>Feature sequence001 1660 494 gene locus_tag LOCUS_00010 1660 494 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071851.1 protein_id gnl|my_center|LOCUS_00010 2612 1650 gene locus_tag LOCUS_00020 2612 1650 CDS product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_00020 3574 2609 gene locus_tag LOCUS_00030 3574 2609 CDS product ABC drugE1 family efflux system MFP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071849.1 protein_id gnl|my_center|LOCUS_00030 4326 3571 gene locus_tag LOCUS_00040 4326 3571 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 protein_id gnl|my_center|LOCUS_00040 4815 4540 gene locus_tag LOCUS_00050 4815 4540 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_00050 6104 5094 gene locus_tag LOCUS_00060 gene hemH 6104 5094 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL51 protein_id gnl|my_center|LOCUS_00060 7516 6518 gene locus_tag LOCUS_00070 7516 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7910 7632 gene locus_tag LOCUS_00080 7910 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 8146 7907 gene locus_tag LOCUS_00090 8146 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8250 8468 gene locus_tag LOCUS_00100 8250 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8908 9651 gene locus_tag LOCUS_00110 8908 9651 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_00110 11052 10195 gene locus_tag LOCUS_00120 gene rsmI 11052 10195 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 protein_id gnl|my_center|LOCUS_00120 11084 12847 gene locus_tag LOCUS_00130 11084 12847 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 protein_id gnl|my_center|LOCUS_00130 12858 13220 gene locus_tag LOCUS_00140 12858 13220 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY4 protein_id gnl|my_center|LOCUS_00140 13316 13900 gene locus_tag LOCUS_00150 gene gmhA 13316 13900 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_00150 15449 14172 gene locus_tag LOCUS_00160 gene sqr 15449 14172 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_00160 16999 16241 gene locus_tag LOCUS_00170 gene moeB 16999 16241 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_00170 17928 17038 gene locus_tag LOCUS_00180 gene prmC 17928 17038 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_00180 19010 17925 gene locus_tag LOCUS_00190 gene prfA 19010 17925 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ25 protein_id gnl|my_center|LOCUS_00190 20296 19013 gene locus_tag LOCUS_00200 gene hemA 20296 19013 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C2 protein_id gnl|my_center|LOCUS_00200 20509 22326 gene locus_tag LOCUS_00210 20509 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266732.1 protein_id gnl|my_center|LOCUS_00210 22316 22921 gene locus_tag LOCUS_00220 gene lolB 22316 22921 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI20 protein_id gnl|my_center|LOCUS_00220 22914 23789 gene locus_tag LOCUS_00230 gene ispE 22914 23789 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 protein_id gnl|my_center|LOCUS_00230 23794 23868 gene locus_tag LOCUS_t00010 23794 23868 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23917 24858 gene locus_tag LOCUS_00240 gene prs 23917 24858 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX2 protein_id gnl|my_center|LOCUS_00240 24975 25589 gene locus_tag LOCUS_00250 gene rplY 24975 25589 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_00250 25714 26301 gene locus_tag LOCUS_00260 gene pth 25714 26301 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN9 protein_id gnl|my_center|LOCUS_00260 26341 27432 gene locus_tag LOCUS_00270 gene ychF 26341 27432 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_00270 27709 28278 gene locus_tag LOCUS_00280 27709 28278 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_00280 28297 28488 gene locus_tag LOCUS_00290 28297 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29118 28519 gene locus_tag LOCUS_00300 29118 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29645 29274 gene locus_tag LOCUS_00310 29645 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_00310 29833 31110 gene locus_tag LOCUS_00320 gene miaB 29833 31110 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_00320 31146 32222 gene locus_tag LOCUS_00330 31146 32222 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_00330 32219 32701 gene locus_tag LOCUS_00340 gene ybeY 32219 32701 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71335 protein_id gnl|my_center|LOCUS_00340 32698 33519 gene locus_tag LOCUS_00350 32698 33519 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_00350 33516 35069 gene locus_tag LOCUS_00360 gene lnt 33516 35069 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_00360 35069 35416 gene locus_tag LOCUS_00370 35069 35416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_00370 35891 35433 gene locus_tag LOCUS_00380 35891 35433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37108 35891 gene locus_tag LOCUS_00390 gene argJ 37108 35891 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_00390 39858 37126 gene locus_tag LOCUS_00400 gene secA 39858 37126 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_00400 40811 39972 gene locus_tag LOCUS_00410 40811 39972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_00410 41998 41090 gene locus_tag LOCUS_00420 gene lpxC 41998 41090 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_00420 43312 42101 gene locus_tag LOCUS_00430 gene ftsZ 43312 42101 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_00430 44588 43353 gene locus_tag LOCUS_00440 gene ftsA 44588 43353 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_00440 45361 44588 gene locus_tag LOCUS_00450 45361 44588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46283 45363 gene locus_tag LOCUS_00460 gene ddl 46283 45363 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_00460 47776 46283 gene locus_tag LOCUS_00470 gene murC 47776 46283 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY6 protein_id gnl|my_center|LOCUS_00470 48863 47769 gene locus_tag LOCUS_00480 gene murG 48863 47769 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GS7 protein_id gnl|my_center|LOCUS_00480 50017 48860 gene locus_tag LOCUS_00490 gene ftsW 50017 48860 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_00490 51386 50010 gene locus_tag LOCUS_00500 gene murD 51386 50010 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_00500 52481 51399 gene locus_tag LOCUS_00510 gene mraY 52481 51399 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_00510 53851 52487 gene locus_tag LOCUS_00520 gene murF 53851 52487 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_00520 55427 53841 gene locus_tag LOCUS_00530 gene murE 55427 53841 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_00530 57145 55424 gene locus_tag LOCUS_00540 gene ftsI 57145 55424 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_00540 57405 57142 gene locus_tag LOCUS_00550 57405 57142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58337 57402 gene locus_tag LOCUS_00560 gene rsmH 58337 57402 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_00560 58789 58334 gene locus_tag LOCUS_00570 gene mraZ 58789 58334 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_00570 59478 60287 gene locus_tag LOCUS_00580 59478 60287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60314 60967 gene locus_tag LOCUS_00590 60314 60967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071870.1 protein_id gnl|my_center|LOCUS_00590 61113 62105 gene locus_tag LOCUS_00600 61113 62105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62213 63001 gene locus_tag LOCUS_00610 62213 63001 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_00610 64142 62991 gene locus_tag LOCUS_00620 gene flhB 64142 62991 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_00620 64922 64146 gene locus_tag LOCUS_00630 gene fliR 64922 64146 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_00630 65248 66345 gene locus_tag LOCUS_00640 gene gcvT 65248 66345 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_00640 66551 66937 gene locus_tag LOCUS_00650 gene gcvH 66551 66937 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L7 protein_id gnl|my_center|LOCUS_00650 67081 70026 gene locus_tag LOCUS_00660 gene gcvP 67081 70026 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ6 protein_id gnl|my_center|LOCUS_00660 70179 70346 gene locus_tag LOCUS_00670 70179 70346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71021 70824 gene locus_tag LOCUS_00680 71021 70824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71559 72005 gene locus_tag LOCUS_00690 71559 72005 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_00690 72710 72898 gene locus_tag LOCUS_00700 72710 72898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 72976 73959 gene locus_tag LOCUS_00710 72976 73959 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_00710 74046 74225 gene locus_tag LOCUS_00720 74046 74225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74197 75120 gene locus_tag LOCUS_00730 74197 75120 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530444.1 protein_id gnl|my_center|LOCUS_00730 75131 75934 gene locus_tag LOCUS_00740 75131 75934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530445.1 protein_id gnl|my_center|LOCUS_00740 75922 76758 gene locus_tag LOCUS_00750 75922 76758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530446.1 protein_id gnl|my_center|LOCUS_00750 76771 78366 gene locus_tag LOCUS_00760 76771 78366 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530447.1 protein_id gnl|my_center|LOCUS_00760 79617 78436 gene locus_tag LOCUS_00770 79617 78436 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_00770 80332 79661 gene locus_tag LOCUS_00780 80332 79661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_00780 80760 80329 gene locus_tag LOCUS_00790 80760 80329 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_00790 82134 80869 gene locus_tag LOCUS_00800 82134 80869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_00800 82680 84164 gene locus_tag LOCUS_00810 82680 84164 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 protein_id gnl|my_center|LOCUS_00810 84572 84384 gene locus_tag LOCUS_00820 84572 84384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85604 84984 gene locus_tag LOCUS_00830 85604 84984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 85915 87543 gene locus_tag LOCUS_00840 85915 87543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_00840 87658 88083 gene locus_tag LOCUS_00850 87658 88083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88553 89326 gene locus_tag LOCUS_00860 88553 89326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 90813 89479 gene locus_tag LOCUS_00870 90813 89479 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810093.1 protein_id gnl|my_center|LOCUS_00870 91645 90980 gene locus_tag LOCUS_00880 91645 90980 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_00880 92885 91779 gene locus_tag LOCUS_00890 92885 91779 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267747.1 protein_id gnl|my_center|LOCUS_00890 93270 94745 gene locus_tag LOCUS_00900 93270 94745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_00900 95347 94823 gene locus_tag LOCUS_00910 95347 94823 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_00910 97072 95486 gene locus_tag LOCUS_00920 97072 95486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_00920 98557 97097 gene locus_tag LOCUS_00930 98557 97097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00930 98844 98554 gene locus_tag LOCUS_00940 98844 98554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100190 99069 gene locus_tag LOCUS_00950 100190 99069 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_00950 101463 100219 gene locus_tag LOCUS_00960 101463 100219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 101952 101503 gene locus_tag LOCUS_00970 101952 101503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 102473 103675 gene locus_tag LOCUS_00980 102473 103675 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_00980 103929 104186 gene locus_tag LOCUS_00990 103929 104186 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8M1 protein_id gnl|my_center|LOCUS_00990 104174 104488 gene locus_tag LOCUS_01000 104174 104488 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_01000 105581 104922 gene locus_tag LOCUS_01010 105581 104922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106889 105597 gene locus_tag LOCUS_01020 gene amt 106889 105597 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_01020 108082 107450 gene locus_tag LOCUS_01030 108082 107450 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704001.1 protein_id gnl|my_center|LOCUS_01030 109225 108152 gene locus_tag LOCUS_01040 109225 108152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 109531 110253 gene locus_tag LOCUS_01050 gene modA 109531 110253 CDS product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_01050 111129 110302 gene locus_tag LOCUS_01060 gene modE 111129 110302 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 protein_id gnl|my_center|LOCUS_01060 111996 111265 gene locus_tag LOCUS_01070 111996 111265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084600.1 protein_id gnl|my_center|LOCUS_01070 112160 112969 gene locus_tag LOCUS_01080 gene ycfH 112160 112969 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262283.1 protein_id gnl|my_center|LOCUS_01080 113129 114151 gene locus_tag LOCUS_01090 113129 114151 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 protein_id gnl|my_center|LOCUS_01090 114388 114714 gene locus_tag LOCUS_01100 114388 114714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 114767 115966 gene locus_tag LOCUS_01110 114767 115966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117258 116014 gene locus_tag LOCUS_01120 117258 116014 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_01120 119065 117353 gene locus_tag LOCUS_01130 119065 117353 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLT4 protein_id gnl|my_center|LOCUS_01130 120584 119094 gene locus_tag LOCUS_01140 gene glpK 120584 119094 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UK6 protein_id gnl|my_center|LOCUS_01140 121179 120724 gene locus_tag LOCUS_01150 121179 120724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 121840 121364 gene locus_tag LOCUS_01160 gene greA 121840 121364 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64282 protein_id gnl|my_center|LOCUS_01160 125087 121866 gene locus_tag LOCUS_01170 125087 121866 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ1 protein_id gnl|my_center|LOCUS_01170 126261 125107 gene locus_tag LOCUS_01180 gene carA 126261 125107 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_01180 126735 127385 gene locus_tag LOCUS_01190 126735 127385 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707289.1 protein_id gnl|my_center|LOCUS_01190 128341 127538 gene locus_tag LOCUS_01200 gene dapB 128341 127538 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_01200 129559 128438 gene locus_tag LOCUS_01210 gene dnaJ 129559 128438 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_01210 131565 129664 gene locus_tag LOCUS_01220 gene dnaK 131565 129664 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_01220 132314 131721 gene locus_tag LOCUS_01230 gene grpE 132314 131721 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_01230 132474 134159 gene locus_tag LOCUS_01240 132474 134159 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_01240 134228 134497 gene locus_tag LOCUS_01250 134228 134497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134824 134417 gene locus_tag LOCUS_01260 gene fur 134824 134417 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_01260 134918 135316 gene locus_tag LOCUS_01270 134918 135316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 135654 135364 gene locus_tag LOCUS_01280 135654 135364 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_01280 136078 135647 gene locus_tag LOCUS_01290 gene yfjG 136078 135647 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_01290 137490 136135 gene locus_tag LOCUS_01300 137490 136135 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_01300 137637 138119 gene locus_tag LOCUS_01310 gene smpB 137637 138119 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL7 protein_id gnl|my_center|LOCUS_01310 138318 138674 gene locus_tag LOCUS_tm00010 138318 138674 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 138899 139150 gene locus_tag LOCUS_01320 138899 139150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_01320 139385 139203 gene locus_tag LOCUS_01330 139385 139203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 139902 139300 gene locus_tag LOCUS_01340 139902 139300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 140451 139948 gene locus_tag LOCUS_01350 140451 139948 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_01350 140970 140611 gene locus_tag LOCUS_01360 140970 140611 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_01360 142675 141026 gene locus_tag LOCUS_01370 142675 141026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143276 142785 gene locus_tag LOCUS_01380 143276 142785 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_01380 143463 145142 gene locus_tag LOCUS_01390 gene leuA-2 143463 145142 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_01390 145512 147023 gene locus_tag LOCUS_01400 145512 147023 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_01400 149059 147041 gene locus_tag LOCUS_01410 149059 147041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 151503 149395 gene locus_tag LOCUS_01420 gene pnp 151503 149395 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_01420 152046 151777 gene locus_tag LOCUS_01430 gene rpsO 152046 151777 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR5 protein_id gnl|my_center|LOCUS_01430 152836 152432 gene locus_tag LOCUS_01440 gene rbfA 152836 152432 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_01440 155695 152945 gene locus_tag LOCUS_01450 gene infB 155695 152945 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR2 protein_id gnl|my_center|LOCUS_01450 157219 155723 gene locus_tag LOCUS_01460 gene nusA 157219 155723 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_01460 157700 157242 gene locus_tag LOCUS_01470 gene rimP 157700 157242 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_01470 158049 157964 gene locus_tag LOCUS_t00020 158049 157964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 158461 158072 gene locus_tag LOCUS_01480 gene secG 158461 158072 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_01480 159208 158468 gene locus_tag LOCUS_01490 gene tpiA 159208 158468 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_01490 160673 159336 gene locus_tag LOCUS_01500 gene glmM 160673 159336 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_01500 161505 160666 gene locus_tag LOCUS_01510 gene folP 161505 160666 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_01510 163675 161750 gene locus_tag LOCUS_01520 gene ftsH 163675 161750 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_01520 164363 163743 gene locus_tag LOCUS_01530 gene rlmE 164363 163743 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ4 protein_id gnl|my_center|LOCUS_01530 164459 164776 gene locus_tag LOCUS_01540 164459 164776 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377487.1 protein_id gnl|my_center|LOCUS_01540 165154 164849 gene locus_tag LOCUS_01550 165154 164849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 165358 166476 gene locus_tag LOCUS_01560 165358 166476 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072810.1 protein_id gnl|my_center|LOCUS_01560 166742 167257 gene locus_tag LOCUS_01570 gene fabA 166742 167257 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV9 protein_id gnl|my_center|LOCUS_01570 167960 167397 gene locus_tag LOCUS_01580 167960 167397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 170271 168049 gene locus_tag LOCUS_01590 170271 168049 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence002 269 577 gene locus_tag LOCUS_01600 gene rpsJ 269 577 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 protein_id gnl|my_center|LOCUS_01600 673 1305 gene locus_tag LOCUS_01610 gene rplC 673 1305 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_203618.2 protein_id gnl|my_center|LOCUS_01610 1309 1911 gene locus_tag LOCUS_01620 gene rplD 1309 1911 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY5 protein_id gnl|my_center|LOCUS_01620 1908 2204 gene locus_tag LOCUS_01630 gene rplW 1908 2204 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_01630 2216 3043 gene locus_tag LOCUS_01640 gene rplB 2216 3043 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY7 protein_id gnl|my_center|LOCUS_01640 3106 3336 gene locus_tag LOCUS_01650 gene rpsS 3106 3336 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q15 protein_id gnl|my_center|LOCUS_01650 3350 3685 gene locus_tag LOCUS_01660 gene rplV 3350 3685 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP9 protein_id gnl|my_center|LOCUS_01660 3697 4386 gene locus_tag LOCUS_01670 gene rpsC 3697 4386 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_01670 4399 4812 gene locus_tag LOCUS_01680 gene rplP 4399 4812 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_01680 4812 5003 gene locus_tag LOCUS_01690 gene rpmC 4812 5003 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44365 protein_id gnl|my_center|LOCUS_01690 5000 5272 gene locus_tag LOCUS_01700 gene rpsQ 5000 5272 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_01700 5306 5674 gene locus_tag LOCUS_01710 gene rplN 5306 5674 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ4 protein_id gnl|my_center|LOCUS_01710 5689 6003 gene locus_tag LOCUS_01720 gene rplX 5689 6003 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE6 protein_id gnl|my_center|LOCUS_01720 6022 6561 gene locus_tag LOCUS_01730 gene rplE 6022 6561 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V9 protein_id gnl|my_center|LOCUS_01730 6572 6877 gene locus_tag LOCUS_01740 gene rpsN 6572 6877 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_01740 6955 7347 gene locus_tag LOCUS_01750 gene rpsH 6955 7347 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_01750 7359 7892 gene locus_tag LOCUS_01760 gene rplF 7359 7892 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_01760 7903 8253 gene locus_tag LOCUS_01770 gene rplR 7903 8253 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_01770 8265 8789 gene locus_tag LOCUS_01780 gene rpsE 8265 8789 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_01780 8796 8981 gene locus_tag LOCUS_01790 gene rpmD 8796 8981 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF39 protein_id gnl|my_center|LOCUS_01790 8983 9417 gene locus_tag LOCUS_01800 gene rplO 8983 9417 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E895 protein_id gnl|my_center|LOCUS_01800 9417 10745 gene locus_tag LOCUS_01810 gene secY 9417 10745 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF5 protein_id gnl|my_center|LOCUS_01810 10983 11339 gene locus_tag LOCUS_01820 gene rpsM 10983 11339 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_01820 11420 11809 gene locus_tag LOCUS_01830 gene rpsK 11420 11809 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_01830 11822 12442 gene locus_tag LOCUS_01840 gene rpsD 11822 12442 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_01840 12464 13465 gene locus_tag LOCUS_01850 gene rpoA 12464 13465 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_01850 13497 13904 gene locus_tag LOCUS_01860 gene rplQ 13497 13904 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_01860 16270 14060 gene locus_tag LOCUS_01870 16270 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 17730 16273 gene locus_tag LOCUS_01880 gene eutA 17730 16273 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836565.1 protein_id gnl|my_center|LOCUS_01880 19492 18119 gene locus_tag LOCUS_01890 19492 18119 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_01890 19693 19529 gene locus_tag LOCUS_01900 19693 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 19912 19703 gene locus_tag LOCUS_01910 19912 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 19925 20362 gene locus_tag LOCUS_01920 19925 20362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706770.1 protein_id gnl|my_center|LOCUS_01920 20359 20829 gene locus_tag LOCUS_01930 20359 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_01930 20971 22617 gene locus_tag LOCUS_01940 gene phoD 20971 22617 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_01940 22901 23836 gene locus_tag LOCUS_01950 22901 23836 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_01950 24002 24559 gene locus_tag LOCUS_01960 24002 24559 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085436.1 protein_id gnl|my_center|LOCUS_01960 24628 25092 gene locus_tag LOCUS_01970 24628 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 25176 26129 gene locus_tag LOCUS_01980 gene rluD 25176 26129 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_01980 26418 27464 gene locus_tag LOCUS_01990 26418 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 27646 27969 gene locus_tag LOCUS_02000 27646 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 27926 28315 gene locus_tag LOCUS_02010 27926 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 28315 29640 gene locus_tag LOCUS_02020 28315 29640 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_02020 29984 29634 gene locus_tag LOCUS_02030 29984 29634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 33034 29981 gene locus_tag LOCUS_02040 33034 29981 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_02040 34041 33034 gene locus_tag LOCUS_02050 