12160 2084 1764 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420444.1 protein_id gnl|my_center|LOCUS_12160 2285 2470 gene locus_tag LOCUS_12170 2285 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2657 3019 gene locus_tag LOCUS_12180 2657 3019 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_12180 3127 5811 gene locus_tag LOCUS_12190 3127 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6739 5771 gene locus_tag LOCUS_12200 6739 5771 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_12200 6895 6810 gene locus_tag LOCUS_t00080 6895 6810 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7238 6903 gene locus_tag LOCUS_12210 gene secG 7238 6903 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_12210 8001 7252 gene locus_tag LOCUS_12220 gene tpiA 8001 7252 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 protein_id gnl|my_center|LOCUS_12220 9478 8123 gene locus_tag LOCUS_12230 gene glmM 9478 8123 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_12230 10310 9468 gene locus_tag LOCUS_12240 gene folP 10310 9468 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_12240 12254 10416 gene locus_tag LOCUS_12250 gene ftsH 12254 10416 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP8 protein_id gnl|my_center|LOCUS_12250 12991 12371 gene locus_tag LOCUS_12260 gene rlmE 12991 12371 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ4 protein_id gnl|my_center|LOCUS_12260 13075 13383 gene locus_tag LOCUS_12270 13075 13383 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_12270 14666 13416 gene locus_tag LOCUS_12280 14666 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 14878 15246 gene locus_tag LOCUS_12290 14878 15246 CDS product UPF0382 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ5 protein_id gnl|my_center|LOCUS_12290 15248 15967 gene locus_tag LOCUS_12300 gene trmB 15248 15967 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV4 protein_id gnl|my_center|LOCUS_12300 16025 16312 gene locus_tag LOCUS_12310 16025 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 16314 17210 gene locus_tag LOCUS_12320 16314 17210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_12320 17227 17934 gene locus_tag LOCUS_12330 17227 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 18022 18291 gene locus_tag LOCUS_12340 18022 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18842 19138 gene locus_tag LOCUS_12350 18842 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 19237 19572 gene locus_tag LOCUS_12360 19237 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence049 398 1123 gene locus_tag LOCUS_12370 398 1123 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_12370 1123 2952 gene locus_tag LOCUS_12380 1123 2952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 protein_id gnl|my_center|LOCUS_12380 4013 3027 gene locus_tag LOCUS_12390 4013 3027 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_12390 4374 5885 gene locus_tag LOCUS_12400 4374 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5887 12846 gene locus_tag LOCUS_12410 5887 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 13001 13489 gene locus_tag LOCUS_12420 13001 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 13666 14046 gene locus_tag LOCUS_12430 13666 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 14624 17629 gene locus_tag LOCUS_12440 14624 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481876.1 protein_id gnl|my_center|LOCUS_12440 17785 18342 gene locus_tag LOCUS_12450 17785 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 19495 18827 gene locus_tag LOCUS_12460 19495 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence050 <1 1099 gene locus_tag LOCUS_12470 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105280.1:sensor histidine kinase 1553 1164 gene locus_tag LOCUS_12480 1553 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2086 1574 gene locus_tag LOCUS_12490 2086 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3321 2464 gene locus_tag LOCUS_12500 3321 2464 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_12500 3474 3908 gene locus_tag LOCUS_12510 3474 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4262 4738 gene locus_tag LOCUS_12520 4262 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5117 5692 gene locus_tag LOCUS_12530 5117 5692 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_12530 5692 6348 gene locus_tag LOCUS_12540 5692 6348 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_12540 7818 6331 gene locus_tag LOCUS_12550 gene glpK1 7818 6331 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_12550 7922 9658 gene locus_tag LOCUS_12560 7922 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9722 10297 gene locus_tag LOCUS_12570 9722 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10294 10815 gene locus_tag LOCUS_12580 10294 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 12266 10863 gene locus_tag LOCUS_12590 12266 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 13599 12277 gene locus_tag LOCUS_12600 13599 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 14754 13621 gene locus_tag LOCUS_12610 14754 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 15092 15616 gene locus_tag LOCUS_12620 15092 15616 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262849.1 protein_id gnl|my_center|LOCUS_12620 16654 15758 gene locus_tag LOCUS_12630 16654 15758 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_12630 17516 16800 gene locus_tag LOCUS_12640 17516 16800 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947243.1 protein_id gnl|my_center|LOCUS_12640 19092 17620 gene locus_tag LOCUS_12650 19092 17620 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence051 123 1307 gene locus_tag LOCUS_12660 gene nhaA 123 1307 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD7 protein_id gnl|my_center|LOCUS_12660 1426 1501 gene locus_tag LOCUS_t00090 1426 1501 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2215 1667 gene locus_tag LOCUS_12670 2215 1667 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_12670 3025 2360 gene locus_tag LOCUS_12680 3025 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3794 3099 gene locus_tag LOCUS_12690 gene bioD 3794 3099 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CU9 protein_id gnl|my_center|LOCUS_12690 4584 3811 gene locus_tag LOCUS_12700 gene bioC 4584 3811 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A95 protein_id gnl|my_center|LOCUS_12700 5281 4577 gene locus_tag LOCUS_12710 5281 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 6462 5293 gene locus_tag LOCUS_12720 gene bioF 6462 5293 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_12720 7573 6455 gene locus_tag LOCUS_12730 gene bioB 7573 6455 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_12730 7608 8309 gene locus_tag LOCUS_12740 7608 8309 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948038.1 protein_id gnl|my_center|LOCUS_12740 8596 9072 gene locus_tag LOCUS_12750 8596 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10037 9699 gene locus_tag LOCUS_12760 10037 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 11278 10586 gene locus_tag LOCUS_12770 gene bioH 11278 10586 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_12770 11617 11363 gene locus_tag LOCUS_12780 11617 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 11523 11735 gene locus_tag LOCUS_12790 11523 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 11758 12618 gene locus_tag LOCUS_12800 gene yafC 11758 12618 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261379.1 protein_id gnl|my_center|LOCUS_12800 12995 13897 gene locus_tag LOCUS_12810 12995 13897 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 protein_id gnl|my_center|LOCUS_12810 13922 14071 gene locus_tag LOCUS_12820 13922 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 14354 14184 gene locus_tag LOCUS_12830 14354 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15515 14658 gene locus_tag LOCUS_12840 gene ubiA 15515 14658 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_12840 16063 15521 gene locus_tag LOCUS_12850 16063 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 16745 16047 gene locus_tag LOCUS_12860 16745 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 17481 16840 gene locus_tag LOCUS_12870 gene dsbA 17481 16840 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_12870 18210 17590 gene locus_tag LOCUS_12880 gene cc4 18210 17590 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_12880 >Feature sequence052 200 856 gene locus_tag LOCUS_12890 gene minD 200 856 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK56 protein_id gnl|my_center|LOCUS_12890 869 1117 gene locus_tag LOCUS_12900 gene minE 869 1117 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_12900 1506 2495 gene locus_tag LOCUS_12910 1506 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4903 2594 gene locus_tag LOCUS_12920 4903 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6182 5541 gene locus_tag LOCUS_12930 6182 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6375 6692 gene locus_tag LOCUS_12940 gene yciH 6375 6692 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602330.1 protein_id gnl|my_center|LOCUS_12940 6831 8201 gene locus_tag LOCUS_12950 6831 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9049 8402 gene locus_tag LOCUS_12960 gene pabA 9049 8402 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_12960 10437 9052 gene locus_tag LOCUS_12970 10437 9052 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_12970 10703 10440 gene locus_tag LOCUS_12980 10703 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 12933 11059 gene locus_tag LOCUS_12990 12933 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 14176 12944 gene locus_tag LOCUS_13000 14176 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14850 15152 gene locus_tag LOCUS_13010 14850 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 15279 15887 gene locus_tag LOCUS_13020 15279 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 16343 16825 gene locus_tag LOCUS_13030 16343 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121651.1 protein_id gnl|my_center|LOCUS_13030 17107 17553 gene locus_tag LOCUS_13040 17107 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 17736 17864 gene locus_tag LOCUS_13050 17736 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 18068 17856 gene locus_tag LOCUS_13060 18068 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 18397 18993 gene locus_tag LOCUS_13070 18397 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence053 1859 2515 gene locus_tag LOCUS_13080 1859 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3043 2690 gene locus_tag LOCUS_13090 3043 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4877 3591 gene locus_tag LOCUS_13100 4877 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6337 9420 gene locus_tag LOCUS_13110 6337 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 9807 9625 gene locus_tag LOCUS_13120 9807 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10186 10845 gene locus_tag LOCUS_13130 10186 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11169 11954 gene locus_tag LOCUS_13140 11169 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12694 12086 gene locus_tag LOCUS_13150 12694 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 14561 12858 gene locus_tag LOCUS_13160 14561 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14965 16812 gene locus_tag LOCUS_13170 gene fabY 14965 16812 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_13170 16878 18053 gene locus_tag LOCUS_13180 gene czcD.2 16878 18053 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_13180 18744 18043 gene locus_tag LOCUS_13190 18744 18043 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015900.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence054 14 122 gene locus_tag LOCUS_r00010 14 122 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 275 1522 gene locus_tag LOCUS_13200 275 1522 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884147.1 protein_id gnl|my_center|LOCUS_13200 2035 2940 gene locus_tag LOCUS_13210 2035 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2965 3498 gene locus_tag LOCUS_13220 gene yaiL 2965 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_13220 4773 3544 gene locus_tag LOCUS_13230 gene cca 4773 3544 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW05 protein_id gnl|my_center|LOCUS_13230 6691 4901 gene locus_tag LOCUS_13240 6691 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7189 7788 gene locus_tag LOCUS_13250 7189 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7831 9048 gene locus_tag LOCUS_13260 7831 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9319 11148 gene locus_tag LOCUS_13270 9319 11148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 protein_id gnl|my_center|LOCUS_13270 11176 12240 gene locus_tag LOCUS_13280 11176 12240 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 protein_id gnl|my_center|LOCUS_13280 12240 13268 gene locus_tag LOCUS_13290 12240 13268 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889066.1 protein_id gnl|my_center|LOCUS_13290 13265 14866 gene locus_tag LOCUS_13300 13265 14866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208828.1 protein_id gnl|my_center|LOCUS_13300 15105 15749 gene locus_tag LOCUS_13310 gene cysZ 15105 15749 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJN3 protein_id gnl|my_center|LOCUS_13310 15925 16464 gene locus_tag LOCUS_13320 15925 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 17226 17822 gene locus_tag LOCUS_13330 17226 17822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence055 424 1068 gene locus_tag LOCUS_13340 424 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1065 1640 gene locus_tag LOCUS_13350 1065 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2873 1743 gene locus_tag LOCUS_13360 2873 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3131 3742 gene locus_tag LOCUS_13370 3131 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_13370 4361 3885 gene locus_tag LOCUS_13380 4361 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4587 4841 gene locus_tag LOCUS_13390 4587 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6188 4914 gene locus_tag LOCUS_13400 6188 4914 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882864.1 protein_id gnl|my_center|LOCUS_13400 7821 6175 gene locus_tag LOCUS_13410 7821 6175 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022475.1 protein_id gnl|my_center|LOCUS_13410 9826 7835 gene locus_tag LOCUS_13420 9826 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 11552 9933 gene locus_tag LOCUS_13430 11552 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 12943 11549 gene locus_tag LOCUS_13440 12943 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 13209 14729 gene locus_tag LOCUS_13450 gene algI 13209 14729 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51392 protein_id gnl|my_center|LOCUS_13450 14738 15859 gene locus_tag LOCUS_13460 14738 15859 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266794.1 protein_id gnl|my_center|LOCUS_13460 15840 16496 gene locus_tag LOCUS_13470 15840 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 16628 17512 gene locus_tag LOCUS_13480 16628 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 17545 18672 gene locus_tag LOCUS_13490 17545 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence056 847 557 gene locus_tag LOCUS_13500 847 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1673 1407 gene locus_tag LOCUS_13510 gene acyP 1673 1407 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 protein_id gnl|my_center|LOCUS_13510 2433 3587 gene locus_tag LOCUS_13520 gene dacC 2433 3587 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_13520 3616 3906 gene locus_tag LOCUS_13530 3616 3906 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_13530 3908 4552 gene locus_tag LOCUS_13540 gene lipB 3908 4552 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_13540 4600 5658 gene locus_tag LOCUS_13550 gene lipA 4600 5658 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_13550 5892 6113 gene locus_tag LOCUS_13560 5892 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6113 6910 gene locus_tag LOCUS_13570 6113 6910 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 protein_id gnl|my_center|LOCUS_13570 7014 7664 gene locus_tag LOCUS_13580 gene pdxH 7014 7664 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FE9 protein_id gnl|my_center|LOCUS_13580 8167 7826 gene locus_tag LOCUS_13590 8167 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 8451 8218 gene locus_tag LOCUS_13600 8451 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 9095 8598 gene locus_tag LOCUS_13610 9095 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 10241 10420 gene locus_tag LOCUS_13620 10241 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11186 10386 gene locus_tag LOCUS_13630 11186 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 12165 11176 gene locus_tag LOCUS_13640 12165 11176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971588.1 protein_id gnl|my_center|LOCUS_13640 14614 12176 gene locus_tag LOCUS_13650 14614 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 15716 15087 gene locus_tag LOCUS_13660 gene yqaB 15716 15087 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273317.1 protein_id gnl|my_center|LOCUS_13660 16813 16040 gene locus_tag LOCUS_13670 16813 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 17643 16813 gene locus_tag LOCUS_13680 17643 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 <18794 17640 gene locus_tag LOCUS_13690 <18794 17640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQF7:segregation and condensation protein B >Feature sequence057 395 1105 gene locus_tag LOCUS_13700 395 1105 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_13700 2742 1168 gene locus_tag LOCUS_13710 2742 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3248 5656 gene locus_tag LOCUS_13720 3248 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5658 6140 gene locus_tag LOCUS_13730 5658 6140 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418723.1 protein_id gnl|my_center|LOCUS_13730 6197 7672 gene locus_tag LOCUS_13740 6197 7672 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104072.1 protein_id gnl|my_center|LOCUS_13740 7786 8295 gene locus_tag LOCUS_13750 7786 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423511.1 protein_id gnl|my_center|LOCUS_13750 8471 9037 gene locus_tag LOCUS_13760 gene tssJ 8471 9037 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941097.1 protein_id gnl|my_center|LOCUS_13760 9175 10560 gene locus_tag LOCUS_13770 gene tssK 9175 10560 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_13770 10563 11237 gene locus_tag LOCUS_13780 10563 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 11254 14796 gene locus_tag LOCUS_13790 gene tssM 11254 14796 CDS product type VI secretion system protein ImpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_13790 14869 16644 gene locus_tag LOCUS_13800 14869 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 16688 17173 gene locus_tag LOCUS_13810 gene tssD 16688 17173 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_13810 17215 17640 gene locus_tag LOCUS_13820 17215 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence058 2265 1291 gene locus_tag LOCUS_13830 2265 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2429 3913 gene locus_tag LOCUS_13840 2429 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3910 4599 gene locus_tag LOCUS_13850 3910 4599 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_13850 4780 5589 gene locus_tag LOCUS_13860 4780 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6695 5682 gene locus_tag LOCUS_13870 6695 5682 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T26 protein_id gnl|my_center|LOCUS_13870 7234 6863 gene locus_tag LOCUS_13880 7234 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7342 12447 gene locus_tag LOCUS_13890 7342 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12449 18241 gene locus_tag LOCUS_13900 12449 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016500.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence059 1949 495 gene locus_tag LOCUS_13910 1949 495 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751431.1 protein_id gnl|my_center|LOCUS_13910 8509 2741 gene locus_tag LOCUS_13920 8509 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9132 10157 gene locus_tag LOCUS_13930 gene tsaD 9132 10157 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRN6 protein_id gnl|my_center|LOCUS_13930 10160 10543 gene locus_tag LOCUS_13940 gene folB 10160 10543 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMT8 protein_id gnl|my_center|LOCUS_13940 10549 11040 gene locus_tag LOCUS_13950 10549 11040 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_13950 11296 12561 gene locus_tag LOCUS_13960 11296 12561 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_13960 13203 12745 gene locus_tag LOCUS_13970 13203 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 15727 13325 gene locus_tag LOCUS_13980 gene pheT 15727 13325 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_13980 16755 15739 gene locus_tag LOCUS_13990 gene pheS 16755 15739 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_13990 17143 18147 gene locus_tag LOCUS_14000 17143 18147 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775610.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence060 1114 1491 gene locus_tag LOCUS_14010 gene pilG 1114 1491 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_14010 1518 1886 gene locus_tag LOCUS_14020 gene pilH 1518 1886 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_14020 1893 2429 gene locus_tag LOCUS_14030 gene pilI 1893 2429 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_14030 2488 4557 gene locus_tag LOCUS_14040 gene pilJ 2488 4557 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_14040 4581 5468 gene locus_tag LOCUS_14050 gene pilK 4581 5468 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_14050 5468 12691 gene locus_tag LOCUS_14060 5468 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12704 13729 gene locus_tag LOCUS_14070 gene chpB 12704 13729 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_14070 13726 14208 gene locus_tag LOCUS_14080 13726 14208 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_14080 14268 14591 gene locus_tag LOCUS_14090 gene cyaY 14268 14591 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTS5 protein_id gnl|my_center|LOCUS_14090 14746 15525 gene locus_tag LOCUS_14100 14746 15525 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_14100 15576 16361 gene locus_tag LOCUS_14110 15576 16361 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_14110 16665 18089 gene locus_tag LOCUS_14120 16665 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence061 224 451 gene locus_tag LOCUS_14130 224 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 468 1340 gene locus_tag LOCUS_14140 468 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3413 2028 gene locus_tag LOCUS_14150 3413 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3632 4930 gene locus_tag LOCUS_14160 gene aroA 3632 4930 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z0 protein_id gnl|my_center|LOCUS_14160 5057 5584 gene locus_tag LOCUS_14170 gene ppa1 5057 5584 CDS product inorganic pyrophosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M7 protein_id gnl|my_center|LOCUS_14170 5687 6688 gene locus_tag LOCUS_14180 5687 6688 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_14180 6756 7115 gene locus_tag LOCUS_14190 6756 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7935 7120 gene locus_tag LOCUS_14200 gene mutM 7935 7120 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55044 protein_id gnl|my_center|LOCUS_14200 8200 8042 gene locus_tag LOCUS_14210 gene rpmG 8200 8042 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66239 protein_id gnl|my_center|LOCUS_14210 8447 8211 gene locus_tag LOCUS_14220 gene rpmB 8447 8211 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEM3 protein_id gnl|my_center|LOCUS_14220 9307 8633 gene locus_tag LOCUS_14230 9307 8633 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8M5 protein_id gnl|my_center|LOCUS_14230 9408 10607 gene locus_tag LOCUS_14240 gene dfp 9408 10607 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_14240 10621 13242 gene locus_tag LOCUS_14250 10621 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 13258 14160 gene locus_tag LOCUS_14260 gene argB 13258 14160 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_14260 14172 14765 gene locus_tag LOCUS_14270 gene slmA 14172 14765 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_14270 15216 15458 gene locus_tag LOCUS_14280 15216 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 16059 15841 gene locus_tag LOCUS_14290 gene infA 16059 15841 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65129 protein_id gnl|my_center|LOCUS_14290 16904 16185 gene locus_tag LOCUS_14300 gene aat 16904 16185 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL02 protein_id gnl|my_center|LOCUS_14300 >Feature sequence062 1552 386 gene locus_tag LOCUS_14310 1552 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 protein_id gnl|my_center|LOCUS_14310 2164 1553 gene locus_tag LOCUS_14320 2164 1553 CDS product UPF0441 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGH1 protein_id gnl|my_center|LOCUS_14320 2575 2174 gene locus_tag LOCUS_14330 2575 2174 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_14330 3257 2592 gene locus_tag LOCUS_14340 3257 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037961.1 protein_id gnl|my_center|LOCUS_14340 4297 3269 gene locus_tag LOCUS_14350 4297 3269 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_14350 4993 4301 gene locus_tag LOCUS_14360 4993 4301 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_14360 5394 4990 gene locus_tag LOCUS_14370 gene yjfI 5394 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 protein_id gnl|my_center|LOCUS_14370 5533 5808 gene locus_tag LOCUS_14380 5533 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7588 5882 gene locus_tag LOCUS_14390 gene speE 7588 5882 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX8 protein_id gnl|my_center|LOCUS_14390 8077 8343 gene locus_tag LOCUS_14400 8077 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9832 8780 gene locus_tag LOCUS_14410 9832 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 10045 9969 gene locus_tag LOCUS_t00100 10045 9969 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12121 10289 gene locus_tag LOCUS_14420 gene rpoD 12121 10289 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF1 protein_id gnl|my_center|LOCUS_14420 14275 12266 gene locus_tag LOCUS_14430 14275 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 14756 14307 gene locus_tag LOCUS_14440 14756 14307 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_14440 15047 14832 gene locus_tag LOCUS_14450 gene rpsU 15047 14832 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_14450 15867 15220 gene locus_tag LOCUS_14460 gene rsmD 15867 15220 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Z7 protein_id gnl|my_center|LOCUS_14460 16823 15864 gene locus_tag LOCUS_14470 16823 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 16895 18160 gene locus_tag LOCUS_14480 gene ftsY 16895 18160 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG3 protein_id gnl|my_center|LOCUS_14480 >Feature sequence063 1987 188 gene locus_tag LOCUS_14490 1987 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2133 2462 gene locus_tag LOCUS_14500 2133 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3427 2444 gene locus_tag LOCUS_14510 3427 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4220 3531 gene locus_tag LOCUS_14520 4220 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5331 4417 gene locus_tag LOCUS_14530 5331 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7324 5981 gene locus_tag LOCUS_14540 7324 5981 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266661.1 protein_id gnl|my_center|LOCUS_14540 9883 7331 gene locus_tag LOCUS_14550 gene cbrA 9883 7331 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_14550 9882 10076 gene locus_tag LOCUS_14560 9882 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 10365 11123 gene locus_tag LOCUS_14570 10365 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 11126 11416 gene locus_tag LOCUS_14580 gene yazA 11126 11416 CDS product UPF0213 protein YazA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31414 protein_id gnl|my_center|LOCUS_14580 11495 12562 gene locus_tag LOCUS_14590 gene lpsB 11495 12562 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384501.1 protein_id gnl|my_center|LOCUS_14590 12559 13362 gene locus_tag LOCUS_14600 12559 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 15419 13377 gene locus_tag LOCUS_14610 15419 13377 CDS product phosphoglycerol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 protein_id gnl|my_center|LOCUS_14610 16539 15421 gene locus_tag LOCUS_14620 gene queG 16539 15421 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI8 protein_id gnl|my_center|LOCUS_14620 16664 17134 gene locus_tag LOCUS_14630 16664 17134 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266493.1 protein_id gnl|my_center|LOCUS_14630 17300 17127 gene locus_tag LOCUS_14640 17300 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 17299 17823 gene locus_tag LOCUS_14650 17299 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14650 >Feature sequence064 686 18 gene locus_tag LOCUS_14660 686 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1588 683 gene locus_tag LOCUS_14670 1588 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2004 1756 gene locus_tag LOCUS_14680 gene tusA 2004 1756 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884S0 protein_id gnl|my_center|LOCUS_14680 2386 2006 gene locus_tag LOCUS_14690 2386 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2802 3203 gene locus_tag LOCUS_14700 2802 3203 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_14700 3200 5671 gene locus_tag LOCUS_14710 3200 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5818 6258 gene locus_tag LOCUS_14720 5818 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6816 6394 gene locus_tag LOCUS_14730 6816 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7807 6824 gene locus_tag LOCUS_14740 7807 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 8451 7849 gene locus_tag LOCUS_14750 8451 7849 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_14750 8621 9091 gene locus_tag LOCUS_14760 gene holC 8621 9091 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_14760 9097 9654 gene locus_tag LOCUS_14770 9097 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 9723 10865 gene locus_tag LOCUS_14780 gene trmA 9723 10865 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_14780 10865 11974 gene locus_tag LOCUS_14790 gene rlmG 10865 11974 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA4 protein_id gnl|my_center|LOCUS_14790 12909 12001 gene locus_tag LOCUS_14800 12909 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254677.1 protein_id gnl|my_center|LOCUS_14800 13071 14552 gene locus_tag LOCUS_14810 13071 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 15401 14466 gene locus_tag LOCUS_14820 15401 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15547 16356 gene locus_tag LOCUS_14830 15547 16356 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_14830 16353 17012 gene locus_tag LOCUS_14840 16353 17012 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946333.1 protein_id gnl|my_center|LOCUS_14840 <17777 17097 gene locus_tag LOCUS_14850 <17777 17097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975233.1:histidine kinase >Feature sequence065 1919 2194 gene locus_tag LOCUS_14860 1919 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 3675 2512 gene locus_tag LOCUS_14870 3675 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4406 3696 gene locus_tag LOCUS_14880 4406 3696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_14880 5686 4418 gene locus_tag LOCUS_14890 5686 4418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_14890 6919 5690 gene locus_tag LOCUS_14900 6919 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 7687 6950 gene locus_tag LOCUS_14910 7687 6950 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_14910 8307 8867 gene locus_tag LOCUS_14920 8307 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8891 9289 gene locus_tag LOCUS_14930 8891 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474275.1 protein_id gnl|my_center|LOCUS_14930 9873 9391 gene locus_tag LOCUS_14940 9873 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 10265 10047 gene locus_tag LOCUS_14950 10265 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14950 10455 10619 gene locus_tag LOCUS_14960 10455 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 11999 10677 gene locus_tag LOCUS_14970 11999 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 12808 12155 gene locus_tag LOCUS_14980 12808 12155 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_14980 12951 13442 gene locus_tag LOCUS_14990 gene rppH 12951 13442 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_14990 13446 15725 gene locus_tag LOCUS_15000 gene ptsP 13446 15725 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_15000 16560 16144 gene locus_tag LOCUS_15010 16560 16144 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104815.1 protein_id gnl|my_center|LOCUS_15010 16915 17454 gene locus_tag LOCUS_15020 16915 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence066 <1 2905 gene locus_tag LOCUS_15030 <1 2905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989464.1:peptidoglycan-binding protein 4600 3056 gene locus_tag LOCUS_15040 4600 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6267 4735 gene locus_tag LOCUS_15050 6267 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7849 6350 gene locus_tag LOCUS_15060 7849 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 8229 8600 gene locus_tag LOCUS_15070 8229 8600 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919384.1 protein_id gnl|my_center|LOCUS_15070 8593 9804 gene locus_tag LOCUS_15080 8593 9804 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861541.1 protein_id gnl|my_center|LOCUS_15080 10752 9913 gene locus_tag LOCUS_15090 10752 9913 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 protein_id gnl|my_center|LOCUS_15090 12179 11094 gene locus_tag LOCUS_15100 12179 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 15529 12305 gene locus_tag LOCUS_15110 15529 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 15782 17461 gene locus_tag LOCUS_15120 15782 17461 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX8 protein_id gnl|my_center|LOCUS_15120 >Feature sequence067 3970 299 gene locus_tag LOCUS_15130 3970 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5001 4531 gene locus_tag LOCUS_15140 5001 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 8649 5881 gene locus_tag LOCUS_15150 8649 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10401 8668 gene locus_tag LOCUS_15160 10401 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 12906 10609 gene locus_tag LOCUS_15170 12906 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13040 14347 gene locus_tag LOCUS_15180 13040 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 15802 14360 gene locus_tag LOCUS_15190 15802 14360 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_15190 15881 16753 gene locus_tag LOCUS_15200 gene menH 15881 16753 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6L0 protein_id gnl|my_center|LOCUS_15200 16812 17348 gene locus_tag LOCUS_15210 gene dsbB 16812 17348 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL09 protein_id gnl|my_center|LOCUS_15210 >Feature sequence068 543 1520 gene locus_tag LOCUS_15220 gene prfB 543 1520 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_15220 1692 1901 gene locus_tag LOCUS_15230 gene rpoZ 1692 1901 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_15230 3475 2048 gene locus_tag LOCUS_15240 3475 2048 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_15240 3642 3830 gene locus_tag LOCUS_15250 3642 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3851 4459 gene locus_tag LOCUS_15260 gene ambA 3851 4459 CDS product protein AmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_15260 5615 4521 gene locus_tag LOCUS_15270 5615 4521 CDS product glycerol-3-phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_15270 5877 7079 gene locus_tag LOCUS_15280 5877 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8140 7109 gene locus_tag LOCUS_15290 gene nadA 8140 7109 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_15290 8309 8234 gene locus_tag LOCUS_t00110 8309 8234 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11428 9029 gene locus_tag LOCUS_15300 11428 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12076 11438 gene locus_tag LOCUS_15310 12076 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 13478 12078 gene locus_tag LOCUS_15320 13478 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 14585 13623 gene locus_tag LOCUS_15330 14585 13623 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_15330 14986 15297 gene locus_tag LOCUS_15340 gene rplU 14986 15297 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_15340 15334 15591 gene locus_tag LOCUS_15350 gene rpmA 15334 15591 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_15350 16268 15708 gene locus_tag LOCUS_15360 16268 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 16382 17302 gene locus_tag LOCUS_15370 16382 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence069 222 749 gene locus_tag LOCUS_15380 222 749 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_15380 867 1583 gene locus_tag LOCUS_15390 867 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2102 1641 gene locus_tag LOCUS_15400 2102 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208936.1 protein_id gnl|my_center|LOCUS_15400 2356 3360 gene locus_tag LOCUS_15410 2356 3360 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_15410 3986 6034 gene locus_tag LOCUS_15420 3986 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6047 7378 gene locus_tag LOCUS_15430 6047 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_15430 7406 9307 gene locus_tag LOCUS_15440 7406 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9718 10107 gene locus_tag LOCUS_15450 9718 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10964 11173 gene locus_tag LOCUS_15460 10964 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 11426 11695 gene locus_tag LOCUS_15470 11426 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 12035 12556 gene locus_tag LOCUS_15480 12035 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14329 13028 gene locus_tag LOCUS_15490 14329 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_15490 16694 14340 gene locus_tag LOCUS_15500 16694 14340 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_15500 <17260 16694 gene locus_tag LOCUS_15510 <17260 16694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097155.1:cytochrome b >Feature sequence070 2229 2591 gene locus_tag LOCUS_15520 2229 2591 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882871.1 protein_id gnl|my_center|LOCUS_15520 3018 2593 gene locus_tag LOCUS_15530 3018 2593 CDS product type IV pili fiber building block protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021793.1 protein_id gnl|my_center|LOCUS_15530 5452 3026 gene locus_tag LOCUS_15540 5452 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6063 5449 gene locus_tag LOCUS_15550 6063 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 7130 6069 gene locus_tag LOCUS_15560 7130 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7579 7127 gene locus_tag LOCUS_15570 7579 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8148 7573 gene locus_tag LOCUS_15580 gene fimT 8148 7573 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_15580 8911 8306 gene locus_tag LOCUS_15590 8911 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10415 9288 gene locus_tag LOCUS_15600 10415 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11596 10418 gene locus_tag LOCUS_15610 11596 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 12317 11589 gene locus_tag LOCUS_15620 12317 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13264 12314 gene locus_tag LOCUS_15630 gene hemC 13264 12314 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_15630 14608 13409 gene locus_tag LOCUS_15640 14608 13409 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551934.1 protein_id gnl|my_center|LOCUS_15640 16028 15534 gene locus_tag LOCUS_15650 16028 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence071 377 1432 gene locus_tag LOCUS_15660 gene hisC 377 1432 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I245 protein_id gnl|my_center|LOCUS_15660 1441 2463 gene locus_tag LOCUS_15670 1441 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4004 2862 gene locus_tag LOCUS_15680 gene pilU 4004 2862 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_15680 5136 4102 gene locus_tag LOCUS_15690 gene pilT 5136 4102 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_15690 5360 6007 gene locus_tag LOCUS_15700 5360 6007 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ4 protein_id gnl|my_center|LOCUS_15700 6044 6859 gene locus_tag LOCUS_15710 gene proC 6044 6859 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_15710 6884 7468 gene locus_tag LOCUS_15720 6884 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_15720 7582 8748 gene locus_tag LOCUS_15730 gene metX 7582 8748 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 protein_id gnl|my_center|LOCUS_15730 8741 9331 gene locus_tag LOCUS_15740 8741 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_15740 9334 9765 gene locus_tag LOCUS_15750 9334 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9762 10373 gene locus_tag LOCUS_15760 gene rdgB 9762 10373 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7S6 protein_id gnl|my_center|LOCUS_15760 10378 11508 gene locus_tag LOCUS_15770 10378 11508 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_15770 11563 12087 gene locus_tag LOCUS_15780 11563 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 12283 13692 gene locus_tag LOCUS_15790 gene argH 12283 13692 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_15790 13780 14745 gene locus_tag LOCUS_15800 gene ftsX 13780 14745 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_15800 14959 15837 gene locus_tag LOCUS_15810 gene rpoH 14959 15837 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_15810 >Feature sequence072 483 229 gene locus_tag LOCUS_15820 483 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 696 565 gene locus_tag LOCUS_15830 696 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 988 1575 gene locus_tag LOCUS_15840 988 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 protein_id gnl|my_center|LOCUS_15840 2023 1682 gene locus_tag LOCUS_15850 2023 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2587 3342 gene locus_tag LOCUS_15860 2587 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4076 3498 gene locus_tag LOCUS_15870 4076 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5084 4395 gene locus_tag LOCUS_15880 5084 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5729 5421 gene locus_tag LOCUS_15890 5729 5421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_15890 6423 5743 gene locus_tag LOCUS_15900 6423 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7619 7110 gene locus_tag LOCUS_15910 7619 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 8011 7604 gene locus_tag LOCUS_15920 8011 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 16849 8873 gene locus_tag LOCUS_15930 16849 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence073 637 1755 gene locus_tag LOCUS_15940 gene ispG 637 1755 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_15940 1766 1966 gene locus_tag LOCUS_15950 1766 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15950 2027 3043 gene locus_tag LOCUS_15960 gene hisS 2027 3043 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P4 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15960 3059 3706 gene locus_tag LOCUS_15970 3059 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_15970 3724 4872 gene locus_tag LOCUS_15980 gene bamB 3724 4872 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIB1 protein_id gnl|my_center|LOCUS_15980 4907 6355 gene locus_tag LOCUS_15990 gene der 4907 6355 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_15990 6371 6775 gene locus_tag LOCUS_16000 6371 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6776 7210 gene locus_tag LOCUS_16010 6776 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 8699 7293 gene locus_tag LOCUS_16020 gene glnA 8699 7293 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E976 protein_id gnl|my_center|LOCUS_16020 11769 9016 gene locus_tag LOCUS_16030 11769 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 11934 13382 gene locus_tag LOCUS_16040 gene sbcB 11934 13382 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_16040 13372 14508 gene locus_tag LOCUS_16050 13372 14508 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_16050 14521 15705 gene locus_tag LOCUS_16060 14521 15705 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035306.1 protein_id gnl|my_center|LOCUS_16060 15698 16174 gene locus_tag LOCUS_16070 15698 16174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969348.1 protein_id gnl|my_center|LOCUS_16070 16174 16518 gene locus_tag LOCUS_16080 16174 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence074 64 1230 gene locus_tag LOCUS_16090 64 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2037 1234 gene locus_tag LOCUS_16100 2037 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2324 2992 gene locus_tag LOCUS_16110 2324 2992 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_16110 3113 3511 gene locus_tag LOCUS_16120 3113 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3661 5460 gene locus_tag LOCUS_16130 gene lepA 3661 5460 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_16130 5513 6613 gene locus_tag LOCUS_16140 gene lepB 5513 6613 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF9 protein_id gnl|my_center|LOCUS_16140 6613 6978 gene locus_tag LOCUS_16150 6613 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6981 7670 gene locus_tag LOCUS_16160 gene rnc 6981 7670 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH81 protein_id gnl|my_center|LOCUS_16160 7667 8572 gene locus_tag LOCUS_16170 gene era 7667 8572 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_16170 8576 9271 gene locus_tag LOCUS_16180 gene recO 8576 9271 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E316 protein_id gnl|my_center|LOCUS_16180 9268 9651 gene locus_tag LOCUS_16190 gene acpS 9268 9651 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_16190 10083 10319 gene locus_tag LOCUS_16200 gene hfq 10083 10319 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ69 protein_id gnl|my_center|LOCUS_16200 10339 11649 gene locus_tag LOCUS_16210 gene hflX 10339 11649 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV10 protein_id gnl|my_center|LOCUS_16210 11639 12742 gene locus_tag LOCUS_16220 11639 12742 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_16220 12751 13626 gene locus_tag LOCUS_16230 12751 13626 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_16230 13886 15784 gene locus_tag LOCUS_16240 13886 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <16784 15830 gene locus_tag LOCUS_16250 <16784 15830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262595.1:ABC transporter >Feature sequence075 82 1425 gene locus_tag LOCUS_16260 82 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3114 1498 gene locus_tag LOCUS_16270 3114 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3253 4587 gene locus_tag LOCUS_16280 3253 4587 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_16280 4600 5127 gene locus_tag LOCUS_16290 gene lspA 4600 5127 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G7W3 protein_id gnl|my_center|LOCUS_16290 5128 5430 gene locus_tag LOCUS_16300 5128 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5445 6266 gene locus_tag LOCUS_16310 5445 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6323 7315 gene locus_tag LOCUS_16320 gene tbpA 6323 7315 CDS product thiamine transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529762.1 protein_id gnl|my_center|LOCUS_16320 7319 8869 gene locus_tag LOCUS_16330 gene thiP 7319 8869 CDS product thiamine transporter membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345595.1 protein_id gnl|my_center|LOCUS_16330 8856 9482 gene locus_tag LOCUS_16340 gene thiQ 8856 9482 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44986 protein_id gnl|my_center|LOCUS_16340 11142 9670 gene locus_tag LOCUS_16350 11142 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11572 11351 gene locus_tag LOCUS_16360 11572 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 11758 13344 gene locus_tag LOCUS_16370 gene ybiT 11758 13344 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_16370 14185 13655 gene locus_tag LOCUS_16380 14185 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence076 456 713 gene locus_tag LOCUS_16390 456 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 703 1359 gene locus_tag LOCUS_16400 703 1359 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_16400 1710 2954 gene locus_tag LOCUS_16410 1710 2954 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 protein_id gnl|my_center|LOCUS_16410 4075 3197 gene locus_tag LOCUS_16420 gene ilvY 4075 3197 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_16420 5152 4085 gene locus_tag LOCUS_16430 5152 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5377 7824 gene locus_tag LOCUS_16440 5377 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7859 9691 gene locus_tag LOCUS_16450 7859 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 9876 11351 gene locus_tag LOCUS_16460 gene ilvC 9876 11351 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_16460 11668 13446 gene locus_tag LOCUS_16470 11668 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 13651 13905 gene locus_tag LOCUS_16480 13651 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377584.1 protein_id gnl|my_center|LOCUS_16480 13991 14293 gene locus_tag LOCUS_16490 13991 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 15118 16311 gene locus_tag LOCUS_16500 15118 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence077 939 271 gene locus_tag LOCUS_16510 gene minC 939 271 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQN9 protein_id gnl|my_center|LOCUS_16510 1371 2045 gene locus_tag LOCUS_16520 gene rpe 1371 2045 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC9 protein_id gnl|my_center|LOCUS_16520 2052 2636 gene locus_tag LOCUS_16530 2052 2636 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_16530 2633 3661 gene locus_tag LOCUS_16540 gene trpD 2633 3661 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_16540 3781 4575 gene locus_tag LOCUS_16550 gene trpC 3781 4575 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_16550 4781 4599 gene locus_tag LOCUS_16560 4781 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4847 5578 gene locus_tag LOCUS_16570 4847 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5622 6617 gene locus_tag LOCUS_16580 5622 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7859 6753 gene locus_tag LOCUS_16590 7859 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8051 8305 gene locus_tag LOCUS_16600 8051 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 9434 8352 gene locus_tag LOCUS_16610 gene prfA 9434 8352 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW7 protein_id gnl|my_center|LOCUS_16610 10712 9450 gene locus_tag LOCUS_16620 gene hemA 10712 9450 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C2 protein_id gnl|my_center|LOCUS_16620 10878 12716 gene locus_tag LOCUS_16630 10878 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_16630 12892 14796 gene locus_tag LOCUS_16640 gene dxs 12892 14796 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU8 protein_id gnl|my_center|LOCUS_16640 >Feature sequence078 138 806 gene locus_tag LOCUS_16650 138 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_16650 1028 1909 gene locus_tag LOCUS_16660 1028 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1902 2348 gene locus_tag LOCUS_16670 1902 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2332 3312 gene locus_tag LOCUS_16680 2332 3312 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_16680 3313 4566 gene locus_tag LOCUS_16690 3313 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4556 5005 gene locus_tag LOCUS_16700 4556 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4998 5669 gene locus_tag LOCUS_16710 4998 5669 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 protein_id gnl|my_center|LOCUS_16710 6050 6544 gene locus_tag LOCUS_16720 6050 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405409.1 protein_id gnl|my_center|LOCUS_16720 6919 7260 gene locus_tag LOCUS_16730 6919 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 7465 10296 gene locus_tag LOCUS_16740 7465 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 10812 10450 gene locus_tag LOCUS_16750 10812 10450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_16750 12331 11561 gene locus_tag LOCUS_16760 12331 11561 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215390.1 protein_id gnl|my_center|LOCUS_16760 13026 12331 gene locus_tag LOCUS_16770 13026 12331 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_16770 13780 13034 gene locus_tag LOCUS_16780 13780 13034 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_16780 14811 13777 gene locus_tag LOCUS_16790 gene rnfD 14811 13777 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B9 protein_id gnl|my_center|LOCUS_16790 >Feature sequence079 825 34 gene locus_tag LOCUS_16800 825 34 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_16800 2132 1563 gene locus_tag LOCUS_16810 2132 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2634 2209 gene locus_tag LOCUS_16820 2634 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16820 4779 3439 gene locus_tag LOCUS_16830 gene gor 4779 3439 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_16830 5465 4941 gene locus_tag LOCUS_16840 5465 4941 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 protein_id gnl|my_center|LOCUS_16840 5653 6048 gene locus_tag LOCUS_16850 5653 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243208.1 protein_id gnl|my_center|LOCUS_16850 12733 6353 gene locus_tag LOCUS_16860 12733 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 13199 13396 gene locus_tag LOCUS_16870 13199 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_16870 13443 13814 gene locus_tag LOCUS_16880 13443 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 14334 13870 gene locus_tag LOCUS_16890 14334 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <16273 14432 gene locus_tag LOCUS_16900 <16273 14432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P622:glucanase >Feature sequence080 1973 3112 gene locus_tag LOCUS_16910 1973 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4591 3419 gene locus_tag LOCUS_16920 4591 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5433 4591 gene locus_tag LOCUS_16930 5433 4591 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_16930 6254 5430 gene locus_tag LOCUS_16940 6254 5430 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723843.1 protein_id gnl|my_center|LOCUS_16940 8486 6399 gene locus_tag LOCUS_16950 8486 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9247 9432 gene locus_tag LOCUS_16960 9247 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 9716 10870 gene locus_tag LOCUS_16970 9716 10870 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073055.1 protein_id gnl|my_center|LOCUS_16970 14295 11086 gene locus_tag LOCUS_16980 14295 11086 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946472.1 protein_id gnl|my_center|LOCUS_16980 14513 15265 gene locus_tag LOCUS_16990 14513 15265 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLG8 protein_id gnl|my_center|LOCUS_16990 15258 15959 gene locus_tag LOCUS_17000 gene ybgJ 15258 15959 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261967.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence081 771 61 gene locus_tag LOCUS_17010 771 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1957 764 gene locus_tag LOCUS_17020 1957 764 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_17020 3086 1971 gene locus_tag LOCUS_17030 3086 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3430 3750 gene locus_tag LOCUS_17040 3430 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17040 3856 4464 gene locus_tag LOCUS_17050 3856 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17050 4461 5114 gene locus_tag LOCUS_17060 gene purN 4461 5114 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_17060 5234 5854 gene locus_tag LOCUS_17070 5234 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5865 6329 gene locus_tag LOCUS_17080 5865 6329 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_17080 6893 6411 gene locus_tag LOCUS_17090 6893 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7793 7098 gene locus_tag LOCUS_17100 7793 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_17100 8922 7783 gene locus_tag LOCUS_17110 8922 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9301 9813 gene locus_tag LOCUS_17120 9301 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 9920 10432 gene locus_tag LOCUS_17130 9920 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10648 12333 gene locus_tag LOCUS_17140 10648 12333 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266636.1 protein_id gnl|my_center|LOCUS_17140 12336 13553 gene locus_tag LOCUS_17150 gene pilC 12336 13553 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_17150 13550 14446 gene locus_tag LOCUS_17160 gene pilD 13550 14446 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_17160 14443 15033 gene locus_tag LOCUS_17170 gene coaE 14443 15033 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44920 protein_id gnl|my_center|LOCUS_17170 15030 15227 gene locus_tag LOCUS_17180 gene yacG 15030 15227 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K155 protein_id gnl|my_center|LOCUS_17180 15595 15203 gene locus_tag LOCUS_17190 15595 15203 CDS product 7,8-dihydro-8-oxoguanine-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461225.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence082 2321 1851 gene locus_tag LOCUS_17200 gene ccmE 2321 1851 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_17200 2527 2318 gene locus_tag LOCUS_17210 2527 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3317 2529 gene locus_tag LOCUS_17220 gene ccmC 3317 2529 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946594.1 protein_id gnl|my_center|LOCUS_17220 3998 3327 gene locus_tag LOCUS_17230 gene ccmB 3998 3327 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WDF6 protein_id gnl|my_center|LOCUS_17230 4146 3982 gene locus_tag LOCUS_17240 4146 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4789 4130 gene locus_tag LOCUS_17250 gene ccmA 4789 4130 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE3 protein_id gnl|my_center|LOCUS_17250 6318 5143 gene locus_tag LOCUS_17260 6318 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_17260 6775 6302 gene locus_tag LOCUS_17270 6775 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 7251 6784 gene locus_tag LOCUS_17280 7251 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_17280 8152 7238 gene locus_tag LOCUS_17290 8152 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_17290 9270 8188 gene locus_tag LOCUS_17300 gene pdxB 9270 8188 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_17300 10676 9429 gene locus_tag LOCUS_17310 gene rhlB 10676 9429 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_17310 11256 10678 gene locus_tag LOCUS_17320 11256 10678 CDS product transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 protein_id gnl|my_center|LOCUS_17320 12076 11258 gene locus_tag LOCUS_17330 gene murI 12076 11258 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_17330 12101 13216 gene locus_tag LOCUS_17340 12101 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_17340 14134 13298 gene locus_tag LOCUS_17350 14134 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707806.1 protein_id gnl|my_center|LOCUS_17350 14293 15711 gene locus_tag LOCUS_17360 14293 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence083 3371 1374 gene locus_tag LOCUS_17370 3371 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3865 4188 gene locus_tag LOCUS_17380 3865 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4199 4537 gene locus_tag LOCUS_17390 4199 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4558 4929 gene locus_tag LOCUS_17400 4558 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5386 6159 gene locus_tag LOCUS_17410 5386 6159 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_17410 6299 7213 gene locus_tag LOCUS_17420 6299 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7482 8339 gene locus_tag LOCUS_17430 7482 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8884 8465 gene locus_tag LOCUS_17440 8884 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 9466 8987 gene locus_tag LOCUS_17450 9466 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9654 10805 gene locus_tag LOCUS_17460 9654 10805 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_17460 11089 10868 gene locus_tag LOCUS_17470 11089 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 11507 13279 gene locus_tag LOCUS_17480 11507 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_17480 13292 13471 gene locus_tag LOCUS_17490 13292 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 13871 14638 gene locus_tag LOCUS_17500 13871 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 14639 15232 gene locus_tag LOCUS_17510 14639 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 15244 15855 gene locus_tag LOCUS_17520 15244 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence084 <1 1023 gene locus_tag LOCUS_17530 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87TQ7:chromosomal replication initiator protein DnaA 1028 2146 gene locus_tag LOCUS_17540 gene dnaN 1028 2146 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_17540 2258 2058 gene locus_tag LOCUS_17550 2258 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2358 3341 gene locus_tag LOCUS_17560 gene recF 2358 3341 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_17560 3338 5758 gene locus_tag LOCUS_17570 gene gyrB 3338 5758 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_17570 5842 6240 gene locus_tag LOCUS_17580 5842 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6249 7895 gene locus_tag LOCUS_17590 6249 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 8602 8003 gene locus_tag LOCUS_17600 8602 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_17600 8681 9349 gene locus_tag LOCUS_17610 gene minC 8681 9349 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZES5 protein_id gnl|my_center|LOCUS_17610 9363 9830 gene locus_tag LOCUS_17620 9363 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 11090 10002 gene locus_tag LOCUS_17630 11090 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11803 11318 gene locus_tag LOCUS_17640 11803 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 13036 12026 gene locus_tag LOCUS_17650 13036 12026 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_17650 13934 13029 gene locus_tag LOCUS_17660 13934 13029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_17660 15362 14079 gene locus_tag LOCUS_17670 15362 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence085 1194 1349 gene locus_tag LOCUS_17680 1194 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1327 1533 gene locus_tag LOCUS_17690 1327 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1656 1955 gene locus_tag LOCUS_17700 1656 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2537 3469 gene locus_tag LOCUS_17710 2537 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3473 4981 gene locus_tag LOCUS_17720 3473 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 5215 5979 gene locus_tag LOCUS_17730 5215 5979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706063.1 protein_id gnl|my_center|LOCUS_17730 6618 6487 gene locus_tag LOCUS_17740 6618 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7117 8553 gene locus_tag LOCUS_17750 7117 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 10195 8813 gene locus_tag LOCUS_17760 10195 8813 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_17760 11016 11360 gene locus_tag LOCUS_17770 11016 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 11490 11801 gene locus_tag LOCUS_17780 11490 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 protein_id gnl|my_center|LOCUS_17780 12853 12002 gene locus_tag LOCUS_17790 12853 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 12887 13189 gene locus_tag LOCUS_17800 12887 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 13839 13255 gene locus_tag LOCUS_17810 13839 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence086 994 1620 gene locus_tag LOCUS_17820 994 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2165 2659 gene locus_tag LOCUS_17830 2165 2659 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478982.1 protein_id gnl|my_center|LOCUS_17830 3105 3818 gene locus_tag LOCUS_17840 gene arsH 3105 3818 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817076.1 protein_id gnl|my_center|LOCUS_17840 4199 6736 gene locus_tag LOCUS_17850 4199 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 6746 7963 gene locus_tag LOCUS_17860 6746 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 8079 9074 gene locus_tag LOCUS_17870 8079 9074 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_17870 9125 9475 gene locus_tag LOCUS_17880 9125 9475 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529502.1 protein_id gnl|my_center|LOCUS_17880 9806 10045 gene locus_tag LOCUS_17890 9806 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_17890 10817 10221 gene locus_tag LOCUS_17900 10817 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 12497 11133 gene locus_tag LOCUS_17910 12497 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence087 763 116 gene locus_tag LOCUS_17920 763 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1182 760 gene locus_tag LOCUS_17930 1182 760 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZA9 protein_id gnl|my_center|LOCUS_17930 1515 1198 gene locus_tag LOCUS_17940 1515 1198 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266663.1 protein_id gnl|my_center|LOCUS_17940 2890 1517 gene locus_tag LOCUS_17950 2890 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4099 2966 gene locus_tag LOCUS_17960 gene lpxB 4099 2966 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF0 protein_id gnl|my_center|LOCUS_17960 4875 4099 gene locus_tag LOCUS_17970 gene lpxA 4875 4099 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_17970 5327 4875 gene locus_tag LOCUS_17980 gene fabZ 5327 4875 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_17980 6388 5330 gene locus_tag LOCUS_17990 gene lpxD 6388 5330 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG5 protein_id gnl|my_center|LOCUS_17990 7001 6408 gene locus_tag LOCUS_18000 7001 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9379 7031 gene locus_tag LOCUS_18010 gene bamA 9379 7031 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N5 protein_id gnl|my_center|LOCUS_18010 10740 9391 gene locus_tag LOCUS_18020 10740 9391 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_18020 11909 10740 gene locus_tag LOCUS_18030 gene dxr 11909 10740 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_18030 12736 11906 gene locus_tag LOCUS_18040 gene cdsA-1 12736 11906 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_18040 13486 12755 gene locus_tag LOCUS_18050 gene uppS 13486 12755 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_18050 14109 13552 gene locus_tag LOCUS_18060 gene frr 14109 13552 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_18060 14848 14099 gene locus_tag LOCUS_18070 gene pyrH 14848 14099 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS6 protein_id gnl|my_center|LOCUS_18070 >Feature sequence088 229 687 gene locus_tag LOCUS_18080 229 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1198 2268 gene locus_tag LOCUS_18090 1198 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681626.1 protein_id gnl|my_center|LOCUS_18090 3658 2399 gene locus_tag LOCUS_18100 3658 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4205 3801 gene locus_tag LOCUS_18110 gene gfaB 4205 3801 CDS product glutathione-dependent formaldehyde-activating enzyme GfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070494.1 protein_id gnl|my_center|LOCUS_18110 5023 4448 gene locus_tag LOCUS_18120 5023 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5668 5264 gene locus_tag LOCUS_18130 5668 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 7896 6031 gene locus_tag LOCUS_18140 gene aceF 7896 6031 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX3 protein_id gnl|my_center|LOCUS_18140 10619 7950 gene locus_tag LOCUS_18150 gene aceE 10619 7950 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_18150 12689 11661 gene locus_tag LOCUS_18160 gene gapA 12689 11661 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_18160 12954 13580 gene locus_tag LOCUS_18170 12954 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 14094 14999 gene locus_tag LOCUS_18180 14094 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence089 264 932 gene locus_tag LOCUS_18190 264 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1480 941 gene locus_tag LOCUS_18200 1480 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2530 1532 gene locus_tag LOCUS_18210 2530 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3579 2530 gene locus_tag LOCUS_18220 3579 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3789 6395 gene locus_tag LOCUS_18230 gene alaS 3789 6395 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_18230 6412 7635 gene locus_tag LOCUS_18240 gene lysC 6412 7635 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_18240 7978 8175 gene locus_tag LOCUS_18250 gene csrA 7978 8175 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_18250 8448 8537 gene locus_tag LOCUS_t00120 8448 8537 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8559 8635 gene locus_tag LOCUS_t00130 8559 8635 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8900 9721 gene locus_tag LOCUS_18260 gene ybbO 8900 9721 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_18260 9952 11160 gene locus_tag LOCUS_18270 gene argD 9952 11160 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59320 protein_id gnl|my_center|LOCUS_18270 11685 11224 gene locus_tag LOCUS_18280 11685 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_18280 12451 11687 gene locus_tag LOCUS_18290 12451 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 13299 12445 gene locus_tag LOCUS_18300 13299 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946413.1 protein_id gnl|my_center|LOCUS_18300 13626 13363 gene locus_tag LOCUS_18310 13626 13363 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence090 2298 4814 gene locus_tag LOCUS_18320 2298 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 9912 5404 gene locus_tag LOCUS_18330 9912 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 10108 9917 gene locus_tag LOCUS_18340 10108 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 10767 10946 gene locus_tag LOCUS_18350 10767 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 11764 12534 gene locus_tag LOCUS_18360 11764 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 12786 13430 gene locus_tag LOCUS_18370 12786 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 14659 13682 gene locus_tag LOCUS_18380 gene ephA 14659 13682 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence091 445 188 gene locus_tag LOCUS_18390 445 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 694 1440 gene locus_tag LOCUS_18400 gene cysH 694 1440 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_18400 1597 3789 gene locus_tag LOCUS_18410 gene glgB 1597 3789 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP85 protein_id gnl|my_center|LOCUS_18410 4834 3986 gene locus_tag LOCUS_18420 4834 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5318 5244 gene locus_tag LOCUS_t00140 5318 5244 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5459 5384 gene locus_tag LOCUS_t00150 5459 5384 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6015 5569 gene