34041 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 33925 34182 gene locus_tag LOCUS_02060 33925 34182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 35426 34197 gene locus_tag LOCUS_02070 35426 34197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 36630 35641 gene locus_tag LOCUS_02080 36630 35641 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_02080 38495 36975 gene locus_tag LOCUS_02090 gene exaC 38495 36975 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_02090 38955 40025 gene locus_tag LOCUS_02100 gene epd 38955 40025 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB2 protein_id gnl|my_center|LOCUS_02100 40102 41262 gene locus_tag LOCUS_02110 gene pgk 40102 41262 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD3 protein_id gnl|my_center|LOCUS_02110 41334 42398 gene locus_tag LOCUS_02120 gene fba 41334 42398 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_02120 42918 43952 gene locus_tag LOCUS_02130 42918 43952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 44970 44053 gene locus_tag LOCUS_02140 44970 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02140 45328 44984 gene locus_tag LOCUS_02150 45328 44984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 45437 45276 gene locus_tag LOCUS_02160 45437 45276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 46077 45646 gene locus_tag LOCUS_02170 gene csdE 46077 45646 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261341.1 protein_id gnl|my_center|LOCUS_02170 47305 46088 gene locus_tag LOCUS_02180 47305 46088 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_02180 48410 47523 gene locus_tag LOCUS_02190 48410 47523 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 protein_id gnl|my_center|LOCUS_02190 48736 50703 gene locus_tag LOCUS_02200 48736 50703 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_02200 50703 50975 gene locus_tag LOCUS_02210 50703 50975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 50975 51268 gene locus_tag LOCUS_02220 50975 51268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 protein_id gnl|my_center|LOCUS_02220 51265 52914 gene locus_tag LOCUS_02230 51265 52914 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 protein_id gnl|my_center|LOCUS_02230 53138 53317 gene locus_tag LOCUS_02240 53138 53317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 53892 53644 gene locus_tag LOCUS_02250 53892 53644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02250 55086 53959 gene locus_tag LOCUS_02260 55086 53959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 56170 55187 gene locus_tag LOCUS_02270 56170 55187 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602530.1 protein_id gnl|my_center|LOCUS_02270 56449 57069 gene locus_tag LOCUS_02280 56449 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 57626 57090 gene locus_tag LOCUS_02290 57626 57090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 57963 59951 gene locus_tag LOCUS_02300 gene tktA 57963 59951 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_02300 60212 60640 gene locus_tag LOCUS_02310 60212 60640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 61690 60668 gene locus_tag LOCUS_02320 gene yjgB 61690 60668 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_02320 62444 61920 gene locus_tag LOCUS_02330 62444 61920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 63666 62587 gene locus_tag LOCUS_02340 gene bioB 63666 62587 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_02340 63644 64003 gene locus_tag LOCUS_02350 63644 64003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 64000 64371 gene locus_tag LOCUS_02360 64000 64371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 64445 65134 gene locus_tag LOCUS_02370 64445 65134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_02370 65134 66369 gene locus_tag LOCUS_02380 65134 66369 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397387.1 protein_id gnl|my_center|LOCUS_02380 67349 66597 gene locus_tag LOCUS_02390 gene ssb 67349 66597 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U1 protein_id gnl|my_center|LOCUS_02390 68706 67333 gene locus_tag LOCUS_02400 68706 67333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_02400 68972 69637 gene locus_tag LOCUS_02410 68972 69637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 69757 70485 gene locus_tag LOCUS_02420 69757 70485 CDS product pteridine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_02420 70889 70464 gene locus_tag LOCUS_02430 70889 70464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 71089 71937 gene locus_tag LOCUS_02440 71089 71937 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262037.1 protein_id gnl|my_center|LOCUS_02440 71986 73713 gene locus_tag LOCUS_02450 gene recJ 71986 73713 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_02450 73767 74285 gene locus_tag LOCUS_02460 73767 74285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 74531 75673 gene locus_tag LOCUS_02470 gene acrA 74531 75673 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_02470 75687 78797 gene locus_tag LOCUS_02480 75687 78797 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_02480 78961 79467 gene locus_tag LOCUS_02490 78961 79467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 79473 81308 gene locus_tag LOCUS_02500 79473 81308 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_02500 81308 81871 gene locus_tag LOCUS_02510 81308 81871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 82227 83156 gene locus_tag LOCUS_02520 82227 83156 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888190.1 protein_id gnl|my_center|LOCUS_02520 83362 84216 gene locus_tag LOCUS_02530 83362 84216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 protein_id gnl|my_center|LOCUS_02530 84255 84956 gene locus_tag LOCUS_02540 84255 84956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 85049 85669 gene locus_tag LOCUS_02550 85049 85669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 85663 86922 gene locus_tag LOCUS_02560 85663 86922 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087197.1 protein_id gnl|my_center|LOCUS_02560 87032 88000 gene locus_tag LOCUS_02570 87032 88000 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_02570 88313 88053 gene locus_tag LOCUS_02580 gene rnfH 88313 88053 CDS product protein RnfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC0 protein_id gnl|my_center|LOCUS_02580 89046 88369 gene locus_tag LOCUS_02590 gene rnfE 89046 88369 CDS product electron transport complex subunit RnfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC1 protein_id gnl|my_center|LOCUS_02590 89715 89071 gene locus_tag LOCUS_02600 gene rnfG 89715 89071 CDS product electron transport complex subunit RnfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC2 protein_id gnl|my_center|LOCUS_02600 90823 89717 gene locus_tag LOCUS_02610 gene rnfD 90823 89717 CDS product electron transport complex subunit RnfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC3 protein_id gnl|my_center|LOCUS_02610 92364 90826 gene locus_tag LOCUS_02620 gene rnfC 92364 90826 CDS product electron transport complex subunit RnfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC4 protein_id gnl|my_center|LOCUS_02620 92893 92366 gene locus_tag LOCUS_02630 gene rnfB 92893 92366 CDS product electron transport complex subunit RnfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC5 protein_id gnl|my_center|LOCUS_02630 93549 92977 gene locus_tag LOCUS_02640 gene rnfA 93549 92977 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_02640 93900 95498 gene locus_tag LOCUS_02650 93900 95498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 95508 97118 gene locus_tag LOCUS_02660 gene nifA 95508 97118 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_02660 97438 98970 gene locus_tag LOCUS_02670 gene nifB 97438 98970 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06770 protein_id gnl|my_center|LOCUS_02670 99026 99304 gene locus_tag LOCUS_02680 99026 99304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 99341 99817 gene locus_tag LOCUS_02690 99341 99817 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084576.1 protein_id gnl|my_center|LOCUS_02690 99814 100455 gene locus_tag LOCUS_02700 99814 100455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 100481 101302 gene locus_tag LOCUS_02710 100481 101302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 101314 101652 gene locus_tag LOCUS_02720 101314 101652 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL7 protein_id gnl|my_center|LOCUS_02720 101665 101934 gene locus_tag LOCUS_02730 gene yrbA 101665 101934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 protein_id gnl|my_center|LOCUS_02730 102109 102822 gene locus_tag LOCUS_02740 102109 102822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 103394 103957 gene locus_tag LOCUS_02750 103394 103957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 106662 104140 gene locus_tag LOCUS_02760 gene glgP 106662 104140 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_02760 108149 106683 gene locus_tag LOCUS_02770 gene glgA 108149 106683 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT93 protein_id gnl|my_center|LOCUS_02770 110344 108167 gene locus_tag LOCUS_02780 gene glgB 110344 108167 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_02780 111750 110359 gene locus_tag LOCUS_02790 111750 110359 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_02790 113490 111763 gene locus_tag LOCUS_02800 113490 111763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 114964 113690 gene locus_tag LOCUS_02810 gene glgC 114964 113690 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_02810 116399 115548 gene locus_tag LOCUS_02820 116399 115548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 protein_id gnl|my_center|LOCUS_02820 116988 117872 gene locus_tag LOCUS_02830 gene nifH 116988 117872 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C2 protein_id gnl|my_center|LOCUS_02830 118019 119497 gene locus_tag LOCUS_02840 gene nifD 118019 119497 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06121 protein_id gnl|my_center|LOCUS_02840 119598 121169 gene locus_tag LOCUS_02850 gene nifK 119598 121169 CDS product nitrogenase molybdenum-iron protein beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20621 protein_id gnl|my_center|LOCUS_02850 121382 121603 gene locus_tag LOCUS_02860 121382 121603 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_02860 121605 122327 gene locus_tag LOCUS_02870 121605 122327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 122324 122590 gene locus_tag LOCUS_02880 122324 122590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 122601 123341 gene locus_tag LOCUS_02890 122601 123341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_02890 123334 123744 gene locus_tag LOCUS_02900 123334 123744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 123728 124210 gene locus_tag LOCUS_02910 123728 124210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 124223 124747 gene locus_tag LOCUS_02920 124223 124747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 124747 125139 gene locus_tag LOCUS_02930 124747 125139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 125136 125426 gene locus_tag LOCUS_02940 125136 125426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 126700 125507 gene locus_tag LOCUS_02950 gene modC 126700 125507 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 protein_id gnl|my_center|LOCUS_02950 127383 126697 gene locus_tag LOCUS_02960 gene modC 127383 126697 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_02960 127945 127448 gene locus_tag LOCUS_02970 127945 127448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 128198 128455 gene locus_tag LOCUS_02980 128198 128455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 128466 130145 gene locus_tag LOCUS_02990 128466 130145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_02990 131175 130177 gene locus_tag LOCUS_03000 131175 130177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 137154 131305 gene locus_tag LOCUS_03010 137154 131305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 138399 137182 gene locus_tag LOCUS_03020 138399 137182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 138885 138418 gene locus_tag LOCUS_03030 138885 138418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 139950 138901 gene locus_tag LOCUS_03040 139950 138901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 142957 139967 gene locus_tag LOCUS_03050 142957 139967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 144824 143706 gene locus_tag LOCUS_03060 144824 143706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_03060 145380 147329 gene locus_tag LOCUS_03070 gene acsA 145380 147329 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K7 protein_id gnl|my_center|LOCUS_03070 147503 148186 gene locus_tag LOCUS_03080 147503 148186 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_03080 151705 148262 gene locus_tag LOCUS_03090 151705 148262 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_03090 151972 153771 gene locus_tag LOCUS_03100 151972 153771 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112968.1 protein_id gnl|my_center|LOCUS_03100 153771 154391 gene locus_tag LOCUS_03110 153771 154391 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_03110 155298 154366 gene locus_tag LOCUS_03120 gene hprA 155298 154366 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_03120 156102 155359 gene locus_tag LOCUS_03130 gene ysgA 156102 155359 CDS product putative tRNA/rRNA methyltransferase YsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94538 protein_id gnl|my_center|LOCUS_03130 156306 157748 gene locus_tag LOCUS_03140 gene gtfA 156306 157748 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence003 771 217 gene locus_tag LOCUS_03150 771 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 10846 917 gene locus_tag LOCUS_03160 10846 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10815 11012 gene locus_tag LOCUS_03170 10815 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12192 10930 gene locus_tag LOCUS_03180 12192 10930 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 protein_id gnl|my_center|LOCUS_03180 13472 12189 gene locus_tag LOCUS_03190 13472 12189 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070583.1 protein_id gnl|my_center|LOCUS_03190 13893 14636 gene locus_tag LOCUS_03200 13893 14636 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 protein_id gnl|my_center|LOCUS_03200 14640 15887 gene locus_tag LOCUS_03210 14640 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 16015 16704 gene locus_tag LOCUS_03220 16015 16704 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K87 protein_id gnl|my_center|LOCUS_03220 17021 19507 gene locus_tag LOCUS_03230 17021 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 19963 19769 gene locus_tag LOCUS_03240 19963 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03240 20252 20046 gene locus_tag LOCUS_03250 20252 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03250 20735 21223 gene locus_tag LOCUS_03260 20735 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 21623 21309 gene locus_tag LOCUS_03270 21623 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 21859 21623 gene locus_tag LOCUS_03280 21859 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 22241 21951 gene locus_tag LOCUS_03290 22241 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 22461 22234 gene locus_tag LOCUS_03300 22461 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 23777 22950 gene locus_tag LOCUS_03310 gene aroE 23777 22950 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43904 protein_id gnl|my_center|LOCUS_03310 24754 23804 gene locus_tag LOCUS_03320 gene hemF 24754 23804 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_03320 25337 24780 gene locus_tag LOCUS_03330 gene tsaC 25337 24780 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_03330 25605 25886 gene locus_tag LOCUS_03340 25605 25886 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105966.1 protein_id gnl|my_center|LOCUS_03340 25886 26164 gene locus_tag LOCUS_03350 25886 26164 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578476.1 protein_id gnl|my_center|LOCUS_03350 26549 26247 gene locus_tag LOCUS_03360 26549 26247 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_03360 26856 26542 gene locus_tag LOCUS_03370 26856 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 protein_id gnl|my_center|LOCUS_03370 27265 26978 gene locus_tag LOCUS_03380 gene higA-2 27265 26978 CDS product antitoxin HigA-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMA5 protein_id gnl|my_center|LOCUS_03380 27554 27258 gene locus_tag LOCUS_03390 27554 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 28885 27659 gene locus_tag LOCUS_03400 28885 27659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 29441 29659 gene locus_tag LOCUS_03410 29441 29659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 31057 29981 gene locus_tag LOCUS_03420 gene smf 31057 29981 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_03420 32198 31143 gene locus_tag LOCUS_03430 32198 31143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_03430 32356 32877 gene locus_tag LOCUS_03440 gene def 32356 32877 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S9 protein_id gnl|my_center|LOCUS_03440 32877 33905 gene locus_tag LOCUS_03450 gene fmt 32877 33905 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_03450 33902 35278 gene locus_tag LOCUS_03460 gene rsmB 33902 35278 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_03460 35281 36654 gene locus_tag LOCUS_03470 gene trkA 35281 36654 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_03470 36680 38128 gene locus_tag LOCUS_03480 gene trkH 36680 38128 CDS product Trk system potassium uptake protein TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN7 protein_id gnl|my_center|LOCUS_03480 39042 38161 gene locus_tag LOCUS_03490 39042 38161 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_03490 39179 40825 gene locus_tag LOCUS_03500 39179 40825 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_03500 40822 41463 gene locus_tag LOCUS_03510 40822 41463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 41751 42782 gene locus_tag LOCUS_03520 gene glyQ 41751 42782 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_03520 42782 44860 gene locus_tag LOCUS_03530 gene glyS 42782 44860 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_03530 45631 44960 gene locus_tag LOCUS_03540 45631 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45895 46548 gene locus_tag LOCUS_03550 45895 46548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 46545 47366 gene locus_tag LOCUS_03560 46545 47366 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099156.1 protein_id gnl|my_center|LOCUS_03560 47379 47624 gene locus_tag LOCUS_03570 gene acpP 47379 47624 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9B5 protein_id gnl|my_center|LOCUS_03570 47651 48208 gene locus_tag LOCUS_03580 47651 48208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707159.1 protein_id gnl|my_center|LOCUS_03580 48201 49955 gene locus_tag LOCUS_03590 48201 49955 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105310.1 protein_id gnl|my_center|LOCUS_03590 49980 51518 gene locus_tag LOCUS_03600 49980 51518 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_03600 51515 51922 gene locus_tag LOCUS_03610 51515 51922 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_03610 51919 52530 gene locus_tag LOCUS_03620 51919 52530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 52511 54916 gene locus_tag LOCUS_03630 52511 54916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_03630 54909 55502 gene locus_tag LOCUS_03640 54909 55502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 55505 56692 gene locus_tag LOCUS_03650 55505 56692 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_03650 56682 57158 gene locus_tag LOCUS_03660 56682 57158 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074035.1 protein_id gnl|my_center|LOCUS_03660 57151 57882 gene locus_tag LOCUS_03670 57151 57882 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 protein_id gnl|my_center|LOCUS_03670 57882 59105 gene locus_tag LOCUS_03680 gene fabF 57882 59105 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_03680 60390 59152 gene locus_tag LOCUS_03690 60390 59152 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_03690 60612 60872 gene locus_tag LOCUS_03700 60612 60872 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707161.1 protein_id gnl|my_center|LOCUS_03700 60888 61646 gene locus_tag LOCUS_03710 60888 61646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 61643 62638 gene locus_tag LOCUS_03720 61643 62638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03720 62763 63314 gene locus_tag LOCUS_03730 gene gmhB 62763 63314 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_03730 63485 64306 gene locus_tag LOCUS_03740 gene lptA 63485 64306 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_03740 64583 65095 gene locus_tag LOCUS_03750 64583 65095 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_03750 66580 65390 gene locus_tag LOCUS_03760 gene fabV 66580 65390 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 protein_id gnl|my_center|LOCUS_03760 69297 66880 gene locus_tag LOCUS_03770 gene gyrB 69297 66880 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_03770 70447 69353 gene locus_tag LOCUS_03780 gene recF 70447 69353 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C3 protein_id gnl|my_center|LOCUS_03780 71554 70454 gene locus_tag LOCUS_03790 71554 70454 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_03790 73067 71571 gene locus_tag LOCUS_03800 gene dnaA 73067 71571 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C5 protein_id gnl|my_center|LOCUS_03800 74405 76054 gene locus_tag LOCUS_03810 gene yidC 74405 76054 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_03810 76157 77551 gene locus_tag LOCUS_03820 gene mnmE 76157 77551 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_03820 78474 77926 gene locus_tag LOCUS_03830 78474 77926 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947683.1 protein_id gnl|my_center|LOCUS_03830 78673 79512 gene locus_tag LOCUS_03840 78673 79512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 79737 80456 gene locus_tag LOCUS_03850 79737 80456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 80982 82997 gene locus_tag LOCUS_03860 gene mnmG 80982 82997 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F5X1 protein_id gnl|my_center|LOCUS_03860 83213 83887 gene locus_tag LOCUS_03870 gene rsmG 83213 83887 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64238 protein_id gnl|my_center|LOCUS_03870 83909 84679 gene locus_tag LOCUS_03880 83909 84679 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377884.1 protein_id gnl|my_center|LOCUS_03880 84718 85620 gene locus_tag LOCUS_03890 gene spoOJ 84718 85620 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_03890 85940 86266 gene locus_tag LOCUS_03900 85940 86266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 86288 87199 gene locus_tag LOCUS_03910 gene atpB 86288 87199 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_03910 87250 87477 gene locus_tag LOCUS_03920 gene atpE 87250 87477 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_03920 87532 88002 gene locus_tag LOCUS_03930 gene atpF 87532 88002 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_03930 88014 88550 gene locus_tag LOCUS_03940 gene atpH 88014 88550 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_03940 88566 90104 gene locus_tag LOCUS_03950 gene atpA 88566 90104 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT2 protein_id gnl|my_center|LOCUS_03950 90171 91031 gene locus_tag LOCUS_03960 gene atpG 90171 91031 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_03960 91071 92465 gene locus_tag LOCUS_03970 gene atpD 91071 92465 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C0 protein_id gnl|my_center|LOCUS_03970 92524 92952 gene locus_tag LOCUS_03980 gene atpC 92524 92952 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_03980 93097 93678 gene locus_tag LOCUS_03990 93097 93678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 94673 93714 gene locus_tag LOCUS_04000 94673 93714 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_04000 97111 94670 gene locus_tag LOCUS_04010 97111 94670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 98070 97108 gene locus_tag LOCUS_04020 98070 97108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_04020 98296 98547 gene locus_tag LOCUS_04030 98296 98547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 100198 98786 gene locus_tag LOCUS_04040 gene argH 100198 98786 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_04040 100425 101510 gene locus_tag LOCUS_04050 gene algZ 100425 101510 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_04050 101485 102216 gene locus_tag LOCUS_04060 gene algR 101485 102216 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_04060 102349 103290 gene locus_tag LOCUS_04070 gene hemC 102349 103290 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_04070 103294 104037 gene locus_tag LOCUS_04080 gene hemD 103294 104037 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_04080 104083 105396 gene locus_tag LOCUS_04090 104083 105396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 105393 106601 gene locus_tag LOCUS_04100 105393 106601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_04100 107884 106640 gene locus_tag LOCUS_04110 107884 106640 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_04110 108838 108002 gene locus_tag LOCUS_04120 108838 108002 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_04120 110074 109007 gene locus_tag LOCUS_04130 110074 109007 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 protein_id gnl|my_center|LOCUS_04130 111555 110071 gene locus_tag LOCUS_04140 gene ubiD 111555 110071 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_04140 111469 111657 gene locus_tag LOCUS_04150 111469 111657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 111743 112135 gene locus_tag LOCUS_04160 gene ygdD 111743 112135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_04160 112152 112940 gene locus_tag LOCUS_04170 gene trmB 112152 112940 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_04170 113046 113339 gene locus_tag LOCUS_04180 113046 113339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence004 142 1197 gene locus_tag LOCUS_04190 142 1197 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530418.1 protein_id gnl|my_center|LOCUS_04190 2137 1319 gene locus_tag LOCUS_04200 2137 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2558 2034 gene locus_tag LOCUS_04210 2558 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3950 2637 gene locus_tag LOCUS_04220 3950 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5516 3972 gene locus_tag LOCUS_04230 5516 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7631 5697 gene locus_tag LOCUS_04240 7631 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04240 8114 7695 gene locus_tag LOCUS_04250 8114 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9101 8151 gene locus_tag LOCUS_04260 9101 8151 CDS product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMB1 protein_id gnl|my_center|LOCUS_04260 9494 9186 gene locus_tag LOCUS_04270 9494 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 10506 10084 gene locus_tag LOCUS_04280 10506 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11341 10586 gene locus_tag LOCUS_04290 gene cylG 11341 10586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861303.1 protein_id gnl|my_center|LOCUS_04290 12725 11760 gene locus_tag LOCUS_04300 12725 11760 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_04300 12909 13832 gene locus_tag LOCUS_04310 12909 13832 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704694.1 protein_id gnl|my_center|LOCUS_04310 13846 14013 gene locus_tag LOCUS_04320 13846 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14053 14205 gene locus_tag LOCUS_04330 14053 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14740 14898 gene locus_tag LOCUS_04340 14740 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 15802 14996 gene locus_tag LOCUS_04350 15802 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 16035 17153 gene locus_tag LOCUS_04360 gene potA1 16035 17153 CDS product spermidine/putrescine import ATP-binding protein PotA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6T2 protein_id gnl|my_center|LOCUS_04360 17157 18053 gene locus_tag LOCUS_04370 17157 18053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337461.1 protein_id gnl|my_center|LOCUS_04370 18078 18887 gene locus_tag LOCUS_04380 18078 18887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 protein_id gnl|my_center|LOCUS_04380 18945 20006 gene locus_tag LOCUS_04390 18945 20006 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLE5 protein_id gnl|my_center|LOCUS_04390 20057 20839 gene locus_tag LOCUS_04400 20057 20839 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_04400 21136 21465 gene locus_tag LOCUS_04410 21136 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 21826 22323 gene locus_tag LOCUS_04420 gene gpt 21826 22323 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 protein_id gnl|my_center|LOCUS_04420 22716 23444 gene locus_tag LOCUS_04430 gene tsx 22716 23444 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_04430 24486 23527 gene locus_tag LOCUS_04440 gene pip 24486 23527 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJI8 protein_id gnl|my_center|LOCUS_04440 24918 26312 gene locus_tag LOCUS_04450 24918 26312 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 protein_id gnl|my_center|LOCUS_04450 26441 27088 gene locus_tag LOCUS_04460 26441 27088 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_04460 27650 27324 gene locus_tag LOCUS_04470 27650 27324 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975193.1 protein_id gnl|my_center|LOCUS_04470 28490 27765 gene locus_tag LOCUS_04480 28490 27765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 31737 28684 gene locus_tag LOCUS_04490 gene soxA-2 31737 28684 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104013.1 protein_id gnl|my_center|LOCUS_04490 32027 31737 gene locus_tag LOCUS_04500 gene soxD-2 32027 31737 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_04500 33375 32116 gene locus_tag LOCUS_04510 gene soxB-2 33375 32116 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_04510 34284 33397 gene locus_tag LOCUS_04520 gene folD2 34284 33397 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA4 protein_id gnl|my_center|LOCUS_04520 35160 34294 gene locus_tag LOCUS_04530 gene purU 35160 34294 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA3 protein_id gnl|my_center|LOCUS_04530 36804 35470 gene locus_tag LOCUS_04540 36804 35470 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367224.1 protein_id gnl|my_center|LOCUS_04540 37511 36828 gene locus_tag LOCUS_04550 37511 36828 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_04550 38446 37550 gene locus_tag LOCUS_04560 38446 37550 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 protein_id gnl|my_center|LOCUS_04560 40011 38662 gene locus_tag LOCUS_04570 40011 38662 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_04570 40309 40899 gene locus_tag LOCUS_04580 40309 40899 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_04580 42881 41472 gene locus_tag LOCUS_04590 42881 41472 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_04590 44313 43087 gene locus_tag LOCUS_04600 44313 43087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104352.1 protein_id gnl|my_center|LOCUS_04600 46295 44649 gene locus_tag LOCUS_04610 46295 44649 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_04610 47252 46323 gene locus_tag LOCUS_04620 gene etfA-2 47252 46323 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_04620 48012 47263 gene locus_tag LOCUS_04630 gene etfB 48012 47263 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_04630 48320 48009 gene locus_tag LOCUS_04640 48320 48009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 48999 48544 gene locus_tag LOCUS_04650 48999 48544 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_04650 51422 48981 gene locus_tag LOCUS_04660 51422 48981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_04660 52490 51438 gene locus_tag LOCUS_04670 52490 51438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 53918 52569 gene locus_tag LOCUS_04680 53918 52569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_04680 55681 53939 gene locus_tag LOCUS_04690 55681 53939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_04690 55753 55962 gene locus_tag LOCUS_04700 55753 55962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 57028 56252 gene locus_tag LOCUS_04710 57028 56252 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_04710 57822 57052 gene locus_tag LOCUS_04720 57822 57052 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258311.1 protein_id gnl|my_center|LOCUS_04720 59009 57891 gene locus_tag LOCUS_04730 59009 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 60662 59064 gene locus_tag LOCUS_04740 gene caiC 60662 59064 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_04740 61903 60674 gene locus_tag LOCUS_04750 61903 60674 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_04750 63109 61937 gene locus_tag LOCUS_04760 63109 61937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_04760 63944 66271 gene locus_tag LOCUS_04770 63944 66271 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_04770 67444 66548 gene locus_tag LOCUS_04780 gene dhcR 67444 66548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_04780 68850 67561 gene locus_tag LOCUS_04790 68850 67561 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_04790 70241 69141 gene locus_tag LOCUS_04800 gene mdh 70241 69141 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_04800 71730 70711 gene locus_tag LOCUS_04810 71730 70711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_04810 72820 71849 gene locus_tag LOCUS_04820 72820 71849 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067516.1 protein_id gnl|my_center|LOCUS_04820 73368 72820 gene locus_tag LOCUS_04830 73368 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 protein_id gnl|my_center|LOCUS_04830 73812 73459 gene locus_tag LOCUS_04840 73812 73459 CDS product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728064.1 protein_id gnl|my_center|LOCUS_04840 76132 73862 gene locus_tag LOCUS_04850 76132 73862 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968355.1 protein_id gnl|my_center|LOCUS_04850 76712 77821 gene locus_tag LOCUS_04860 76712 77821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 77818 78570 gene locus_tag LOCUS_04870 gene narL 77818 78570 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 protein_id gnl|my_center|LOCUS_04870 78567 79367 gene locus_tag LOCUS_04880 78567 79367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 79540 79385 gene locus_tag LOCUS_04890 79540 79385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 80070 79579 gene locus_tag LOCUS_04900 80070 79579 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_04900 81108 80104 gene locus_tag LOCUS_04910 81108 80104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 protein_id gnl|my_center|LOCUS_04910 81360 82436 gene locus_tag LOCUS_04920 81360 82436 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_04920 84037 82664 gene locus_tag LOCUS_04930 84037 82664 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_04930 85411 84134 gene locus_tag LOCUS_04940 85411 84134 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_04940 86646 85408 gene locus_tag LOCUS_04950 86646 85408 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_04950 87884 86703 gene locus_tag LOCUS_04960 87884 86703 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_04960 88936 89109 gene locus_tag LOCUS_04970 88936 89109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 89738 89361 gene locus_tag LOCUS_04980 89738 89361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 90454 89822 gene locus_tag LOCUS_04990 90454 89822 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FS8 protein_id gnl|my_center|LOCUS_04990 91769 90519 gene locus_tag LOCUS_05000 91769 90519 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_05000 92213 92869 gene locus_tag LOCUS_05010 92213 92869 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_05010 93024 94682 gene locus_tag LOCUS_05020 gene pgi 93024 94682 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY4 protein_id gnl|my_center|LOCUS_05020 95627 94800 gene locus_tag LOCUS_05030 95627 94800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 96611 95790 gene locus_tag LOCUS_05040 gene mutM 96611 95790 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHR7 protein_id gnl|my_center|LOCUS_05040 96891 96733 gene locus_tag LOCUS_05050 gene rpmG 96891 96733 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_05050 97139 96903 gene locus_tag LOCUS_05060 gene rpmB 97139 96903 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_05060 98238 97309 gene locus_tag LOCUS_05070 98238 97309 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence005 <1 893 gene locus_tag LOCUS_05080 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957282.1:cell filamentation protein Fic 890 4015 gene locus_tag LOCUS_05090 890 4015 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706627.1 protein_id gnl|my_center|LOCUS_05090 4522 4280 gene locus_tag LOCUS_05100 4522 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4940 4548 gene locus_tag LOCUS_05110 4940 4548 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 protein_id gnl|my_center|LOCUS_05110 5369 5647 gene locus_tag LOCUS_05120 5369 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9133 5876 gene locus_tag LOCUS_05130 9133 5876 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_05130 10215 9139 gene locus_tag LOCUS_05140 10215 9139 CDS product multidrug transporter AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_05140 10565 10801 gene locus_tag LOCUS_05150 gene grxA 10565 10801 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 protein_id gnl|my_center|LOCUS_05150 12069 10912 gene locus_tag LOCUS_05160 gene nhaA 12069 10912 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG33 protein_id gnl|my_center|LOCUS_05160 12306 13286 gene locus_tag LOCUS_05170 12306 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 13388 14899 gene locus_tag LOCUS_05180 13388 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 14903 15787 gene locus_tag LOCUS_05190 14903 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 15790 19455 gene locus_tag LOCUS_05200 15790 19455 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_05200 20291 20614 gene locus_tag LOCUS_05210 20291 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 21695 20715 gene locus_tag LOCUS_05220 gene dusA 21695 20715 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_05220 22327 21692 gene locus_tag LOCUS_05230 gene hflD 22327 21692 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 protein_id gnl|my_center|LOCUS_05230 23445 22324 gene locus_tag LOCUS_05240 gene mnmA 23445 22324 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_05240 23896 23447 gene locus_tag LOCUS_05250 23896 23447 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_05250 24658 23999 gene locus_tag LOCUS_05260 24658 23999 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_05260 24912 27146 gene locus_tag LOCUS_05270 gene icd 24912 27146 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_05270 27577 27314 gene locus_tag LOCUS_05280 gene cspD 27577 27314 CDS product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211350.1 protein_id gnl|my_center|LOCUS_05280 27700 28092 gene locus_tag LOCUS_05290 gene clpS 27700 28092 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK6 protein_id gnl|my_center|LOCUS_05290 28104 30368 gene locus_tag LOCUS_05300 gene clpA 28104 30368 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_05300 30645 30427 gene locus_tag LOCUS_05310 gene infA 30645 30427 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_05310 31413 30712 gene locus_tag LOCUS_05320 gene ate 31413 30712 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_05320 31497 31616 gene locus_tag LOCUS_05330 31497 31616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 32186 35008 gene locus_tag LOCUS_05340 32186 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 35142 35801 gene locus_tag LOCUS_05350 gene lolA 35142 35801 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_05350 35801 37156 gene locus_tag LOCUS_05360 35801 37156 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_05360 37179 37565 gene locus_tag LOCUS_05370 gene crcB 37179 37565 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF5 protein_id gnl|my_center|LOCUS_05370 37664 38947 gene locus_tag LOCUS_05380 gene serS 37664 38947 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RS1 protein_id gnl|my_center|LOCUS_05380 38944 40317 gene locus_tag LOCUS_05390 gene cysG 38944 40317 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_05390 41383 40361 gene locus_tag LOCUS_05400 41383 40361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108776.1 protein_id gnl|my_center|LOCUS_05400 41733 41380 gene locus_tag LOCUS_05410 41733 41380 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_05410 42008 41730 gene locus_tag LOCUS_05420 42008 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 42366 42010 gene locus_tag LOCUS_05430 42366 42010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 42818 42366 gene locus_tag LOCUS_05440 42818 42366 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 protein_id gnl|my_center|LOCUS_05440 43137 44366 gene locus_tag LOCUS_05450 gene proV 43137 44366 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212210.1 protein_id gnl|my_center|LOCUS_05450 44363 45484 gene locus_tag LOCUS_05460 44363 45484 CDS product proline/betaine ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370072.1 protein_id gnl|my_center|LOCUS_05460 45496 46494 gene locus_tag LOCUS_05470 gene proX 45496 46494 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215933.1 protein_id gnl|my_center|LOCUS_05470 46884 47498 gene locus_tag LOCUS_05480 46884 47498 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_05480 47721 47631 gene locus_tag LOCUS_t00030 47721 47631 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48757 47810 gene locus_tag LOCUS_05490 48757 47810 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_05490 48835 51549 gene locus_tag LOCUS_05500 48835 51549 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_05500 51632 52279 gene locus_tag LOCUS_05510 gene gacA 51632 52279 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_05510 52280 54103 gene locus_tag LOCUS_05520 gene uvrC 52280 54103 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_05520 54173 54718 gene locus_tag LOCUS_05530 gene pgsA 54173 54718 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_05530 54806 54881 gene locus_tag LOCUS_t00040 54806 54881 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54994 55067 gene locus_tag LOCUS_t00050 54994 55067 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 55119 55205 gene locus_tag LOCUS_t00060 55119 55205 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55486 55343 gene locus_tag LOCUS_05540 55486 55343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 55535 56050 gene locus_tag LOCUS_05550 55535 56050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_05550 57628 56033 gene locus_tag LOCUS_05560 57628 56033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 59232 57658 gene locus_tag LOCUS_05570 59232 57658 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_05570 59346 60122 gene locus_tag LOCUS_05580 59346 60122 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_05580 60138 60572 gene locus_tag LOCUS_05590 gene rnhA 60138 60572 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVL1 protein_id gnl|my_center|LOCUS_05590 60569 61285 gene locus_tag LOCUS_05600 60569 61285 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 protein_id gnl|my_center|LOCUS_05600 62856 61345 gene locus_tag LOCUS_05610 gene nhaB 62856 61345 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_05610 63388 65031 gene locus_tag LOCUS_05620 63388 65031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 65037 65678 gene locus_tag LOCUS_05630 65037 65678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_05630 66052 65738 gene locus_tag LOCUS_05640 66052 65738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_05640 66272 67333 gene locus_tag LOCUS_05650 66272 67333 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402788.1 protein_id gnl|my_center|LOCUS_05650 68665 67505 gene locus_tag LOCUS_05660 68665 67505 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_05660 69353 68859 gene locus_tag LOCUS_05670 69353 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_05670 71004 69337 gene locus_tag LOCUS_05680 gene cysI 71004 69337 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_05680 71907 71155 gene locus_tag LOCUS_05690 71907 71155 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768957.1 protein_id gnl|my_center|LOCUS_05690 73287 71929 gene locus_tag LOCUS_05700 73287 71929 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_05700 76998 73291 gene locus_tag LOCUS_05710 gene metH 76998 73291 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_05710 77130 77747 gene locus_tag LOCUS_05720 gene nfuA 77130 77747 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_05720 78148 77846 gene locus_tag LOCUS_05730 78148 77846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 78402 79580 gene locus_tag LOCUS_05740 78402 79580 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_05740 79577 80068 gene locus_tag LOCUS_05750 79577 80068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_05750 80087 81112 gene locus_tag LOCUS_05760 gene gpsA 80087 81112 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_05760 81127 81450 gene locus_tag LOCUS_05770 81127 81450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 81504 81968 gene locus_tag LOCUS_05780 gene sixA 81504 81968 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209707.1 protein_id gnl|my_center|LOCUS_05780 82047 82880 gene locus_tag LOCUS_05790 82047 82880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706060.1 protein_id gnl|my_center|LOCUS_05790 82877 83590 gene locus_tag LOCUS_05800 82877 83590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 84233 83598 gene locus_tag LOCUS_05810 gene rluA 84233 83598 CDS product ribosomal large subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD3 protein_id gnl|my_center|LOCUS_05810 85530 84226 gene locus_tag LOCUS_05820 85530 84226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 86945 85578 gene locus_tag LOCUS_05830 gene yegQ 86945 85578 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_05830 87589 87068 gene locus_tag LOCUS_05840 87589 87068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 88738 87626 gene locus_tag LOCUS_05850 gene rlmG 88738 87626 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE2 protein_id gnl|my_center|LOCUS_05850 89088 88738 gene locus_tag LOCUS_05860 89088 88738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 89304 90167 gene locus_tag LOCUS_05870 89304 90167 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268873.1 protein_id gnl|my_center|LOCUS_05870 90214 91182 gene locus_tag LOCUS_05880 90214 91182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 91607 91266 gene locus_tag LOCUS_05890 91607 91266 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_05890 92796 91702 gene locus_tag LOCUS_05900 92796 91702 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_05900 92979 93914 gene locus_tag LOCUS_05910 gene apbE 92979 93914 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_05910 93925 94158 gene locus_tag LOCUS_05920 93925 94158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_05920 94238 95629 gene locus_tag LOCUS_05930 gene sthA 94238 95629 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_05930 >Feature sequence006 652 1665 gene locus_tag LOCUS_05940 652 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1665 2330 gene locus_tag LOCUS_05950 1665 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2327 3112 gene locus_tag LOCUS_05960 2327 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3105 3524 gene locus_tag LOCUS_05970 3105 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3521 5185 gene locus_tag LOCUS_05980 gene mshL 3521 5185 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_05980 5182 5556 gene locus_tag LOCUS_05990 5182 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5572 7284 gene locus_tag LOCUS_06000 5572 7284 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_06000 7284 8513 gene locus_tag LOCUS_06010 7284 8513 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_06010 9478 8711 gene locus_tag LOCUS_06020 gene hbdH1 9478 8711 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037308.1 protein_id gnl|my_center|LOCUS_06020 9910 10359 gene locus_tag LOCUS_06030 9910 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10366 10851 gene locus_tag LOCUS_06040 10366 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 10842 11360 gene locus_tag LOCUS_06050 gene mshD 10842 11360 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_06050 11360 12199 gene locus_tag LOCUS_06060 gene mshO 11360 12199 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_06060 12318 12665 gene locus_tag LOCUS_06070 12318 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12662 16258 gene locus_tag LOCUS_06080 12662 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 17731 16307 gene locus_tag LOCUS_06090 gene ntrC 17731 16307 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_06090 18810 17728 gene locus_tag LOCUS_06100 gene ntrB 18810 17728 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103111.1 protein_id gnl|my_center|LOCUS_06100 19235 19975 gene locus_tag LOCUS_06110 19235 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 20440 20012 gene locus_tag LOCUS_06120 gene thi3 20440 20012 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_06120 22431 20542 gene locus_tag LOCUS_06130 gene dsbD 22431 20542 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9P5 protein_id gnl|my_center|LOCUS_06130 23429 22461 gene locus_tag LOCUS_06140 23429 22461 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_06140 23610 24029 gene locus_tag LOCUS_06150 23610 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 24121 24378 gene locus_tag LOCUS_06160 gene rpmA 24121 24378 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_06160 24478 25680 gene locus_tag LOCUS_06170 gene obg 24478 25680 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_06170 25815 26963 gene locus_tag LOCUS_06180 gene proB 25815 26963 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_06180 27052 27894 gene locus_tag LOCUS_06190 gene kdsA 27052 27894 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_06190 28015 28281 gene locus_tag LOCUS_06200 gene rpsT 28015 28281 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ7 protein_id gnl|my_center|LOCUS_06200 28509 30008 gene locus_tag LOCUS_06210 gene murJ 28509 30008 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_06210 30161 31177 gene locus_tag LOCUS_06220 