locus_tag LOCUS_18430 6015 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6061 6423 gene locus_tag LOCUS_18440 6061 6423 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_18440 6425 7543 gene locus_tag LOCUS_18450 6425 7543 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_18450 12224 7638 gene locus_tag LOCUS_18460 12224 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14107 12224 gene locus_tag LOCUS_18470 14107 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 <14984 14223 gene locus_tag LOCUS_18480 <14984 14223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082399.1:glycosyl transferase >Feature sequence092 1 1083 gene locus_tag LOCUS_18490 gene mraY 1 1083 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_18490 1093 2430 gene locus_tag LOCUS_18500 gene murD 1093 2430 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_18500 2427 3599 gene locus_tag LOCUS_18510 gene ftsW 2427 3599 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_18510 3596 4684 gene locus_tag LOCUS_18520 gene murG 3596 4684 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_18520 4681 6111 gene locus_tag LOCUS_18530 gene murC 4681 6111 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P8 protein_id gnl|my_center|LOCUS_18530 6115 6909 gene locus_tag LOCUS_18540 6115 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6899 8140 gene locus_tag LOCUS_18550 gene ftsA 6899 8140 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_18550 8176 9333 gene locus_tag LOCUS_18560 gene ftsZ 8176 9333 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_18560 9420 10334 gene locus_tag LOCUS_18570 gene lpxC 9420 10334 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_18570 10338 11285 gene locus_tag LOCUS_18580 10338 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 11453 14152 gene locus_tag LOCUS_18590 gene secA 11453 14152 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_18590 >Feature sequence093 3637 2897 gene locus_tag LOCUS_18600 3637 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6592 4052 gene locus_tag LOCUS_18610 6592 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7743 7075 gene locus_tag LOCUS_18620 gene ppa 7743 7075 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404754.1 protein_id gnl|my_center|LOCUS_18620 9681 7768 gene locus_tag LOCUS_18630 9681 7768 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267537.1 protein_id gnl|my_center|LOCUS_18630 11068 10061 gene locus_tag LOCUS_18640 11068 10061 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072427.1 protein_id gnl|my_center|LOCUS_18640 11662 12099 gene locus_tag LOCUS_18650 gene umuD 11662 12099 CDS product protein impA' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705912.1 protein_id gnl|my_center|LOCUS_18650 12563 13825 gene locus_tag LOCUS_18660 gene umuC 12563 13825 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_18660 14634 13927 gene locus_tag LOCUS_18670 14634 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence094 916 3060 gene locus_tag LOCUS_18680 916 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3480 4454 gene locus_tag LOCUS_18690 3480 4454 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_18690 4467 4931 gene locus_tag LOCUS_18700 4467 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5227 6096 gene locus_tag LOCUS_18710 gene myg1 5227 6096 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_18710 6729 8090 gene locus_tag LOCUS_18720 6729 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 8083 11034 gene locus_tag LOCUS_18730 8083 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11049 13235 gene locus_tag LOCUS_18740 11049 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 13232 14197 gene locus_tag LOCUS_18750 13232 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence095 1070 51 gene locus_tag LOCUS_18760 gene dapD 1070 51 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7C5 protein_id gnl|my_center|LOCUS_18760 1458 1105 gene locus_tag LOCUS_18770 1458 1105 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377785.1 protein_id gnl|my_center|LOCUS_18770 2648 1455 gene locus_tag LOCUS_18780 2648 1455 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_18780 5350 2654 gene locus_tag LOCUS_18790 gene glnD 5350 2654 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_18790 6139 5351 gene locus_tag LOCUS_18800 gene map 6139 5351 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_18800 7090 6194 gene locus_tag LOCUS_18810 7090 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 7580 7083 gene locus_tag LOCUS_18820 7580 7083 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV70 protein_id gnl|my_center|LOCUS_18820 10339 7619 gene locus_tag LOCUS_18830 gene rapA 10339 7619 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44781 protein_id gnl|my_center|LOCUS_18830 11967 10441 gene locus_tag LOCUS_18840 gene lysS 11967 10441 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_18840 13367 12054 gene locus_tag LOCUS_18850 13367 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 13477 14331 gene locus_tag LOCUS_18860 13477 14331 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence096 87 1127 gene locus_tag LOCUS_18870 87 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18870 1954 1142 gene locus_tag LOCUS_18880 1954 1142 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_18880 2170 3618 gene locus_tag LOCUS_18890 2170 3618 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707906.1 protein_id gnl|my_center|LOCUS_18890 4184 3996 gene locus_tag LOCUS_18900 4184 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4337 4588 gene locus_tag LOCUS_18910 4337 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4590 4859 gene locus_tag LOCUS_18920 4590 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105954.1 protein_id gnl|my_center|LOCUS_18920 5312 5791 gene locus_tag LOCUS_18930 gene iscR 5312 5791 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_18930 5805 7019 gene locus_tag LOCUS_18940 gene iscS 5805 7019 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A1 protein_id gnl|my_center|LOCUS_18940 7186 7572 gene locus_tag LOCUS_18950 gene iscU 7186 7572 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACD4 protein_id gnl|my_center|LOCUS_18950 7583 7906 gene locus_tag LOCUS_18960 7583 7906 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY0 protein_id gnl|my_center|LOCUS_18960 8142 8675 gene locus_tag LOCUS_18970 gene hscB 8142 8675 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX9 protein_id gnl|my_center|LOCUS_18970 8724 10604 gene locus_tag LOCUS_18980 gene hscA 8724 10604 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ36 protein_id gnl|my_center|LOCUS_18980 10676 11014 gene locus_tag LOCUS_18990 gene fdx 10676 11014 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_18990 11773 11069 gene locus_tag LOCUS_19000 11773 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 13434 11968 gene locus_tag LOCUS_19010 13434 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 14300 13482 gene locus_tag LOCUS_19020 gene aroE 14300 13482 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT3 protein_id gnl|my_center|LOCUS_19020 >Feature sequence097 1565 1855 gene locus_tag LOCUS_19030 1565 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2897 1953 gene locus_tag LOCUS_19040 2897 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3329 4156 gene locus_tag LOCUS_19050 3329 4156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_19050 4877 4254 gene locus_tag LOCUS_19060 4877 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5789 4953 gene locus_tag LOCUS_19070 5789 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8171 6042 gene locus_tag LOCUS_19080 gene priA 8171 6042 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2H7 protein_id gnl|my_center|LOCUS_19080 8396 8605 gene locus_tag LOCUS_19090 gene rpmE-2 8396 8605 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQR9 protein_id gnl|my_center|LOCUS_19090 9408 8722 gene locus_tag LOCUS_19100 9408 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 11488 9584 gene locus_tag LOCUS_19110 gene yheS 11488 9584 CDS product putative ABC transporter ATP-binding protein YheS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63390 protein_id gnl|my_center|LOCUS_19110 12301 11627 gene locus_tag LOCUS_19120 12301 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 12519 13313 gene locus_tag LOCUS_19130 12519 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 13889 14068 gene locus_tag LOCUS_19140 13889 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence098 3927 3106 gene locus_tag LOCUS_19150 3927 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4225 5202 gene locus_tag LOCUS_19160 4225 5202 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_19160 5220 6800 gene locus_tag LOCUS_19170 5220 6800 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_19170 7453 7010 gene locus_tag LOCUS_19180 7453 7010 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED72 protein_id gnl|my_center|LOCUS_19180 8118 7561 gene locus_tag LOCUS_19190 8118 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 8712 8272 gene locus_tag LOCUS_19200 gene dtd 8712 8272 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44814 protein_id gnl|my_center|LOCUS_19200 8781 9365 gene locus_tag LOCUS_19210 gene ydaL 8781 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418232.1 protein_id gnl|my_center|LOCUS_19210 9368 9649 gene locus_tag LOCUS_19220 9368 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 11531 9756 gene locus_tag LOCUS_19230 11531 9756 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence099 1160 429 gene locus_tag LOCUS_19240 gene pdxJ 1160 429 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDU5 protein_id gnl|my_center|LOCUS_19240 4266 1399 gene locus_tag LOCUS_19250 4266 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6357 4312 gene locus_tag LOCUS_19260 gene glgX-2 6357 4312 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP84 protein_id gnl|my_center|LOCUS_19260 6726 8819 gene locus_tag LOCUS_19270 gene fusA2 6726 8819 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_19270 8971 9189 gene locus_tag LOCUS_19280 8971 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9443 9670 gene locus_tag LOCUS_19290 9443 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9982 10680 gene locus_tag LOCUS_19300 gene rsuA 9982 10680 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRK5 protein_id gnl|my_center|LOCUS_19300 10707 11024 gene locus_tag LOCUS_19310 10707 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence100 738 67 gene locus_tag LOCUS_19320 gene ureF 738 67 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_19320 1256 738 gene locus_tag LOCUS_19330 gene ureE 1256 738 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX5 protein_id gnl|my_center|LOCUS_19330 3185 1485 gene locus_tag LOCUS_19340 gene ureC 3185 1485 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_19340 3544 3182 gene locus_tag LOCUS_19350 gene ureB 3544 3182 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU6 protein_id gnl|my_center|LOCUS_19350 3683 3555 gene locus_tag LOCUS_19360 3683 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4000 3698 gene locus_tag LOCUS_19370 gene ureA 4000 3698 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRU3 protein_id gnl|my_center|LOCUS_19370 4913 4011 gene locus_tag LOCUS_19380 gene ureD 4913 4011 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRM4 protein_id gnl|my_center|LOCUS_19380 5318 6607 gene locus_tag LOCUS_19390 5318 6607 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888240.1 protein_id gnl|my_center|LOCUS_19390 6799 8355 gene locus_tag LOCUS_19400 6799 8355 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_19400 8359 9519 gene locus_tag LOCUS_19410 8359 9519 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531847.1 protein_id gnl|my_center|LOCUS_19410 9519 10280 gene locus_tag LOCUS_19420 9519 10280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_19420 10297 10992 gene locus_tag LOCUS_19430 10297 10992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888236.1 protein_id gnl|my_center|LOCUS_19430 12848 11073 gene locus_tag LOCUS_19440 12848 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 13337 12954 gene locus_tag LOCUS_19450 13337 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_19450 13622 13341 gene locus_tag LOCUS_19460 13622 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence101 89 634 gene locus_tag LOCUS_19470 89 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 597 1202 gene locus_tag LOCUS_19480 597 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1907 1329 gene locus_tag LOCUS_19490 1907 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2218 2541 gene locus_tag LOCUS_19500 2218 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2598 3479 gene locus_tag LOCUS_19510 2598 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3986 5167 gene locus_tag LOCUS_19520 gene pgk 3986 5167 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6Q3 protein_id gnl|my_center|LOCUS_19520 5243 6319 gene locus_tag LOCUS_19530 5243 6319 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_19530 6473 7702 gene locus_tag LOCUS_19540 gene serA 6473 7702 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_19540 8006 8428 gene locus_tag LOCUS_19550 8006 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 8459 9127 gene locus_tag LOCUS_19560 8459 9127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941865.1 protein_id gnl|my_center|LOCUS_19560 9938 9258 gene locus_tag LOCUS_19570 9938 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 10145 11518 gene locus_tag LOCUS_19580 10145 11518 CDS product Na+/H+ antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 protein_id gnl|my_center|LOCUS_19580 11704 12231 gene locus_tag LOCUS_19590 11704 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 12578 13147 gene locus_tag LOCUS_19600 12578 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 13217 13798 gene locus_tag LOCUS_19610 13217 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence102 1863 556 gene locus_tag LOCUS_19620 1863 556 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882564.1 protein_id gnl|my_center|LOCUS_19620 2437 3393 gene locus_tag LOCUS_19630 2437 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3864 3658 gene locus_tag LOCUS_19640 gene iscX 3864 3658 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072283.1 protein_id gnl|my_center|LOCUS_19640 5334 4144 gene locus_tag LOCUS_19650 5334 4144 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261972.1 protein_id gnl|my_center|LOCUS_19650 5846 6589 gene locus_tag LOCUS_19660 5846 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8087 6843 gene locus_tag LOCUS_19670 8087 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8681 9847 gene locus_tag LOCUS_19680 8681 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10112 10705 gene locus_tag LOCUS_19690 10112 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 11055 11582 gene locus_tag LOCUS_19700 11055 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 13155 11734 gene locus_tag LOCUS_19710 13155 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence103 1282 239 gene locus_tag LOCUS_19720 1282 239 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178906.1 protein_id gnl|my_center|LOCUS_19720 1726 1301 gene locus_tag LOCUS_19730 1726 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3368 1746 gene locus_tag LOCUS_19740 3368 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 7769 3672 gene locus_tag LOCUS_19750 7769 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 13377 8578 gene locus_tag LOCUS_19760 13377 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence104 <1 842 gene locus_tag LOCUS_19770 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000961457.1:ABC-F family ATPase 2004 1030 gene locus_tag LOCUS_19780 2004 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2185 2661 gene locus_tag LOCUS_19790 2185 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3089 2733 gene locus_tag LOCUS_19800 3089 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 7964 3102 gene locus_tag LOCUS_19810 7964 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_19810 10158 8095 gene locus_tag LOCUS_19820 10158 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_19820 10842 10195 gene locus_tag LOCUS_19830 10842 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_19830 11179 10859 gene locus_tag LOCUS_19840 11179 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 11903 11202 gene locus_tag LOCUS_19850 11903 11202 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_19850 12360 11917 gene locus_tag LOCUS_19860 12360 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 13611 12655 gene locus_tag LOCUS_19870 13611 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence105 1178 2266 gene locus_tag LOCUS_19880 1178 2266 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_19880 2271 5462 gene locus_tag LOCUS_19890 2271 5462 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_19890 5595 6143 gene locus_tag LOCUS_19900 5595 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11133 6322 gene locus_tag LOCUS_19910 11133 6322 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267201.1 protein_id gnl|my_center|LOCUS_19910 12122 11703 gene locus_tag LOCUS_19920 12122 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 13310 12135 gene locus_tag LOCUS_19930 13310 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence106 <1 610 gene locus_tag LOCUS_19940 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399691.1:hybrid sensor histidine kinase/response regulator 709 1332 gene locus_tag LOCUS_19950 gene coq7 709 1332 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_19950 2432 1731 gene locus_tag LOCUS_19960 2432 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_19960 3256 2411 gene locus_tag LOCUS_19970 gene dapF 3256 2411 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B6 protein_id gnl|my_center|LOCUS_19970 4549 3305 gene locus_tag LOCUS_19980 gene lysA 4549 3305 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_19980 5385 4690 gene locus_tag LOCUS_19990 5385 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6216 5560 gene locus_tag LOCUS_20000 gene pyrE 6216 5560 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_20000 6293 6478 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaccattcttttgtaaaacaaaaa 7166 6435 gene locus_tag LOCUS_20010 gene rph 7166 6435 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQU6 protein_id gnl|my_center|LOCUS_20010 7317 7404 gene locus_tag LOCUS_t00160 7317 7404 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8164 7718 gene locus_tag LOCUS_20020 8164 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 8481 8239 gene locus_tag LOCUS_20030 8481 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9630 9001 gene locus_tag LOCUS_20040 gene tag 9630 9001 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 protein_id gnl|my_center|LOCUS_20040 10242 11024 gene locus_tag LOCUS_20050 10242 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 11303 13336 gene locus_tag LOCUS_20060 11303 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence107 1577 1386 gene locus_tag LOCUS_20070 1577 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3079 1850 gene locus_tag LOCUS_20080 3079 1850 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_20080 3606 3076 gene locus_tag LOCUS_20090 3606 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5598 3613 gene locus_tag LOCUS_20100 gene prc 5598 3613 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_20100 6117 5704 gene locus_tag LOCUS_20110 gene hisI 6117 5704 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53158 protein_id gnl|my_center|LOCUS_20110 6925 6107 gene locus_tag LOCUS_20120 gene znuB 6925 6107 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_20120 7731 6925 gene locus_tag LOCUS_20130 gene znuC 7731 6925 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44692 protein_id gnl|my_center|LOCUS_20130 7798 8772 gene locus_tag LOCUS_20140 7798 8772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933760.1 protein_id gnl|my_center|LOCUS_20140 8941 9801 gene locus_tag LOCUS_20150 gene htpX 8941 9801 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KID0 protein_id gnl|my_center|LOCUS_20150 10238 13594 gene locus_tag LOCUS_20160 gene smc 10238 13594 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_20160 >Feature sequence108 2925 1504 gene locus_tag LOCUS_20170 gene lpd 2925 1504 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPF6 protein_id gnl|my_center|LOCUS_20170 3901 3002 gene locus_tag LOCUS_20180 3901 3002 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225735.1 protein_id gnl|my_center|LOCUS_20180 4587 3937 gene locus_tag LOCUS_20190 4587 3937 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975294.1 protein_id gnl|my_center|LOCUS_20190 5082 4660 gene locus_tag LOCUS_20200 5082 4660 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339046.1 protein_id gnl|my_center|LOCUS_20200 5343 5468 gene locus_tag LOCUS_20210 5343 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6387 5977 gene locus_tag LOCUS_20220 6387 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8343 6706 gene locus_tag LOCUS_20230 8343 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 9739 8795 gene locus_tag LOCUS_20240 9739 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 10909 9779 gene locus_tag LOCUS_20250 10909 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 12497 12282 gene locus_tag LOCUS_20260 12497 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 12382 13590 gene locus_tag LOCUS_20270 12382 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence109 <1 1221 gene locus_tag LOCUS_20280 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:hybrid sensor histidine kinase/response regulator 1983 1693 gene locus_tag LOCUS_20290 1983 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3163 2177 gene locus_tag LOCUS_20300 3163 2177 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_20300 3700 4116 gene locus_tag LOCUS_20310 3700 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 6392 4656 gene locus_tag LOCUS_20320 6392 4656 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700947.1 protein_id gnl|my_center|LOCUS_20320 7238 6813 gene locus_tag LOCUS_20330 7238 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7773 7417 gene locus_tag LOCUS_20340 7773 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 8663 7878 gene locus_tag LOCUS_20350 8663 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 11486 8829 gene locus_tag LOCUS_20360 11486 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12477 11491 gene locus_tag LOCUS_20370 12477 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 <13588 12819 gene locus_tag LOCUS_20380 <13588 12819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530764.1:LysR family transcriptional regulator >Feature sequence110 1337 927 gene locus_tag LOCUS_20390 1337 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1786 2154 gene locus_tag LOCUS_20400 1786 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2244 3785 gene locus_tag LOCUS_20410 2244 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114085.1 protein_id gnl|my_center|LOCUS_20410 5157 3820 gene locus_tag LOCUS_20420 5157 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5869 5363 gene locus_tag LOCUS_20430 5869 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6107 6943 gene locus_tag LOCUS_20440 6107 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 6991 8610 gene locus_tag LOCUS_20450 6991 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8760 10967 gene locus_tag LOCUS_20460 8760 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 11505 11122 gene locus_tag LOCUS_20470 11505 11122 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_20470 11587 12048 gene locus_tag LOCUS_20480 11587 12048 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_20480 12118 12261 gene locus_tag LOCUS_20490 12118 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence111 668 1531 gene locus_tag LOCUS_20500 668 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2840 2049 gene locus_tag LOCUS_20510 2840 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3519 3343 gene locus_tag LOCUS_20520 3519 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3554 5113 gene locus_tag LOCUS_20530 gene gnd 3554 5113 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFR5 protein_id gnl|my_center|LOCUS_20530 5732 5917 gene locus_tag LOCUS_20540 5732 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6126 6797 gene locus_tag LOCUS_20550 6126 6797 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_20550 6864 7367 gene locus_tag LOCUS_20560 6864 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7997 8164 gene locus_tag LOCUS_20570 7997 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 8329 9012 gene locus_tag LOCUS_20580 8329 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 9210 10427 gene locus_tag LOCUS_20590 9210 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 10436 10852 gene locus_tag LOCUS_20600 10436 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 11068 11853 gene locus_tag LOCUS_20610 11068 11853 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence112 1204 473 gene locus_tag LOCUS_20620 gene dapB 1204 473 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ80 protein_id gnl|my_center|LOCUS_20620 1384 1797 gene locus_tag LOCUS_20630 1384 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_20630 2547 1882 gene locus_tag LOCUS_20640 2547 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3333 3740 gene locus_tag LOCUS_20650 3333 3740 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957285.1 protein_id gnl|my_center|LOCUS_20650 3737 4609 gene locus_tag LOCUS_20660 3737 4609 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_20660 4602 5924 gene locus_tag LOCUS_20670 4602 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 8431 6398 gene locus_tag LOCUS_20680 gene rep 8431 6398 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 protein_id gnl|my_center|LOCUS_20680 8900 8646 gene locus_tag LOCUS_20690 gene yoeB 8900 8646 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4V8 protein_id gnl|my_center|LOCUS_20690 9199 8897 gene locus_tag LOCUS_20700 gene yefM 9199 8897 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_20700 10471 9599 gene locus_tag LOCUS_20710 10471 9599 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_20710 11256 10573 gene locus_tag LOCUS_20720 11256 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11906 11268 gene locus_tag LOCUS_20730 11906 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 <13285 12072 gene locus_tag LOCUS_20740 <13285 12072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105075.1:energy-dependent translational throttle protein EttA >Feature sequence113 1014 256 gene locus_tag LOCUS_20750 1014 256 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 protein_id gnl|my_center|LOCUS_20750 2258 1014 gene locus_tag LOCUS_20760 2258 1014 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_20760 2841 2260 gene locus_tag LOCUS_20770 2841 2260 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_20770 3434 3042 gene locus_tag LOCUS_20780 gene rpsI 3434 3042 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_20780 3877 3446 gene locus_tag LOCUS_20790 gene rplM 3877 3446 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_20790 6328 4049 gene locus_tag LOCUS_20800 gene clpA 6328 4049 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_20800 6845 6522 gene locus_tag LOCUS_20810 gene clpS 6845 6522 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_20810 7038 7292 gene locus_tag LOCUS_20820 gene cspD 7038 7292 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_20820 8302 7361 gene locus_tag LOCUS_20830 8302 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20830 9580 8327 gene locus_tag LOCUS_20840 9580 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20840 9744 10403 gene locus_tag LOCUS_20850 gene rluC 9744 10403 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFW2 protein_id gnl|my_center|LOCUS_20850 10618 10412 gene locus_tag LOCUS_20860 gene cspA 10618 10412 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_20860 11600 10773 gene locus_tag LOCUS_20870 11600 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 11703 12596 gene locus_tag LOCUS_20880 11703 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence114 2440 1250 gene locus_tag LOCUS_20890 gene ctrB 2440 1250 CDS product capsule polysaccharide export inner-membrane protein CtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32014 protein_id gnl|my_center|LOCUS_20890 3093 2440 gene locus_tag LOCUS_20900 gene kpsT 3093 2440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323198.1 protein_id gnl|my_center|LOCUS_20900 3916 3107 gene locus_tag LOCUS_20910 gene kpsM 3916 3107 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8G7 protein_id gnl|my_center|LOCUS_20910 4879 4367 gene locus_tag LOCUS_20920 4879 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5973 5032 gene locus_tag LOCUS_20930 5973 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6160 6738 gene locus_tag LOCUS_20940 gene sodB 6160 6738 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6D0 protein_id gnl|my_center|LOCUS_20940 7183 8553 gene locus_tag LOCUS_20950 7183 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 8566 9816 gene locus_tag LOCUS_20960 8566 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 9852 10607 gene locus_tag LOCUS_20970 9852 10607 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813L0 protein_id gnl|my_center|LOCUS_20970 10688 11509 gene locus_tag LOCUS_20980 10688 11509 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_20980 11605 12702 gene locus_tag LOCUS_20990 11605 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence115 78 716 gene locus_tag LOCUS_21000 gene leuD 78 716 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_21000 793 1866 gene locus_tag LOCUS_21010 gene leuB 793 1866 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ4 protein_id gnl|my_center|LOCUS_21010 2014 3123 gene locus_tag LOCUS_21020 gene asd 2014 3123 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30903 protein_id gnl|my_center|LOCUS_21020 4142 3261 gene locus_tag LOCUS_21030 4142 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7204 4970 gene locus_tag LOCUS_21040 gene ladS 7204 4970 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_21040 7342 7806 gene locus_tag LOCUS_21050 7342 7806 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_21050 7851 8267 gene locus_tag LOCUS_21060 7851 8267 CDS product aldoketomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_21060 8607 8401 gene locus_tag LOCUS_21070 8607 8401 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 protein_id gnl|my_center|LOCUS_21070 9238 8771 gene locus_tag LOCUS_21080 gene brf1 9238 8771 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_21080 9498 9968 gene locus_tag LOCUS_21090 gene bfrB 9498 9968 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_21090 10213 10803 gene locus_tag LOCUS_21100 gene hisB 10213 10803 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_21100 10989 11639 gene locus_tag LOCUS_21110 gene hisH1 10989 11639 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_21110 11642 12421 gene locus_tag LOCUS_21120 gene hisF 11642 12421 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_21120 >Feature sequence116 3 2177 gene locus_tag LOCUS_21130 gene amtB 3 2177 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F074 protein_id gnl|my_center|LOCUS_21130 5342 2850 gene locus_tag LOCUS_21140 5342 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 9007 5957 gene locus_tag LOCUS_21150 9007 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 10637 9489 gene locus_tag LOCUS_21160 10637 9489 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_21160 11259 10672 gene locus_tag LOCUS_21170 gene calR 11259 10672 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 protein_id gnl|my_center|LOCUS_21170 12371 11430 gene locus_tag LOCUS_21180 12371 11430 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707318.