30161 31177 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ5 protein_id gnl|my_center|LOCUS_06220 31167 34073 gene locus_tag LOCUS_06230 gene ileS 31167 34073 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_06230 34073 34594 gene locus_tag LOCUS_06240 gene lspA 34073 34594 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ3 protein_id gnl|my_center|LOCUS_06240 34693 35151 gene locus_tag LOCUS_06250 34693 35151 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E2 protein_id gnl|my_center|LOCUS_06250 35141 36085 gene locus_tag LOCUS_06260 gene ispH 35141 36085 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_06260 36662 36216 gene locus_tag LOCUS_06270 gene pilE 36662 36216 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_06270 37541 36702 gene locus_tag LOCUS_06280 37541 36702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 38146 37538 gene locus_tag LOCUS_06290 38146 37538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 38642 38139 gene locus_tag LOCUS_06300 38642 38139 CDS product general secretion pathway protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266582.1 protein_id gnl|my_center|LOCUS_06300 42289 38639 gene locus_tag LOCUS_06310 42289 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 42657 42304 gene locus_tag LOCUS_06320 42657 42304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 43268 42678 gene locus_tag LOCUS_06330 43268 42678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 44038 43484 gene locus_tag LOCUS_06340 44038 43484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 45558 44194 gene locus_tag LOCUS_06350 gene pilR 45558 44194 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_06350 47093 45555 gene locus_tag LOCUS_06360 gene pilS 47093 45555 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_06360 47208 48842 gene locus_tag LOCUS_06370 gene nadE 47208 48842 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_06370 49796 48975 gene locus_tag LOCUS_06380 gene bamD 49796 48975 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889C4 protein_id gnl|my_center|LOCUS_06380 49925 50890 gene locus_tag LOCUS_06390 gene rluD 49925 50890 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_06390 50871 51605 gene locus_tag LOCUS_06400 50871 51605 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EK85 protein_id gnl|my_center|LOCUS_06400 52073 51615 gene locus_tag LOCUS_06410 52073 51615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_06410 52462 54186 gene locus_tag LOCUS_06420 gene ilvB 52462 54186 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N6 protein_id gnl|my_center|LOCUS_06420 54188 54682 gene locus_tag LOCUS_06430 gene ilvH 54188 54682 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_06430 55435 54782 gene locus_tag LOCUS_06440 gene coq7 55435 54782 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_06440 55599 57086 gene locus_tag LOCUS_06450 55599 57086 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_06450 59354 57096 gene locus_tag LOCUS_06460 gene retS 59354 57096 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_06460 60846 59545 gene locus_tag LOCUS_06470 gene purD 60846 59545 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5D9 protein_id gnl|my_center|LOCUS_06470 62570 60942 gene locus_tag LOCUS_06480 gene purH 62570 60942 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_06480 62975 62661 gene locus_tag LOCUS_06490 62975 62661 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_06490 63838 62972 gene locus_tag LOCUS_06500 gene dusB 63838 62972 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_06500 65655 64093 gene locus_tag LOCUS_06510 65655 64093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 66596 65703 gene locus_tag LOCUS_06520 gene prmA 66596 65703 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_06520 67043 67411 gene locus_tag LOCUS_06530 67043 67411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 67799 67521 gene locus_tag LOCUS_06540 67799 67521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 68529 68296 gene locus_tag LOCUS_06550 gene yacG 68529 68296 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH32 protein_id gnl|my_center|LOCUS_06550 69229 68591 gene locus_tag LOCUS_06560 gene coaE 69229 68591 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_06560 70267 69380 gene locus_tag LOCUS_06570 gene pilD 70267 69380 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 protein_id gnl|my_center|LOCUS_06570 71499 70270 gene locus_tag LOCUS_06580 71499 70270 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_06580 73246 71552 gene locus_tag LOCUS_06590 gene pilB 73246 71552 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_06590 74486 73386 gene locus_tag LOCUS_06600 gene tnpA 74486 73386 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071337.1 protein_id gnl|my_center|LOCUS_06600 75113 74610 gene locus_tag LOCUS_06610 75113 74610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 75544 75750 gene locus_tag LOCUS_06620 75544 75750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 77063 75762 gene locus_tag LOCUS_06630 77063 75762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 79430 77118 gene locus_tag LOCUS_06640 79430 77118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 81941 79986 gene locus_tag LOCUS_06650 81941 79986 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_06650 82860 81910 gene locus_tag LOCUS_06660 gene panE-2 82860 81910 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ9 protein_id gnl|my_center|LOCUS_06660 83170 83655 gene locus_tag LOCUS_06670 83170 83655 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_06670 83655 85064 gene locus_tag LOCUS_06680 83655 85064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_06680 85168 85908 gene locus_tag LOCUS_06690 85168 85908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 85920 87908 gene locus_tag LOCUS_06700 85920 87908 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_06700 88716 88057 gene locus_tag LOCUS_06710 gene pphA 88716 88057 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930070.1 protein_id gnl|my_center|LOCUS_06710 90092 88719 gene locus_tag LOCUS_06720 90092 88719 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 protein_id gnl|my_center|LOCUS_06720 90812 90180 gene locus_tag LOCUS_06730 90812 90180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence007 693 193 gene locus_tag LOCUS_06740 693 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1703 690 gene locus_tag LOCUS_06750 1703 690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_06750 2284 2015 gene locus_tag LOCUS_06760 2284 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2770 2549 gene locus_tag LOCUS_06770 2770 2549 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_06770 3727 2957 gene locus_tag LOCUS_06780 3727 2957 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_06780 3855 4991 gene locus_tag LOCUS_06790 3855 4991 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_06790 6355 5051 gene locus_tag LOCUS_06800 gene hisD 6355 5051 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_06800 7019 6369 gene locus_tag LOCUS_06810 gene hisG 7019 6369 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_06810 8314 7049 gene locus_tag LOCUS_06820 gene murA 8314 7049 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_06820 8574 8329 gene locus_tag LOCUS_06830 8574 8329 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_06830 9070 8759 gene locus_tag LOCUS_06840 9070 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9738 9070 gene locus_tag LOCUS_06850 9738 9070 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766521.1 protein_id gnl|my_center|LOCUS_06850 10332 9871 gene locus_tag LOCUS_06860 10332 9871 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_06860 11117 10335 gene locus_tag LOCUS_06870 11117 10335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 protein_id gnl|my_center|LOCUS_06870 12049 11120 gene locus_tag LOCUS_06880 gene mlaF 12049 11120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_06880 12139 13104 gene locus_tag LOCUS_06890 12139 13104 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_06890 13124 14101 gene locus_tag LOCUS_06900 gene kdsD 13124 14101 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_06900 14101 14664 gene locus_tag LOCUS_06910 14101 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14654 15190 gene locus_tag LOCUS_06920 gene lptA 14654 15190 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV7 protein_id gnl|my_center|LOCUS_06920 15187 15912 gene locus_tag LOCUS_06930 15187 15912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_06930 16042 17532 gene locus_tag LOCUS_06940 16042 17532 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU5 protein_id gnl|my_center|LOCUS_06940 17584 17886 gene locus_tag LOCUS_06950 17584 17886 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_06950 17890 18348 gene locus_tag LOCUS_06960 17890 18348 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 protein_id gnl|my_center|LOCUS_06960 18375 19247 gene locus_tag LOCUS_06970 18375 19247 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_06970 19285 19554 gene locus_tag LOCUS_06980 19285 19554 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400240.1 protein_id gnl|my_center|LOCUS_06980 19728 21083 gene locus_tag LOCUS_06990 19728 21083 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_06990 21157 21669 gene locus_tag LOCUS_07000 21157 21669 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_07000 22614 21862 gene locus_tag LOCUS_07010 22614 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 22877 22617 gene locus_tag LOCUS_07020 22877 22617 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 protein_id gnl|my_center|LOCUS_07020 23140 24168 gene locus_tag LOCUS_07030 23140 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 24740 24174 gene locus_tag LOCUS_07040 24740 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 25329 24727 gene locus_tag LOCUS_07050 25329 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231615.2 protein_id gnl|my_center|LOCUS_07050 27363 25384 gene locus_tag LOCUS_07060 27363 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 28024 27614 gene locus_tag LOCUS_07070 28024 27614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 29100 28273 gene locus_tag LOCUS_07080 29100 28273 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD9 protein_id gnl|my_center|LOCUS_07080 30634 29342 gene locus_tag LOCUS_07090 gene purA 30634 29342 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_07090 31823 30642 gene locus_tag LOCUS_07100 gene hisZ 31823 30642 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_07100 32049 31837 gene locus_tag LOCUS_07110 32049 31837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_07110 33079 32210 gene locus_tag LOCUS_07120 33079 32210 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_07120 34275 33079 gene locus_tag LOCUS_07130 gene hflK 34275 33079 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_07130 35733 34423 gene locus_tag LOCUS_07140 gene hflX 35733 34423 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_07140 36007 35756 gene locus_tag LOCUS_07150 gene hfq 36007 35756 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_07150 37042 36086 gene locus_tag LOCUS_07160 gene miaA 37042 36086 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY1 protein_id gnl|my_center|LOCUS_07160 38961 37042 gene locus_tag LOCUS_07170 gene mutL 38961 37042 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_07170 40351 38969 gene locus_tag LOCUS_07180 40351 38969 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266494.1 protein_id gnl|my_center|LOCUS_07180 40854 40348 gene locus_tag LOCUS_07190 gene yjeE 40854 40348 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_07190 42556 41030 gene locus_tag LOCUS_07200 gene nnr 42556 41030 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_07200 42722 43801 gene locus_tag LOCUS_07210 gene queG 42722 43801 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_07210 45005 43869 gene locus_tag LOCUS_07220 45005 43869 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851183.1 protein_id gnl|my_center|LOCUS_07220 45218 46141 gene locus_tag LOCUS_07230 45218 46141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_07230 46882 46181 gene locus_tag LOCUS_07240 46882 46181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_07240 47571 46879 gene locus_tag LOCUS_07250 47571 46879 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389907.1 protein_id gnl|my_center|LOCUS_07250 48396 47647 gene locus_tag LOCUS_07260 48396 47647 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_07260 49253 48477 gene locus_tag LOCUS_07270 49253 48477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096153.1 protein_id gnl|my_center|LOCUS_07270 49661 49437 gene locus_tag LOCUS_07280 49661 49437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 50252 51559 gene locus_tag LOCUS_07290 gene ycaD 50252 51559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_07290 51827 54097 gene locus_tag LOCUS_07300 51827 54097 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 protein_id gnl|my_center|LOCUS_07300 54330 54148 gene locus_tag LOCUS_07310 54330 54148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 54311 55042 gene locus_tag LOCUS_07320 54311 55042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 55104 56015 gene locus_tag LOCUS_07330 55104 56015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 56699 56151 gene locus_tag LOCUS_07340 gene orn 56699 56151 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQM7 protein_id gnl|my_center|LOCUS_07340 57691 56759 gene locus_tag LOCUS_07350 57691 56759 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_07350 61076 57681 gene locus_tag LOCUS_07360 61076 57681 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_07360 61270 62532 gene locus_tag LOCUS_07370 61270 62532 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083788.1 protein_id gnl|my_center|LOCUS_07370 62620 63549 gene locus_tag LOCUS_07380 62620 63549 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_07380 63560 64762 gene locus_tag LOCUS_07390 63560 64762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083790.1 protein_id gnl|my_center|LOCUS_07390 64749 65513 gene locus_tag LOCUS_07400 64749 65513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 protein_id gnl|my_center|LOCUS_07400 65544 66233 gene locus_tag LOCUS_07410 65544 66233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_07410 66262 67308 gene locus_tag LOCUS_07420 gene amiE 66262 67308 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 protein_id gnl|my_center|LOCUS_07420 67322 68500 gene locus_tag LOCUS_07430 gene amiB 67322 68500 CDS product ATP-dependent protease ATP-binding subunit-like protein AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51416 protein_id gnl|my_center|LOCUS_07430 68493 69725 gene locus_tag LOCUS_07440 68493 69725 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 protein_id gnl|my_center|LOCUS_07440 69816 70202 gene locus_tag LOCUS_07450 69816 70202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_07450 70481 71509 gene locus_tag LOCUS_07460 gene rsgA 70481 71509 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_07460 72447 71542 gene locus_tag LOCUS_07470 72447 71542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 73388 72537 gene locus_tag LOCUS_07480 gene motA 73388 72537 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_07480 73443 75323 gene locus_tag LOCUS_07490 73443 75323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 75425 76249 gene locus_tag LOCUS_07500 75425 76249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 76319 77344 gene locus_tag LOCUS_07510 76319 77344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07510 77736 77338 gene locus_tag LOCUS_07520 77736 77338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 78760 77834 gene locus_tag LOCUS_07530 gene epmA 78760 77834 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_07530 79475 78909 gene locus_tag LOCUS_07540 gene efp 79475 78909 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_07540 79511 80536 gene locus_tag LOCUS_07550 79511 80536 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_07550 80768 82870 gene locus_tag LOCUS_07560 gene fimX 80768 82870 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_07560 84145 82898 gene locus_tag LOCUS_07570 84145 82898 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_07570 84350 84180 gene locus_tag LOCUS_07580 84350 84180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 84604 85941 gene locus_tag LOCUS_07590 84604 85941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 86545 86006 gene locus_tag LOCUS_07600 86545 86006 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 protein_id gnl|my_center|LOCUS_07600 89442 86596 gene locus_tag LOCUS_07610 gene uvrA 89442 86596 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_07610 >Feature sequence008 356 3019 gene locus_tag LOCUS_07620 gene topA 356 3019 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_07620 3137 3568 gene locus_tag LOCUS_07630 3137 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4286 3597 gene locus_tag LOCUS_07640 4286 3597 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_07640 4853 4356 gene locus_tag LOCUS_07650 4853 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5066 5950 gene locus_tag LOCUS_07660 5066 5950 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_07660 7374 6019 gene locus_tag LOCUS_07670 7374 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8795 7704 gene locus_tag LOCUS_07680 8795 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9624 10364 gene locus_tag LOCUS_07690 9624 10364 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_07690 10388 11026 gene locus_tag LOCUS_07700 10388 11026 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_07700 11188 14820 gene locus_tag LOCUS_07710 11188 14820 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 protein_id gnl|my_center|LOCUS_07710 15970 14939 gene locus_tag LOCUS_07720 15970 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 16686 15967 gene locus_tag LOCUS_07730 16686 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 17559 18311 gene locus_tag LOCUS_07740 17559 18311 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707378.1 protein_id gnl|my_center|LOCUS_07740 20305 18335 gene locus_tag LOCUS_07750 20305 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 22255 20660 gene locus_tag LOCUS_07760 22255 20660 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_07760 23649 22444 gene locus_tag LOCUS_07770 23649 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_07770 23748 24569 gene locus_tag LOCUS_07780 23748 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 25191 24580 gene locus_tag LOCUS_07790 gene rnhB 25191 24580 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_07790 26381 25206 gene locus_tag LOCUS_07800 gene lpxB 26381 25206 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N0 protein_id gnl|my_center|LOCUS_07800 27151 26381 gene locus_tag LOCUS_07810 gene lpxA 27151 26381 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_07810 27612 27148 gene locus_tag LOCUS_07820 gene fabZ 27612 27148 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_07820 28634 27612 gene locus_tag LOCUS_07830 gene lpxD 28634 27612 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_07830 29158 28667 gene locus_tag LOCUS_07840 gene skp 29158 28667 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_07840 31761 29200 gene locus_tag LOCUS_07850 gene opr86 31761 29200 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_07850 33138 31798 gene locus_tag LOCUS_07860 33138 31798 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_07860 34328 33135 gene locus_tag LOCUS_07870 gene dxr 34328 33135 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_07870 35170 34325 gene locus_tag LOCUS_07880 gene cdsA 35170 34325 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_07880 35930 35163 gene locus_tag LOCUS_07890 gene uppS 35930 35163 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_07890 36503 35940 gene locus_tag LOCUS_07900 gene frr 36503 35940 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_07900 37234 36500 gene locus_tag LOCUS_07910 gene pyrH 37234 36500 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P1 protein_id gnl|my_center|LOCUS_07910 38185 37331 gene locus_tag LOCUS_07920 gene tsf 38185 37331 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_07920 39030 38275 gene locus_tag LOCUS_07930 gene rpsB 39030 38275 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_07930 39330 40112 gene locus_tag LOCUS_07940 gene map 39330 40112 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_07940 40109 42802 gene locus_tag LOCUS_07950 gene glnD 40109 42802 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_07950 42913 43746 gene locus_tag LOCUS_07960 42913 43746 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKY1 protein_id gnl|my_center|LOCUS_07960 45200 43788 gene locus_tag LOCUS_07970 45200 43788 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_07970 45486 45331 gene locus_tag LOCUS_07980 45486 45331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 45461 46192 gene locus_tag LOCUS_07990 45461 46192 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_07990 48153 46261 gene locus_tag LOCUS_08000 48153 46261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 49787 48267 gene locus_tag LOCUS_08010 gene lysS 49787 48267 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P8 protein_id gnl|my_center|LOCUS_08010 50858 49956 gene locus_tag LOCUS_08020 gene prfB 50858 49956 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPL5 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 51348 51728 gene locus_tag LOCUS_08030 51348 51728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 52780 51611 gene locus_tag LOCUS_08040 52780 51611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 protein_id gnl|my_center|LOCUS_08040 56105 52761 gene locus_tag LOCUS_08050 56105 52761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 56845 56111 gene locus_tag LOCUS_08060 56845 56111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 58347 56848 gene locus_tag LOCUS_08070 58347 56848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 61582 58919 gene locus_tag LOCUS_08080 61582 58919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 61967 61647 gene locus_tag LOCUS_08090 61967 61647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 63314 62022 gene locus_tag LOCUS_08100 63314 62022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 64589 63375 gene locus_tag LOCUS_08110 64589 63375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 64908 66692 gene locus_tag LOCUS_08120 64908 66692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 67199 66732 gene locus_tag LOCUS_08130 67199 66732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 67571 67846 gene locus_tag LOCUS_08140 67571 67846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 67877 68836 gene locus_tag LOCUS_08150 gene cas1-1 67877 68836 CDS product CRISPR-associated endonuclease Cas1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS2 protein_id gnl|my_center|LOCUS_08150 68833 69162 gene locus_tag LOCUS_08160 68833 69162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 69490 73100 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgaaaacagccccgccaataaggggattaagac 73739 73957 gene locus_tag LOCUS_08170 73739 73957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 73970 74164 gene locus_tag LOCUS_08180 73970 74164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 74166 75395 gene locus_tag LOCUS_08190 74166 75395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 75388 77415 gene locus_tag LOCUS_08200 75388 77415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 77412 78719 gene locus_tag LOCUS_08210 77412 78719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 78746 79633 gene locus_tag LOCUS_08220 78746 79633 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_08220 79637 80143 gene locus_tag LOCUS_08230 79637 80143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 80145 81308 gene locus_tag LOCUS_08240 80145 81308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence009 31 930 gene locus_tag LOCUS_08250 31 930 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_08250 945 1271 gene locus_tag LOCUS_08260 945 1271 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_08260 2313 1288 gene locus_tag LOCUS_08270 2313 1288 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 protein_id gnl|my_center|LOCUS_08270 2506 3573 gene locus_tag LOCUS_08280 2506 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3921 6692 gene locus_tag LOCUS_08290 gene rapA 3921 6692 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDT5 protein_id gnl|my_center|LOCUS_08290 8141 6786 gene locus_tag LOCUS_08300 8141 6786 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268131.1 protein_id gnl|my_center|LOCUS_08300 8855 8343 gene locus_tag LOCUS_08310 8855 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 10054 8852 gene locus_tag LOCUS_08320 gene xcpY 10054 8852 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_08320 11141 10089 gene locus_tag LOCUS_08330 11141 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11854 11141 gene locus_tag LOCUS_08340 gene xcpW 11854 11141 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_08340 12234 11851 gene locus_tag LOCUS_08350 gene xcpV 12234 11851 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_08350 12763 12224 gene locus_tag LOCUS_08360 12763 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13312 12884 gene locus_tag LOCUS_08370 gene xcpT 13312 12884 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_08370 14530 13322 gene locus_tag LOCUS_08380 gene xcpS 14530 13322 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_08380 16110 14533 gene locus_tag LOCUS_08390 gene xcpR 16110 14533 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_08390 17451 16114 gene locus_tag LOCUS_08400 17451 16114 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_08400 18494 17565 gene locus_tag LOCUS_08410 gene etfA 18494 17565 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_08410 19259 18510 gene locus_tag LOCUS_08420 gene etfB 19259 18510 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_08420 19585 21225 gene locus_tag LOCUS_08430 19585 21225 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_08430 23139 21304 gene locus_tag LOCUS_08440 gene ppiD 23139 21304 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_08440 23579 23307 gene locus_tag LOCUS_08450 gene hupB 23579 23307 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_08450 26086 23696 gene locus_tag LOCUS_08460 gene lon 26086 23696 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_08460 27498 26206 gene locus_tag LOCUS_08470 gene clpX 27498 26206 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_08470 28211 27585 gene locus_tag LOCUS_08480 gene clpP 28211 27585 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 protein_id gnl|my_center|LOCUS_08480 29643 28333 gene locus_tag LOCUS_08490 gene tig 29643 28333 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU0 protein_id gnl|my_center|LOCUS_08490 30096 30021 gene locus_tag LOCUS_t00070 30096 30021 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30198 30122 gene locus_tag LOCUS_t00080 30198 30122 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30301 30225 gene locus_tag LOCUS_t00090 30301 30225 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30593 30420 gene locus_tag LOCUS_08500 30593 30420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 30540 31394 gene locus_tag LOCUS_08510 gene folD1 30540 31394 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR0 protein_id gnl|my_center|LOCUS_08510 32844 31474 gene locus_tag LOCUS_08520 gene cysS 32844 31474 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN9 protein_id gnl|my_center|LOCUS_08520 34523 32853 gene locus_tag LOCUS_08530 gene glnS 34523 32853 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_08530 34715 35212 gene locus_tag LOCUS_08540 gene ppiB 34715 35212 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_08540 35212 35937 gene locus_tag LOCUS_08550 gene lpxH 35212 35937 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_08550 36935 35934 gene locus_tag LOCUS_08560 gene murB 36935 35934 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9J9 protein_id gnl|my_center|LOCUS_08560 37214 37005 gene locus_tag LOCUS_08570 37214 37005 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_08570 38199 37207 gene locus_tag LOCUS_08580 gene lpxK 38199 37207 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY9 protein_id gnl|my_center|LOCUS_08580 39982 38201 gene locus_tag LOCUS_08590 gene msbA 39982 38201 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_08590 40394 39972 gene locus_tag LOCUS_08600 40394 39972 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_604208.2 protein_id gnl|my_center|LOCUS_08600 41026 40391 gene locus_tag LOCUS_08610 41026 40391 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_08610 43410 41206 gene locus_tag LOCUS_08620 gene comA 43410 41206 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_08620 43732 44355 gene locus_tag LOCUS_08630 43732 44355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_08630 45108 44395 gene locus_tag LOCUS_08640 gene lolD 45108 44395 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884I3 protein_id gnl|my_center|LOCUS_08640 46351 45101 gene locus_tag LOCUS_08650 46351 45101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_08650 46567 47589 gene locus_tag LOCUS_08660 gene aguA 46567 47589 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_08660 47582 48484 gene locus_tag LOCUS_08670 gene aguB 47582 48484 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_08670 48557 49171 gene locus_tag LOCUS_08680 48557 49171 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_08680 49324 49992 gene locus_tag LOCUS_08690 49324 49992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 52209 50119 gene locus_tag LOCUS_08700 gene dinG 52209 50119 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_08700 53019 52216 gene locus_tag LOCUS_08710 53019 52216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 54635 53019 gene locus_tag LOCUS_08720 gene gspA 54635 53019 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_08720 54908 55126 gene locus_tag LOCUS_08730 54908 55126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 55134 55313 gene locus_tag LOCUS_08740 55134 55313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 55572 57389 gene locus_tag LOCUS_08750 55572 57389 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_08750 58381 57422 gene locus_tag LOCUS_08760 58381 57422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 59600 58674 gene locus_tag LOCUS_08770 59600 58674 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P699 protein_id gnl|my_center|LOCUS_08770 59897 62083 gene locus_tag LOCUS_08780 gene katG 59897 62083 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CVH1 protein_id gnl|my_center|LOCUS_08780 64401 62224 gene locus_tag LOCUS_08790 gene glcB 64401 62224 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_08790 65313 64642 gene locus_tag LOCUS_08800 65313 64642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 65300 65710 gene locus_tag LOCUS_08810 65300 65710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 66554 65772 gene locus_tag LOCUS_08820 gene hmuV 66554 65772 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_08820 67666 66551 gene locus_tag LOCUS_08830 67666 66551 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_08830 68607 67666 gene locus_tag LOCUS_08840 68607 67666 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_08840 69701 68607 gene locus_tag LOCUS_08850 gene hmuS 69701 68607 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_08850 70846 69704 gene locus_tag LOCUS_08860 70846 69704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 73138 70967 gene locus_tag LOCUS_08870 73138 70967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 74807 73413 gene locus_tag LOCUS_08880 74807 73413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 74995 76470 gene locus_tag LOCUS_08890 74995 76470 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769539.1 protein_id gnl|my_center|LOCUS_08890 77666 76557 gene locus_tag LOCUS_08900 77666 76557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970793.1 protein_id gnl|my_center|LOCUS_08900 79305 77725 gene locus_tag LOCUS_08910 79305 77725 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_08910 79759 79484 gene locus_tag LOCUS_08920 79759 79484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 80070 80516 gene locus_tag LOCUS_08930 80070 80516 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_08930 80849 80586 gene locus_tag LOCUS_08940 80849 80586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence010 1786 488 gene locus_tag LOCUS_08950 gene tyrS 1786 488 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_08950 2129 3196 gene locus_tag LOCUS_08960 2129 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_08960 3196 4296 gene locus_tag LOCUS_08970 gene anmK 3196 4296 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_08970 4697 4317 gene locus_tag LOCUS_08980 4697 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5152 4805 gene locus_tag LOCUS_08990 gene erpA 5152 4805 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_08990 5657 5238 gene locus_tag LOCUS_09000 5657 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6406 5669 gene locus_tag LOCUS_09010 6406 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635878.2 protein_id gnl|my_center|LOCUS_09010 7475 6438 gene locus_tag LOCUS_09020 gene argC 7475 6438 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_09020 7606 9369 gene locus_tag LOCUS_09030 7606 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 9411 9833 gene locus_tag LOCUS_09040 9411 9833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_09040 9909 11204 gene locus_tag LOCUS_09050 gene hemL 9909 11204 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_09050 11204 11854 gene locus_tag LOCUS_09060 11204 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12266 11859 gene locus_tag LOCUS_09070 12266 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14524 12344 gene locus_tag LOCUS_09080 gene mrcB 14524 12344 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_09080 14601 15059 gene locus_tag LOCUS_09090 14601 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 15089 18028 gene locus_tag LOCUS_09100 gene glnE 15089 18028 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_09100 18053 18982 gene locus_tag LOCUS_09110 gene ilvE 18053 18982 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_09110 19203 20021 gene locus_tag LOCUS_09120 19203 20021 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407244.1 protein_id gnl|my_center|LOCUS_09120 21769 20231 gene locus_tag LOCUS_09130 gene pckA 21769 20231 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_09130 22908 22033 gene locus_tag LOCUS_09140 gene hslO 22908 22033 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_09140 23332 22928 gene locus_tag LOCUS_09150 gene hslR 23332 22928 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_09150 24011 23325 gene locus_tag LOCUS_09160 24011 23325 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_09160 24056 24625 gene locus_tag LOCUS_09170 gene nudE 24056 24625 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 protein_id gnl|my_center|LOCUS_09170 26766 24598 gene locus_tag LOCUS_09180 26766 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 27626 26934 gene locus_tag LOCUS_09190 27626 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_09190 27955 27623 gene locus_tag LOCUS_09200 27955 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 29197 28325 gene locus_tag LOCUS_09210 gene rpoH 29197 28325 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_09210 30402 29362 gene locus_tag LOCUS_09220 gene ftsX 30402 29362 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_09220 31066 30383 gene locus_tag LOCUS_09230 gene ftsE 31066 30383 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_09230 32413 31070 gene locus_tag LOCUS_09240 32413 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 32583 33134 gene locus_tag LOCUS_09250 32583 33134 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_09250 35472 33220 gene locus_tag LOCUS_09260 gene parC 35472 33220 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SJ2 protein_id gnl|my_center|LOCUS_09260 37444 35546 gene locus_tag LOCUS_09270 37444 35546 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941205.1 protein_id gnl|my_center|LOCUS_09270 38255 38956 gene locus_tag LOCUS_09280 38255 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 38938 39915 gene locus_tag LOCUS_09290 38938 39915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 39885 40403 gene locus_tag LOCUS_09300 39885 40403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 40414 40920 gene locus_tag LOCUS_09310 40414 40920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 40924 42858 gene locus_tag LOCUS_09320 40924 42858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 42851 45682 gene locus_tag LOCUS_09330 42851 45682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 45663 46409 gene locus_tag LOCUS_09340 45663 46409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 46409 46705 gene locus_tag LOCUS_09350 46409 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 46867 47517 gene locus_tag LOCUS_09360 46867 47517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 47531 48049 gene locus_tag LOCUS_09370 47531 48049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 48046 48552 gene locus_tag LOCUS_09380 48046 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 48549 49490 gene locus_tag LOCUS_09390 48549 49490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 49800 50237 gene locus_tag LOCUS_09400 gene nsrR 49800 50237 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 protein_id gnl|my_center|LOCUS_09400 52173 50239 gene locus_tag LOCUS_09410 gene parE 52173 50239 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGH6 protein_id gnl|my_center|LOCUS_09410 52863 52255 gene locus_tag LOCUS_09420 52863 52255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_09420 53609 52884 gene locus_tag LOCUS_09430 gene cpdA 53609 52884 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_09430 54256 53738 gene locus_tag LOCUS_09440 54256 53738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 protein_id gnl|my_center|LOCUS_09440 54883 54269 gene locus_tag LOCUS_09450 gene aspP 54883 54269 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_09450 55039 56391 gene locus_tag LOCUS_09460 55039 56391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_09460 57880 56477 gene locus_tag LOCUS_09470 gene glmU 57880 56477 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT27 protein_id gnl|my_center|LOCUS_09470 58980 58006 gene locus_tag LOCUS_09480 58980 58006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 59038 59538 gene locus_tag LOCUS_09490 59038 59538 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_09490 59531 60298 gene locus_tag LOCUS_09500 gene znuC 59531 60298 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT73 protein_id gnl|my_center|LOCUS_09500 60295 61092 gene locus_tag LOCUS_09510 60295 61092 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 protein_id gnl|my_center|LOCUS_09510 61334 61179 gene locus_tag LOCUS_09520 61334 61179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 62152 61514 gene locus_tag LOCUS_09530 gene senC 62152 61514 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_09530 62191 63615 gene locus_tag LOCUS_09540 62191 63615 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704205.1 protein_id gnl|my_center|LOCUS_09540 63721 64305 gene locus_tag LOCUS_09550 63721 64305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 65440 64529 gene locus_tag LOCUS_09560 65440 64529 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067076.1 protein_id gnl|my_center|LOCUS_09560 65651 66190 gene locus_tag LOCUS_09570 65651 66190 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 protein_id gnl|my_center|LOCUS_09570 66285 66854 gene locus_tag LOCUS_09580 66285 66854 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_09580 68018 66939 gene locus_tag LOCUS_09590 68018 66939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 68684 68022 gene locus_tag LOCUS_09600 68684 68022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 70419 68776 gene locus_tag LOCUS_09610 70419 68776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 70896 70609 gene locus_tag LOCUS_09620 70896 70609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 72986 70896 gene locus_tag LOCUS_09630 gene prlC 72986 70896 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_09630 74250 73177 gene locus_tag LOCUS_09640 74250 73177 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_09640 74433 74981 gene locus_tag LOCUS_09650 74433 74981 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_09650 75372 76013 gene locus_tag LOCUS_09660 75372 76013 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence011 33 296 gene locus_tag LOCUS_09670 33 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2797 338 gene locus_tag LOCUS_09680 2797 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4016 2784 gene locus_tag LOCUS_09690 4016 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5028 4018 gene locus_tag LOCUS_09700 5028 4018 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_09700 5607 7916 gene locus_tag LOCUS_09710 gene hbpA 5607 7916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_09710 7916 8893 gene locus_tag LOCUS_09720 gene oppB 7916 8893 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_09720 8893 10350 gene locus_tag LOCUS_09730 8893 10350 CDS product oligopeptide transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_09730 10350 11975 gene locus_tag LOCUS_09740 10350 11975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 protein_id gnl|my_center|LOCUS_09740 12029 13138 gene locus_tag LOCUS_09750 12029 13138 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN1 protein_id gnl|my_center|LOCUS_09750 13274 13468 gene locus_tag LOCUS_09760 13274 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13465 13857 gene locus_tag LOCUS_09770 gene vapC 13465 13857 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_09770 15317 14052 gene locus_tag LOCUS_09780 gene glt-4 15317 14052 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_09780 16049 15453 gene locus_tag LOCUS_09790 16049 15453 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_09790 17773 16043 gene locus_tag LOCUS_09800 gene proS 17773 16043 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_09800 17995 18639 gene locus_tag LOCUS_09810 17995 18639 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_09810 19195 18791 gene locus_tag LOCUS_09820 19195 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 21868 19271 gene locus_tag LOCUS_09830 21868 19271 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_09830 22846 25407 gene locus_tag LOCUS_09840 gene nirB 22846 25407 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 protein_id gnl|my_center|LOCUS_09840 25419 25745 gene locus_tag LOCUS_09850 gene nirD-2 25419 25745 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_09850 26354 28081 gene locus_tag LOCUS_09860 26354 28081 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_09860 30291 28207 gene locus_tag LOCUS_09870 gene prc 30291 28207 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_09870 30634 31065 gene locus_tag LOCUS_09880 30634 31065 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_09880 32006 31089 gene locus_tag LOCUS_09890 32006 31089 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_09890 33096 32194 gene locus_tag LOCUS_09900 33096 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_09900 33392 35995 gene locus_tag LOCUS_09910 gene clpB 33392 35995 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU18 protein_id gnl|my_center|LOCUS_09910 36115 36609 gene locus_tag LOCUS_09920 36115 36609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 36618 37148 gene locus_tag LOCUS_09930 gene ruvC 36618 37148 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A1 protein_id gnl|my_center|LOCUS_09930 37230 37841 gene locus_tag LOCUS_09940 gene ruvA 37230 37841 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QU8 protein_id gnl|my_center|LOCUS_09940 37838 38869 gene locus_tag LOCUS_09950 gene ruvB 37838 38869 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_09950 38856 39281 gene locus_tag LOCUS_09960 38856 39281 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_09960 39306 40016 gene locus_tag LOCUS_09970 39306 40016 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_09970 40016 40465 gene locus_tag LOCUS_09980 gene tolR 40016 40465 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_09980 40462 41343 gene locus_tag LOCUS_09990 40462 41343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 41337 42617 gene locus_tag LOCUS_10000 gene tolB 41337 42617 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_10000 42654 43229 gene locus_tag LOCUS_10010 42654 43229 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_10010 43229 43996 gene locus_tag LOCUS_10020 43229 43996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 44055 44130 gene locus_tag LOCUS_t00100 44055 44130 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 44288 44363 gene locus_tag LOCUS_t00110 44288 44363 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 44499 45533 gene locus_tag LOCUS_10030 gene nadA 44499 45533 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGY8 protein_id gnl|my_center|LOCUS_10030 47069 45621 gene locus_tag LOCUS_10040 47069 45621 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_10040 47207 47467 gene locus_tag LOCUS_10050 47207 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 47464 48555 gene locus_tag LOCUS_10060 47464 48555 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_10060 48700 49575 gene locus_tag LOCUS_10070 gene dapA 48700 49575 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW75 protein_id gnl|my_center|LOCUS_10070 49580 50239 gene locus_tag LOCUS_10080 49580 50239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 50236 50994 gene locus_tag LOCUS_10090 50236 50994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_10090 51097 51807 gene locus_tag LOCUS_10100 gene purC 51097 51807 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_10100 52064 52810 gene locus_tag LOCUS_10110 52064 52810 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 protein_id gnl|my_center|LOCUS_10110 54590 52983 gene locus_tag LOCUS_10120 gene cysNC 54590 52983 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_10120 55502 54591 gene locus_tag LOCUS_10130 gene cysD 55502 54591 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 protein_id gnl|my_center|LOCUS_10130 55916 56545 gene locus_tag LOCUS_10140 55916 56545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_10140 56673 57788 gene locus_tag LOCUS_10150 gene zapE 56673 57788 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_10150 58457 57948 gene locus_tag LOCUS_10160 58457 57948 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_10160 60174 58534 gene locus_tag LOCUS_10170 60174 58534 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268314.1 protein_id gnl|my_center|LOCUS_10170 60210 60443 gene locus_tag LOCUS_10180 60210 60443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 60602 61363 gene locus_tag LOCUS_10190 60602 61363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 61367 62371 gene locus_tag LOCUS_10200 61367 62371 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_10200 63339 63263 gene locus_tag LOCUS_t00120 63339 63263 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63448 63373 gene locus_tag LOCUS_t00130 63448 63373 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63549 63473 gene locus_tag LOCUS_t00140 63549 63473 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63646 63571 gene locus_tag LOCUS_t00150 63646 63571 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 66878 63744 gene locus_tag LOCUS_10210 66878 63744 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_10210 67969 66881 gene locus_tag LOCUS_10220 67969 66881 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence012 1634 57 gene locus_tag LOCUS_10230 1634 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4780 1733 gene locus_tag LOCUS_10240 gene fecA 4780 1733 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_10240 6116 5064 gene locus_tag LOCUS_10250 6116 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_10250 6401 7033 gene locus_tag LOCUS_10260 6401 7033 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104835.1 protein_id gnl|my_center|LOCUS_10260 7343 7759 gene locus_tag LOCUS_10270 7343 7759 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_10270 7967 10372 gene locus_tag LOCUS_10280 7967 10372 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918626.1 protein_id gnl|my_center|LOCUS_10280 10955 10392 gene locus_tag LOCUS_10290 10955 10392 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_10290 11090 12430 gene locus_tag LOCUS_10300 11090 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 13754 12591 gene locus_tag LOCUS_10310 13754 12591 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_10310 14102 15418 gene locus_tag LOCUS_10320 14102 15418 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390266.1 protein_id gnl|my_center|LOCUS_10320 16801 15536 gene locus_tag LOCUS_10330 16801 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 16937 17863 gene locus_tag LOCUS_10340 16937 17863 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 protein_id gnl|my_center|LOCUS_10340 18014 19858 gene locus_tag LOCUS_10350 18014 19858 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 protein_id gnl|my_center|LOCUS_10350 20747 19875 gene locus_tag LOCUS_10360 20747 19875 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_10360 22723 20921 gene locus_tag LOCUS_10370 22723 20921 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_10370 23192 22800 gene locus_tag LOCUS_10380 23192 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 23702 23451 gene locus_tag LOCUS_10390 23702 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 24904 23747 gene locus_tag LOCUS_10400 24904 23747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267283.1 protein_id gnl|my_center|LOCUS_10400 25998 24916 gene locus_tag LOCUS_10410 gene aroC 25998 24916 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC2 protein_id gnl|my_center|LOCUS_10410 27054 26122 gene locus_tag LOCUS_10420 gene prmB 27054 26122 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC5 protein_id gnl|my_center|LOCUS_10420 28147 27221 gene locus_tag LOCUS_10430 gene rssA 28147 27221 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_10430 29052 28150 gene locus_tag LOCUS_10440 29052 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 29276 31075 gene locus_tag LOCUS_10450 29276 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 31634 31182 gene locus_tag LOCUS_10460 31634 31182 CDS product RNA methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072972.1 