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence117 300 3032 gene locus_tag LOCUS_21190 300 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3019 4122 gene locus_tag LOCUS_21200 3019 4122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463527.1 protein_id gnl|my_center|LOCUS_21200 4310 6907 gene locus_tag LOCUS_21210 gene hrpB 4310 6907 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262606.1 protein_id gnl|my_center|LOCUS_21210 6979 7185 gene locus_tag LOCUS_21220 6979 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7564 7950 gene locus_tag LOCUS_21230 gene merR 7564 7950 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Q8 protein_id gnl|my_center|LOCUS_21230 8281 8607 gene locus_tag LOCUS_21240 8281 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 8629 8994 gene locus_tag LOCUS_21250 8629 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9486 9160 gene locus_tag LOCUS_21260 9486 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence118 1405 2157 gene locus_tag LOCUS_21270 1405 2157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_21270 2252 4168 gene locus_tag LOCUS_21280 2252 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4740 4561 gene locus_tag LOCUS_21290 4740 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 4892 5347 gene locus_tag LOCUS_21300 4892 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 6424 5537 gene locus_tag LOCUS_21310 6424 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 7025 6747 gene locus_tag LOCUS_21320 7025 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 7793 8368 gene locus_tag LOCUS_21330 7793 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9847 10218 gene locus_tag LOCUS_21340 9847 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 11296 12375 gene locus_tag LOCUS_21350 11296 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence119 611 1582 gene locus_tag LOCUS_21360 611 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2175 1816 gene locus_tag LOCUS_21370 2175 1816 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_21370 3564 2248 gene locus_tag LOCUS_21380 3564 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4852 3557 gene locus_tag LOCUS_21390 4852 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6350 4854 gene locus_tag LOCUS_21400 6350 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 7131 6424 gene locus_tag LOCUS_21410 gene salX 7131 6424 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903135.1 protein_id gnl|my_center|LOCUS_21410 8641 7331 gene locus_tag LOCUS_21420 8641 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 8825 10510 gene locus_tag LOCUS_21430 8825 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 10507 11214 gene locus_tag LOCUS_21440 10507 11214 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 protein_id gnl|my_center|LOCUS_21440 11213 11348 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggtttgttaaattggttt >Feature sequence120 189 1586 gene locus_tag LOCUS_21450 189 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2919 1999 gene locus_tag LOCUS_21460 2919 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3907 5028 gene locus_tag LOCUS_21470 3907 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 6330 5092 gene locus_tag LOCUS_21480 6330 5092 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_21480 7529 8308 gene locus_tag LOCUS_21490 7529 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 8938 10041 gene locus_tag LOCUS_21500 gene purC 8938 10041 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q87 protein_id gnl|my_center|LOCUS_21500 10532 12151 gene locus_tag LOCUS_21510 10532 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence121 1188 727 gene locus_tag LOCUS_21520 1188 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1450 2436 gene locus_tag LOCUS_21530 gene ttcA 1450 2436 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG9 protein_id gnl|my_center|LOCUS_21530 5807 2706 gene locus_tag LOCUS_21540 5807 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 7348 6956 gene locus_tag LOCUS_21550 7348 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 9245 8022 gene locus_tag LOCUS_21560 gene tufA 9245 8022 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_252955.1 protein_id gnl|my_center|LOCUS_21560 11369 9279 gene locus_tag LOCUS_21570 gene fusA 11369 9279 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_21570 11852 11382 gene locus_tag LOCUS_21580 gene rpsG 11852 11382 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD1 protein_id gnl|my_center|LOCUS_21580 12316 11942 gene locus_tag LOCUS_21590 gene rpsL 12316 11942 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7S3 protein_id gnl|my_center|LOCUS_21590 >Feature sequence122 1291 509 gene locus_tag LOCUS_21600 gene dsbC 1291 509 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_21600 2148 1453 gene locus_tag LOCUS_21610 2148 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2335 4023 gene locus_tag LOCUS_21620 2335 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21620 4317 4787 gene locus_tag LOCUS_21630 4317 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 4797 4973 gene locus_tag LOCUS_21640 4797 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 4983 5162 gene locus_tag LOCUS_21650 4983 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5340 6218 gene locus_tag LOCUS_21660 5340 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104419.1 protein_id gnl|my_center|LOCUS_21660 7106 6594 gene locus_tag LOCUS_21670 7106 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 11644 7157 gene locus_tag LOCUS_21680 11644 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 <12786 12122 gene locus_tag LOCUS_21690 <12786 12122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence123 167 1159 gene locus_tag LOCUS_21700 gene ybgK 167 1159 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_21700 1436 2713 gene locus_tag LOCUS_21710 1436 2713 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_21710 2855 3544 gene locus_tag LOCUS_21720 2855 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3625 4029 gene locus_tag LOCUS_21730 3625 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4039 6042 gene locus_tag LOCUS_21740 gene uvrB 4039 6042 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV05 protein_id gnl|my_center|LOCUS_21740 6050 6409 gene locus_tag LOCUS_21750 6050 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 6580 6656 gene locus_tag LOCUS_t00170 6580 6656 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6801 8732 gene locus_tag LOCUS_21760 gene thrS 6801 8732 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP9 protein_id gnl|my_center|LOCUS_21760 8930 9268 gene locus_tag LOCUS_21770 8930 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 9373 9567 gene locus_tag LOCUS_21780 gene rpmI 9373 9567 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER7 protein_id gnl|my_center|LOCUS_21780 9593 9952 gene locus_tag LOCUS_21790 gene rplT 9593 9952 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK7 protein_id gnl|my_center|LOCUS_21790 10081 10560 gene locus_tag LOCUS_21800 10081 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10742 10826 gene locus_tag LOCUS_t00180 10742 10826 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <12775 10939 gene locus_tag LOCUS_21810 <12775 10939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947391.1:penicillin-binding protein 1C >Feature sequence124 2 256 gene locus_tag LOCUS_21820 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 261 1211 gene locus_tag LOCUS_21830 261 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1870 1208 gene locus_tag LOCUS_21840 1870 1208 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43930 protein_id gnl|my_center|LOCUS_21840 4251 2191 gene locus_tag LOCUS_21850 gene fimX 4251 2191 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_21850 6043 4271 gene locus_tag LOCUS_21860 6043 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_21860 7241 6237 gene locus_tag LOCUS_21870 gene epmB 7241 6237 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44641 protein_id gnl|my_center|LOCUS_21870 7277 7846 gene locus_tag LOCUS_21880 gene efp 7277 7846 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_21880 7896 8867 gene locus_tag LOCUS_21890 gene epmA 7896 8867 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIQ4 protein_id gnl|my_center|LOCUS_21890 9045 9692 gene locus_tag LOCUS_21900 9045 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 10503 9685 gene locus_tag LOCUS_21910 gene bamD 10503 9685 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UR5 protein_id gnl|my_center|LOCUS_21910 10575 11540 gene locus_tag LOCUS_21920 gene rluD 10575 11540 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK83 protein_id gnl|my_center|LOCUS_21920 11541 12278 gene locus_tag LOCUS_21930 11541 12278 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DH5 protein_id gnl|my_center|LOCUS_21930 >Feature sequence125 959 414 gene locus_tag LOCUS_21940 959 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2496 1192 gene locus_tag LOCUS_21950 2496 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5310 2506 gene locus_tag LOCUS_21960 5310 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 10582 6221 gene locus_tag LOCUS_21970 10582 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 12354 11671 gene locus_tag LOCUS_21980 12354 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21980 >Feature sequence126 395 135 gene locus_tag LOCUS_21990 395 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD1 protein_id gnl|my_center|LOCUS_21990 516 1379 gene locus_tag LOCUS_22000 516 1379 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_22000 1419 2252 gene locus_tag LOCUS_22010 1419 2252 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_22010 2381 3967 gene locus_tag LOCUS_22020 gene prfC 2381 3967 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43928 protein_id gnl|my_center|LOCUS_22020 3997 4266 gene locus_tag LOCUS_22030 3997 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4355 4792 gene locus_tag LOCUS_22040 4355 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4924 6186 gene locus_tag LOCUS_22050 gene glyA 4924 6186 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E706 protein_id gnl|my_center|LOCUS_22050 6654 9368 gene locus_tag LOCUS_22060 gene gyrA 6654 9368 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLA2 protein_id gnl|my_center|LOCUS_22060 9361 10461 gene locus_tag LOCUS_22070 9361 10461 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_22070 10470 11579 gene locus_tag LOCUS_22080 gene hisC2 10470 11579 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_22080 11579 12478 gene locus_tag LOCUS_22090 11579 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence127 55 807 gene locus_tag LOCUS_22100 55 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22100 1271 1011 gene locus_tag LOCUS_22110 1271 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2228 3295 gene locus_tag LOCUS_22120 2228 3295 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_22120 3314 4336 gene locus_tag LOCUS_22130 3314 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22130 4421 4735 gene locus_tag LOCUS_22140 4421 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22140 4824 4899 gene locus_tag LOCUS_t00190 4824 4899 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4936 5319 gene locus_tag LOCUS_22150 gene secE 4936 5319 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 protein_id gnl|my_center|LOCUS_22150 5329 5862 gene locus_tag LOCUS_22160 gene nusG 5329 5862 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN2 protein_id gnl|my_center|LOCUS_22160 6077 6406 gene locus_tag LOCUS_22170 gene rplK 6077 6406 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22170 6406 7104 gene locus_tag LOCUS_22180 gene rplA 6406 7104 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_22180 7301 7804 gene locus_tag LOCUS_22190 gene rplJ 7301 7804 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KQ2 protein_id gnl|my_center|LOCUS_22190 7877 8242 gene locus_tag LOCUS_22200 gene rplL 7877 8242 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAP4 protein_id gnl|my_center|LOCUS_22200 8409 12491 gene locus_tag LOCUS_22210 gene rpoB 8409 12491 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_22210 >Feature sequence128 1141 2031 gene locus_tag LOCUS_22220 gene rdgC 1141 2031 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW36 protein_id gnl|my_center|LOCUS_22220 2791 2129 gene locus_tag LOCUS_22230 2791 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_22230 3175 2906 gene locus_tag LOCUS_22240 gene sdpR 3175 2906 CDS product transcriptional repressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32242 protein_id gnl|my_center|LOCUS_22240 4082 3528 gene locus_tag LOCUS_22250 4082 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4688 5227 gene locus_tag LOCUS_22260 4688 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 5249 5731 gene locus_tag LOCUS_22270 5249 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5833 6357 gene locus_tag LOCUS_22280 5833 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6671 7552 gene locus_tag LOCUS_22290 6671 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7542 7976 gene locus_tag LOCUS_22300 7542 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 8948 7986 gene locus_tag LOCUS_22310 gene lpxK 8948 7986 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUI0 protein_id gnl|my_center|LOCUS_22310 10677 8953 gene locus_tag LOCUS_22320 gene msbA 10677 8953 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLD6 protein_id gnl|my_center|LOCUS_22320 11096 10677 gene locus_tag LOCUS_22330 11096 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 11711 11100 gene locus_tag LOCUS_22340 11711 11100 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence129 1629 316 gene locus_tag LOCUS_22350 gene rsmB 1629 316 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_22350 2560 1619 gene locus_tag LOCUS_22360 gene fmt 2560 1619 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_22360 3080 2568 gene locus_tag LOCUS_22370 gene def 3080 2568 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_22370 3348 4520 gene locus_tag LOCUS_22380 3348 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_22380 4621 5715 gene locus_tag LOCUS_22390 gene dprA 4621 5715 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 protein_id gnl|my_center|LOCUS_22390 5748 5942 gene locus_tag LOCUS_22400 5748 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5965 6405 gene locus_tag LOCUS_22410 5965 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_22410 6652 7542 gene locus_tag LOCUS_22420 gene htrB 6652 7542 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_22420 7946 10207 gene locus_tag LOCUS_22430 gene nrdA 7946 10207 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKQ5 protein_id gnl|my_center|LOCUS_22430 10384 11514 gene locus_tag LOCUS_22440 gene nrdB 10384 11514 CDS product ribonucleoside-diphosphate reductase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69924 protein_id gnl|my_center|LOCUS_22440 11594 12064 gene locus_tag LOCUS_22450 11594 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence130 1259 657 gene locus_tag LOCUS_22460 1259 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1900 1340 gene locus_tag LOCUS_22470 1900 1340 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_22470 3022 2195 gene locus_tag LOCUS_22480 3022 2195 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 protein_id gnl|my_center|LOCUS_22480 3191 4042 gene locus_tag LOCUS_22490 gene nadC 3191 4042 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_22490 4073 4363 gene locus_tag LOCUS_22500 4073 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4774 4968 gene locus_tag LOCUS_22510 4774 4968 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766274.1 protein_id gnl|my_center|LOCUS_22510 5336 6127 gene locus_tag LOCUS_22520 5336 6127 CDS product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 protein_id gnl|my_center|LOCUS_22520 6761 6249 gene locus_tag LOCUS_22530 6761 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 7222 6773 gene locus_tag LOCUS_22540 7222 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8082 7225 gene locus_tag LOCUS_22550 8082 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 8512 8084 gene locus_tag LOCUS_22560 8512 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 9054 8596 gene locus_tag LOCUS_22570 9054 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 12206 9051 gene locus_tag LOCUS_22580 gene cusA 12206 9051 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence131 1193 210 gene locus_tag LOCUS_22590 1193 210 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_22590 2146 1862 gene locus_tag LOCUS_22600 2146 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3125 2529 gene locus_tag LOCUS_22610 3125 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 3522 3136 gene locus_tag LOCUS_22620 3522 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22620 4879 4034 gene locus_tag LOCUS_22630 4879 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 5418 4882 gene locus_tag LOCUS_22640 5418 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5762 5499 gene locus_tag LOCUS_22650 5762 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6789 6208 gene locus_tag LOCUS_22660 gene nrdG 6789 6208 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0J4 protein_id gnl|my_center|LOCUS_22660 7294 6791 gene locus_tag LOCUS_22670 7294 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 7500 7297 gene locus_tag LOCUS_22680 7500 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9965 7500 gene locus_tag LOCUS_22690 9965 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 11722 9965 gene locus_tag LOCUS_22700 11722 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence132 1837 44 gene locus_tag LOCUS_22710 gene atmA 1837 44 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_22710 2180 1965 gene locus_tag LOCUS_22720 2180 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2351 2830 gene locus_tag LOCUS_22730 2351 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3037 5211 gene locus_tag LOCUS_22740 gene glnN 3037 5211 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_22740 5363 5845 gene locus_tag LOCUS_22750 5363 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22750 5927 6682 gene locus_tag LOCUS_22760 5927 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 7889 6723 gene locus_tag LOCUS_22770 7889 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 8248 7886 gene locus_tag LOCUS_22780 8248 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8304 9158 gene locus_tag LOCUS_22790 gene psd 8304 9158 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_22790 9238 9723 gene locus_tag LOCUS_22800 9238 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 9738 10505 gene locus_tag LOCUS_22810 gene gloB 9738 10505 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHX1 protein_id gnl|my_center|LOCUS_22810 10515 11009 gene locus_tag LOCUS_22820 10515 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 11057 11626 gene locus_tag LOCUS_22830 11057 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence133 524 12 gene locus_tag LOCUS_22840 gene cheW 524 12 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_22840 2616 541 gene locus_tag LOCUS_22850 gene cheA-1 2616 541 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_22850 2923 2621 gene locus_tag LOCUS_22860 2923 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3300 2932 gene locus_tag LOCUS_22870 gene cheY-1 3300 2932 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_22870 4490 3309 gene locus_tag LOCUS_22880 4490 3309 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_22880 5922 5335 gene locus_tag LOCUS_22890 5922 5335 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089436.1 protein_id gnl|my_center|LOCUS_22890 6477 5953 gene locus_tag LOCUS_22900 gene pgpA 6477 5953 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_22900 8330 6921 gene locus_tag LOCUS_22910 gene cpsB 8330 6921 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_22910 9787 8447 gene locus_tag LOCUS_22920 gene algD 9787 8447 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11759 protein_id gnl|my_center|LOCUS_22920 10031 11473 gene locus_tag LOCUS_22930 10031 11473 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence134 2430 133 gene locus_tag LOCUS_22940 2430 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2690 4045 gene locus_tag LOCUS_22950 gene ybhO 2690 4045 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016286.1 protein_id gnl|my_center|LOCUS_22950 4236 5540 gene locus_tag LOCUS_22960 4236 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5747 7003 gene locus_tag LOCUS_22970 5747 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7802 7963 gene locus_tag LOCUS_22980 7802 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 8836 8291 gene locus_tag LOCUS_22990 8836 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 9764 8871 gene locus_tag LOCUS_23000 9764 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 10234 9860 gene locus_tag LOCUS_23010 10234 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 10318 10935 gene locus_tag LOCUS_23020 gene msrA 10318 10935 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D255 protein_id gnl|my_center|LOCUS_23020 10932 11165 gene locus_tag LOCUS_23030 10932 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 11535 11993 gene locus_tag LOCUS_23040 11535 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence135 1431 10 gene locus_tag LOCUS_23050 gene leuC 1431 10 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_23050 1974 2495 gene locus_tag LOCUS_23060 1974 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2529 3044 gene locus_tag LOCUS_23070 2529 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3046 3912 gene locus_tag LOCUS_23080 3046 3912 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038431.1 protein_id gnl|my_center|LOCUS_23080 3946 4956 gene locus_tag LOCUS_23090 3946 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5192 6127 gene locus_tag LOCUS_23100 5192 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6748 6197 gene locus_tag LOCUS_23110 6748 6197 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI2 protein_id gnl|my_center|LOCUS_23110 7350 6757 gene locus_tag LOCUS_23120 7350 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 8069 7530 gene locus_tag LOCUS_23130 8069 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 9254 8451 gene locus_tag LOCUS_23140 gene yeaD 9254 8451 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261570.1 protein_id gnl|my_center|LOCUS_23140 9454 10032 gene locus_tag LOCUS_23150 9454 10032 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_23150 10242 10679 gene locus_tag LOCUS_23160 10242 10679 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence136 233 931 gene locus_tag LOCUS_23170 233 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1045 3669 gene locus_tag LOCUS_23180 1045 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4033 3848 gene locus_tag LOCUS_23190 4033 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4285 5700 gene locus_tag LOCUS_23200 4285 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 5940 8081 gene locus_tag LOCUS_23210 5940 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 9453 8173 gene locus_tag LOCUS_23220 9453 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 11474 9456 gene locus_tag LOCUS_23230 11474 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence137 1463 213 gene locus_tag LOCUS_23240 1463 213 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483518.1 protein_id gnl|my_center|LOCUS_23240 1486 1623 gene locus_tag LOCUS_23250 1486 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2577 2777 gene locus_tag LOCUS_23260 2577 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4224 2854 gene locus_tag LOCUS_23270 4224 2854 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 protein_id gnl|my_center|LOCUS_23270 5537 4224 gene locus_tag LOCUS_23280 5537 4224 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 protein_id gnl|my_center|LOCUS_23280 7272 5824 gene locus_tag LOCUS_23290 gene glgA 7272 5824 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPQ1 protein_id gnl|my_center|LOCUS_23290 8491 7262 gene locus_tag LOCUS_23300 gene glgC1 8491 7262 CDS product glucose-1-phosphate adenylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB5 protein_id gnl|my_center|LOCUS_23300 8742 8915 gene locus_tag LOCUS_23310 8742 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 9072 9722 gene locus_tag LOCUS_23320 gene gacA 9072 9722 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 protein_id gnl|my_center|LOCUS_23320 9736 11565 gene locus_tag LOCUS_23330 gene uvrC 9736 11565 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence138 2295 1495 gene locus_tag LOCUS_23340 2295 1495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039425.1 protein_id gnl|my_center|LOCUS_23340 3205 2297 gene locus_tag LOCUS_23350 3205 2297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067273.1 protein_id gnl|my_center|LOCUS_23350 4188 3205 gene locus_tag LOCUS_23360 4188 3205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 protein_id gnl|my_center|LOCUS_23360 4618 5124 gene locus_tag LOCUS_23370 4618 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5155 5664 gene locus_tag LOCUS_23380 5155 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6425 5886 gene locus_tag LOCUS_23390 6425 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7655 6573 gene locus_tag LOCUS_23400 7655 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 protein_id gnl|my_center|LOCUS_23400 8245 7784 gene locus_tag LOCUS_23410 8245 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 8921 8460 gene locus_tag LOCUS_23420 8921 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 9352 9936 gene locus_tag LOCUS_23430 9352 9936 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT86 protein_id gnl|my_center|LOCUS_23430 9980 10561 gene locus_tag LOCUS_23440 gene rnfB 9980 10561 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_23440 >Feature sequence139 915 469 gene locus_tag LOCUS_23450 915 469 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815875.1 protein_id gnl|my_center|LOCUS_23450 1592 921 gene locus_tag LOCUS_23460 1592 921 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDH4 protein_id gnl|my_center|LOCUS_23460 1727 2911 gene locus_tag LOCUS_23470 gene ackA 1727 2911 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ02 protein_id gnl|my_center|LOCUS_23470 2931 5051 gene locus_tag LOCUS_23480 2931 5051 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN7 protein_id gnl|my_center|LOCUS_23480 5201 5689 gene locus_tag LOCUS_23490 5201 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_23490 5780 6010 gene locus_tag LOCUS_23500 5780 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 6643 7062 gene locus_tag LOCUS_23510 6643 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 7169 7573 gene locus_tag LOCUS_23520 7169 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23520 7563 7754 gene locus_tag LOCUS_23530 7563 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 8022 8522 gene locus_tag LOCUS_23540 8022 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 9833 8745 gene locus_tag LOCUS_23550 gene rsgA 9833 8745 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 protein_id gnl|my_center|LOCUS_23550 10670 9837 gene locus_tag LOCUS_23560 10670 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence140 <1 668 gene locus_tag LOCUS_23570 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093042.1:copper-transporting ATPase 735 1148 gene locus_tag LOCUS_23580 735 1148 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720046.1 protein_id gnl|my_center|LOCUS_23580 1557 2411 gene locus_tag LOCUS_23590 1557 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263894.1 protein_id gnl|my_center|LOCUS_23590 3006 3872 gene locus_tag LOCUS_23600 3006 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4030 5865 gene locus_tag LOCUS_23610 4030 5865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_23610 5862 7643 gene locus_tag LOCUS_23620 5862 7643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_23620 7885 8283 gene locus_tag LOCUS_23630 7885 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 9097 9390 gene locus_tag LOCUS_23640 9097 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence141 1925 441 gene locus_tag LOCUS_23650 gene guaB 1925 441 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_23650 2069 3379 gene locus_tag LOCUS_23660 gene xseA 2069 3379 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW4 protein_id gnl|my_center|LOCUS_23660 3379 4077 gene locus_tag LOCUS_23670 3379 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4503 5150 gene locus_tag LOCUS_23680 4503 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5515 6063 gene locus_tag LOCUS_23690 5515 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 7621 6209 gene locus_tag LOCUS_23700 7621 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 7913 10744 gene locus_tag LOCUS_23710 gene uvrA 7913 10744 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_23710 >Feature sequence142 233 143 gene locus_tag LOCUS_t00200 233 143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 367 1134 gene locus_tag LOCUS_23720 367 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2883 1318 gene locus_tag LOCUS_23730 2883 1318 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD3 protein_id gnl|my_center|LOCUS_23730 2789 3019 gene locus_tag LOCUS_23740 2789 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3091 3675 gene locus_tag LOCUS_23750 gene rpoE 3091 3675 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF4 protein_id gnl|my_center|LOCUS_23750 3686 4249 gene locus_tag LOCUS_23760 3686 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4254 5225 gene locus_tag LOCUS_23770 4254 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5239 5691 gene locus_tag LOCUS_23780 gene rseC 5239 5691 CDS product SoxR reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172756.1 protein_id gnl|my_center|LOCUS_23780 6507 5749 gene locus_tag LOCUS_23790 gene rlmB 6507 5749 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_23790 6613 6924 gene locus_tag LOCUS_23800 6613 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 7456 6929 gene locus_tag LOCUS_23810 7456 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 7560 8810 gene locus_tag LOCUS_23820 7560 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_23820 8800 9489 gene locus_tag LOCUS_23830 gene lolD 8800 9489 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_23830 11113 9692 gene locus_tag LOCUS_23840 gene gltD 11113 9692 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence143 1312 611 gene locus_tag LOCUS_23850 1312 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 protein_id gnl|my_center|LOCUS_23850 1518 1309 gene locus_tag LOCUS_23860 1518 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 protein_id gnl|my_center|LOCUS_23860 4265 1590 gene locus_tag LOCUS_23870 4265 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4781 5773 gene locus_tag LOCUS_23880 gene rluC 4781 5773 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_23880 5783 6790 gene locus_tag LOCUS_23890 5783 6790 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_23890 7578 6808 gene locus_tag LOCUS_23900 7578 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 7902 10526 gene locus_tag LOCUS_23910 gene topA 7902 10526 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA3 protein_id gnl|my_center|LOCUS_23910 11596 10694 gene locus_tag LOCUS_23920 11596 10694 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence144 1072 194 gene locus_tag LOCUS_23930 gene rpsB 1072 194 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_23930 1595 2806 gene locus_tag LOCUS_23940 1595 2806 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266487.1 protein_id gnl|my_center|LOCUS_23940 2808 4694 gene locus_tag LOCUS_23950 gene rnb 2808 4694 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED8 protein_id gnl|my_center|LOCUS_23950 4684 5520 gene locus_tag LOCUS_23960 4684 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 7439 5577 gene locus_tag LOCUS_23970 7439 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 8372 7521 gene locus_tag LOCUS_23980 8372 7521 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_23980 9379 8375 gene locus_tag LOCUS_23990 9379 8375 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748814.1 protein_id gnl|my_center|LOCUS_23990 10704 9475 gene locus_tag LOCUS_24000 10704 9475 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence145 2665 776 gene locus_tag LOCUS_24010 2665 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 3833 2640 gene locus_tag LOCUS_24020 3833 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4791 5984 gene locus_tag LOCUS_24030 4791 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 6441 7685 gene locus_tag LOCUS_24040 6441 7685 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 protein_id gnl|my_center|LOCUS_24040 8468 8061 gene locus_tag LOCUS_24050 gene dksA 8468 8061 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBV2 protein_id gnl|my_center|LOCUS_24050 8689 9543 gene locus_tag LOCUS_24060 gene purU1 8689 9543 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_24060 >Feature sequence146 <1 975 gene locus_tag LOCUS_24070 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0E6:putative malate:quinone oxidoreductase 1900 1265 gene locus_tag LOCUS_24080 gene nth 1900 1265 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW8 protein_id gnl|my_center|LOCUS_24080 2150 2452 gene locus_tag LOCUS_24090 gene ihfA 2150 2452 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG1 protein_id gnl|my_center|LOCUS_24090 2430 2801 gene locus_tag LOCUS_24100 2430 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_24100 2856 3722 gene locus_tag LOCUS_24110 2856 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064131.1 protein_id gnl|my_center|LOCUS_24110 4104 3781 gene locus_tag LOCUS_24120 4104 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4456 4659 gene locus_tag LOCUS_24130 4456 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4869 6983 gene locus_tag LOCUS_24140 4869 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 6993 8027 gene locus_tag LOCUS_24150 6993 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 8024 8812 gene locus_tag LOCUS_24160 8024 8812 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_24160 10005 9388 gene locus_tag LOCUS_24170 10005 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 10202 10609 gene locus_tag LOCUS_24180 gene ndk 10202 10609 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_24180 11332 10637 gene locus_tag LOCUS_24190 gene yfiP 11332 10637 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262001.1 protein_id gnl|my_center|LOCUS_24190 11513 11438 gene locus_tag LOCUS_t00210 11513 11438 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence147 1646 378 gene locus_tag LOCUS_24200 1646 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2299 1637 gene locus_tag LOCUS_24210 2299 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2734 2318 gene locus_tag LOCUS_24220 2734 2318 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_24220 3254 2736 gene locus_tag LOCUS_24230 3254 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263090.1 protein_id gnl|my_center|LOCUS_24230 4651 3251 gene locus_tag LOCUS_24240 4651 3251 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_24240 5490 4648 gene locus_tag LOCUS_24250 5490 4648 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707900.1 protein_id gnl|my_center|LOCUS_24250 7796 5505 gene locus_tag LOCUS_24260 7796 5505 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_24260 7861 8181 gene locus_tag LOCUS_24270 7861 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 10297 8303 gene locus_tag LOCUS_24280 10297 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 11160 10303 gene locus_tag LOCUS_24290 11160 10303 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_24290 >Feature sequence148 372 2417 gene locus_tag LOCUS_24300 gene fadH 372 2417 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 protein_id gnl|my_center|LOCUS_24300 2875 3762 gene locus_tag LOCUS_24310 2875 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 5949 3811 gene locus_tag LOCUS_24320 gene uvrD 5949 3811 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_24320 6480 8684 gene locus_tag LOCUS_24330 6480 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 8681 9451 gene locus_tag LOCUS_24340 8681 9451 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057385.1 protein_id gnl|my_center|LOCUS_24340 9453 10226 gene locus_tag LOCUS_24350 9453 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence149 134 481 gene locus_tag LOCUS_24360 134 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 481 1356 gene locus_tag LOCUS_24370 481 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24370 1454 1903 gene locus_tag LOCUS_24380 1454 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3580 2165 gene locus_tag LOCUS_24390 gene mltF 3580 2165 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_24390 4304 4231 gene locus_tag LOCUS_t00220 4304 4231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4597 5103 gene locus_tag LOCUS_24400 4597 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 5094 5558 gene locus_tag LOCUS_24410 5094 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5558 6640 gene locus_tag LOCUS_24420 5558 6640 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_24420 6640 7290 gene locus_tag LOCUS_24430 6640 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 7468 7543 gene locus_tag LOCUS_t00230 7468 7543 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7811 7978 gene locus_tag LOCUS_24440 7811 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8115 7927 gene locus_tag LOCUS_24450 8115 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8171 9628 gene locus_tag LOCUS_24460 8171 9628 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 protein_id gnl|my_center|LOCUS_24460 9709 10722 gene locus_tag LOCUS_24470 9709 10722 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence150 <1 2531 gene locus_tag LOCUS_24480 <1 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459255.1:ATPase 3255 3722 gene locus_tag LOCUS_24490 3255 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 4489 5763 gene locus_tag LOCUS_24500 4489 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5894 6409 gene locus_tag LOCUS_24510 5894 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6991 9360 gene locus_tag LOCUS_24520 6991 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 9677 9913 gene locus_tag LOCUS_24530 9677 9913 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UE9 protein_id gnl|my_center|LOCUS_24530 9910 10296 gene locus_tag LOCUS_24540 9910 10296 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_24540 10656 10958 gene locus_tag LOCUS_24550 10656 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11060 11136 gene locus_tag LOCUS_t00240 11060 11136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11156 11230 gene locus_tag LOCUS_t00250 11156 11230 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence151 29 2803 gene locus_tag LOCUS_24560 29 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2876 3166 gene locus_tag LOCUS_24570 2876 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3311 3781 gene locus_tag LOCUS_24580 3311 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5930 3870 gene locus_tag LOCUS_24590 gene metG 5930 3870 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN0 protein_id gnl|my_center|LOCUS_24590 6120 6872 gene locus_tag LOCUS_24600 6120 6872 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267476.1 protein_id gnl|my_center|LOCUS_24600 6869 7792 gene locus_tag LOCUS_24610 gene etfA 6869 7792 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_24610 8279 7866 gene locus_tag LOCUS_24620 8279 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 8779 9225 gene locus_tag LOCUS_24630 8779 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9280 10995 gene locus_tag LOCUS_24640 gene fliF 9280 10995 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51463 protein_id gnl|my_center|LOCUS_24640 >Feature sequence152 4362 1159 gene locus_tag LOCUS_24650 4362 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4824 5129 gene locus_tag LOCUS_24660 4824 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 5134 5562 gene locus_tag LOCUS_24670 5134 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_24670 5563 6024 gene locus_tag LOCUS_24680 5563 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 6457 6125 gene locus_tag LOCUS_24690 6457 6125 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383176.1 protein_id gnl|my_center|LOCUS_24690 8298 6619 gene locus_tag LOCUS_24700 8298 6619 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_24700 8706 9590 gene locus_tag LOCUS_24710 8706 9590 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_24710 9599 10027 gene locus_tag LOCUS_24720 9599 10027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_24720 10201 10647 gene locus_tag LOCUS_24730 10201 10647 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_24730 11038 10745 gene locus_tag LOCUS_24740 11038 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence153 725 1147 gene locus_tag LOCUS_24750 725 1147 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_24750 2042 1275 gene locus_tag LOCUS_24760 gene thiD 2042 1275 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_24760 2229 2837 gene locus_tag LOCUS_24770 gene gmk 2229 2837 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_24770 3604 2915 gene locus_tag LOCUS_24780 gene motB2 3604 2915 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263084.1 protein_id gnl|my_center|LOCUS_24780 4410 3613 gene locus_tag LOCUS_24790 gene motA2 4410 3613 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263083.1 protein_id gnl|my_center|LOCUS_24790 6357 4438 gene locus_tag LOCUS_24800 6357 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263082.1 protein_id gnl|my_center|LOCUS_24800 7060 6359 gene locus_tag LOCUS_24810 7060 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 8013 7057 gene locus_tag LOCUS_24820 8013 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 9110 8652 gene locus_tag LOCUS_24830 9110 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 10157 9495 gene locus_tag LOCUS_24840 10157 9495 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097904.1 protein_id gnl|my_center|LOCUS_24840 10278 10150 gene locus_tag LOCUS_24850 10278 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 <11262 10271 gene locus_tag LOCUS_24860 <11262 10271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005162191.1:two-component sensor histidine kinase >Feature sequence154 1300 335 gene locus_tag LOCUS_24870 1300 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2132 2482 gene locus_tag LOCUS_24880 2132 2482 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_24880 2732 6019 gene locus_tag LOCUS_24890 2732 6019 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_24890 6022 6681 gene locus_tag LOCUS_24900 6022 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6790 8667 gene locus_tag LOCUS_24910 6790 8667 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202281.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence155 <1 652 gene locus_tag LOCUS_24920 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969623.1:adenylate cyclase 870 1577 gene locus_tag LOCUS_24930 gene ate 870 1577 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_24930 2239 1646 gene locus_tag LOCUS_24940 2239 1646 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_24940 2739 2239 gene locus_tag LOCUS_24950 2739 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2858 3847 gene locus_tag LOCUS_24960 2858 3847 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_24960 5047 4721 gene locus_tag LOCUS_24970 5047 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5994 5314 gene locus_tag LOCUS_24980 5994 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 7496 6111 gene locus_tag LOCUS_24990 gene mnmE 7496 6111 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z9 protein_id gnl|my_center|LOCUS_24990 9411 7639 gene locus_tag LOCUS_25000 gene yidC 9411 7639 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_25000 9869 9492 gene locus_tag LOCUS_25010 gene rnpA 9869 9492 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY2 protein_id gnl|my_center|LOCUS_25010 >Feature sequence156 1010 210 gene locus_tag LOCUS_25020 1010 210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_25020 1409 2347 gene locus_tag LOCUS_25030 1409 2347 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383432.1 protein_id gnl|my_center|LOCUS_25030 3548 2793 gene locus_tag LOCUS_25040 gene algR 3548 2793 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_25040 4573 3575 gene locus_tag LOCUS_25050 4573 3575 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_25050 5652 4801 gene locus_tag LOCUS_25060 5652 4801 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775663.1 protein_id gnl|my_center|LOCUS_25060 7681 6092 gene locus_tag LOCUS_25070 7681 6092 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_25070 9139 7871 gene locus_tag LOCUS_25080 9139 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 10005 10916 gene locus_tag LOCUS_25090 10005 10916 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence157 2853 2203 gene locus_tag LOCUS_25100 2853 2203 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_25100 3921 2965 gene locus_tag LOCUS_25110 3921 2965 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_25110 4827 4096 gene locus_tag LOCUS_25120 4827 4096 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524793.1 protein_id gnl|my_center|LOCUS_25120 4951 6303 gene locus_tag LOCUS_25130 4951 6303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_25130 6979 8934 gene locus_tag LOCUS_25140 6979 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9166 10014 gene locus_tag LOCUS_25150 9166 10014 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_25150 10042 10629 gene locus_tag LOCUS_25160 10042 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708318.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence158 773 333 gene locus_tag LOCUS_25170 773 333 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_25170 1823 978 gene locus_tag LOCUS_25180 1823 978 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727S2 protein_id gnl|my_center|LOCUS_25180 2028 2813 gene locus_tag LOCUS_25190 2028 2813 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 protein_id gnl|my_center|LOCUS_25190 3468 2788 gene locus_tag LOCUS_25200 3468 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 4011 3550 gene locus_tag LOCUS_25210 4011 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 4720 4088 gene locus_tag LOCUS_25220 4720 4088 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_25220 5020 4823 gene locus_tag LOCUS_25230 5020 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5760 6365 gene locus_tag LOCUS_25240 gene ribA 5760 6365 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSJ3 protein_id gnl|my_center|LOCUS_25240 6367 7377 gene locus_tag LOCUS_25250 6367 7377 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_25250 7488 8213 gene locus_tag LOCUS_25260 gene cmoA 7488 8213 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_25260 8210 9205 gene locus_tag LOCUS_25270 gene cmoB 8210 9205 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF5 protein_id gnl|my_center|LOCUS_25270 9198 9971 gene locus_tag LOCUS_25280 9198 9971 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_25280 10010 10417 gene locus_tag LOCUS_25290 10010 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence159 3055 1262 gene locus_tag LOCUS_25300 3055 1262 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_25300 3341 3099 gene locus_tag LOCUS_25310 3341 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3593 5143 gene locus_tag LOCUS_25320 gene leuA 3593 5143 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_25320 5171 5908 gene locus_tag LOCUS_25330 5171 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5890 6327 gene locus_tag LOCUS_25340 5890 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 6859 6548 gene locus_tag LOCUS_25350 6859 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 7377 6850 gene locus_tag LOCUS_25360 7377 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583048.1 protein_id gnl|my_center|LOCUS_25360 8099 7374 gene locus_tag LOCUS_25370 8099 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 8872 8102 gene locus_tag LOCUS_25380 8872 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 9277 8978 gene locus_tag LOCUS_25390 9277 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 10017 9274 gene locus_tag LOCUS_25400 gene cobS 10017 9274 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q45 protein_id gnl|my_center|LOCUS_25400 10122 10682 gene locus_tag LOCUS_25410 10122 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764901.1 protein_id gnl|my_center|LOCUS_25410 11083 10724 gene locus_tag LOCUS_25420 11083 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence160 440 171 gene locus_tag LOCUS_25430 gene rpsT 440 171 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_25430 608 2152 gene locus_tag LOCUS_25440 gene murJ 608 2152 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_25440 2195 3127 gene locus_tag LOCUS_25450 gene ribF 2195 3127 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44957 protein_id gnl|my_center|LOCUS_25450 3131 5941 gene locus_tag LOCUS_25460 gene ileS 3131 5941 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_25460 6192 6617 gene locus_tag LOCUS_25470 6192 6617 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_25470 6617 7570 gene locus_tag LOCUS_25480 gene ispH 6617 7570 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_25480 7570 8055 gene locus_tag LOCUS_25490 7570 8055 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_25490 8370 8798 gene locus_tag LOCUS_25500 8370 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 9079 9618 gene locus_tag LOCUS_25510 9079 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706014.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence161 <1 644 gene locus_tag LOCUS_25520 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974621.1:transposase 952 1167 gene locus_tag LOCUS_25530 952 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1338 2108 gene locus_tag LOCUS_25540 1338 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2741 2292 gene locus_tag LOCUS_25550 2741 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3905 3192 gene locus_tag LOCUS_25560 3905 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 7171 4919 gene locus_tag LOCUS_25570 7171 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 7913 7320 gene locus_tag LOCUS_25580 7913 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 8126 8620 gene locus_tag LOCUS_25590 8126 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 9868 8831 gene locus_tag LOCUS_25600 9868 8831 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_25600 10288 10103 gene locus_tag LOCUS_25610 10288 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence162 830 1396 gene locus_tag LOCUS_25620 830 1396 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_25620 2216 1641 gene locus_tag LOCUS_25630 2216 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462950.1 protein_id gnl|my_center|LOCUS_25630 5910 2302 gene locus_tag LOCUS_25640 5910 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 8656 7145 gene locus_tag LOCUS_25650 gene lnt 8656 7145 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_25650 8829 10739 gene locus_tag LOCUS_25660 8829 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence163 7278 3934 gene locus_tag LOCUS_25670 7278 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 7756 9075 gene locus_tag LOCUS_25680 7756 9075 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_25680 9150 9887 gene locus_tag LOCUS_25690 gene ubiG 9150 9887 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RZ8 protein_id gnl|my_center|LOCUS_25690 9893 10684 gene locus_tag LOCUS_25700 9893 10684 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence164 3208 1151 gene locus_tag LOCUS_25710 gene flhA 3208 1151 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_25710 3120 3344 gene locus_tag LOCUS_25720 3120 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 7098 3496 gene locus_tag LOCUS_25730 7098 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 8158 7379 gene locus_tag LOCUS_25740 8158 7379 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_25740 9309 8689 gene locus_tag LOCUS_25750 9309 8689 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980794.1 protein_id gnl|my_center|LOCUS_25750 9671 9306 gene locus_tag LOCUS_25760 9671 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 10130 9678 gene locus_tag LOCUS_25770 10130 9678 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW57 protein_id gnl|my_center|LOCUS_25770 10520 10194 gene locus_tag LOCUS_25780 10520 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence165 1012 821 gene locus_tag LOCUS_25790 1012 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1442 1038 gene locus_tag LOCUS_25800 1442 1038 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200966.1 protein_id gnl|my_center|LOCUS_25800 2338 1451 gene locus_tag LOCUS_25810 2338 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4461 2350 gene locus_tag LOCUS_25820 4461 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886324.1 protein_id gnl|my_center|LOCUS_25820 5405 4464 gene locus_tag LOCUS_25830 5405 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 6779 5415 gene locus_tag LOCUS_25840 6779 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 9928 6875 gene locus_tag LOCUS_25850 9928 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence166 2574 1132 gene locus_tag LOCUS_25860 2574 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6281 2853 gene locus_tag LOCUS_25870 6281 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6919 6692 gene locus_tag LOCUS_25880 6919 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25880 7814 7014 gene locus_tag LOCUS_25890 7814 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25890 8957 8214 gene locus_tag LOCUS_25900 8957 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 9475 9200 gene locus_tag LOCUS_25910 9475 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 9602 10534 gene locus_tag LOCUS_25920 gene dusA 9602 10534 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 protein_id gnl|my_center|LOCUS_25920 >Feature sequence167 3236 1533 gene locus_tag LOCUS_25930 3236 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5261 3624 gene locus_tag LOCUS_25940 5261 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_25940 8374 5336 gene locus_tag LOCUS_25950 8374 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 <10631 9361 gene locus_tag LOCUS_25960 <10631 9361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein >Feature sequence168 209 367 gene locus_tag LOCUS_25970 209 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1139 561 gene locus_tag LOCUS_25980 1139 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1641 1132 gene locus_tag LOCUS_25990 1641 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2614 1706 gene locus_tag LOCUS_26000 2614 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2889 3248 gene locus_tag LOCUS_26010 2889 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 5184 3598 gene locus_tag LOCUS_26020 5184 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 6270 5278 gene locus_tag LOCUS_26030 6270 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6398 6727 gene locus_tag LOCUS_26040 6398 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7060 9438 gene locus_tag LOCUS_26050 7060 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 10409 9495 gene locus_tag LOCUS_26060 10409 9495 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence169 755 213 gene locus_tag LOCUS_26070 gene hutZ 755 213 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 protein_id gnl|my_center|LOCUS_26070 1480 1049 gene locus_tag LOCUS_26080 1480 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 4275 1687 gene locus_tag LOCUS_26090 4275 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 4523 4759 gene locus_tag LOCUS_26100 4523 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 5860 5342 gene locus_tag LOCUS_26110 5860 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 7010 5850 gene locus_tag LOCUS_26120 7010 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 10090 7388 gene locus_tag LOCUS_26130 10090 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence170 1022 4780 gene locus_tag LOCUS_26140 1022 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 4806 6107 gene locus_tag LOCUS_26150 4806 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 6491 10048 gene locus_tag LOCUS_26160 6491 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence171 936 406 gene locus_tag LOCUS_26170 936 406 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_26170 1202 933 gene locus_tag LOCUS_26180 1202 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232878.2 protein_id gnl|my_center|LOCUS_26180 4227 2785 gene locus_tag LOCUS_26190 4227 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 4868 4701 gene locus_tag LOCUS_26200 4868 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5123 4872 gene locus_tag LOCUS_26210 5123 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 6414 5383 gene locus_tag LOCUS_26220 gene yesN 6414 5383 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_26220 6622 7296 gene locus_tag LOCUS_26230 6622 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence172 3 1202 gene locus_tag LOCUS_26240 3 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_26240 1418 2242 gene locus_tag LOCUS_26250 1418 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2294 2653 gene locus_tag LOCUS_26260 2294 2653 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_26260 4128 2824 gene locus_tag LOCUS_26270 4128 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4229 4459 gene locus_tag LOCUS_26280 4229 4459 CDS product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 protein_id gnl|my_center|LOCUS_26280 4452 5546 gene locus_tag LOCUS_26290 4452 5546 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_26290 6360 5851 gene locus_tag LOCUS_26300 gene bcp 6360 5851 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_26300 6598 7473 gene locus_tag LOCUS_26310 gene dapA 6598 7473 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y56 protein_id gnl|my_center|LOCUS_26310 7473 8072 gene locus_tag LOCUS_26320 7473 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 8069 8830 gene locus_tag LOCUS_26330 8069 8830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_26330 9086 9898 gene locus_tag LOCUS_26340 9086 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence173 <1 769 gene locus_tag LOCUS_26350 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29248:RNA polymerase sigma factor FliA 965 1357 gene locus_tag LOCUS_26360 gene cheY 965 1357 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_26360 1344 2156 gene locus_tag LOCUS_26370 1344 2156 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_26370 2168 4378 gene locus_tag LOCUS_26380 2168 4378 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_26380 4433 5500 gene locus_tag LOCUS_26390 gene cheB1 4433 5500 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_26390 5500 6207 gene locus_tag LOCUS_26400 5500 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 6290 7075 gene locus_tag LOCUS_26410 6290 7075 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766970.1 protein_id gnl|my_center|LOCUS_26410 7065 7388 gene locus_tag LOCUS_26420 7065 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 7381 8397 gene locus_tag LOCUS_26430 7381 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 8430 8909 gene locus_tag LOCUS_26440 gene cheW-2 8430 8909 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_26440 9019 9480 gene locus_tag LOCUS_26450 9019 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 9565 10311 gene locus_tag LOCUS_26460 9565 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence174 3006 1738 gene locus_tag LOCUS_26470 3006 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118920.1 protein_id gnl|my_center|LOCUS_26470 3369 4232 gene locus_tag LOCUS_26480 3369 4232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_26480 6261 4501 gene locus_tag LOCUS_26490 6261 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_26490 6957 6496 gene locus_tag LOCUS_26500 6957 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7535 7275 gene locus_tag LOCUS_26510 7535 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 8034 7723 gene locus_tag LOCUS_26520 8034 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 8640 8179 gene locus_tag LOCUS_26530 8640 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 9059 8748 gene locus_tag LOCUS_26540 9059 8748 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204343.1 protein_id gnl|my_center|LOCUS_26540 9668 9222 gene locus_tag LOCUS_26550 9668 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 10190 9822 gene locus_tag LOCUS_26560 10190 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence175 2239 944 gene locus_tag LOCUS_26570 2239 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2208 2483 gene locus_tag LOCUS_26580 2208 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4873 2567 gene locus_tag LOCUS_26590 4873 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 5994 5263 gene locus_tag LOCUS_26600 gene suhB 5994 5263 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_26600 6142 6864 gene locus_tag LOCUS_26610 gene trmJ 6142 6864 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S30 protein_id gnl|my_center|LOCUS_26610 6888 7691 gene locus_tag LOCUS_26620 6888 7691 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266905.1 protein_id gnl|my_center|LOCUS_26620 7954 8400 gene locus_tag LOCUS_26630 7954 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 8641 8964 gene locus_tag LOCUS_26640 8641 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 8951 9508 gene locus_tag LOCUS_26650 8951 9508 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249869.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence176 309 911 gene locus_tag LOCUS_26660 309 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 913 2559 gene locus_tag LOCUS_26670 913 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2610 3995 gene locus_tag LOCUS_26680 gene cysG 2610 3995 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_26680 4469 4756 gene locus_tag LOCUS_26690 4469 4756 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_26690 6396 5185 gene locus_tag LOCUS_26700 6396 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 6902 6399 gene locus_tag LOCUS_26710 gene moaC 6902 6399 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_26710 7944 7045 gene locus_tag LOCUS_26720 7944 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113045.1 protein_id gnl|my_center|LOCUS_26720 8371 7946 gene locus_tag LOCUS_26730 gene gloA 8371 7946 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707961.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence177 375 1253 gene locus_tag LOCUS_26740 375 1253 CDS product alkylphosphonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477713.1 protein_id gnl|my_center|LOCUS_26740 1263 3989 gene locus_tag LOCUS_26750 1263 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 4634 5245 gene locus_tag LOCUS_26760 4634 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 5661 5242 gene locus_tag LOCUS_26770 5661 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 6782 6495 gene locus_tag LOCUS_26780 6782 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142361.1 protein_id gnl|my_center|LOCUS_26780 7149 7631 gene locus_tag LOCUS_26790 7149 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 8518 7715 gene locus_tag LOCUS_26800 8518 7715 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219484.1 protein_id gnl|my_center|LOCUS_26800 9102 9503 gene locus_tag LOCUS_26810 9102 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 9507 9821 gene locus_tag LOCUS_26820 9507 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence178 608 423 gene locus_tag LOCUS_26830 608 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 1125 595 gene locus_tag LOCUS_26840 1125 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1561 1127 gene locus_tag LOCUS_26850 1561 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2161 2919 gene locus_tag LOCUS_26860 2161 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4714 3209 gene locus_tag LOCUS_26870 4714 3209 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_26870 6640 4949 gene locus_tag LOCUS_26880 6640 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_26880 7962 7444 gene locus_tag LOCUS_26890 7962 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 8647 7964 gene locus_tag LOCUS_26900 8647 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_26900 <9874 8659 gene locus_tag LOCUS_26910 <9874 8659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268339.1:ABC transporter ATP-binding protein >Feature sequence179 349 1767 gene locus_tag LOCUS_26920 349 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3070 1976 gene locus_tag LOCUS_26930 3070 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3235 3696 gene locus_tag LOCUS_26940 3235 3696 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_26940 3683 4792 gene locus_tag LOCUS_26950 gene mnmA 3683 4792 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_26950 4896 5498 gene locus_tag LOCUS_26960 gene hflD 4896 5498 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR5 protein_id gnl|my_center|LOCUS_26960 6436 5534 gene locus_tag LOCUS_26970 6436 5534 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_26970 6688 7143 gene locus_tag LOCUS_26980 6688 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_26980 7390 9594 gene locus_tag LOCUS_26990 7390 9594 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence180 986 546 gene locus_tag LOCUS_27000 986 546 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR0 protein_id gnl|my_center|LOCUS_27000 1387 989 gene locus_tag LOCUS_27010 1387 989 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQQ9 protein_id gnl|my_center|LOCUS_27010 1633 2757 gene locus_tag LOCUS_27020 1633 2757 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_27020 4058 2853 gene locus_tag LOCUS_27030 4058 2853 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_27030 5297 4089 gene locus_tag LOCUS_27040 gene ubiH 5297 4089 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_27040 5600 6103 gene locus_tag LOCUS_27050 5600 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 6243 6899 gene locus_tag LOCUS_27060 6243 6899 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 protein_id gnl|my_center|LOCUS_27060 6993 7466 gene locus_tag LOCUS_27070 6993 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 7656 8297 gene locus_tag LOCUS_27080 7656 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence181 1603 1250 gene locus_tag LOCUS_27090 1603 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_27090 3323 1596 gene locus_tag LOCUS_27100 3323 1596 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_27100 3647 3342 gene locus_tag LOCUS_27110 3647 3342 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_27110 4802 3756 gene locus_tag LOCUS_27120 gene cheB 4802 3756 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH42 protein_id gnl|my_center|LOCUS_27120 5459 4812 gene locus_tag LOCUS_27130 gene cheD1 5459 4812 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_27130 5816 5658 gene locus_tag LOCUS_27140 5816 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6743 5925 gene locus_tag LOCUS_27150 gene cheR 6743 5925 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133931.1 protein_id gnl|my_center|LOCUS_27150 <9679 6829 gene locus_tag LOCUS_27160 <9679 6829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000488898.1:methyl-accepting chemotaxis protein >Feature sequence182 1746 499 gene locus_tag LOCUS_27170 1746 499 CDS product heme transporter CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_27170 2218 1778 gene locus_tag LOCUS_27180 2218 1778 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 protein_id gnl|my_center|LOCUS_27180 2416 3192 gene locus_tag LOCUS_27190 2416 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3348 4136 gene locus_tag LOCUS_27200 gene cbiF 3348 4136 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 protein_id gnl|my_center|LOCUS_27200 4221 5288 gene locus_tag LOCUS_27210 4221 5288 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192861.1 protein_id gnl|my_center|LOCUS_27210 7002 5620 gene locus_tag LOCUS_27220 7002 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8099 7293 gene locus_tag LOCUS_27230 gene bax 8099 7293 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_27230 9237 8563 gene locus_tag LOCUS_27240 9237 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence183 1088 465 gene locus_tag LOCUS_27250 1088 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3207 1618 gene locus_tag LOCUS_27260 gene cysNC 3207 1618 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_27260 4116 3208 gene locus_tag LOCUS_27270 gene cysD 4116 3208 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_27270 8439 4303 gene locus_tag LOCUS_27280 8439 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 <9602 8843 gene locus_tag LOCUS_27290 <9602 8843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7J5:endoglucanase >Feature sequence184 4085 1950 gene locus_tag LOCUS_27300 4085 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4592 4095 gene locus_tag LOCUS_27310 4592 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5157 6056 gene locus_tag LOCUS_27320 gene ansA 5157 6056 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166135.1 protein_id gnl|my_center|LOCUS_27320 6895 6155 gene locus_tag LOCUS_27330 6895 6155 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC3 protein_id gnl|my_center|LOCUS_27330 7973 6951 gene locus_tag LOCUS_27340 gene murB 7973 6951 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGJ6 protein_id gnl|my_center|LOCUS_27340 8425 7970 gene locus_tag LOCUS_27350 gene ptpA 8425 7970 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_27350 9199 8435 gene locus_tag LOCUS_27360 gene kdsB 9199 8435 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_27360 >Feature sequence185 <1 1669 gene locus_tag LOCUS_27370 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:cell surface protein 1938 1741 gene locus_tag LOCUS_27380 1938 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27380 2374 2012 gene locus_tag LOCUS_27390 2374 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 2838 3425 gene locus_tag LOCUS_27400 gene nfuA 2838 3425 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_27400 >Feature sequence186 2149 770 gene locus_tag LOCUS_27410 gene ffh 2149 770 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS7 protein_id gnl|my_center|LOCUS_27410 3520 2585 gene locus_tag LOCUS_27420 3520 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 4548 3517 gene locus_tag LOCUS_27430 4548 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 6829 4838 gene locus_tag LOCUS_27440 6829 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7677 7375 gene locus_tag LOCUS_27450 gene bolA 7677 7375 CDS product DNA-binding transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPS0 protein_id gnl|my_center|LOCUS_27450 9318 7822 gene locus_tag LOCUS_27460 9318 7822 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence187 <1 3347 gene locus_tag LOCUS_27470 <1 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs 4011 5192 gene locus_tag LOCUS_27480 4011 5192 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866466.1 protein_id gnl|my_center|LOCUS_27480 5898 5467 gene locus_tag LOCUS_27490 5898 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 6028 6516 gene locus_tag LOCUS_27500 6028 6516 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640378.1 protein_id gnl|my_center|LOCUS_27500 6633 7007 gene locus_tag LOCUS_27510 6633 7007 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929671.1 protein_id gnl|my_center|LOCUS_27510 7812 7192 gene locus_tag LOCUS_27520 7812 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 8359 8159 gene locus_tag LOCUS_27530 8359 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 <9327 8361 gene locus_tag LOCUS_27540 <9327 8361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q00934:type 4 fimbriae expression regulatory protein PilR >Feature sequence188 1328 612 gene locus_tag LOCUS_27550 1328 612 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_27550 1417 2553 gene locus_tag LOCUS_27560 1417 2553 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_27560 3755 2622 gene locus_tag LOCUS_27570 gene flhB 3755 2622 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420337.1 protein_id gnl|my_center|LOCUS_27570 4546 3764 gene locus_tag LOCUS_27580 gene fliR 4546 3764 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W2 protein_id gnl|my_center|LOCUS_27580 4825 4556 gene locus_tag LOCUS_27590 gene fliQ 4825 4556 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_27590 5715 4936 gene locus_tag LOCUS_27600 gene fliP 5715 4936 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_27600 6100 5690 gene locus_tag LOCUS_27610 6100 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 6640 6146 gene locus_tag LOCUS_27620 gene fliN 6640 6146 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI11 protein_id gnl|my_center|LOCUS_27620 7685 6633 gene locus_tag LOCUS_27630 gene fliM 7685 6633 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_27630 8253 7699 gene locus_tag LOCUS_27640 8253 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 <9287 8692 gene locus_tag LOCUS_27650 <9287 8692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072101.1:co-chaperone YbbN >Feature sequence189 1925 825 gene locus_tag LOCUS_27660 1925 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2100 3416 gene locus_tag LOCUS_27670 2100 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3509 4174 gene locus_tag LOCUS_27680 3509 4174 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137873.1 protein_id gnl|my_center|LOCUS_27680 5483 4242 gene locus_tag LOCUS_27690 5483 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 5784 6725 gene locus_tag LOCUS_27700 5784 6725 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121843.1 protein_id gnl|my_center|LOCUS_27700 7212 6805 gene locus_tag LOCUS_27710 7212 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8431 7505 gene locus_tag LOCUS_27720 8431 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104419.1 protein_id gnl|my_center|LOCUS_27720 9121 8501 gene locus_tag LOCUS_27730 9121 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence190 <1 1377 gene locus_tag LOCUS_27740 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein 1689 1765 gene locus_tag LOCUS_t00260 1689 1765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3513 2638 gene locus_tag LOCUS_27750 3513 2638 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUW6 protein_id gnl|my_center|LOCUS_27750 4679 3513 gene locus_tag LOCUS_27760 gene sucC 4679 3513 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_27760 6209 4770 gene locus_tag LOCUS_27770 gene lpdG 6209 4770 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_27770 7507 6314 gene locus_tag LOCUS_27780 gene sucB 7507 6314 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_27780 9241 7517 gene locus_tag LOCUS_27790 9241 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence191 1333 185 gene locus_tag LOCUS_27800 gene rlmN 1333 185 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX26 protein_id gnl|my_center|LOCUS_27800 1761 1339 gene locus_tag LOCUS_27810 gene ndk 1761 1339 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S20 protein_id gnl|my_center|LOCUS_27810 1992 2867 gene locus_tag LOCUS_27820 gene cheV 1992 2867 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 protein_id gnl|my_center|LOCUS_27820 3746 2868 gene locus_tag LOCUS_27830 3746 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27830 4715 3759 gene locus_tag LOCUS_27840 4715 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27840 5495 4731 gene locus_tag LOCUS_27850 5495 4731 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453786.1 protein_id gnl|my_center|LOCUS_27850 6612 5644 gene locus_tag LOCUS_27860 6612 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 7026 6742 gene locus_tag LOCUS_27870 7026 6742 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R6 protein_id gnl|my_center|LOCUS_27870 7174 8910 gene locus_tag LOCUS_27880 gene proS 7174 8910 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_27880 >Feature sequence192 894 28 gene locus_tag LOCUS_27890 894 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3087 1375 gene locus_tag LOCUS_27900 gene recJ 3087 1375 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103574.1 protein_id gnl|my_center|LOCUS_27900 3273 4232 gene locus_tag LOCUS_27910 3273 4232 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119789.1 protein_id gnl|my_center|LOCUS_27910 4331 4951 gene locus_tag LOCUS_27920 4331 4951 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707344.1 protein_id gnl|my_center|LOCUS_27920 5083 5772 gene locus_tag LOCUS_27930 5083 5772 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481578.1 protein_id gnl|my_center|LOCUS_27930 6561 5755 gene locus_tag LOCUS_27940 6561 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 7321 6455 gene locus_tag LOCUS_27950 7321 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 8344 7406 gene locus_tag LOCUS_27960 8344 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 <9173 8402 gene locus_tag LOCUS_27970 <9173 8402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I291:UTP--glucose-1-phosphate uridylyltransferase >Feature sequence193 1 216 gene locus_tag LOCUS_27980 1 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2215 638 gene locus_tag LOCUS_27990 2215 638 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_27990 3352 4761 gene locus_tag LOCUS_28000 3352 4761 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_28000 4807 5841 gene locus_tag LOCUS_28010 gene thrA 4807 5841 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KQ03 protein_id gnl|my_center|LOCUS_28010 6659 6219 gene locus_tag LOCUS_28020 gene marR 6659 6219 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520538.1 protein_id gnl|my_center|LOCUS_28020 7210 6728 gene locus_tag LOCUS_28030 7210 6728 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_28030 8960 7980 gene locus_tag LOCUS_28040 8960 7980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228244.