protein_id gnl|my_center|LOCUS_10460 32855 32115 gene locus_tag LOCUS_10470 32855 32115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 33839 33330 gene locus_tag LOCUS_10480 33839 33330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 35495 34173 gene locus_tag LOCUS_10490 35495 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_10490 36077 35673 gene locus_tag LOCUS_10500 36077 35673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 36417 36013 gene locus_tag LOCUS_10510 36417 36013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10510 37790 36567 gene locus_tag LOCUS_10520 37790 36567 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_10520 37850 38197 gene locus_tag LOCUS_10530 gene yfgD 37850 38197 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 protein_id gnl|my_center|LOCUS_10530 38197 38814 gene locus_tag LOCUS_10540 gene wrbA 38197 38814 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_10540 38816 39226 gene locus_tag LOCUS_10550 38816 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 39644 39411 gene locus_tag LOCUS_10560 39644 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 39954 40670 gene locus_tag LOCUS_10570 39954 40670 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_10570 40843 41511 gene locus_tag LOCUS_10580 gene gstA 40843 41511 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_10580 42614 41541 gene locus_tag LOCUS_10590 42614 41541 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_10590 43530 42616 gene locus_tag LOCUS_10600 43530 42616 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_10600 44000 46780 gene locus_tag LOCUS_10610 44000 46780 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_10610 46915 48921 gene locus_tag LOCUS_10620 46915 48921 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_10620 49206 48991 gene locus_tag LOCUS_10630 49206 48991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 49955 49224 gene locus_tag LOCUS_10640 49955 49224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 50902 50093 gene locus_tag LOCUS_10650 50902 50093 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_10650 51581 50955 gene locus_tag LOCUS_10660 51581 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 53041 51782 gene locus_tag LOCUS_10670 53041 51782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 53684 53217 gene locus_tag LOCUS_10680 53684 53217 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_10680 53962 55437 gene locus_tag LOCUS_10690 gene ycf24 53962 55437 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_10690 55573 56322 gene locus_tag LOCUS_10700 55573 56322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_10700 56324 57673 gene locus_tag LOCUS_10710 56324 57673 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_10710 57670 58914 gene locus_tag LOCUS_10720 57670 58914 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_10720 58943 59302 gene locus_tag LOCUS_10730 58943 59302 CDS product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_10730 59470 59997 gene locus_tag LOCUS_10740 59470 59997 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_10740 60110 60805 gene locus_tag LOCUS_10750 60110 60805 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_10750 62796 60796 gene locus_tag LOCUS_10760 62796 60796 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261723.1 protein_id gnl|my_center|LOCUS_10760 63940 62948 gene locus_tag LOCUS_10770 63940 62948 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_10770 <66985 63937 gene locus_tag LOCUS_10780 <66985 63937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWR8:histidine kinase >Feature sequence013 56 1120 gene locus_tag LOCUS_10790 gene hemE 56 1120 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_10790 2567 1197 gene locus_tag LOCUS_10800 gene radA 2567 1197 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQW7 protein_id gnl|my_center|LOCUS_10800 2754 3422 gene locus_tag LOCUS_10810 2754 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4486 3761 gene locus_tag LOCUS_10820 gene rsmE 4486 3761 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK7 protein_id gnl|my_center|LOCUS_10820 5155 4568 gene locus_tag LOCUS_10830 5155 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6122 5142 gene locus_tag LOCUS_10840 gene motB 6122 5142 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418111.1 protein_id gnl|my_center|LOCUS_10840 6884 6126 gene locus_tag LOCUS_10850 6884 6126 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_10850 7031 7282 gene locus_tag LOCUS_10860 gene xseB 7031 7282 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_10860 7279 8178 gene locus_tag LOCUS_10870 7279 8178 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_10870 8348 10228 gene locus_tag LOCUS_10880 gene dxs 8348 10228 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_10880 10421 11431 gene locus_tag LOCUS_10890 10421 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11424 12767 gene locus_tag LOCUS_10900 11424 12767 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_10900 13423 12788 gene locus_tag LOCUS_10910 gene ribA 13423 12788 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_10910 13656 14333 gene locus_tag LOCUS_10920 13656 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989841.1 protein_id gnl|my_center|LOCUS_10920 14543 14986 gene locus_tag LOCUS_10930 14543 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14979 15839 gene locus_tag LOCUS_10940 14979 15839 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_10940 15836 16615 gene locus_tag LOCUS_10950 15836 16615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_10950 16629 17291 gene locus_tag LOCUS_10960 16629 17291 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_10960 17288 18589 gene locus_tag LOCUS_10970 17288 18589 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_10970 19080 18610 gene locus_tag LOCUS_10980 gene pgpA 19080 18610 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_10980 21456 19189 gene locus_tag LOCUS_10990 gene priA 21456 19189 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_10990 21644 21856 gene locus_tag LOCUS_11000 gene rpmE 21644 21856 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Z0 protein_id gnl|my_center|LOCUS_11000 23525 22125 gene locus_tag LOCUS_11010 23525 22125 CDS product amino acid APC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_11010 24857 23565 gene locus_tag LOCUS_11020 24857 23565 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_11020 25324 24905 gene locus_tag LOCUS_11030 25324 24905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528789.1 protein_id gnl|my_center|LOCUS_11030 26548 25409 gene locus_tag LOCUS_11040 26548 25409 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600796.1 protein_id gnl|my_center|LOCUS_11040 26801 27634 gene locus_tag LOCUS_11050 26801 27634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 28413 27766 gene locus_tag LOCUS_11060 28413 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_11060 29997 28489 gene locus_tag LOCUS_11070 29997 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202021.1 protein_id gnl|my_center|LOCUS_11070 30658 30080 gene locus_tag LOCUS_11080 30658 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 31315 30836 gene locus_tag LOCUS_11090 31315 30836 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_11090 31503 32039 gene locus_tag LOCUS_11100 gene hslV 31503 32039 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_11100 32036 33382 gene locus_tag LOCUS_11110 gene hslU 32036 33382 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_11110 35099 33555 gene locus_tag LOCUS_11120 35099 33555 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 protein_id gnl|my_center|LOCUS_11120 35344 35715 gene locus_tag LOCUS_11130 35344 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_11130 35838 38483 gene locus_tag LOCUS_11140 gene rnr 35838 38483 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_11140 38537 39277 gene locus_tag LOCUS_11150 gene rlmB 38537 39277 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_11150 40282 39467 gene locus_tag LOCUS_11160 40282 39467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_11160 40692 41909 gene locus_tag LOCUS_11170 40692 41909 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_11170 42080 43327 gene locus_tag LOCUS_11180 42080 43327 CDS product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 protein_id gnl|my_center|LOCUS_11180 43590 44147 gene locus_tag LOCUS_11190 43590 44147 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_11190 44471 46033 gene locus_tag LOCUS_11200 44471 46033 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_11200 47113 46133 gene locus_tag LOCUS_11210 47113 46133 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_11210 47322 47807 gene locus_tag LOCUS_11220 47322 47807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 48890 47892 gene locus_tag LOCUS_11230 48890 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_11230 49594 49019 gene locus_tag LOCUS_11240 49594 49019 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766763.1 protein_id gnl|my_center|LOCUS_11240 49694 50383 gene locus_tag LOCUS_11250 49694 50383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 50425 50862 gene locus_tag LOCUS_11260 50425 50862 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701717.1 protein_id gnl|my_center|LOCUS_11260 51330 50896 gene locus_tag LOCUS_11270 51330 50896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 51495 51785 gene locus_tag LOCUS_11280 51495 51785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 52072 52221 gene locus_tag LOCUS_11290 52072 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 53209 52229 gene locus_tag LOCUS_11300 53209 52229 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_11300 53334 54749 gene locus_tag LOCUS_11310 53334 54749 CDS product pyruvate carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_11310 54777 56576 gene locus_tag LOCUS_11320 gene oadA 54777 56576 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_11320 56836 57507 gene locus_tag LOCUS_11330 56836 57507 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKQ0 protein_id gnl|my_center|LOCUS_11330 57948 57697 gene locus_tag LOCUS_11340 57948 57697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435988.1 protein_id gnl|my_center|LOCUS_11340 58250 58588 gene locus_tag LOCUS_11350 58250 58588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 58605 59183 gene locus_tag LOCUS_11360 58605 59183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 60078 59269 gene locus_tag LOCUS_11370 60078 59269 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_11370 60845 60162 gene locus_tag LOCUS_11380 60845 60162 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_11380 61207 62619 gene locus_tag LOCUS_11390 gene ffh 61207 62619 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP8 protein_id gnl|my_center|LOCUS_11390 63928 62786 gene locus_tag LOCUS_11400 63928 62786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_11400 <64937 63930 gene locus_tag LOCUS_11410 <64937 63930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205708.1:ABC transporter ATP-binding protein >Feature sequence014 1047 298 gene locus_tag LOCUS_11420 1047 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1281 3332 gene locus_tag LOCUS_11430 1281 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3455 5032 gene locus_tag LOCUS_11440 3455 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5347 6957 gene locus_tag LOCUS_11450 5347 6957 CDS product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_11450 7093 8322 gene locus_tag LOCUS_11460 gene cca 7093 8322 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTY6 protein_id gnl|my_center|LOCUS_11460 8849 8331 gene locus_tag LOCUS_11470 8849 8331 CDS product 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230176.2 protein_id gnl|my_center|LOCUS_11470 9203 8850 gene locus_tag LOCUS_11480 gene folB 9203 8850 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V5 protein_id gnl|my_center|LOCUS_11480 10311 9196 gene locus_tag LOCUS_11490 gene tsaD 10311 9196 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43764 protein_id gnl|my_center|LOCUS_11490 10505 10720 gene locus_tag LOCUS_11500 gene rpsU 10505 10720 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_11500 10750 11196 gene locus_tag LOCUS_11510 10750 11196 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_11510 11319 13238 gene locus_tag LOCUS_11520 gene dnaG 11319 13238 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_11520 13453 15276 gene locus_tag LOCUS_11530 gene rpoD 13453 15276 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A60 protein_id gnl|my_center|LOCUS_11530 15420 15496 gene locus_tag LOCUS_t00160 15420 15496 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15897 16433 gene locus_tag LOCUS_11540 15897 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 16499 16978 gene locus_tag LOCUS_11550 16499 16978 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_11550 17664 16975 gene locus_tag LOCUS_11560 17664 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 17873 18670 gene locus_tag LOCUS_11570 gene smtA 17873 18670 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LN6 protein_id gnl|my_center|LOCUS_11570 18667 19185 gene locus_tag LOCUS_11580 18667 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_11580 19498 19422 gene locus_tag LOCUS_t00170 19498 19422 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19616 19540 gene locus_tag LOCUS_t00180 19616 19540 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19784 19694 gene locus_tag LOCUS_t00190 19784 19694 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20047 19853 gene locus_tag LOCUS_11590 gene csrA 20047 19853 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 protein_id gnl|my_center|LOCUS_11590 21476 20235 gene locus_tag LOCUS_11600 gene lysC 21476 20235 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_11600 24350 21723 gene locus_tag LOCUS_11610 gene alaS 24350 21723 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_11610 24513 24797 gene locus_tag LOCUS_11620 24513 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 25387 24821 gene locus_tag LOCUS_11630 gene recX 25387 24821 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LR2 protein_id gnl|my_center|LOCUS_11630 26405 25362 gene locus_tag LOCUS_11640 gene recA 26405 25362 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_11640 27029 26547 gene locus_tag LOCUS_11650 27029 26547 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_11650 28288 27287 gene locus_tag LOCUS_11660 28288 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 28771 28298 gene locus_tag LOCUS_11670 gene usp-2 28771 28298 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E46 protein_id gnl|my_center|LOCUS_11670 30116 28788 gene locus_tag LOCUS_11680 30116 28788 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_11680 30693 30172 gene locus_tag LOCUS_11690 30693 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 31746 30703 gene locus_tag LOCUS_11700 31746 30703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_11700 32314 31934 gene locus_tag LOCUS_11710 gene hpcD 32314 31934 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101265.1 protein_id gnl|my_center|LOCUS_11710 33781 32318 gene locus_tag LOCUS_11720 gene hpaE 33781 32318 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_11720 34273 35049 gene locus_tag LOCUS_11730 34273 35049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113009.1 protein_id gnl|my_center|LOCUS_11730 35062 35823 gene locus_tag LOCUS_11740 35062 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113008.1 protein_id gnl|my_center|LOCUS_11740 36009 36812 gene locus_tag LOCUS_11750 36009 36812 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 protein_id gnl|my_center|LOCUS_11750 36852 37661 gene locus_tag LOCUS_11760 gene hpcH 36852 37661 CDS product 4-hydroxy-2-oxo-heptane-1,7-dioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83P19 protein_id gnl|my_center|LOCUS_11760 37755 38669 gene locus_tag LOCUS_11770 37755 38669 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113010.1 protein_id gnl|my_center|LOCUS_11770 38787 40100 gene locus_tag LOCUS_11780 38787 40100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_11780 40159 40581 gene locus_tag LOCUS_11790 40159 40581 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093470.1 protein_id gnl|my_center|LOCUS_11790 40904 41755 gene locus_tag LOCUS_11800 gene hpcB 40904 41755 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194590.1 protein_id gnl|my_center|LOCUS_11800 41768 41962 gene locus_tag LOCUS_11810 41768 41962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 42052 43485 gene locus_tag LOCUS_11820 42052 43485 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_11820 43561 44775 gene locus_tag LOCUS_11830 43561 44775 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 protein_id gnl|my_center|LOCUS_11830 44838 45764 gene locus_tag LOCUS_11840 gene hpcB 44838 45764 CDS product homoprotocatechuate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093449.1 protein_id gnl|my_center|LOCUS_11840 46636 45872 gene locus_tag LOCUS_11850 46636 45872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 47114 46824 gene locus_tag LOCUS_11860 47114 46824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11860 47776 47441 gene locus_tag LOCUS_11870 47776 47441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 48081 47791 gene locus_tag LOCUS_11880 48081 47791 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_11880 48406 48612 gene locus_tag LOCUS_11890 48406 48612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 48729 48956 gene locus_tag LOCUS_11900 48729 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 49342 48989 gene locus_tag LOCUS_11910 49342 48989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 50391 49339 gene locus_tag LOCUS_11920 50391 49339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_11920 53713 50747 gene locus_tag LOCUS_11930 53713 50747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 54192 54004 gene locus_tag LOCUS_11940 54192 54004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_11940 54528 54989 gene locus_tag LOCUS_11950 54528 54989 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_11950 55038 55634 gene locus_tag LOCUS_11960 55038 55634 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_11960 55747 56079 gene locus_tag LOCUS_11970 55747 56079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_11970 56280 57566 gene locus_tag LOCUS_11980 56280 57566 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_11980 58500 57607 gene locus_tag LOCUS_11990 58500 57607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_11990 58729 59598 gene locus_tag LOCUS_12000 gene menA 58729 59598 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFQ9 protein_id gnl|my_center|LOCUS_12000 59753 61873 gene locus_tag LOCUS_12010 gene metG 59753 61873 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK6 protein_id gnl|my_center|LOCUS_12010 62331 63623 gene locus_tag LOCUS_12020 62331 63623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence015 1405 2664 gene locus_tag LOCUS_12030 1405 2664 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972567.1 protein_id gnl|my_center|LOCUS_12030 2651 3205 gene locus_tag LOCUS_12040 2651 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3240 4151 gene locus_tag LOCUS_12050 3240 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4182 4952 gene locus_tag LOCUS_12060 4182 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6006 4942 gene locus_tag LOCUS_12070 6006 4942 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S78 protein_id gnl|my_center|LOCUS_12070 7800 6961 gene locus_tag LOCUS_12080 gene pcaH 7800 6961 CDS product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_12080 8158 7793 gene locus_tag LOCUS_12090 8158 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9106 8237 gene locus_tag LOCUS_12100 9106 8237 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_12100 10318 9227 gene locus_tag LOCUS_12110 gene fldA 10318 9227 CDS product FldA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_12110 10988 10311 gene locus_tag LOCUS_12120 10988 10311 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208962.1 protein_id gnl|my_center|LOCUS_12120 12037 11024 gene locus_tag LOCUS_12130 gene fldW 12037 11024 CDS product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_12130 12326 13561 gene locus_tag LOCUS_12140 gene fldY 12326 13561 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039100.1 protein_id gnl|my_center|LOCUS_12140 14154 15104 gene locus_tag LOCUS_12150 14154 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15308 16303 gene locus_tag LOCUS_12160 15308 16303 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_12160 16403 17359 gene locus_tag LOCUS_12170 16403 17359 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086449.1 protein_id gnl|my_center|LOCUS_12170 17470 18024 gene locus_tag LOCUS_12180 17470 18024 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_12180 19123 18146 gene locus_tag LOCUS_12190 gene corA 19123 18146 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE82 protein_id gnl|my_center|LOCUS_12190 20035 19154 gene locus_tag LOCUS_12200 20035 19154 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_12200 22575 20035 gene locus_tag LOCUS_12210 22575 20035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_12210 26097 22720 gene locus_tag LOCUS_12220 26097 22720 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_12220 27136 26201 gene locus_tag LOCUS_12230 27136 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_12230 28596 27136 gene locus_tag LOCUS_12240 28596 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_12240 31235 29076 gene locus_tag LOCUS_12250 31235 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 31867 31238 gene locus_tag LOCUS_12260 31867 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 32256 31870 gene locus_tag LOCUS_12270 32256 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 34195 32333 gene locus_tag LOCUS_12280 gene atpA 34195 32333 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_12280 35025 34246 gene locus_tag LOCUS_12290 35025 34246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 35849 35160 gene locus_tag LOCUS_12300 35849 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 36366 35908 gene locus_tag LOCUS_12310 36366 35908 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583857.1 protein_id gnl|my_center|LOCUS_12310 38209 36359 gene locus_tag LOCUS_12320 38209 36359 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SQ0 protein_id gnl|my_center|LOCUS_12320 38811 38206 gene locus_tag LOCUS_12330 gene atpD 38811 38206 CDS product ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_12330 40180 38813 gene locus_tag LOCUS_12340 gene atpB 40180 38813 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51120 protein_id gnl|my_center|LOCUS_12340 40631 41266 gene locus_tag LOCUS_12350 40631 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 42797 41271 gene locus_tag LOCUS_12360 gene glsF 42797 41271 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_12360 43306 42977 gene locus_tag LOCUS_12370 43306 42977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 44459 43536 gene locus_tag LOCUS_12380 44459 43536 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_12380 44696 45550 gene locus_tag LOCUS_12390 44696 45550 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_12390 45595 45987 gene locus_tag LOCUS_12400 45595 45987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 46284 47261 gene locus_tag LOCUS_12410 46284 47261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_12410 47258 48157 gene locus_tag LOCUS_12420 47258 48157 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_12420 48150 49637 gene locus_tag LOCUS_12430 gene phr 48150 49637 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207154.1 protein_id gnl|my_center|LOCUS_12430 49630 50064 gene locus_tag LOCUS_12440 49630 50064 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_12440 50061 50861 gene locus_tag LOCUS_12450 50061 50861 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 protein_id gnl|my_center|LOCUS_12450 50880 52148 gene locus_tag LOCUS_12460 50880 52148 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_12460 52148 53056 gene locus_tag LOCUS_12470 52148 53056 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_12470 53056 54330 gene locus_tag LOCUS_12480 gene cfaA 53056 54330 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_12480 54514 56523 gene locus_tag LOCUS_12490 54514 56523 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_12490 56699 57670 gene locus_tag LOCUS_12500 56699 57670 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_12500 60156 57667 gene locus_tag LOCUS_12510 gene polB 60156 57667 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGA1 protein_id gnl|my_center|LOCUS_12510 60207 60566 gene locus_tag LOCUS_12520 60207 60566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_12520 61217 61549 gene locus_tag LOCUS_12530 61217 61549 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 protein_id gnl|my_center|LOCUS_12530 62101 61610 gene locus_tag LOCUS_12540 62101 61610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 62513 62352 gene locus_tag LOCUS_12550 62513 62352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 62827 62450 gene locus_tag LOCUS_12560 62827 62450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 63012 63284 gene locus_tag LOCUS_12570 63012 63284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 63265 63534 gene locus_tag LOCUS_12580 63265 63534 