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence194 6828 7304 gene locus_tag LOCUS_28050 6828 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence195 1038 547 gene locus_tag LOCUS_28060 1038 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_28060 2221 1046 gene locus_tag LOCUS_28070 2221 1046 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_28070 2408 2710 gene locus_tag LOCUS_28080 2408 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2751 3206 gene locus_tag LOCUS_28090 2751 3206 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963077.1 protein_id gnl|my_center|LOCUS_28090 4241 3252 gene locus_tag LOCUS_28100 gene glk 4241 3252 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58618 protein_id gnl|my_center|LOCUS_28100 4825 4313 gene locus_tag LOCUS_28110 4825 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 5145 4843 gene locus_tag LOCUS_28120 5145 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 5946 5221 gene locus_tag LOCUS_28130 5946 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 6087 7019 gene locus_tag LOCUS_28140 6087 7019 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316772.1 protein_id gnl|my_center|LOCUS_28140 7049 7870 gene locus_tag LOCUS_28150 gene cheR1 7049 7870 CDS product chemotaxis protein methyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87131 protein_id gnl|my_center|LOCUS_28150 <8910 7902 gene locus_tag LOCUS_28160 <8910 7902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPK3:DNA topoisomerase 4 subunit B >Feature sequence196 1056 412 gene locus_tag LOCUS_28170 1056 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1790 1083 gene locus_tag LOCUS_28180 1790 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2799 1912 gene locus_tag LOCUS_28190 2799 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_28190 3192 2893 gene locus_tag LOCUS_28200 3192 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_28200 5033 3291 gene locus_tag LOCUS_28210 5033 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458398.1 protein_id gnl|my_center|LOCUS_28210 5337 6581 gene locus_tag LOCUS_28220 5337 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_28220 6586 7467 gene locus_tag LOCUS_28230 6586 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 <8904 7785 gene locus_tag LOCUS_28240 <8904 7785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P10475:endoglucanase >Feature sequence197 6921 6211 gene locus_tag LOCUS_28250 6921 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 7112 6918 gene locus_tag LOCUS_28260 7112 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7301 7125 gene locus_tag LOCUS_28270 7301 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7536 7309 gene locus_tag LOCUS_28280 7536 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 8080 7790 gene locus_tag LOCUS_28290 8080 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 <8904 8119 gene locus_tag LOCUS_28300 <8904 8119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478447.1:ABC transporter ATP-binding protein >Feature sequence198 <1 722 gene locus_tag LOCUS_28310 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CTR3:stress response kinase A 960 1643 gene locus_tag LOCUS_28320 960 1643 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_28320 3575 1710 gene locus_tag LOCUS_28330 3575 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 4815 4090 gene locus_tag LOCUS_28340 4815 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 5339 4803 gene locus_tag LOCUS_28350 5339 4803 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_28350 6345 5545 gene locus_tag LOCUS_28360 6345 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 7249 6389 gene locus_tag LOCUS_28370 gene rbgA 7249 6389 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_28370 8113 7259 gene locus_tag LOCUS_28380 gene dcyD 8113 7259 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence199 221 18 gene locus_tag LOCUS_28390 221 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 480 325 gene locus_tag LOCUS_28400 480 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1031 528 gene locus_tag LOCUS_28410 1031 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1590 1024 gene locus_tag LOCUS_28420 1590 1024 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 protein_id gnl|my_center|LOCUS_28420 1675 3081 gene locus_tag LOCUS_28430 gene cyaB 1675 3081 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_28430 3587 3084 gene locus_tag LOCUS_28440 3587 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4698 3823 gene locus_tag LOCUS_28450 4698 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 5603 4698 gene locus_tag LOCUS_28460 gene nodI 5603 4698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_28460 5989 5600 gene locus_tag LOCUS_28470 5989 5600 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768967.1 protein_id gnl|my_center|LOCUS_28470 7200 5989 gene locus_tag LOCUS_28480 7200 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 8388 7204 gene locus_tag LOCUS_28490 8388 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence200 2749 356 gene locus_tag LOCUS_28500 2749 356 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261908.1 protein_id gnl|my_center|LOCUS_28500 3292 2759 gene locus_tag LOCUS_28510 3292 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 4692 3292 gene locus_tag LOCUS_28520 4692 3292 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_28520 5679 4765 gene locus_tag LOCUS_28530 gene ccoP 5679 4765 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_28530 5863 5672 gene locus_tag LOCUS_28540 5863 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 6540 5893 gene locus_tag LOCUS_28550 gene ccoO 6540 5893 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_28550 7984 6551 gene locus_tag LOCUS_28560 gene ccoN 7984 6551 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_28560 <8894 8290 gene locus_tag LOCUS_28570 <8894 8290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KK58:glutamyl-Q tRNA(Asp) synthetase >Feature sequence201 2266 1028 gene locus_tag LOCUS_28580 2266 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2801 5221 gene locus_tag LOCUS_28590 2801 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 5357 6121 gene locus_tag LOCUS_28600 5357 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence202 1447 2526 gene locus_tag LOCUS_28610 1447 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3763 2717 gene locus_tag LOCUS_28620 3763 2717 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167652.1 protein_id gnl|my_center|LOCUS_28620 4433 4567 gene locus_tag LOCUS_28630 4433 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence203 2016 244 gene locus_tag LOCUS_28640 2016 244 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_28640 2334 2828 gene locus_tag LOCUS_28650 2334 2828 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 protein_id gnl|my_center|LOCUS_28650 2852 4933 gene locus_tag LOCUS_28660 2852 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5056 5238 gene locus_tag LOCUS_28670 5056 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 7065 5845 gene locus_tag LOCUS_28680 7065 5845 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_28680 <8752 7052 gene locus_tag LOCUS_28690 <8752 7052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073811.1:MSHA biogenesis protein MshE >Feature sequence204 129 1250 gene locus_tag LOCUS_28700 129 1250 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_28700 1497 1913 gene locus_tag LOCUS_28710 1497 1913 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_28710 2011 2418 gene locus_tag LOCUS_28720 2011 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2508 4568 gene locus_tag LOCUS_28730 gene recG 2508 4568 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZZ8 protein_id gnl|my_center|LOCUS_28730 4909 4706 gene locus_tag LOCUS_28740 4909 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6746 5136 gene locus_tag LOCUS_28750 gene ctpH 6746 5136 CDS product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA3 protein_id gnl|my_center|LOCUS_28750 <8710 6976 gene locus_tag LOCUS_28760 <8710 6976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490914.1:hybrid sensor histidine kinase/response regulator >Feature sequence205 1541 207 gene locus_tag LOCUS_28770 1541 207 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_28770 2609 1746 gene locus_tag LOCUS_28780 2609 1746 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530765.1 protein_id gnl|my_center|LOCUS_28780 2848 3759 gene locus_tag LOCUS_28790 2848 3759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_28790 4809 3838 gene locus_tag LOCUS_28800 4809 3838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_28800 5059 5943 gene locus_tag LOCUS_28810 5059 5943 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_28810 6320 5988 gene locus_tag LOCUS_28820 6320 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7454 6504 gene locus_tag LOCUS_28830 7454 6504 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_28830 7681 8430 gene locus_tag LOCUS_28840 7681 8430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972156.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence206 <1 1227 gene locus_tag LOCUS_28850 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EII0:histidine kinase 2044 1550 gene locus_tag LOCUS_28860 2044 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2160 3728 gene locus_tag LOCUS_28870 2160 3728 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105048.1 protein_id gnl|my_center|LOCUS_28870 6082 4331 gene locus_tag LOCUS_28880 6082 4331 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_28880 6525 6079 gene locus_tag LOCUS_28890 6525 6079 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_28890 8204 6534 gene locus_tag LOCUS_28900 8204 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence207 4521 4207 gene locus_tag LOCUS_28910 4521 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 4905 5396 gene locus_tag LOCUS_28920 4905 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 5891 6667 gene locus_tag LOCUS_28930 5891 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 7224 6901 gene locus_tag LOCUS_28940 7224 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 8279 7647 gene locus_tag LOCUS_28950 8279 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28950 >Feature sequence208 <1 830 gene locus_tag LOCUS_28960 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083369.1:radical SAM protein 1351 2568 gene locus_tag LOCUS_28970 1351 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28970 2617 3000 gene locus_tag LOCUS_28980 2617 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3084 3998 gene locus_tag LOCUS_28990 3084 3998 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584089.1 protein_id gnl|my_center|LOCUS_28990 3995 4831 gene locus_tag LOCUS_29000 gene amyC 3995 4831 CDS product putative ABC transporter permease protein AmyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34518 protein_id gnl|my_center|LOCUS_29000 4837 6003 gene locus_tag LOCUS_29010 4837 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 7072 6137 gene locus_tag LOCUS_29020 7072 6137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_29020 7265 7756 gene locus_tag LOCUS_29030 gene ywoC 7265 7756 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence209 <1 624 gene locus_tag LOCUS_29040 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZGB3:cytidylate kinase 625 1371 gene locus_tag LOCUS_29050 625 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_29050 1368 2411 gene locus_tag LOCUS_29060 gene holA 1368 2411 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_29060 2398 3291 gene locus_tag LOCUS_29070 2398 3291 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177413.1 protein_id gnl|my_center|LOCUS_29070 3284 4207 gene locus_tag LOCUS_29080 3284 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_29080 4222 5178 gene locus_tag LOCUS_29090 4222 5178 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_29090 5178 7148 gene locus_tag LOCUS_29100 5178 7148 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267406.1 protein_id gnl|my_center|LOCUS_29100 <8225 7629 gene locus_tag LOCUS_29110 <8225 7629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957591.1:sodium:hydrogen antiporter >Feature sequence210 3058 1619 gene locus_tag LOCUS_29120 3058 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3957 3118 gene locus_tag LOCUS_29130 3957 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5048 3954 gene locus_tag LOCUS_29140 5048 3954 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_29140 5408 5163 gene locus_tag LOCUS_29150 5408 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 6019 5402 gene locus_tag LOCUS_29160 6019 5402 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence211 2900 1266 gene locus_tag LOCUS_29170 2900 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3999 3403 gene locus_tag LOCUS_29180 3999 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 4798 4316 gene locus_tag LOCUS_29190 4798 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6430 5243 gene locus_tag LOCUS_29200 6430 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence212 100 1059 gene locus_tag LOCUS_29210 gene motB 100 1059 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_29210 1170 3152 gene locus_tag LOCUS_29220 gene tkt1 1170 3152 CDS product transketolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP2 protein_id gnl|my_center|LOCUS_29220 3318 3743 gene locus_tag LOCUS_29230 3318 3743 CDS product cytochrome c-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_29230 3868 4695 gene locus_tag LOCUS_29240 3868 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 4794 5957 gene locus_tag LOCUS_29250 4794 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 5958 6512 gene locus_tag LOCUS_29260 5958 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 6522 7823 gene locus_tag LOCUS_29270 6522 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7961 8036 gene locus_tag LOCUS_t00270 7961 8036 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence213 1533 535 gene locus_tag LOCUS_29280 1533 535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_29280 2536 1544 gene locus_tag LOCUS_29290 2536 1544 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_29290 3421 5265 gene locus_tag LOCUS_29300 3421 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 5552 5821 gene locus_tag LOCUS_29310 5552 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29310 5830 6090 gene locus_tag LOCUS_29320 5830 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 6250 7788 gene locus_tag LOCUS_29330 6250 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence214 212 1048 gene locus_tag LOCUS_29340 212 1048 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_29340 1053 1481 gene locus_tag LOCUS_29350 1053 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2362 1817 gene locus_tag LOCUS_29360 gene orn 2362 1817 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRY0 protein_id gnl|my_center|LOCUS_29360 2427 3458 gene locus_tag LOCUS_29370 gene rsgA 2427 3458 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_29370 3451 3918 gene locus_tag LOCUS_29380 3451 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence215 1655 609 gene locus_tag LOCUS_29390 gene queA 1655 609 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 protein_id gnl|my_center|LOCUS_29390 1853 2101 gene locus_tag LOCUS_29400 1853 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3130 2201 gene locus_tag LOCUS_29410 3130 2201 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_29410 4424 3459 gene locus_tag LOCUS_29420 gene truB 4424 3459 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBC4 protein_id gnl|my_center|LOCUS_29420 4867 4424 gene locus_tag LOCUS_29430 gene rbfA 4867 4424 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_29430 7658 4983 gene locus_tag LOCUS_29440 gene infB 7658 4983 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L5 protein_id gnl|my_center|LOCUS_29440 >Feature sequence216 15 1307 gene locus_tag LOCUS_29450 gene tig 15 1307 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 protein_id gnl|my_center|LOCUS_29450 1464 2099 gene locus_tag LOCUS_29460 gene clpP 1464 2099 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_29460 2203 3486 gene locus_tag LOCUS_29470 gene clpX 2203 3486 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_29470 3600 6026 gene locus_tag LOCUS_29480 gene lon 3600 6026 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_29480 6165 6440 gene locus_tag LOCUS_29490 gene hupB 6165 6440 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_29490 6703 7815 gene locus_tag LOCUS_29500 6703 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence217 1150 608 gene locus_tag LOCUS_29510 1150 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1400 1143 gene locus_tag LOCUS_29520 1400 1143 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_29520 1749 1402 gene locus_tag LOCUS_29530 gene pilZ 1749 1402 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_29530 2788 1799 gene locus_tag LOCUS_29540 gene holB 2788 1799 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_29540 3423 2788 gene locus_tag LOCUS_29550 gene tmk 3423 2788 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_29550 4456 3980 gene locus_tag LOCUS_29560 gene pilE 4456 3980 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05431 protein_id gnl|my_center|LOCUS_29560 5262 4453 gene locus_tag LOCUS_29570 5262 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence218 2975 732 gene locus_tag LOCUS_29580 2975 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3798 3268 gene locus_tag LOCUS_29590 3798 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 6185 3945 gene locus_tag LOCUS_29600 gene parC 6185 3945 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence219 1521 427 gene locus_tag LOCUS_29610 gene ychF 1521 427 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_29610 2171 1686 gene locus_tag LOCUS_29620 2171 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2368 2186 gene locus_tag LOCUS_29630 2368 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2641 2390 gene locus_tag LOCUS_29640 2641 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3492 2734 gene locus_tag LOCUS_29650 3492 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 4202 3504 gene locus_tag LOCUS_29660 4202 3504 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419443.1 protein_id gnl|my_center|LOCUS_29660 5454 4195 gene locus_tag LOCUS_29670 5454 4195 CDS product precorrin-6Y-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_29670 6095 5454 gene locus_tag LOCUS_29680 gene cbiC 6095 5454 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972575.1 protein_id gnl|my_center|LOCUS_29680 6973 6092 gene locus_tag LOCUS_29690 6973 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 <7737 7061 gene locus_tag LOCUS_29700 <7737 7061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124958.1:sirohydrochlorin cobaltochelatase >Feature sequence220 1746 229 gene locus_tag LOCUS_29710 1746 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 2328 2945 gene locus_tag LOCUS_29720 2328 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325274.1 protein_id gnl|my_center|LOCUS_29720 2935 3600 gene locus_tag LOCUS_29730 2935 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3824 4351 gene locus_tag LOCUS_29740 3824 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4344 5906 gene locus_tag LOCUS_29750 4344 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence221 613 858 gene locus_tag LOCUS_29760 613 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1495 920 gene locus_tag LOCUS_29770 1495 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1927 1586 gene locus_tag LOCUS_29780 1927 1586 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_29780 3225 2350 gene locus_tag LOCUS_29790 3225 2350 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382934.1 protein_id gnl|my_center|LOCUS_29790 3458 4534 gene locus_tag LOCUS_29800 gene ndh 3458 4534 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_29800 5533 4946 gene locus_tag LOCUS_29810 5533 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence222 2134 101 gene locus_tag LOCUS_29820 2134 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2513 2794 gene locus_tag LOCUS_29830 2513 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 4382 3069 gene locus_tag LOCUS_29840 4382 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 <7648 4821 gene locus_tag LOCUS_29850 <7648 4821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P514:glucanase >Feature sequence223 412 1692 gene locus_tag LOCUS_29860 412 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1692 2768 gene locus_tag LOCUS_29870 1692 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2932 3843 gene locus_tag LOCUS_29880 2932 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 5369 4083 gene locus_tag LOCUS_29890 5369 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 5602 5450 gene locus_tag LOCUS_29900 5602 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 6719 5790 gene locus_tag LOCUS_29910 6719 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 7476 6721 gene locus_tag LOCUS_29920 7476 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence224 <1 722 gene locus_tag LOCUS_29930 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase 1119 2096 gene locus_tag LOCUS_29940 1119 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3960 3091 gene locus_tag LOCUS_29950 3960 3091 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530130.1 protein_id gnl|my_center|LOCUS_29950 4206 5429 gene locus_tag LOCUS_29960 4206 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5576 6211 gene locus_tag LOCUS_29970 5576 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 6440 6976 gene locus_tag LOCUS_29980 6440 6976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_29980 7405 6980 gene locus_tag LOCUS_29990 7405 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence225 112 1407 gene locus_tag LOCUS_30000 112 1407 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192375.1 protein_id gnl|my_center|LOCUS_30000 1407 1979 gene locus_tag LOCUS_30010 1407 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2003 2506 gene locus_tag LOCUS_30020 2003 2506 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 protein_id gnl|my_center|LOCUS_30020 2690 4222 gene locus_tag LOCUS_30030 gene purF 2690 4222 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_30030 4326 4652 gene locus_tag LOCUS_30040 4326 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261767.1 protein_id gnl|my_center|LOCUS_30040 6706 6796 gene locus_tag LOCUS_t00280 6706 6796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence226 69 380 gene locus_tag LOCUS_30050 69 380 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577802.1 protein_id gnl|my_center|LOCUS_30050 377 1219 gene locus_tag LOCUS_30060 gene tnpB 377 1219 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816180.1 protein_id gnl|my_center|LOCUS_30060 1543 2160 gene locus_tag LOCUS_30070 1543 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3864 2812 gene locus_tag LOCUS_30080 3864 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 <7411 3942 gene locus_tag LOCUS_30090 <7411 3942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence227 395 1384 gene locus_tag LOCUS_30100 395 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1937 2074 gene locus_tag LOCUS_30110 1937 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2071 3024 gene locus_tag LOCUS_30120 2071 3024 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974703.1 protein_id gnl|my_center|LOCUS_30120 4788 3574 gene locus_tag LOCUS_30130 4788 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence228 918 157 gene locus_tag LOCUS_30140 918 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1872 1276 gene locus_tag LOCUS_30150 1872 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2645 4063 gene locus_tag LOCUS_30160 2645 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_30160 4604 4134 gene locus_tag LOCUS_30170 4604 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 5276 4698 gene locus_tag LOCUS_30180 gene pth 5276 4698 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN5 protein_id gnl|my_center|LOCUS_30180 5969 5340 gene locus_tag LOCUS_30190 gene rplY 5969 5340 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_30190 7072 6140 gene locus_tag LOCUS_30200 gene prs 7072 6140 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_30200 7190 7116 gene locus_tag LOCUS_t00290 7190 7116 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence229 489 2030 gene locus_tag LOCUS_30210 gene ppx 489 2030 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209783.1 protein_id gnl|my_center|LOCUS_30210 2176 2850 gene locus_tag LOCUS_30220 gene rstA 2176 2850 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_30220 3729 2863 gene locus_tag LOCUS_30230 gene tesB 3729 2863 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 protein_id gnl|my_center|LOCUS_30230 3917 4513 gene locus_tag LOCUS_30240 3917 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_30240 4584 4979 gene locus_tag LOCUS_30250 4584 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 5840 5229 gene locus_tag LOCUS_30260 5840 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6173 5844 gene locus_tag LOCUS_30270 6173 5844 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_30270 6403 7254 gene locus_tag LOCUS_30280 6403 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence230 1289 807 gene locus_tag LOCUS_30290 1289 807 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_30290 1398 2726 gene locus_tag LOCUS_30300 1398 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2732 3613 gene locus_tag LOCUS_30310 gene panE 2732 3613 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAS5 protein_id gnl|my_center|LOCUS_30310 3701 5665 gene locus_tag LOCUS_30320 3701 5665 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 protein_id gnl|my_center|LOCUS_30320 6128 5700 gene locus_tag LOCUS_30330 6128 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 6317 6490 gene locus_tag LOCUS_30340 6317 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence231 1385 693 gene locus_tag LOCUS_30350 1385 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1869 1420 gene locus_tag LOCUS_30360 1869 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1956 3062 gene locus_tag LOCUS_30370 gene ddl 1956 3062 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_30370 5627 2994 gene locus_tag LOCUS_30380 5627 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 6798 5947 gene locus_tag LOCUS_30390 gene tatC 6798 5947 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY5 protein_id gnl|my_center|LOCUS_30390 7130 6795 gene locus_tag LOCUS_30400 7130 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence232 917 1453 gene locus_tag LOCUS_30410 917 1453 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_30410 2039 1455 gene locus_tag LOCUS_30420 2039 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3081 2032 gene locus_tag LOCUS_30430 3081 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261813.1 protein_id gnl|my_center|LOCUS_30430 4052 3081 gene locus_tag LOCUS_30440 4052 3081 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261812.1 protein_id gnl|my_center|LOCUS_30440 5413 4052 gene locus_tag LOCUS_30450 5413 4052 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261811.1 protein_id gnl|my_center|LOCUS_30450 6713 5463 gene locus_tag LOCUS_30460 6713 5463 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105989.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence233 <1 582 gene locus_tag LOCUS_30470 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205967.1:3-oxoacyl-ACP synthase 668 1564 gene locus_tag LOCUS_30480 668 1564 CDS product putative aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72208 protein_id gnl|my_center|LOCUS_30480 3746 1776 gene locus_tag LOCUS_30490 gene mnmC 3746 1776 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886E0 protein_id gnl|my_center|LOCUS_30490 4081 3746 gene locus_tag LOCUS_30500 4081 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 4747 4085 gene locus_tag LOCUS_30510 4747 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 5063 4764 gene locus_tag LOCUS_30520 gene yciI 5063 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261655.1 protein_id gnl|my_center|LOCUS_30520 5227 5072 gene locus_tag LOCUS_30530 5227 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 5769 6623 gene locus_tag LOCUS_30540 gene trpH 5769 6623 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261667.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence234 1927 365 gene locus_tag LOCUS_30550 1927 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3779 3087 gene locus_tag LOCUS_30560 3779 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 4281 3769 gene locus_tag LOCUS_30570 4281 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 4392 5099 gene locus_tag LOCUS_30580 4392 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence235 1696 764 gene locus_tag LOCUS_30590 gene ilvE 1696 764 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_30590 2457 2011 gene locus_tag LOCUS_30600 2457 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3318 2650 gene locus_tag LOCUS_30610 3318 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30610 4428 3358 gene locus_tag LOCUS_30620 4428 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30620 5428 4421 gene locus_tag LOCUS_30630 5428 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6136 5585 gene locus_tag LOCUS_30640 6136 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 <7111 6496 gene locus_tag LOCUS_30650 <7111 6496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262175.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence236 54 287 gene locus_tag LOCUS_30660 gene atpE 54 287 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57119 protein_id gnl|my_center|LOCUS_30660 340 810 gene locus_tag LOCUS_30670 gene atpF 340 810 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL20 protein_id gnl|my_center|LOCUS_30670 824 1360 gene locus_tag LOCUS_30680 gene atpH 824 1360 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_30680 1369 2913 gene locus_tag LOCUS_30690 gene atpA 1369 2913 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_30690 2948 3808 gene locus_tag LOCUS_30700 gene atpG 2948 3808 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_30700 3824 5233 gene locus_tag LOCUS_30710 gene atpD 3824 5233 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_30710 5251 5667 gene locus_tag LOCUS_30720 gene atpC 5251 5667 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_30720 5750 6439 gene locus_tag LOCUS_30730 5750 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6436 6711 gene locus_tag LOCUS_30740 6436 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence237 213 1679 gene locus_tag LOCUS_30750 213 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1696 6660 gene locus_tag LOCUS_30760 1696 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence238 411 1769 gene locus_tag LOCUS_30770 411 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1780 2472 gene locus_tag LOCUS_30780 gene rstA 1780 2472 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_30780 3131 2529 gene locus_tag LOCUS_30790 3131 2529 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_30790 3261 4220 gene locus_tag LOCUS_30800 3261 4220 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_30800 4557 4252 gene locus_tag LOCUS_30810 4557 4252 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710151.1 protein_id gnl|my_center|LOCUS_30810 5031 4702 gene locus_tag LOCUS_30820 5031 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_30820 5529 5068 gene locus_tag LOCUS_30830 5529 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 6138 5584 gene locus_tag LOCUS_30840 6138 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 6860 6237 gene locus_tag LOCUS_30850 6860 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence239 <1 2128 gene locus_tag LOCUS_30860 <1 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947978.1:endonuclease 2121 5546 gene locus_tag LOCUS_30870 2121 5546 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947538.1 protein_id gnl|my_center|LOCUS_30870 6348 5797 gene locus_tag LOCUS_30880 6348 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6561 6636 gene locus_tag LOCUS_t00300 6561 6636 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6661 6737 gene locus_tag LOCUS_t00310 6661 6737 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6782 6857 gene locus_tag LOCUS_t00320 6782 6857 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence240 2515 191 gene locus_tag LOCUS_30890 2515 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3149 2535 gene locus_tag LOCUS_30900 3149 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4650 3163 gene locus_tag LOCUS_30910 4650 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 5213 4650 gene locus_tag LOCUS_30920 5213 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 5629 5210 gene locus_tag LOCUS_30930 5629 5210 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_30930 6700 6497 gene locus_tag LOCUS_30940 6700 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence241 680 405 gene locus_tag LOCUS_30950 680 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1376 954 gene locus_tag LOCUS_30960 1376 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2164 1430 gene locus_tag LOCUS_30970 2164 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_30970 3032 3484 gene locus_tag LOCUS_30980 3032 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4287 3634 gene locus_tag LOCUS_30990 4287 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 5485 4433 gene locus_tag LOCUS_31000 5485 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 6056 6244 gene locus_tag LOCUS_31010 6056 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 6256 6570 gene locus_tag LOCUS_31020 6256 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence242 808 2919 gene locus_tag LOCUS_31030 808 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 5182 3047 gene locus_tag LOCUS_31040 gene pnp 5182 3047 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR6 protein_id gnl|my_center|LOCUS_31040 5667 5398 gene locus_tag LOCUS_31050 gene rpsO 5667 5398 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 protein_id gnl|my_center|LOCUS_31050 6529 5834 gene locus_tag LOCUS_31060 gene rsuA 6529 5834 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI8 protein_id gnl|my_center|LOCUS_31060 >Feature sequence243 250 17 gene locus_tag LOCUS_31070 250 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 342 3254 gene locus_tag LOCUS_31080 342 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3288 4895 gene locus_tag LOCUS_31090 3288 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5627 4959 gene locus_tag LOCUS_31100 5627 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 6340 5690 gene locus_tag LOCUS_31110 6340 5690 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence244 634 1416 gene locus_tag LOCUS_31120 634 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1894 1559 gene locus_tag LOCUS_31130 gene erpA 1894 1559 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_31130 2414 1986 gene locus_tag LOCUS_31140 2414 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3162 2425 gene locus_tag LOCUS_31150 3162 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 4243 3206 gene locus_tag LOCUS_31160 gene argC 4243 3206 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_31160 4376 6082 gene locus_tag LOCUS_31170 4376 6082 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence245 2759 2046 gene locus_tag LOCUS_31180 2759 2046 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_31180 3542 2775 gene locus_tag LOCUS_31190 gene panB 3542 2775 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X251 protein_id gnl|my_center|LOCUS_31190 4261 3602 gene locus_tag LOCUS_31200 4261 3602 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_31200 4480 4737 gene locus_tag LOCUS_31210 4480 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4730 5449 gene locus_tag LOCUS_31220 gene ispD 4730 5449 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_31220 5467 5952 gene locus_tag LOCUS_31230 gene ispF 5467 5952 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_31230 >Feature sequence246 <1 532 gene locus_tag LOCUS_31240 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KV66:tRNA-dihydrouridine synthase B 529 849 gene locus_tag LOCUS_31250 529 849 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_31250 871 2457 gene locus_tag LOCUS_31260 gene purH 871 2457 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRT9 protein_id gnl|my_center|LOCUS_31260 3316 4605 gene locus_tag LOCUS_31270 gene purD 3316 4605 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPD1 protein_id gnl|my_center|LOCUS_31270 4820 4578 gene locus_tag LOCUS_31280 4820 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 5435 5181 gene locus_tag LOCUS_31290 5435 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 5582 5457 gene locus_tag LOCUS_31300 5582 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5873 5583 gene locus_tag LOCUS_31310 5873 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 5824 6411 gene locus_tag LOCUS_31320 5824 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence247 312 869 gene locus_tag LOCUS_31330 312 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1655 972 gene locus_tag LOCUS_31340 1655 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2042 1701 gene locus_tag LOCUS_31350 2042 1701 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706199.1 protein_id gnl|my_center|LOCUS_31350 2290 4182 gene locus_tag LOCUS_31360 gene mnmG 2290 4182 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_31360 4182 4826 gene locus_tag LOCUS_31370 gene rsmG 4182 4826 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS4 protein_id gnl|my_center|LOCUS_31370 4844 5617 gene locus_tag LOCUS_31380 4844 5617 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 protein_id gnl|my_center|LOCUS_31380 5633 6376 gene locus_tag LOCUS_31390 5633 6376 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence248 1421 474 gene locus_tag LOCUS_31400 1421 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1933 1667 gene locus_tag LOCUS_31410 1933 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3371 2262 gene locus_tag LOCUS_31420 3371 2262 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_31420 4918 3551 gene locus_tag LOCUS_31430 4918 3551 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_31430 5961 5107 gene locus_tag LOCUS_31440 5961 5107 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence249 1 729 gene locus_tag LOCUS_31450 1 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1275 808 gene locus_tag LOCUS_31460 1275 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1663 1977 gene locus_tag LOCUS_31470 1663 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 2015 2674 gene locus_tag LOCUS_31480 2015 2674 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_31480 3222 2698 gene locus_tag LOCUS_31490 3222 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3520 3251 gene locus_tag LOCUS_31500 3520 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_31500 3680 3889 gene locus_tag LOCUS_31510 3680 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_31510 3990 4388 gene locus_tag LOCUS_31520 3990 4388 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence250 745 206 gene locus_tag LOCUS_31530 745 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 913 2007 gene locus_tag LOCUS_31540 913 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2081 2290 gene locus_tag LOCUS_31550 2081 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2287 2562 gene locus_tag LOCUS_31560 2287 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2623 4134 gene locus_tag LOCUS_31570 gene ilvA1 2623 4134 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_31570 4569 6035 gene locus_tag LOCUS_31580 4569 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence251 1257 463 gene locus_tag LOCUS_31590 1257 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3093 1450 gene locus_tag LOCUS_31600 gene groL1 3093 1450 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_31600 3426 3139 gene locus_tag LOCUS_31610 gene groS 3426 3139 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_31610 4014 3550 gene locus_tag LOCUS_31620 4014 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 4270 5400 gene locus_tag LOCUS_31630 gene carA 4270 5400 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_31630 5471 6286 gene locus_tag LOCUS_31640 5471 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence252 647 234 gene locus_tag LOCUS_31650 647 234 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_31650 1361 699 gene locus_tag LOCUS_31660 1361 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2413 1358 gene locus_tag LOCUS_31670 2413 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705434.1 protein_id gnl|my_center|LOCUS_31670 5292 2413 gene locus_tag LOCUS_31680 5292 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence253 131 844 gene locus_tag LOCUS_31690 131 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 4166 1143 gene locus_tag LOCUS_31700 4166 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 4688 5887 gene locus_tag LOCUS_31710 4688 5887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963654.1 protein_id gnl|my_center|LOCUS_31710 >Feature sequence254 4310 2424 gene locus_tag LOCUS_31720 4310 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 5532 4312 gene locus_tag LOCUS_31730 5532 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5881 5726 gene locus_tag LOCUS_31740 5881 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence255 <1 1345 gene locus_tag LOCUS_31750 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P514:glucanase 1868 2914 gene locus_tag LOCUS_31760 1868 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2915 4102 gene locus_tag LOCUS_31770 2915 4102 CDS product spore coat protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938001.1 protein_id gnl|my_center|LOCUS_31770 5393 4413 gene locus_tag LOCUS_31780 5393 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_31780 <6177 5575 gene locus_tag LOCUS_31790 <6177 5575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836295.1:racemase >Feature sequence256 2498 504 gene locus_tag LOCUS_31800 2498 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3070 2504 gene locus_tag LOCUS_31810 3070 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 4844 3567 gene locus_tag LOCUS_31820 4844 3567 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_31820 5202 4837 gene locus_tag LOCUS_31830 5202 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 6088 5591 gene locus_tag LOCUS_31840 6088 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence257 1947 1549 gene locus_tag LOCUS_31850 1947 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3252 2053 gene locus_tag LOCUS_31860 3252 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3819 3484 gene locus_tag LOCUS_31870 3819 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4868 3942 gene locus_tag LOCUS_31880 4868 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5000 5866 gene locus_tag LOCUS_31890 5000 5866 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence258 3985 3410 gene locus_tag LOCUS_31900 3985 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence259 16 300 gene locus_tag LOCUS_31910 16 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31910 355 603 gene locus_tag LOCUS_31920 355 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 938 1555 gene locus_tag LOCUS_31930 gene thrH 938 1555 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_31930 1907 2770 gene locus_tag LOCUS_31940 1907 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 2936 3988 gene locus_tag LOCUS_31950 2936 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3989 5125 gene locus_tag LOCUS_31960 gene cotH 3989 5125 CDS product spore coat protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831321.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence260 949 59 gene locus_tag LOCUS_31970 949 59 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 protein_id gnl|my_center|LOCUS_31970 1226 1684 gene locus_tag LOCUS_31980 1226 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2203 1793 gene locus_tag LOCUS_31990 2203 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2357 2097 gene locus_tag LOCUS_32000 2357 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2810 3748 gene locus_tag LOCUS_32010 gene hemH2 2810 3748 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_32010 4805 4095 gene locus_tag LOCUS_32020 gene yqcB 4805 4095 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889996.1 protein_id gnl|my_center|LOCUS_32020 5488 4877 gene locus_tag LOCUS_32030 5488 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence261 1001 417 gene locus_tag LOCUS_32040 1001 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 1151 2701 gene locus_tag LOCUS_32050 gene rmuC 1151 2701 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44733 protein_id gnl|my_center|LOCUS_32050 3467 2988 gene locus_tag LOCUS_32060 3467 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3732 4109 gene locus_tag LOCUS_32070 gene pilH 3732 4109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_32070 4513 4175 gene locus_tag LOCUS_32080 4513 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 5075 4590 gene locus_tag LOCUS_32090 5075 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 6010 5162 gene locus_tag LOCUS_32100 6010 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence262 2760 319 gene locus_tag LOCUS_32110 2760 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5962 3194 gene locus_tag LOCUS_32120 5962 3194 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ42 protein_id gnl|my_center|LOCUS_32120 >Feature sequence263 2019 2891 gene locus_tag LOCUS_32130 2019 2891 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKY1 protein_id gnl|my_center|LOCUS_32130 2977 3522 gene locus_tag LOCUS_32140 2977 3522 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_32140 5916 3931 gene locus_tag LOCUS_32150 5916 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence264 512 691 gene locus_tag LOCUS_32160 gene rpmF 512 691 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_32160 1929 784 gene locus_tag LOCUS_32170 1929 784 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_32170 4903 2039 gene locus_tag LOCUS_32180 4903 2039 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816594.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence265 1056 352 gene locus_tag LOCUS_32190 1056 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_32190 2058 1375 gene locus_tag LOCUS_32200 2058 1375 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_32200 2557 2069 gene locus_tag LOCUS_32210 2557 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 2763 2557 gene locus_tag LOCUS_32220 2763 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4883 2760 gene locus_tag LOCUS_32230 gene ligA 4883 2760 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_32230 5879 4887 gene locus_tag LOCUS_32240 5879 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence266 866 441 gene locus_tag LOCUS_32250 866 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1170 1260 gene locus_tag LOCUS_t00330 1170 1260 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 1498 1947 gene locus_tag LOCUS_32260 1498 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1958 2455 gene locus_tag LOCUS_32270 1958 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2409 2618 gene locus_tag LOCUS_32280 2409 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2599 3138 gene locus_tag LOCUS_32290 2599 3138 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ60 protein_id gnl|my_center|LOCUS_32290 3221 3676 gene locus_tag LOCUS_32300 3221 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 5744 4593 gene locus_tag LOCUS_32310 5744 4593 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence267 551 1456 gene locus_tag LOCUS_32320 551 1456 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_32320 2408 1698 gene locus_tag LOCUS_32330 2408 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_32330 2580 2828 gene locus_tag LOCUS_32340 2580 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3100 2825 gene locus_tag LOCUS_32350 3100 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 4380 3343 gene locus_tag LOCUS_32360 4380 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 5009 4437 gene locus_tag LOCUS_32370 5009 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32370 5190 5372 gene locus_tag LOCUS_32380 5190 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence268 983 537 gene locus_tag LOCUS_32390 983 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1311 976 gene locus_tag LOCUS_32400 1311 976 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972013.1 protein_id gnl|my_center|LOCUS_32400 2200 1538 gene locus_tag LOCUS_32410 2200 1538 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_32410 4525 2231 gene locus_tag LOCUS_32420 4525 2231 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_32420 4711 5631 gene locus_tag LOCUS_32430 4711 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence269 383 1327 gene locus_tag LOCUS_32440 383 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2169 3167 gene locus_tag LOCUS_32450 2169 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3718 4422 gene locus_tag LOCUS_32460 3718 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_32460 4419 5396 gene locus_tag LOCUS_32470 4419 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_32470 >Feature sequence270 614 243 gene locus_tag LOCUS_32480 614 243 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_32480 1789 1079 gene locus_tag LOCUS_32490 1789 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 1924 2841 gene locus_tag LOCUS_32500 1924 2841 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 protein_id gnl|my_center|LOCUS_32500 3007 2813 gene locus_tag LOCUS_32510 3007 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 3164 3814 gene locus_tag LOCUS_32520 3164 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 4682 4500 gene locus_tag LOCUS_32530 4682 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence271 702 1106 gene locus_tag LOCUS_32540 702 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1645 2298 gene locus_tag LOCUS_32550 1645 2298 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_32550 2301 3653 gene locus_tag LOCUS_32560 2301 3653 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_32560 3646 3948 gene locus_tag LOCUS_32570 3646 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3938 4948 gene locus_tag LOCUS_32580 3938 4948 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 protein_id gnl|my_center|LOCUS_32580 <5789 5025 gene locus_tag LOCUS_32590 <5789 5025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114255.1:beta-ketoacyl-[acyl-carrier-protein] synthase I >Feature sequence272 1626 733 gene locus_tag LOCUS_32600 1626 733 CDS product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402916.1 protein_id gnl|my_center|LOCUS_32600 1895 2938 gene locus_tag LOCUS_32610 1895 2938 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 protein_id gnl|my_center|LOCUS_32610 4343 3045 gene locus_tag LOCUS_32620 gene yisQ 4343 3045 CDS product putative transporter YisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07940 protein_id gnl|my_center|LOCUS_32620 5559 4615 gene locus_tag LOCUS_32630 5559 4615 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F9 protein_id gnl|my_center|LOCUS_32630 >Feature sequence273 703 1527 gene locus_tag LOCUS_32640 703 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1802 4219 gene locus_tag LOCUS_32650 1802 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 5312 4503 gene locus_tag LOCUS_32660 5312 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705996.1 protein_id gnl|my_center|LOCUS_32660 5626 5309 gene locus_tag LOCUS_32670 5626 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence274 113 1024 gene locus_tag LOCUS_32680 113 1024 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_32680 1572 1796 gene locus_tag LOCUS_32690 1572 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 1786 2991 gene locus_tag LOCUS_32700 1786 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763811.1 protein_id gnl|my_center|LOCUS_32700 3894 3163 gene locus_tag LOCUS_32710 3894 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence275 <1 2442 gene locus_tag LOCUS_32720 <1 2442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224314.1:ABC transporter substrate-binding protein 3533 3877 gene locus_tag LOCUS_32730 3533 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3904 4254 gene locus_tag LOCUS_32740 3904 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 4251 4949 gene locus_tag LOCUS_32750 4251 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083368.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence276 1222 308 gene locus_tag LOCUS_32760 1222 308 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090560.1 protein_id gnl|my_center|LOCUS_32760 1370 2035 gene locus_tag LOCUS_32770 gene azoR 1370 2035 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63463 protein_id gnl|my_center|LOCUS_32770 2874 2398 gene locus_tag LOCUS_32780 2874 2398 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_32780 3332 3514 gene locus_tag LOCUS_32790 3332 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 4468 3575 gene locus_tag LOCUS_32800 4468 3575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 protein_id gnl|my_center|LOCUS_32800 4579 5256 gene locus_tag LOCUS_32810 4579 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5304 5525 gene locus_tag LOCUS_32820 5304 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence277 2751 1321 gene locus_tag LOCUS_32830 2751 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3034 5223 gene locus_tag LOCUS_32840 gene fadB 3034 5223 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_32840 >Feature sequence278 1111 107 gene locus_tag LOCUS_32850 1111 107 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_32850 4639 1283 gene locus_tag LOCUS_32860 4639 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5152 4655 gene locus_tag LOCUS_32870 5152 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence279 1151 2683 gene locus_tag LOCUS_32880 1151 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3602 2742 gene locus_tag LOCUS_32890 gene hexR 3602 2742 CDS product HTH-type transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68281 protein_id gnl|my_center|LOCUS_32890 3796 5268 gene locus_tag LOCUS_32900 gene zwf 3796 5268 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_32900 >Feature sequence280 1006 701 gene locus_tag LOCUS_32910 1006 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 1814 1365 gene locus_tag LOCUS_32920 gene rplI 1814 1365 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_32920 2054 1827 gene locus_tag LOCUS_32930 gene rpsR 2054 1827 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_32930 2485 2057 gene locus_tag LOCUS_32940 gene rpsF 2485 2057 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG67 protein_id gnl|my_center|LOCUS_32940 2764 3555 gene locus_tag LOCUS_32950 2764 3555 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_32950 3610 4911 gene locus_tag LOCUS_32960 3610 4911 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence281 <1 5258 gene locus_tag LOCUS_32970 <1 5258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:cadherin >Feature sequence282 718 473 gene locus_tag LOCUS_32980 718 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1016 726 gene locus_tag LOCUS_32990 gene ihfB 1016 726 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_32990 2925 1249 gene locus_tag LOCUS_33000 gene rpsA 2925 1249 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_33000 3861 3160 gene locus_tag LOCUS_33010 gene sfsA 3861 3160 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LV9 protein_id gnl|my_center|LOCUS_33010 5029 3866 gene locus_tag LOCUS_33020 gene aspC 5029 3866 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P544 protein_id gnl|my_center|LOCUS_33020 5079 5360 gene locus_tag LOCUS_33030 5079 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence283 1186 146 gene locus_tag LOCUS_33040 1186 146 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_33040 1525 1878 gene locus_tag LOCUS_33050 1525 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 1938 3299 gene locus_tag LOCUS_33060 gene glmU 1938 3299 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1N9 protein_id gnl|my_center|LOCUS_33060 3296 3928 gene locus_tag LOCUS_33070 3296 3928 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189609.1 protein_id gnl|my_center|LOCUS_33070 3945 4676 gene locus_tag LOCUS_33080 3945 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 5262 4684 gene locus_tag LOCUS_33090 gene yceF 5262 4684 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHR3 protein_id gnl|my_center|LOCUS_33090 >Feature sequence284 1684 1217 gene locus_tag LOCUS_33100 1684 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 1714 1908 gene locus_tag LOCUS_33110 1714 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 2457 5132 gene locus_tag LOCUS_33120 2457 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence285 <1 1425 gene locus_tag LOCUS_33130 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXM6:GMP synthase [glutamine-hydrolyzing] 1416 1889 gene locus_tag LOCUS_33140 gene tadA 1416 1889 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 protein_id gnl|my_center|LOCUS_33140 1886 2311 gene locus_tag LOCUS_33150 1886 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 2311 3408 gene locus_tag LOCUS_33160 gene zapE 2311 3408 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_33160 3482 4471 gene locus_tag LOCUS_33170 3482 4471 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FT1 protein_id gnl|my_center|LOCUS_33170 4646 4897 gene locus_tag LOCUS_33180 gene rpsP 4646 4897 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_33180 >Feature sequence286 <1 1310 gene locus_tag LOCUS_33190 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NFK3:tRNA(Ile)-lysidine synthase 1438 3069 gene locus_tag LOCUS_33200 gene pyrG 1438 3069 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_33200 3206 5230 gene locus_tag LOCUS_33210 3206 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence287 3785 2241 gene locus_tag LOCUS_33220 3785 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5077 4262 gene locus_tag LOCUS_33230 5077 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence288 754 1029 gene locus_tag LOCUS_33240 754 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1189 3093 gene locus_tag LOCUS_33250 gene xqhA 1189 3093 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106682.1 protein_id gnl|my_center|LOCUS_33250 3658 3155 gene locus_tag LOCUS_33260 gene rnhA 3658 3155 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VRX8 protein_id gnl|my_center|LOCUS_33260 3826 4707 gene locus_tag LOCUS_33270 3826 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence289 2017 1190 gene locus_tag LOCUS_33280 gene truA 2017 1190 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_33280 4737 2080 gene locus_tag LOCUS_33290 gene fimV 4737 2080 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence290 279 500 gene locus_tag LOCUS_33300 279 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 2694 658 gene locus_tag LOCUS_33310 2694 658 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_33310 3302 2694 gene locus_tag LOCUS_33320 3302 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3456 4001 gene locus_tag LOCUS_33330 3456 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 <5102 4401 gene locus_tag LOCUS_33340 <5102 4401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000070205.1:oligopeptidase A >Feature sequence291 535 128 gene locus_tag LOCUS_33350 535 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33350 2284 698 gene locus_tag LOCUS_33360 gene pilS 2284 698 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_33360 2375 4018 gene locus_tag LOCUS_33370 gene nadE 2375 4018 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence292 <1 1288 gene locus_tag LOCUS_33380 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545300.1:pilus assembly protein PilY 1953 4457 gene locus_tag LOCUS_33390 1953 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33390 >Feature sequence293 961 3072 gene locus_tag LOCUS_33400 961 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence294 1020 22 gene locus_tag LOCUS_33410 1020 22 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_33410 1140 1379 gene locus_tag LOCUS_33420 1140 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2073 1612 gene locus_tag LOCUS_33430 2073 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 4029 2122 gene locus_tag LOCUS_33440 4029 2122 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33440 4726 4070 gene locus_tag LOCUS_33450 4726 4070 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937932.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence295 1063 2103 gene locus_tag LOCUS_33460 1063 2103 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256287.1 protein_id gnl|my_center|LOCUS_33460 2100 3542 gene locus_tag LOCUS_33470 2100 3542 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483564.1 protein_id gnl|my_center|LOCUS_33470 3563 4459 gene locus_tag LOCUS_33480 3563 4459 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence296 267 16 gene locus_tag LOCUS_33490 gene tatA 267 16 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_33490 617 282 gene locus_tag LOCUS_33500 gene hitA 617 282 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 protein_id gnl|my_center|LOCUS_33500 965 636 gene locus_tag LOCUS_33510 gene hisE 965 636 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG7 protein_id gnl|my_center|LOCUS_33510 2653 1013 gene locus_tag LOCUS_33520 gene ubiB 2653 1013 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_33520 3300 2653 gene locus_tag LOCUS_33530 3300 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4051 3302 gene locus_tag LOCUS_33540 gene ubiE 4051 3302 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF6 protein_id gnl|my_center|LOCUS_33540 4508 4080 gene locus_tag LOCUS_33550 4508 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence297 152 493 gene locus_tag LOCUS_33560 152 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 626 1192 gene locus_tag LOCUS_33570 626 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 1436 1738 gene locus_tag LOCUS_33580 1436 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1818 2189 gene locus_tag LOCUS_33590 1818 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 2386 2625 gene locus_tag LOCUS_33600 2386 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3531 3049 gene locus_tag LOCUS_33610 gene slyD 3531 3049 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A3 protein_id gnl|my_center|LOCUS_33610 4597 3539 gene locus_tag LOCUS_33620 gene pyrC 4597 3539 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB40 protein_id gnl|my_center|LOCUS_33620 >Feature sequence298 <1 1011 gene locus_tag LOCUS_33630 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z3U1:DNA translocase FtsK 1105 1905 gene locus_tag LOCUS_33640 1105 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 2039 3340 gene locus_tag LOCUS_33650 2039 3340 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_33650 3373 3786 gene locus_tag LOCUS_33660 gene crcB 3373 3786 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_33660 >Feature sequence299 1954 1250 gene locus_tag LOCUS_33670 gene sdhB 1954 1250 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_33670 3736 1964 gene locus_tag LOCUS_33680 3736 1964 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX2 protein_id gnl|my_center|LOCUS_33680 4091 3741 gene locus_tag LOCUS_33690 gene sdhD 4091 3741 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSF7 protein_id gnl|my_center|LOCUS_33690 4428 4081 gene locus_tag LOCUS_33700 4428 4081 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence300 2469 1372 gene locus_tag LOCUS_33710 gene aroC 2469 1372 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC2 protein_id gnl|my_center|LOCUS_33710 3395 2469 gene locus_tag LOCUS_33720 gene prmB 3395 2469 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_33720 3907 3482 gene locus_tag LOCUS_33730 3907 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4383 3922 gene locus_tag LOCUS_33740 4383 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence301 491 1915 gene locus_tag LOCUS_33750 491 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1927 3552 gene locus_tag LOCUS_33760 1927 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence302 3696 2875 gene locus_tag LOCUS_33770 3696 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4418 3831 gene locus_tag LOCUS_33780 4418 3831 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence303 1021 656 gene locus_tag LOCUS_tm00010 1021 656 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1718 1191 gene locus_tag LOCUS_33790 1718 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 2962 1715 gene locus_tag LOCUS_33800 2962 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 4017 2977 gene locus_tag LOCUS_33810 4017 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 4693 4007 gene locus_tag LOCUS_33820 gene xcpW 4693 4007 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_33820 >Feature sequence304 3952 2318 gene locus_tag LOCUS_33830 3952 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence305 1183 221 gene locus_tag LOCUS_33840 gene pfkA 1183 221 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV5 protein_id gnl|my_center|LOCUS_33840 4237 1469 gene locus_tag LOCUS_33850 4237 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence306 1118 366 gene locus_tag LOCUS_33860 1118 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 2550 1261 gene locus_tag LOCUS_33870 2550 1261 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946247.1 protein_id gnl|my_center|LOCUS_33870 3711 2563 gene locus_tag LOCUS_33880 gene envC 3711 2563 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262746.1 protein_id gnl|my_center|LOCUS_33880 <4750 3794 gene locus_tag LOCUS_33890 <4750 3794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU53:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence307 1185 298 gene locus_tag LOCUS_33900 1185 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 4660 1187 gene locus_tag LOCUS_33910 4660 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence308 515 2374 gene locus_tag LOCUS_33920 gene edd 515 2374 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_33920 2463 3098 gene locus_tag LOCUS_33930 2463 3098 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence309 2374 440 gene locus_tag LOCUS_33940 2374 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 2773 2904 gene locus_tag LOCUS_33950 2773 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3985 2894 gene locus_tag LOCUS_33960 3985 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence310 <1 1143 gene locus_tag LOCUS_33970 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903921.1:halolysin 1833 2426 gene locus_tag LOCUS_33980 gene mcbG 1833 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_33980 3700 2564 gene locus_tag LOCUS_33990 3700 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 4281 3781 gene locus_tag LOCUS_34000 gene yesJ 4281 3781 CDS product putative N-acetyltransferase YesJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31513 protein_id gnl|my_center|LOCUS_34000 >Feature sequence311 291 217 gene locus_tag LOCUS_t00340 291 217 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 379 306 gene locus_tag LOCUS_t00350 379 306 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 481 398 gene locus_tag LOCUS_t00360 481 398 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1340 654 gene locus_tag LOCUS_34010 1340 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 2079 1369 gene locus_tag LOCUS_34020 2079 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3035 2079 gene locus_tag LOCUS_34030 gene birA 3035 2079 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV39 protein_id gnl|my_center|LOCUS_34030 3235 3573 gene locus_tag LOCUS_34040 gene fbp 3235 3573 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG87 protein_id gnl|my_center|LOCUS_34040 3658 4266 gene locus_tag LOCUS_34050 3658 4266 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_34050 >Feature sequence312 31 513 gene locus_tag LOCUS_34060 31 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 920 3667 gene locus_tag LOCUS_34070 920 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 4345 4136 gene locus_tag LOCUS_34080 4345 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence313 1537 665 gene locus_tag LOCUS_34090 1537 665 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 protein_id gnl|my_center|LOCUS_34090 1667 2617 gene locus_tag LOCUS_34100 1667 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_34100 3092 4360 gene locus_tag LOCUS_34110 3092 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence314 312 1328 gene locus_tag LOCUS_34120 312 1328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_34120 1325 2116 gene locus_tag LOCUS_34130 1325 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268797.1 protein_id gnl|my_center|LOCUS_34130 2119 2907 gene locus_tag LOCUS_34140 2119 2907 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 protein_id gnl|my_center|LOCUS_34140 3396 2971 gene locus_tag LOCUS_34150 3396 2971 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43981 protein_id gnl|my_center|LOCUS_34150 4302 3400 gene locus_tag LOCUS_34160 gene tonB 4302 3400 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence315 1137 670 gene locus_tag LOCUS_34170 gene bfrA 1137 670 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX7 protein_id gnl|my_center|LOCUS_34170 1678 2148 gene locus_tag LOCUS_34180 gene bfrB 1678 2148 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_34180 2700 2332 gene locus_tag LOCUS_34190 2700 2332 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_34190 <4527 3361 gene locus_tag LOCUS_34200 <4527 3361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZN97:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence316 2108 267 gene locus_tag LOCUS_34210 2108 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 2873 2118 gene locus_tag LOCUS_34220 2873 2118 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_34220 4240 2870 gene locus_tag LOCUS_34230 4240 2870 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence317 575 1645 gene locus_tag LOCUS_34240 575 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2170 2814 gene locus_tag LOCUS_34250 2170 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 3124 4365 gene locus_tag LOCUS_34260 3124 4365 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence318 <1 1181 gene locus_tag LOCUS_34270 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIN4:amino-acid acetyltransferase 1327 2145 gene locus_tag LOCUS_34280 gene pyrF 1327 2145 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK37 protein_id gnl|my_center|LOCUS_34280 2464 3816 gene locus_tag LOCUS_34290 2464 3816 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence319 276 980 gene locus_tag LOCUS_34300 gene pcm 276 980 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_34300 964 1890 gene locus_tag LOCUS_34310 964 1890 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_34310 1983 2999 gene locus_tag LOCUS_34320 1983 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3071 4078 gene locus_tag LOCUS_34330 gene rpoS 3071 4078 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_34330 >Feature sequence320 <1 541 gene locus_tag LOCUS_34340 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVP2:UDP-2,3-diacylglucosamine hydrolase 866 3319 gene locus_tag LOCUS_34350 866 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3346 3996 gene locus_tag LOCUS_34360 gene queE 3346 3996 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVJ8 protein_id gnl|my_center|LOCUS_34360 >Feature sequence321 1057 146 gene locus_tag LOCUS_34370 gene argF 1057 146 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ1 protein_id gnl|my_center|LOCUS_34370 1312 2601 gene locus_tag LOCUS_34380 gene purA 1312 2601 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_34380 >Feature sequence322 201 671 gene locus_tag LOCUS_34390 gene ribH 201 671 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_34390 760 1218 gene locus_tag LOCUS_34400 gene nusB 760 1218 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_34400 1215 2186 gene locus_tag LOCUS_34410 gene thiL 1215 2186 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP5 protein_id gnl|my_center|LOCUS_34410 2994 2422 gene locus_tag LOCUS_34420 2994 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3869 3474 gene locus_tag LOCUS_34430 3869 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence323 3709 2579 gene locus_tag LOCUS_34440 gene ald 3709 2579 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_34440 >Feature sequence324 645 145 gene locus_tag LOCUS_34450 645 145 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143464.1 protein_id gnl|my_center|LOCUS_34450 896 633 gene locus_tag LOCUS_34460 896 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378883.1 protein_id gnl|my_center|LOCUS_34460 1502 2404 gene locus_tag LOCUS_34470 1502 2404 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022896.1 protein_id gnl|my_center|LOCUS_34470 3642 2665 gene locus_tag LOCUS_34480 3642 2665 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_34480 4196 3822 gene locus_tag LOCUS_34490 4196 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence325 938 1369 gene locus_tag LOCUS_34500 938 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1587 2210 gene locus_tag LOCUS_34510 1587 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2338 3021 gene locus_tag LOCUS_34520 2338 3021 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263756.1 protein_id gnl|my_center|LOCUS_34520 3258 3743 gene locus_tag LOCUS_34530 3258 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence326 1363 116 gene locus_tag LOCUS_34540 1363 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 1542 2795 gene locus_tag LOCUS_34550 gene proA 1542 2795 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_34550 2849 3541 gene locus_tag LOCUS_34560 2849 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3582 3956 gene locus_tag LOCUS_34570 gene rsfS 3582 3956 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_34570 >Feature sequence327 >Feature sequence328 <1 617 gene locus_tag LOCUS_34580 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941100.1:type VI secretion system protein ImpG 581 1606 gene locus_tag LOCUS_34590 581 1606 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200970.