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence016 429 124 gene locus_tag LOCUS_12590 429 124 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_12590 1352 432 gene locus_tag LOCUS_12600 gene ygbT 1352 432 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46896 protein_id gnl|my_center|LOCUS_12600 2254 1514 gene locus_tag LOCUS_12610 2254 1514 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602844.1 protein_id gnl|my_center|LOCUS_12610 3033 2254 gene locus_tag LOCUS_12620 3033 2254 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_12620 4103 3039 gene locus_tag LOCUS_12630 4103 3039 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_12630 4669 4127 gene locus_tag LOCUS_12640 4669 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6528 4885 gene locus_tag LOCUS_12650 6528 4885 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 protein_id gnl|my_center|LOCUS_12650 7099 6599 gene locus_tag LOCUS_12660 7099 6599 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533488.1 protein_id gnl|my_center|LOCUS_12660 7557 7294 gene locus_tag LOCUS_12670 7557 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312288.1 protein_id gnl|my_center|LOCUS_12670 10373 7623 gene locus_tag LOCUS_12680 10373 7623 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 protein_id gnl|my_center|LOCUS_12680 10838 10452 gene locus_tag LOCUS_12690 10838 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13812 10915 gene locus_tag LOCUS_12700 gene preP2 13812 10915 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_12700 14346 14002 gene locus_tag LOCUS_12710 gene pilZ 14346 14002 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_12710 15365 14346 gene locus_tag LOCUS_12720 gene holB 15365 14346 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_12720 16012 15362 gene locus_tag LOCUS_12730 gene tmk 16012 15362 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E35 protein_id gnl|my_center|LOCUS_12730 17064 16009 gene locus_tag LOCUS_12740 17064 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_12740 17891 17061 gene locus_tag LOCUS_12750 17891 17061 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 protein_id gnl|my_center|LOCUS_12750 19090 17897 gene locus_tag LOCUS_12760 gene fabF1 19090 17897 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_12760 19446 19213 gene locus_tag LOCUS_12770 gene acpP 19446 19213 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH5 protein_id gnl|my_center|LOCUS_12770 20229 19489 gene locus_tag LOCUS_12780 gene fabG 20229 19489 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_12780 21170 20226 gene locus_tag LOCUS_12790 gene fabD 21170 20226 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCZ6 protein_id gnl|my_center|LOCUS_12790 22378 21368 gene locus_tag LOCUS_12800 gene plsX 22378 21368 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG5 protein_id gnl|my_center|LOCUS_12800 22565 22380 gene locus_tag LOCUS_12810 gene rpmF 22565 22380 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_12810 23134 22580 gene locus_tag LOCUS_12820 23134 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_12820 24113 23160 gene locus_tag LOCUS_12830 24113 23160 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_12830 24940 24287 gene locus_tag LOCUS_12840 24940 24287 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_12840 25898 24930 gene locus_tag LOCUS_12850 25898 24930 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_12850 26668 30180 gene locus_tag LOCUS_12860 gene rne 26668 30180 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_12860 30475 31533 gene locus_tag LOCUS_12870 30475 31533 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_12870 31586 35011 gene locus_tag LOCUS_12880 31586 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 36371 35193 gene locus_tag LOCUS_12890 36371 35193 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_12890 39106 36488 gene locus_tag LOCUS_12900 39106 36488 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_12900 40472 39339 gene locus_tag LOCUS_12910 gene prpC 40472 39339 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_12910 41491 40610 gene locus_tag LOCUS_12920 gene prpB 41491 40610 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW1 protein_id gnl|my_center|LOCUS_12920 42156 41488 gene locus_tag LOCUS_12930 42156 41488 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103931.1 protein_id gnl|my_center|LOCUS_12930 43293 42799 gene locus_tag LOCUS_12940 43293 42799 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_12940 44425 43391 gene locus_tag LOCUS_12950 gene estX 44425 43391 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_12950 46874 44502 gene locus_tag LOCUS_12960 gene ppsA 46874 44502 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_12960 47164 47982 gene locus_tag LOCUS_12970 47164 47982 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q9 protein_id gnl|my_center|LOCUS_12970 48760 48023 gene locus_tag LOCUS_12980 48760 48023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 49061 50446 gene locus_tag LOCUS_12990 49061 50446 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 protein_id gnl|my_center|LOCUS_12990 51974 50514 gene locus_tag LOCUS_13000 51974 50514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 53422 52805 gene locus_tag LOCUS_13010 53422 52805 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_13010 53707 54426 gene locus_tag LOCUS_13020 gene cysH 53707 54426 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_13020 55460 54486 gene locus_tag LOCUS_13030 gene cysB 55460 54486 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_13030 55583 56353 gene locus_tag LOCUS_13040 55583 56353 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF8 protein_id gnl|my_center|LOCUS_13040 57248 56385 gene locus_tag LOCUS_13050 57248 56385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816527.1 protein_id gnl|my_center|LOCUS_13050 57437 58516 gene locus_tag LOCUS_13060 57437 58516 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_13060 59444 58647 gene locus_tag LOCUS_13070 59444 58647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_13070 60366 59548 gene locus_tag LOCUS_13080 60366 59548 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_13080 61235 60369 gene locus_tag LOCUS_13090 61235 60369 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_13090 61725 61276 gene locus_tag LOCUS_13100 61725 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence017 1380 349 gene locus_tag LOCUS_13110 1380 349 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_13110 2125 1517 gene locus_tag LOCUS_13120 2125 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_13120 2444 2163 gene locus_tag LOCUS_13130 2444 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2620 3198 gene locus_tag LOCUS_13140 gene greB 2620 3198 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_13140 3367 3723 gene locus_tag LOCUS_13150 3367 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4648 3797 gene locus_tag LOCUS_13160 gene ttcA 4648 3797 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_13160 5677 4907 gene locus_tag LOCUS_13170 gene anr 5677 4907 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_13170 6454 5798 gene locus_tag LOCUS_13180 6454 5798 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_13180 6571 6726 gene locus_tag LOCUS_13190 6571 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9217 6734 gene locus_tag LOCUS_13200 9217 6734 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_13200 9666 9214 gene locus_tag LOCUS_13210 gene ccoH 9666 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_13210 11349 9943 gene locus_tag LOCUS_13220 11349 9943 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_13220 12488 11568 gene locus_tag LOCUS_13230 gene ccoP 12488 11568 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_13230 12670 12491 gene locus_tag LOCUS_13240 12670 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 13283 12675 gene locus_tag LOCUS_13250 gene ccoO1 13283 12675 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_13250 14729 13296 gene locus_tag LOCUS_13260 gene ccoN2 14729 13296 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_13260 15094 15750 gene locus_tag LOCUS_13270 15094 15750 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_13270 16039 15758 gene locus_tag LOCUS_13280 16039 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 16509 16120 gene locus_tag LOCUS_13290 16509 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_13290 17162 16632 gene locus_tag LOCUS_13300 17162 16632 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_13300 19088 17391 gene locus_tag LOCUS_13310 gene fabY 19088 17391 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_13310 19206 20195 gene locus_tag LOCUS_13320 19206 20195 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_13320 20628 23279 gene locus_tag LOCUS_13330 gene aceE 20628 23279 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_13330 23292 25256 gene locus_tag LOCUS_13340 gene aceF 23292 25256 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPV0 protein_id gnl|my_center|LOCUS_13340 25295 25462 gene locus_tag LOCUS_13350 25295 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 25509 25793 gene locus_tag LOCUS_13360 25509 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 25906 26214 gene locus_tag LOCUS_13370 25906 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 26372 27925 gene locus_tag LOCUS_13380 26372 27925 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_13380 28049 30172 gene locus_tag LOCUS_13390 28049 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 30956 30195 gene locus_tag LOCUS_13400 gene pdhR 30956 30195 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 protein_id gnl|my_center|LOCUS_13400 31235 32050 gene locus_tag LOCUS_13410 31235 32050 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_13410 32047 33615 gene locus_tag LOCUS_13420 32047 33615 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_13420 33605 34318 gene locus_tag LOCUS_13430 33605 34318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706378.1 protein_id gnl|my_center|LOCUS_13430 34380 37259 gene locus_tag LOCUS_13440 34380 37259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_13440 37530 39368 gene locus_tag LOCUS_13450 37530 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 39365 41797 gene locus_tag LOCUS_13460 39365 41797 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707108.1 protein_id gnl|my_center|LOCUS_13460 42004 42792 gene locus_tag LOCUS_13470 42004 42792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_13470 42980 42789 gene locus_tag LOCUS_13480 42980 42789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 43079 44680 gene locus_tag LOCUS_13490 43079 44680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 47321 44718 gene locus_tag LOCUS_13500 47321 44718 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_13500 47383 47565 gene locus_tag LOCUS_13510 47383 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 47659 47925 gene locus_tag LOCUS_13520 gene tusA 47659 47925 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_13520 49181 47973 gene locus_tag LOCUS_13530 49181 47973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_13530 52140 49426 gene locus_tag LOCUS_13540 52140 49426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 52371 53813 gene locus_tag LOCUS_13550 gene sbcB 52371 53813 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_13550 54803 53922 gene locus_tag LOCUS_13560 54803 53922 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705748.1 protein_id gnl|my_center|LOCUS_13560 54867 55667 gene locus_tag LOCUS_13570 54867 55667 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 protein_id gnl|my_center|LOCUS_13570 55678 55875 gene locus_tag LOCUS_13580 55678 55875 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933047.1 protein_id gnl|my_center|LOCUS_13580 57216 55924 gene locus_tag LOCUS_13590 gene fabF2 57216 55924 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3X1 protein_id gnl|my_center|LOCUS_13590 60447 57367 gene locus_tag LOCUS_13600 60447 57367 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267494.1 protein_id gnl|my_center|LOCUS_13600 61496 60444 gene locus_tag LOCUS_13610 61496 60444 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence018 1552 254 gene locus_tag LOCUS_13620 1552 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1697 2458 gene locus_tag LOCUS_13630 gene rpe 1697 2458 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_13630 2474 3193 gene locus_tag LOCUS_13640 gene gph1 2474 3193 CDS product phosphoglycolate phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S586 protein_id gnl|my_center|LOCUS_13640 3302 3958 gene locus_tag LOCUS_13650 3302 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3958 5511 gene locus_tag LOCUS_13660 3958 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5711 7471 gene locus_tag LOCUS_13670 5711 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7623 8039 gene locus_tag LOCUS_13680 7623 8039 CDS product PduO protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_13680 8126 8866 gene locus_tag LOCUS_13690 gene cmoA 8126 8866 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G3 protein_id gnl|my_center|LOCUS_13690 8924 9970 gene locus_tag LOCUS_13700 gene cmoB 8924 9970 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_13700 10747 10046 gene locus_tag LOCUS_13710 10747 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 11740 10877 gene locus_tag LOCUS_13720 11740 10877 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_13720 12079 12636 gene locus_tag LOCUS_13730 gene ampD 12079 12636 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_13730 12633 13667 gene locus_tag LOCUS_13740 12633 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 14065 13709 gene locus_tag LOCUS_13750 14065 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14566 14174 gene locus_tag LOCUS_13760 14566 14174 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_13760 15541 15068 gene locus_tag LOCUS_13770 15541 15068 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_13770 16925 15987 gene locus_tag LOCUS_13780 gene dusC 16925 15987 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_13780 17354 17605 gene locus_tag LOCUS_13790 17354 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 17665 19434 gene locus_tag LOCUS_13800 gene oadA 17665 19434 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_454666.1 protein_id gnl|my_center|LOCUS_13800 19450 20625 gene locus_tag LOCUS_13810 19450 20625 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_13810 21196 20771 gene locus_tag LOCUS_13820 21196 20771 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261327.1 protein_id gnl|my_center|LOCUS_13820 23981 21189 gene locus_tag LOCUS_13830 23981 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 24709 23993 gene locus_tag LOCUS_13840 24709 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 25738 24713 gene locus_tag LOCUS_13850 25738 24713 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946367.1 protein_id gnl|my_center|LOCUS_13850 26250 25753 gene locus_tag LOCUS_13860 26250 25753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 26832 26263 gene locus_tag LOCUS_13870 26832 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28894 27410 gene locus_tag LOCUS_13880 gene mqo1 28894 27410 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_13880 29553 29876 gene locus_tag LOCUS_13890 29553 29876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 30328 32571 gene locus_tag LOCUS_13900 gene bcsA 30328 32571 CDS product cellulose synthase catalytic subunit (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880909.1 protein_id gnl|my_center|LOCUS_13900 32680 34941 gene locus_tag LOCUS_13910 32680 34941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 34941 36002 gene locus_tag LOCUS_13920 34941 36002 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_13920 35999 38533 gene locus_tag LOCUS_13930 35999 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 40665 38548 gene locus_tag LOCUS_13940 40665 38548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 41025 41474 gene locus_tag LOCUS_13950 gene fliS 41025 41474 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_13950 41877 43346 gene locus_tag LOCUS_13960 gene fleQ 41877 43346 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 protein_id gnl|my_center|LOCUS_13960 43532 44839 gene locus_tag LOCUS_13970 gene fleS 43532 44839 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_13970 44869 46239 gene locus_tag LOCUS_13980 gene fleR 44869 46239 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_13980 47070 46255 gene locus_tag LOCUS_13990 47070 46255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 47692 47123 gene locus_tag LOCUS_14000 47692 47123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 48164 47829 gene locus_tag LOCUS_14010 48164 47829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 49032 48274 gene locus_tag LOCUS_14020 gene fabG 49032 48274 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268829.1 protein_id gnl|my_center|LOCUS_14020 49391 49870 gene locus_tag LOCUS_14030 gene fxsA 49391 49870 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_14030 50038 50331 gene locus_tag LOCUS_14040 gene groS 50038 50331 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30720 protein_id gnl|my_center|LOCUS_14040 50388 52028 gene locus_tag LOCUS_14050 gene groL1 50388 52028 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_14050 53085 54794 gene locus_tag LOCUS_14060 53085 54794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 55306 55797 gene locus_tag LOCUS_14070 55306 55797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 55847 57538 gene locus_tag LOCUS_14080 gene fliF 55847 57538 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51463 protein_id gnl|my_center|LOCUS_14080 57531 58547 gene locus_tag LOCUS_14090 gene fliG 57531 58547 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884X7 protein_id gnl|my_center|LOCUS_14090 >Feature sequence019 4271 327 gene locus_tag LOCUS_14100 gene hrpA 4271 327 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_14100 4545 5048 gene locus_tag LOCUS_14110 gene femI 4545 5048 CDS product ECF sigma factor FemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_14110 5050 6051 gene locus_tag LOCUS_14120 5050 6051 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 protein_id gnl|my_center|LOCUS_14120 6129 8501 gene locus_tag LOCUS_14130 6129 8501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390127.1 protein_id gnl|my_center|LOCUS_14130 8508 9734 gene locus_tag LOCUS_14140 8508 9734 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_14140 10165 9731 gene locus_tag LOCUS_14150 10165 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_14150 11194 10271 gene locus_tag LOCUS_14160 gene btuF 11194 10271 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_14160 11754 11191 gene locus_tag LOCUS_14170 gene cobO 11754 11191 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_14170 13384 11780 gene locus_tag LOCUS_14180 gene cobQ 13384 11780 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I467 protein_id gnl|my_center|LOCUS_14180 14021 13350 gene locus_tag LOCUS_14190 14021 13350 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480583.1 protein_id gnl|my_center|LOCUS_14190 14549 14025 gene locus_tag LOCUS_14200 gene cobU 14549 14025 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215857.1 protein_id gnl|my_center|LOCUS_14200 15340 14546 gene locus_tag LOCUS_14210 gene cobS 15340 14546 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSL8 protein_id gnl|my_center|LOCUS_14210 16416 15340 gene locus_tag LOCUS_14220 gene cobT 16416 15340 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q46 protein_id gnl|my_center|LOCUS_14220 17453 16431 gene locus_tag LOCUS_14230 gene btuC 17453 16431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_14230 18274 17450 gene locus_tag LOCUS_14240 gene btuD 18274 17450 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_14240 18622 18936 gene locus_tag LOCUS_14250 18622 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 19330 20142 gene locus_tag LOCUS_14260 19330 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 21953 20253 gene locus_tag LOCUS_14270 gene fadD1 21953 20253 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_14270 22256 23263 gene locus_tag LOCUS_14280 22256 23263 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102569.1 protein_id gnl|my_center|LOCUS_14280 23364 23837 gene locus_tag LOCUS_14290 23364 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_14290 25117 23834 gene locus_tag LOCUS_14300 25117 23834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 25706 25263 gene locus_tag LOCUS_14310 25706 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 26586 26050 gene locus_tag LOCUS_14320 26586 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 27955 26858 gene locus_tag LOCUS_14330 27955 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 28268 28855 gene locus_tag LOCUS_14340 gene ybcL 28268 28855 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 protein_id gnl|my_center|LOCUS_14340 29713 28874 gene locus_tag LOCUS_14350 29713 28874 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263642.1 protein_id gnl|my_center|LOCUS_14350 30334 29855 gene locus_tag LOCUS_14360 30334 29855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106045.1 protein_id gnl|my_center|LOCUS_14360 30416 31345 gene locus_tag LOCUS_14370 30416 31345 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_14370 32286 31351 gene locus_tag LOCUS_14380 gene nahR 32286 31351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_14380 32512 33360 gene locus_tag LOCUS_14390 32512 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 33752 34549 gene locus_tag LOCUS_14400 33752 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 35128 34643 gene locus_tag LOCUS_14410 gene slyD 35128 34643 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_14410 36511 35315 gene locus_tag LOCUS_14420 36511 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 38838 36541 gene locus_tag LOCUS_14430 38838 36541 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q935N6 protein_id gnl|my_center|LOCUS_14430 39276 39013 gene locus_tag LOCUS_14440 39276 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 39668 40447 gene locus_tag LOCUS_14450 gene modE 39668 40447 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204316.1 protein_id gnl|my_center|LOCUS_14450 41121 40579 gene locus_tag LOCUS_14460 41121 40579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 41862 41167 gene locus_tag LOCUS_14470 41862 41167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 43913 42054 gene locus_tag LOCUS_14480 43913 42054 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_14480 45258 44041 gene locus_tag LOCUS_14490 45258 44041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226921.1 protein_id gnl|my_center|LOCUS_14490 46750 45380 gene locus_tag LOCUS_14500 46750 45380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_14500 48463 46766 gene locus_tag LOCUS_14510 48463 46766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 49520 48510 gene locus_tag LOCUS_14520 49520 48510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 50662 49517 gene locus_tag LOCUS_14530 50662 49517 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_14530 51303 52226 gene locus_tag LOCUS_14540 51303 52226 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705003.1 protein_id gnl|my_center|LOCUS_14540 53169 52234 gene locus_tag LOCUS_14550 53169 52234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 55054 53270 gene locus_tag LOCUS_14560 55054 53270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence020 35 799 gene locus_tag LOCUS_14570 35 799 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_14570 799 2169 gene locus_tag LOCUS_14580 799 2169 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_14580 2175 2696 gene locus_tag LOCUS_14590 2175 2696 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_14590 2714 3124 gene locus_tag LOCUS_14600 2714 3124 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_14600 3127 3753 gene locus_tag LOCUS_14610 gene tonB2 3127 3753 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_14610 3765 5060 gene locus_tag LOCUS_14620 3765 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_14620 5805 5146 gene locus_tag LOCUS_14630 5805 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5908 7029 gene locus_tag LOCUS_14640 5908 7029 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_14640 7912 7031 gene locus_tag LOCUS_14650 7912 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8006 8302 gene locus_tag LOCUS_14660 8006 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_14660 8286 8714 gene locus_tag LOCUS_14670 8286 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10381 8756 gene locus_tag LOCUS_14680 gene nadB 10381 8756 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_14680 10573 11160 gene locus_tag LOCUS_14690 gene algU 10573 11160 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_14690 11181 11894 gene locus_tag LOCUS_14700 gene mucA 11181 11894 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38107 protein_id gnl|my_center|LOCUS_14700 11891 12916 gene locus_tag LOCUS_14710 11891 12916 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_14710 12921 13343 gene locus_tag LOCUS_14720 gene rseC 12921 13343 CDS product SoxR reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172756.1 protein_id gnl|my_center|LOCUS_14720 13438 14832 gene locus_tag LOCUS_14730 gene mucD 13438 14832 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_14730 14986 16785 