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence329 4074 3919 gene locus_tag LOCUS_34600 4074 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34600 >Feature sequence330 1637 225 gene locus_tag LOCUS_34610 1637 225 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJU5 protein_id gnl|my_center|LOCUS_34610 2349 3872 gene locus_tag LOCUS_34620 2349 3872 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027790.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence331 222 680 gene locus_tag LOCUS_34630 222 680 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_34630 1277 816 gene locus_tag LOCUS_34640 1277 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_34640 2098 1274 gene locus_tag LOCUS_34650 2098 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_34650 2355 2759 gene locus_tag LOCUS_34660 2355 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence332 213 917 gene locus_tag LOCUS_34670 213 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1612 1193 gene locus_tag LOCUS_34680 1612 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 2386 2099 gene locus_tag LOCUS_34690 2386 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3817 3419 gene locus_tag LOCUS_34700 3817 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence333 361 810 gene locus_tag LOCUS_34710 gene yokK 361 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31996 protein_id gnl|my_center|LOCUS_34710 2425 1070 gene locus_tag LOCUS_34720 gene hflX 2425 1070 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E680 protein_id gnl|my_center|LOCUS_34720 3495 2977 gene locus_tag LOCUS_34730 3495 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705550.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence334 3133 77 gene locus_tag LOCUS_34740 3133 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence335 794 45 gene locus_tag LOCUS_34750 794 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34750 1498 782 gene locus_tag LOCUS_34760 1498 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34760 1792 1529 gene locus_tag LOCUS_34770 1792 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2208 2525 gene locus_tag LOCUS_34780 2208 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2528 3196 gene locus_tag LOCUS_34790 gene phoP 2528 3196 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence336 1130 891 gene locus_tag LOCUS_34800 1130 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 1619 1179 gene locus_tag LOCUS_34810 1619 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 2181 1621 gene locus_tag LOCUS_34820 2181 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 2567 2914 gene locus_tag LOCUS_34830 2567 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3118 3516 gene locus_tag LOCUS_34840 3118 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3613 3744 gene locus_tag LOCUS_34850 3613 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence337 757 479 gene locus_tag LOCUS_34860 757 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 1469 984 gene locus_tag LOCUS_34870 1469 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2027 1608 gene locus_tag LOCUS_34880 2027 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2265 2396 gene locus_tag LOCUS_34890 2265 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3594 2926 gene locus_tag LOCUS_34900 3594 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence338 1775 1272 gene locus_tag LOCUS_34910 1775 1272 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_34910 3672 1915 gene locus_tag LOCUS_34920 3672 1915 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence339 1097 351 gene locus_tag LOCUS_34930 gene cobK 1097 351 CDS product cobalt-precorrin-6A/precorrin-6x reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311006.1 protein_id gnl|my_center|LOCUS_34930 2100 1111 gene locus_tag LOCUS_34940 2100 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2428 2700 gene locus_tag LOCUS_34950 2428 2700 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7T0 protein_id gnl|my_center|LOCUS_34950 3305 2979 gene locus_tag LOCUS_34960 gene nirD 3305 2979 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_34960 <3894 3308 gene locus_tag LOCUS_34970 <3894 3308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205570.1:nitrite reductase large subunit >Feature sequence340 1732 1310 gene locus_tag LOCUS_34980 1732 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072758.1 protein_id gnl|my_center|LOCUS_34980 2040 1741 gene locus_tag LOCUS_34990 2040 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3098 2181 gene locus_tag LOCUS_35000 3098 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence341 2519 228 gene locus_tag LOCUS_35010 2519 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 2794 3318 gene locus_tag LOCUS_35020 gene fabA 2794 3318 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK2 protein_id gnl|my_center|LOCUS_35020 >Feature sequence342 >Feature sequence343 1424 630 gene locus_tag LOCUS_35030 1424 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 2017 2277 gene locus_tag LOCUS_35040 2017 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 2300 3640 gene locus_tag LOCUS_35050 2300 3640 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 >Feature sequence344 513 1721 gene locus_tag LOCUS_35060 gene fleS 513 1721 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_35060 1718 3172 gene locus_tag LOCUS_35070 1718 3172 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268444.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence345 >Feature sequence346 1322 1732 gene locus_tag LOCUS_35080 1322 1732 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence347 <1 1636 gene locus_tag LOCUS_35090 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260997.1:choline-sulfatase 1658 2686 gene locus_tag LOCUS_35100 gene rsmC 1658 2686 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA0 protein_id gnl|my_center|LOCUS_35100 >Feature sequence348 730 239 gene locus_tag LOCUS_35110 gene ilvH 730 239 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_35110 2474 732 gene locus_tag LOCUS_35120 gene ilvB 2474 732 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N6 protein_id gnl|my_center|LOCUS_35120 2937 3533 gene locus_tag LOCUS_35130 gene cobU 2937 3533 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404268.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence349 537 1229 gene locus_tag LOCUS_35140 gene rstA 537 1229 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_35140 1598 1347 gene locus_tag LOCUS_35150 1598 1347 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_35150 2086 1601 gene locus_tag LOCUS_35160 gene coaD 2086 1601 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_35160 2382 2957 gene locus_tag LOCUS_35170 gene yceJ 2382 2957 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_35170 2984 3541 gene locus_tag LOCUS_35180 2984 3541 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX5 protein_id gnl|my_center|LOCUS_35180 >Feature sequence350 <3616 3116 gene locus_tag LOCUS_35190 <3616 3116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HT80:DNA polymerase I >Feature sequence351 684 3392 gene locus_tag LOCUS_35200 684 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence352 237 671 gene locus_tag LOCUS_35210 237 671 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_35210 661 1041 gene locus_tag LOCUS_35220 661 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 2276 1146 gene locus_tag LOCUS_35230 2276 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence353 149 934 gene locus_tag LOCUS_35240 gene flgG 149 934 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_35240 944 1609 gene locus_tag LOCUS_35250 gene flgH2 944 1609 CDS product flagellar L-ring protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI3 protein_id gnl|my_center|LOCUS_35250 1628 2614 gene locus_tag LOCUS_35260 gene flgI 1628 2614 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_35260 2572 2715 gene locus_tag LOCUS_35270 2572 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35270 3061 2897 gene locus_tag LOCUS_35280 3061 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence354 <1 553 gene locus_tag LOCUS_35290 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5Z0:S-adenosylmethionine synthase 608 2011 gene locus_tag LOCUS_35300 gene ahcY 608 2011 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_35300 2275 3123 gene locus_tag LOCUS_35310 gene metF 2275 3123 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 protein_id gnl|my_center|LOCUS_35310 >Feature sequence355 1835 1224 gene locus_tag LOCUS_35320 1835 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2555 2893 gene locus_tag LOCUS_35330 gene glnK 2555 2893 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence356 >Feature sequence357 <3304 1218 gene locus_tag LOCUS_35340 <3304 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7J5:endoglucanase >Feature sequence358 1195 797 gene locus_tag LOCUS_35350 1195 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 1580 1323 gene locus_tag LOCUS_35360 1580 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 protein_id gnl|my_center|LOCUS_35360 2435 2046 gene locus_tag LOCUS_35370 2435 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 2918 2565 gene locus_tag LOCUS_35380 2918 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence359 1286 108 gene locus_tag LOCUS_35390 1286 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_35390 2531 1413 gene locus_tag LOCUS_35400 gene ydjI 2531 1413 CDS product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence360 809 411 gene locus_tag LOCUS_35410 809 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 <3262 1022 gene locus_tag LOCUS_35420 <3262 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97LJ9:endoglucanase >Feature sequence361 175 1269 gene locus_tag LOCUS_35430 gene cbiD 175 1269 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KC5 protein_id gnl|my_center|LOCUS_35430 2153 1299 gene locus_tag LOCUS_35440 2153 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 2265 3053 gene locus_tag LOCUS_35450 2265 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence362 496 152 gene locus_tag LOCUS_35460 gene arsC 496 152 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_35460 541 1041 gene locus_tag LOCUS_35470 541 1041 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463613.1 protein_id gnl|my_center|LOCUS_35470 1236 2021 gene locus_tag LOCUS_35480 1236 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 2035 2244 gene locus_tag LOCUS_35490 2035 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence363 <1 2193 gene locus_tag LOCUS_35500 <1 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q887M3:valine--tRNA ligase 2483 2869 gene locus_tag LOCUS_35510 2483 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence364 228 653 gene locus_tag LOCUS_35520 228 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35520 1684 839 gene locus_tag LOCUS_35530 1684 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 2023 1697 gene locus_tag LOCUS_35540 2023 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 2809 2507 gene locus_tag LOCUS_35550 2809 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence365 >Feature sequence366 1518 2630 gene locus_tag LOCUS_35560 1518 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence367 635 216 gene locus_tag LOCUS_35570 gene fliS 635 216 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_35570 866 2890 gene locus_tag LOCUS_35580 866 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence368 1111 191 gene locus_tag LOCUS_35590 1111 191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_35590 2073 1108 gene locus_tag LOCUS_35600 2073 1108 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_35600 2192 2773 gene locus_tag LOCUS_35610 gene azoR 2192 2773 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 protein_id gnl|my_center|LOCUS_35610 >Feature sequence369 2951 1770 gene locus_tag LOCUS_35620 2951 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence370 2040 817 gene locus_tag LOCUS_35630 gene argG 2040 817 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_35630 2348 3034 gene locus_tag LOCUS_35640 2348 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence371 827 168 gene locus_tag LOCUS_35650 827 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1366 1238 gene locus_tag LOCUS_35660 1366 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 1877 1422 gene locus_tag LOCUS_35670 1877 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2906 2106 gene locus_tag LOCUS_35680 2906 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence372 1104 214 gene locus_tag LOCUS_35690 1104 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 2018 1101 gene locus_tag LOCUS_35700 2018 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 <3066 2023 gene locus_tag LOCUS_35710 <3066 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073813.1:MSHA biogenesis protein MshM >Feature sequence373 144 953 gene locus_tag LOCUS_35720 144 953 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK15 protein_id gnl|my_center|LOCUS_35720 985 1908 gene locus_tag LOCUS_35730 gene lgt 985 1908 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P2 protein_id gnl|my_center|LOCUS_35730 1905 2699 gene locus_tag LOCUS_35740 gene thyA 1905 2699 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPC9 protein_id gnl|my_center|LOCUS_35740 >Feature sequence374 433 23 gene locus_tag LOCUS_35750 433 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1596 580 gene locus_tag LOCUS_35760 1596 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_35760 2020 2754 gene locus_tag LOCUS_35770 2020 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence375 1342 2 gene locus_tag LOCUS_35780 1342 2 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_35780 1515 1333 gene locus_tag LOCUS_35790 1515 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2022 2498 gene locus_tag LOCUS_35800 2022 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence376 1115 1873 gene locus_tag LOCUS_35810 1115 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence377 755 270 gene locus_tag LOCUS_35820 755 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 2590 902 gene locus_tag LOCUS_35830 2590 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence378 >Feature sequence379 532 236 gene locus_tag LOCUS_35840 532 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 867 2717 gene locus_tag LOCUS_35850 867 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence380 <1 549 gene locus_tag LOCUS_35860 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399770.1:peptidoglycan glycosyltransferase 542 1681 gene locus_tag LOCUS_35870 542 1681 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_35870 1685 2668 gene locus_tag LOCUS_35880 gene sltB1 1685 2668 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence381 379 2286 gene locus_tag LOCUS_35890 gene mutL 379 2286 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_35890 >Feature sequence382 743 156 gene locus_tag LOCUS_35900 743 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1382 912 gene locus_tag LOCUS_35910 1382 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence383 45 120 gene locus_tag LOCUS_t00370 45 120 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 130 206 gene locus_tag LOCUS_t00380 130 206 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 299 868 gene locus_tag LOCUS_35920 299 868 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_35920 943 1596 gene locus_tag LOCUS_35930 gene rnhB 943 1596 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence384 318 2150 gene locus_tag LOCUS_35940 gene typA 318 2150 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_35940 >Feature sequence385 <2818 377 gene locus_tag LOCUS_35950 <2818 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNQ1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence386 >Feature sequence387 864 487 gene locus_tag LOCUS_35960 gene msrB 864 487 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_35960 949 2169 gene locus_tag LOCUS_35970 949 2169 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179458.1 protein_id gnl|my_center|LOCUS_35970 2162 2548 gene locus_tag LOCUS_35980 2162 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence388 490 185 gene locus_tag LOCUS_35990 490 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1330 2484 gene locus_tag LOCUS_36000 1330 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence389 1100 471 gene locus_tag LOCUS_36010 gene msrQ 1100 471 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_36010 2077 1100 gene locus_tag LOCUS_36020 gene msrP 2077 1100 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_36020 <2773 2225 gene locus_tag LOCUS_36030 <2773 2225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095061.1:phosphatidylserine synthase >Feature sequence390 1979 1380 gene locus_tag LOCUS_36040 gene lexA 1979 1380 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q8 protein_id gnl|my_center|LOCUS_36040 2586 2452 gene locus_tag LOCUS_36050 2586 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence391 885 1340 gene locus_tag LOCUS_36060 gene rimP 885 1340 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95578 protein_id gnl|my_center|LOCUS_36060 >Feature sequence392 <1 2146 gene locus_tag LOCUS_36070 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWR3:DNA-directed DNA polymerase >Feature sequence393 554 117 gene locus_tag LOCUS_36080 554 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 1133 690 gene locus_tag LOCUS_36090 1133 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 1335 1108 gene locus_tag LOCUS_36100 1335 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 2172 1807 gene locus_tag LOCUS_36110 2172 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence394 492 118 gene locus_tag LOCUS_36120 492 118 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36120 738 2456 gene locus_tag LOCUS_36130 gene leuA-2 738 2456 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_36130 >Feature sequence395 726 451 gene locus_tag LOCUS_36140 726 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence396 1211 273 gene locus_tag LOCUS_36150 1211 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 1442 1696 gene locus_tag LOCUS_36160 1442 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 1821 1693 gene locus_tag LOCUS_36170 1821 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1947 2309 gene locus_tag LOCUS_36180 1947 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence397 <2618 442 gene locus_tag LOCUS_36190 <2618 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858465.1:membrane protein >Feature sequence398 <1 984 gene locus_tag LOCUS_36200 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KRR3:fumarate hydratase class II 1002 1226 gene locus_tag LOCUS_36210 1002 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 1775 1326 gene locus_tag LOCUS_36220 1775 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence399 <2597 1393 gene locus_tag LOCUS_36230 <2597 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29363:threonine synthase >Feature sequence400 155 445 gene locus_tag LOCUS_36240 155 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 479 856 gene locus_tag LOCUS_36250 479 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 923 1408 gene locus_tag LOCUS_36260 923 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2387 1683 gene locus_tag LOCUS_36270 2387 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence401 <1 607 gene locus_tag LOCUS_36280 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706088.1:transposase 1146 616 gene locus_tag LOCUS_36290 1146 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence402 520 942 gene locus_tag LOCUS_36300 520 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 1152 2273 gene locus_tag LOCUS_36310 1152 2273 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888209.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence403 >Feature sequence404 1267 590 gene locus_tag LOCUS_36320 1267 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2143 1469 gene locus_tag LOCUS_36330 2143 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence405 344 30 gene locus_tag LOCUS_36340 344 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 751 353 gene locus_tag LOCUS_36350 751 353 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence406 75 953 gene locus_tag LOCUS_36360 gene ispA 75 953 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261435.1 protein_id gnl|my_center|LOCUS_36360 966 1661 gene locus_tag LOCUS_36370 966 1661 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707903.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence407 674 180 gene locus_tag LOCUS_36380 gene ppiB 674 180 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_36380 1564 698 gene locus_tag LOCUS_36390 gene folD1 1564 698 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN1 protein_id gnl|my_center|LOCUS_36390 1798 1874 gene locus_tag LOCUS_t00390 1798 1874 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1915 1991 gene locus_tag LOCUS_t00400 1915 1991 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2015 2090 gene locus_tag LOCUS_t00410 2015 2090 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2146 2230 gene locus_tag LOCUS_t00420 2146 2230 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence408 >Feature sequence409 <1 591 gene locus_tag LOCUS_36400 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775606.1:transposase <2468 714 gene locus_tag LOCUS_36410 <2468 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O86730:glucanase >Feature sequence410 >Feature sequence411 174 503 gene locus_tag LOCUS_36420 174 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 877 1098 gene locus_tag LOCUS_36430 877 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1091 1381 gene locus_tag LOCUS_36440 1091 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1940 1533 gene locus_tag LOCUS_36450 gene vapC 1940 1533 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JND5 protein_id gnl|my_center|LOCUS_36450 2173 1940 gene locus_tag LOCUS_36460 2173 1940 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence412 >Feature sequence413 190 537 gene locus_tag LOCUS_36470 190 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 537 1220 gene locus_tag LOCUS_36480 537 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1545 1802 gene locus_tag LOCUS_36490 1545 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 1804 2172 gene locus_tag LOCUS_36500 1804 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence414 >Feature sequence415 1017 175 gene locus_tag LOCUS_36510 gene hisG 1017 175 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G695 protein_id gnl|my_center|LOCUS_36510 2094 1084 gene locus_tag LOCUS_36520 2094 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence416 152 322 gene locus_tag LOCUS_36530 152 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 1034 504 gene locus_tag LOCUS_36540 1034 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1262 2296 gene locus_tag LOCUS_36550 1262 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence417 1006 1830 gene locus_tag LOCUS_36560 1006 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence418 2313 4 gene locus_tag LOCUS_36570 gene ladS 2313 4 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_36570 >Feature sequence419 <1 515 gene locus_tag LOCUS_36580 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KJ03:aminomethyltransferase 536 922 gene locus_tag LOCUS_36590 gene gcvH 536 922 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_36590 >Feature sequence420 702 310 gene locus_tag LOCUS_36600 702 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 918 1865 gene locus_tag LOCUS_36610 918 1865 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence421 <1 692 gene locus_tag LOCUS_36620 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245372.1:thiol:disulfide interchange protein DsbC 761 2062 gene locus_tag LOCUS_36630 761 2062 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence422 >Feature sequence423 <2203 1547 gene locus_tag LOCUS_36640 <2203 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704349.1:cell division ATP-binding protein FtsE >Feature sequence424 1460 555 gene locus_tag LOCUS_36650 1460 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 <2194 1457 gene locus_tag LOCUS_36660 <2194 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E4C3:DNA polymerase >Feature sequence425 >Feature sequence426 <1 616 gene locus_tag LOCUS_36670 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268599.1:two-component sensor histidine kinase 1334 660 gene locus_tag LOCUS_36680 1334 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1885 1388 gene locus_tag LOCUS_36690 1885 1388 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071861.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence427 754 1740 gene locus_tag LOCUS_36700 754 1740 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence428 544 1899 gene locus_tag LOCUS_36710 544 1899 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459964.1 protein_id gnl|my_center|LOCUS_36710 1999 2118 gene locus_tag LOCUS_36720 1999 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence429 1749 1525 gene locus_tag LOCUS_36730 1749 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence430 <1 1102 gene locus_tag LOCUS_36740 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262136.1:GGDEF domain-containing protein 1991 1131 gene locus_tag LOCUS_36750 gene rlmJ 1991 1131 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN14 protein_id gnl|my_center|LOCUS_36750 >Feature sequence431 <1 611 gene locus_tag LOCUS_36760 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528655.1:mannose-1-phosphate guanyltransferase 645 1145 gene locus_tag LOCUS_36770 645 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 1555 1962 gene locus_tag LOCUS_36780 gene marR 1555 1962 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843419.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence432 <1 1493 gene locus_tag LOCUS_36790 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545300.1:pilus assembly protein PilY >Feature sequence433 975 298 gene locus_tag LOCUS_36800 975 298 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 protein_id gnl|my_center|LOCUS_36800 1412 1864 gene locus_tag LOCUS_36810 1412 1864 CDS product IS200/IS605 family transposase ISMac7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020315.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence434 >Feature sequence435 709 8 gene locus_tag LOCUS_36820 709 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 916 1143 gene locus_tag LOCUS_36830 916 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 <1899 1348 gene locus_tag LOCUS_36840 <1899 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957282.1:cell filamentation protein Fic >Feature sequence436 <1 1103 gene locus_tag LOCUS_36850 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070523.1:transposase >Feature sequence437 <1 1419 gene locus_tag LOCUS_36860 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIY0:tRNA sulfurtransferase >Feature sequence438 431 946 gene locus_tag LOCUS_36870 431 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36870 959 1495 gene locus_tag LOCUS_36880 959 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36880 >Feature sequence439 444 647 gene locus_tag LOCUS_36890 444 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 875 1153 gene locus_tag LOCUS_36900 875 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_36900 1498 1346 gene locus_tag LOCUS_36910 1498 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1686 1495 gene locus_tag LOCUS_36920 1686 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence440 272 1192 gene locus_tag LOCUS_36930 272 1192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence441 <1 1230 gene locus_tag LOCUS_36940 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074383.1:toxin secretion, membrane fusion protein 1578 1721 gene locus_tag LOCUS_36950 1578 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence442 >Feature sequence443 740 84 gene locus_tag LOCUS_36960 740 84 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 protein_id gnl|my_center|LOCUS_36960 1437 862 gene locus_tag LOCUS_36970 1437 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence444 14 122 gene locus_tag LOCUS_r00020 14 122 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1589 1738 gene locus_tag LOCUS_36980 1589 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence445 14 122 gene locus_tag LOCUS_r00030 14 122 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 <1723 416 gene locus_tag LOCUS_36990 <1723 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P3J4:cellobionic acid phosphorylase >Feature sequence446 896 54 gene locus_tag LOCUS_37000 896 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37000 <1721 996 gene locus_tag LOCUS_37010 <1721 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVL8:GTPase Obg >Feature sequence447 >Feature sequence448 >Feature sequence449 1283 927 gene locus_tag LOCUS_37020 1283 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence450 <1 1389 gene locus_tag LOCUS_37030 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065935.1:IS5/IS1182 family transposase >Feature sequence451 339 31 gene locus_tag LOCUS_37040 339 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 836 474 gene locus_tag LOCUS_37050 836 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 1266 967 gene locus_tag LOCUS_37060 1266 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence452 628 263 gene locus_tag LOCUS_37070 gene rplS 628 263 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_37070 1395 625 gene locus_tag LOCUS_37080 gene trmD 1395 625 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43912 protein_id gnl|my_center|LOCUS_37080 >Feature sequence453 1462 1097 gene locus_tag LOCUS_37090 1462 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37090 >Feature sequence454 >Feature sequence455 1207 398 gene locus_tag LOCUS_37100 gene trpA 1207 398 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_37100 >Feature sequence456 264 803 gene locus_tag LOCUS_37110 gene dsbE 264 803 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE9 protein_id gnl|my_center|LOCUS_37110 800 1267 gene locus_tag LOCUS_37120 800 1267 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence457 862 14 gene locus_tag LOCUS_37130 862 14 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 protein_id gnl|my_center|LOCUS_37130 1326 874 gene locus_tag LOCUS_37140 1326 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence458 530 99 gene locus_tag LOCUS_37150 530 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 826 620 gene locus_tag LOCUS_37160 826 620 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence459 125 1135 gene locus_tag LOCUS_37170 gene galE 125 1135 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence460 >Feature sequence461 1189 248 gene locus_tag LOCUS_37180 1189 248 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118252.1 protein_id gnl|my_center|LOCUS_37180 >Feature sequence462 >Feature sequence463 <1254 463 gene locus_tag LOCUS_37190 <1254 463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN61:succinyl-diaminopimelate desuccinylase >Feature sequence464 1084 485 gene locus_tag LOCUS_37200 1084 485 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence465 >Feature sequence466 388 1065 gene locus_tag LOCUS_37210 388 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 >Feature sequence467 <1 972 gene locus_tag LOCUS_37220 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929632.1:IS110 family transposase