gene locus_tag LOCUS_14740 gene lepA 14986 16785 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_14740 16785 17144 gene locus_tag LOCUS_14750 16785 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 17145 17831 gene locus_tag LOCUS_14760 gene rnc 17145 17831 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPB0 protein_id gnl|my_center|LOCUS_14760 17828 18724 gene locus_tag LOCUS_14770 gene era 17828 18724 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG2 protein_id gnl|my_center|LOCUS_14770 18724 19374 gene locus_tag LOCUS_14780 gene recO 18724 19374 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_14780 19450 20190 gene locus_tag LOCUS_14790 gene pdxJ 19450 20190 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_14790 20187 20600 gene locus_tag LOCUS_14800 gene acpS 20187 20600 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH77 protein_id gnl|my_center|LOCUS_14800 23525 20619 gene locus_tag LOCUS_14810 23525 20619 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ42 protein_id gnl|my_center|LOCUS_14810 23763 24692 gene locus_tag LOCUS_14820 gene cysM 23763 24692 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_14820 24823 26139 gene locus_tag LOCUS_14830 gene rlmD 24823 26139 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI4 protein_id gnl|my_center|LOCUS_14830 26132 28378 gene locus_tag LOCUS_14840 gene relA 26132 28378 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_14840 28378 29220 gene locus_tag LOCUS_14850 28378 29220 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_14850 29655 29323 gene locus_tag LOCUS_14860 29655 29323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_14860 29816 32455 gene locus_tag LOCUS_14870 gene ppc 29816 32455 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNZ5 protein_id gnl|my_center|LOCUS_14870 32819 33472 gene locus_tag LOCUS_14880 gene adk 32819 33472 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWV2 protein_id gnl|my_center|LOCUS_14880 33591 34328 gene locus_tag LOCUS_14890 33591 34328 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 protein_id gnl|my_center|LOCUS_14890 34339 35136 gene locus_tag LOCUS_14900 gene uppP1 34339 35136 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_14900 35153 35932 gene locus_tag LOCUS_14910 gene rsmJ 35153 35932 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU6 protein_id gnl|my_center|LOCUS_14910 38440 35987 gene locus_tag LOCUS_14920 gene plsB 38440 35987 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Q7 protein_id gnl|my_center|LOCUS_14920 38793 38509 gene locus_tag LOCUS_14930 38793 38509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 38893 39327 gene locus_tag LOCUS_14940 38893 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 40412 39639 gene locus_tag LOCUS_14950 40412 39639 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_14950 40595 41509 gene locus_tag LOCUS_14960 gene trmJ 40595 41509 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_14960 41478 42344 gene locus_tag LOCUS_14970 gene cysE 41478 42344 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_14970 42514 42996 gene locus_tag LOCUS_14980 42514 42996 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_14980 43163 44335 gene locus_tag LOCUS_14990 gene iscS 43163 44335 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_14990 44449 44874 gene locus_tag LOCUS_15000 gene ndk 44449 44874 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_15000 44954 46072 gene locus_tag LOCUS_15010 gene rlmN 44954 46072 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_15010 46084 46884 gene locus_tag LOCUS_15020 46084 46884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 46914 48023 gene locus_tag LOCUS_15030 gene ispG 46914 48023 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_15030 48081 49361 gene locus_tag LOCUS_15040 gene hisS 48081 49361 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 protein_id gnl|my_center|LOCUS_15040 49454 50113 gene locus_tag LOCUS_15050 49454 50113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 50113 51324 gene locus_tag LOCUS_15060 gene bamB 50113 51324 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_15060 51401 52912 gene locus_tag LOCUS_15070 gene der 51401 52912 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_15070 53065 52793 gene locus_tag LOCUS_15080 53065 52793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 53024 53659 gene locus_tag LOCUS_15090 53024 53659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 54211 53702 gene locus_tag LOCUS_15100 54211 53702 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence021 1024 2253 gene locus_tag LOCUS_15110 1024 2253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 protein_id gnl|my_center|LOCUS_15110 2407 4755 gene locus_tag LOCUS_15120 2407 4755 CDS product 9-hexadecenoic acid cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270842.1 protein_id gnl|my_center|LOCUS_15120 6912 4825 gene locus_tag LOCUS_15130 gene lipA 6912 4825 CDS product capsule polysaccharide modification protein LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05013 protein_id gnl|my_center|LOCUS_15130 8522 7089 gene locus_tag LOCUS_15140 gene rhlB 8522 7089 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_15140 9116 8535 gene locus_tag LOCUS_15150 gene epmC 9116 8535 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44255 protein_id gnl|my_center|LOCUS_15150 9334 10695 gene locus_tag LOCUS_15160 gene mdtK 9334 10695 CDS product multidrug resistance protein MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDZ8 protein_id gnl|my_center|LOCUS_15160 11862 10825 gene locus_tag LOCUS_15170 11862 10825 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_15170 12221 12682 gene locus_tag LOCUS_15180 12221 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 13609 12725 gene locus_tag LOCUS_15190 13609 12725 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204912.1 protein_id gnl|my_center|LOCUS_15190 14033 14644 gene locus_tag LOCUS_15200 14033 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_15200 16687 14630 gene locus_tag LOCUS_15210 gene tgpA 16687 14630 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_15210 17676 16684 gene locus_tag LOCUS_15220 17676 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_15220 18603 17680 gene locus_tag LOCUS_15230 18603 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_15230 20046 18832 gene locus_tag LOCUS_15240 gene metZ 20046 18832 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_15240 21670 20150 gene locus_tag LOCUS_15250 gene purF 21670 20150 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_15250 22186 21683 gene locus_tag LOCUS_15260 22186 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_15260 22922 22368 gene locus_tag LOCUS_15270 22922 22368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_15270 24247 22907 gene locus_tag LOCUS_15280 24247 22907 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267159.1 protein_id gnl|my_center|LOCUS_15280 25083 24277 gene locus_tag LOCUS_15290 gene trpA 25083 24277 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_15290 26346 25099 gene locus_tag LOCUS_15300 gene trpB 26346 25099 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_15300 26986 26318 gene locus_tag LOCUS_15310 gene trpF 26986 26318 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_15310 27955 27131 gene locus_tag LOCUS_15320 gene truA 27955 27131 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_15320 31585 27959 gene locus_tag LOCUS_15330 31585 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 33002 31884 gene locus_tag LOCUS_15340 gene asd-1 33002 31884 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJM5 protein_id gnl|my_center|LOCUS_15340 34191 33115 gene locus_tag LOCUS_15350 gene leuB 34191 33115 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C0 protein_id gnl|my_center|LOCUS_15350 34921 34274 gene locus_tag LOCUS_15360 gene leuD 34921 34274 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_15360 36354 34936 gene locus_tag LOCUS_15370 gene leuC 36354 34936 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_15370 36542 37462 gene locus_tag LOCUS_15380 36542 37462 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_15380 37576 38502 gene locus_tag LOCUS_15390 gene uspE 37576 38502 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_15390 40611 38683 gene locus_tag LOCUS_15400 40611 38683 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105893.1 protein_id gnl|my_center|LOCUS_15400 41645 40773 gene locus_tag LOCUS_15410 gene sucD 41645 40773 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_15410 42821 41655 gene locus_tag LOCUS_15420 gene sucC 42821 41655 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_15420 44406 42967 gene locus_tag LOCUS_15430 gene lpdG 44406 42967 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_15430 45624 44428 gene locus_tag LOCUS_15440 gene sucB 45624 44428 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_15440 48488 45651 gene locus_tag LOCUS_15450 gene sucA 48488 45651 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_15450 49479 48769 gene locus_tag LOCUS_15460 gene sdhB 49479 48769 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_15460 51265 49493 gene locus_tag LOCUS_15470 gene sdhA 51265 49493 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_15470 51616 51269 gene locus_tag LOCUS_15480 51616 51269 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 protein_id gnl|my_center|LOCUS_15480 51960 51610 gene locus_tag LOCUS_15490 gene sdhC 51960 51610 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738085.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence022 964 888 gene locus_tag LOCUS_t00200 964 888 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1085 1009 gene locus_tag LOCUS_t00210 1085 1009 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1261 2322 gene locus_tag LOCUS_15500 1261 2322 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_15500 3000 2464 gene locus_tag LOCUS_15510 3000 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3741 3064 gene locus_tag LOCUS_15520 3741 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4883 3738 gene locus_tag LOCUS_15530 4883 3738 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230104.2 protein_id gnl|my_center|LOCUS_15530 6241 4937 gene locus_tag LOCUS_15540 6241 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_15540 7081 6509 gene locus_tag LOCUS_15550 7081 6509 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103364.1 protein_id gnl|my_center|LOCUS_15550 7805 8179 gene locus_tag LOCUS_15560 7805 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 8929 8195 gene locus_tag LOCUS_15570 8929 8195 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_15570 9729 9079 gene locus_tag LOCUS_15580 gene msrA 9729 9079 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_15580 9788 10531 gene locus_tag LOCUS_15590 9788 10531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_15590 10585 11268 gene locus_tag LOCUS_15600 10585 11268 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269047.1 protein_id gnl|my_center|LOCUS_15600 13095 11329 gene locus_tag LOCUS_15610 gene phoD 13095 11329 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_15610 13270 15204 gene locus_tag LOCUS_15620 gene rnb 13270 15204 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED8 protein_id gnl|my_center|LOCUS_15620 16524 15319 gene locus_tag LOCUS_15630 gene cycH 16524 15319 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_15630 17033 16521 gene locus_tag LOCUS_15640 17033 16521 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_15640 17554 17033 gene locus_tag LOCUS_15650 gene dsbE 17554 17033 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE9 protein_id gnl|my_center|LOCUS_15650 19563 17551 gene locus_tag LOCUS_15660 gene ccmF 19563 17551 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_15660 20075 19563 gene locus_tag LOCUS_15670 gene ccmE 20075 19563 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_15670 20298 20077 gene locus_tag LOCUS_15680 gene ccmD 20298 20077 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z06 protein_id gnl|my_center|LOCUS_15680 21074 20298 gene locus_tag LOCUS_15690 gene ccmC 21074 20298 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_15690 21753 21085 gene locus_tag LOCUS_15700 gene ccmB 21753 21085 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI32 protein_id gnl|my_center|LOCUS_15700 22433 21750 gene locus_tag LOCUS_15710 gene ccmA 22433 21750 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_15710 23475 23287 gene locus_tag LOCUS_15720 23475 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 23510 24577 gene locus_tag LOCUS_15730 23510 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 24574 24864 gene locus_tag LOCUS_15740 24574 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 protein_id gnl|my_center|LOCUS_15740 25532 24870 gene locus_tag LOCUS_15750 25532 24870 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920065.1 protein_id gnl|my_center|LOCUS_15750 25900 27294 gene locus_tag LOCUS_15760 gene hemN 25900 27294 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_15760 27263 27826 gene locus_tag LOCUS_15770 27263 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 28595 27846 gene locus_tag LOCUS_15780 28595 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 28651 29418 gene locus_tag LOCUS_15790 28651 29418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_15790 29535 29864 gene locus_tag LOCUS_15800 29535 29864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 30786 29845 gene locus_tag LOCUS_15810 30786 29845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 30978 31895 gene locus_tag LOCUS_15820 30978 31895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 31897 32259 gene locus_tag LOCUS_15830 31897 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 32386 33288 gene locus_tag LOCUS_15840 32386 33288 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_15840 33372 34319 gene locus_tag LOCUS_15850 33372 34319 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ7 protein_id gnl|my_center|LOCUS_15850 34441 35049 gene locus_tag LOCUS_15860 34441 35049 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_15860 36051 35041 gene locus_tag LOCUS_15870 36051 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 36977 36111 gene locus_tag LOCUS_15880 gene fieF 36977 36111 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPK2 protein_id gnl|my_center|LOCUS_15880 38414 37056 gene locus_tag LOCUS_15890 38414 37056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 39106 38414 gene locus_tag LOCUS_15900 39106 38414 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_15900 42270 39100 gene locus_tag LOCUS_15910 42270 39100 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_15910 43582 42263 gene locus_tag LOCUS_15920 43582 42263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 45059 43584 gene locus_tag LOCUS_15930 45059 43584 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_15930 45570 45277 gene locus_tag LOCUS_15940 45570 45277 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_15940 45840 45571 gene locus_tag LOCUS_15950 45840 45571 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DG3 protein_id gnl|my_center|LOCUS_15950 47136 45931 gene locus_tag LOCUS_15960 47136 45931 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7G9 protein_id gnl|my_center|LOCUS_15960 47728 47123 gene locus_tag LOCUS_15970 47728 47123 CDS product type II restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208279.1 protein_id gnl|my_center|LOCUS_15970 47973 48317 gene locus_tag LOCUS_15980 47973 48317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 48685 48365 gene locus_tag LOCUS_15990 48685 48365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 49104 48823 gene locus_tag LOCUS_16000 49104 48823 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141822.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence023 1159 2598 gene locus_tag LOCUS_16010 gene hldE 1159 2598 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL4 protein_id gnl|my_center|LOCUS_16010 2595 3566 gene locus_tag LOCUS_16020 gene hldD 2595 3566 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_16020 3640 4551 gene locus_tag LOCUS_16030 gene lpxL 3640 4551 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_16030 6021 4552 gene locus_tag LOCUS_16040 6021 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 6725 6231 gene locus_tag LOCUS_16050 6725 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8596 6824 gene locus_tag LOCUS_16060 8596 6824 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_16060 10018 8624 gene locus_tag LOCUS_16070 10018 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 10033 11205 gene locus_tag LOCUS_16080 10033 11205 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_16080 11332 12636 gene locus_tag LOCUS_16090 gene argA 11332 12636 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_16090 12653 13492 gene locus_tag LOCUS_16100 12653 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 14731 13508 gene locus_tag LOCUS_16110 gene chrA 14731 13508 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_16110 15952 14882 gene locus_tag LOCUS_16120 15952 14882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_16120 16516 16010 gene locus_tag LOCUS_16130 gene folA 16516 16010 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_16130 18358 16643 gene locus_tag LOCUS_16140 18358 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 19295 18501 gene locus_tag LOCUS_16150 gene thyA 19295 18501 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_16150 20128 19322 gene locus_tag LOCUS_16160 gene lgt 20128 19322 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_16160 21007 20213 gene locus_tag LOCUS_16170 21007 20213 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_16170 21045 21899 gene locus_tag LOCUS_16180 21045 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_16180 24265 21980 gene locus_tag LOCUS_16190 24265 21980 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_16190 24766 24272 gene locus_tag LOCUS_16200 gene rppH 24766 24272 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_16200 25164 25823 gene locus_tag LOCUS_16210 25164 25823 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_16210 25861 27096 gene locus_tag LOCUS_16220 25861 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 28456 27251 gene locus_tag LOCUS_16230 28456 27251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_16230 29871 28612 gene locus_tag LOCUS_16240 29871 28612 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_16240 31153 29861 gene locus_tag LOCUS_16250 gene ubiH 31153 29861 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_16250 32605 31268 gene locus_tag LOCUS_16260 gene pepP 32605 31268 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_16260 33172 32618 gene locus_tag LOCUS_16270 33172 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 33321 33536 gene locus_tag LOCUS_16280 33321 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 33526 33840 gene locus_tag LOCUS_16290 gene zapA 33526 33840 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_16290 34093 34686 gene locus_tag LOCUS_16300 34093 34686 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_16300 36030 35197 gene locus_tag LOCUS_16310 36030 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_16310 37694 36288 gene locus_tag LOCUS_16320 gene glnA 37694 36288 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_16320 38075 39895 gene locus_tag LOCUS_16330 gene typA 38075 39895 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_16330 40960 39992 gene locus_tag LOCUS_16340 40960 39992 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 protein_id gnl|my_center|LOCUS_16340 41030 41773 gene locus_tag LOCUS_16350 41030 41773 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971501.1 protein_id gnl|my_center|LOCUS_16350 43407 41914 gene locus_tag LOCUS_16360 gene ibeB 43407 41914 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815451.1 protein_id gnl|my_center|LOCUS_16360 46549 43409 gene locus_tag LOCUS_16370 46549 43409 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815450.1 protein_id gnl|my_center|LOCUS_16370 47737 46562 gene locus_tag LOCUS_16380 47737 46562 CDS product acriflavine resistance protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815449.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence024 985 737 gene locus_tag LOCUS_16390 985 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1055 1834 gene locus_tag LOCUS_16400 1055 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2566 1928 gene locus_tag LOCUS_16410 2566 1928 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_16410 4471 2765 gene locus_tag LOCUS_16420 4471 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4759 5280 gene locus_tag LOCUS_16430 gene nlpC 4759 5280 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 protein_id gnl|my_center|LOCUS_16430 5351 6268 gene locus_tag LOCUS_16440 gene glsA 5351 6268 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PH0 protein_id gnl|my_center|LOCUS_16440 7285 6359 gene locus_tag LOCUS_16450 7285 6359 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_16450 7464 7946 gene locus_tag LOCUS_16460 7464 7946 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_16460 8044 8844 gene locus_tag LOCUS_16470 8044 8844 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_16470 9010 10002 gene locus_tag LOCUS_16480 9010 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_16480 10085 10321 gene locus_tag LOCUS_16490 10085 10321 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 protein_id gnl|my_center|LOCUS_16490 10404 10793 gene locus_tag LOCUS_16500 10404 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11333 10887 gene locus_tag LOCUS_16510 11333 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 11518 15153 gene locus_tag LOCUS_16520 11518 15153 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_16520 15153 16088 gene locus_tag LOCUS_16530 15153 16088 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888247.1 protein_id gnl|my_center|LOCUS_16530 18479 16539 gene locus_tag LOCUS_16540 18479 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 20923 18479 gene locus_tag LOCUS_16550 20923 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 22457 20916 gene locus_tag LOCUS_16560 22457 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 25974 22441 gene locus_tag LOCUS_16570 25974 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 27408 25978 gene locus_tag LOCUS_16580 27408 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 28116 27412 gene locus_tag LOCUS_16590 28116 27412 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 protein_id gnl|my_center|LOCUS_16590 28799 28116 gene locus_tag LOCUS_16600 28799 28116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338966.1 protein_id gnl|my_center|LOCUS_16600 29183 28929 gene locus_tag LOCUS_16610 29183 28929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 29348 30634 gene locus_tag LOCUS_16620 29348 30634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888240.1 protein_id gnl|my_center|LOCUS_16620 30773 32473 gene locus_tag LOCUS_16630 30773 32473 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972307.1 protein_id gnl|my_center|LOCUS_16630 32470 33639 gene locus_tag LOCUS_16640 32470 33639 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972306.1 protein_id gnl|my_center|LOCUS_16640 33636 34481 gene locus_tag LOCUS_16650 33636 34481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_16650 34478 35200 gene locus_tag LOCUS_16660 34478 35200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938472.1 protein_id gnl|my_center|LOCUS_16660 35251 36225 gene locus_tag LOCUS_16670 gene ureD 35251 36225 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_16670 36274 36576 gene locus_tag LOCUS_16680 gene ureA 36274 36576 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP4 protein_id gnl|my_center|LOCUS_16680 36697 38757 gene locus_tag LOCUS_16690 gene ureC2 36697 38757 CDS product urease subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN06 protein_id gnl|my_center|LOCUS_16690 38879 39448 gene locus_tag LOCUS_16700 38879 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 39429 40154 gene locus_tag LOCUS_16710 gene ureF 39429 40154 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_16710 40194 40841 gene locus_tag LOCUS_16720 gene ureG 40194 40841 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_16720 40927 41514 gene locus_tag LOCUS_16730 40927 41514 CDS product protein hupE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368916.1 protein_id gnl|my_center|LOCUS_16730 43025 41580 gene locus_tag LOCUS_16740 43025 41580 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_16740 43259 44101 gene locus_tag LOCUS_16750 43259 44101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 44098 44643 gene locus_tag LOCUS_16760 gene maa 44098 44643 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072056.1 protein_id gnl|my_center|LOCUS_16760 44662 45015 gene locus_tag LOCUS_16770 44662 45015 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071541.1 protein_id gnl|my_center|LOCUS_16770 45407 45868 gene locus_tag LOCUS_16780 45407 45868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 46973 46089 gene locus_tag LOCUS_16790 46973 46089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_16790 47117 47890 gene locus_tag LOCUS_16800 gene fpr 47117 47890 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_16800 <48657 47983 gene locus_tag LOCUS_16810 <48657 47983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084207617.1:CDP-abequose synthase >Feature sequence025 <1 549 gene locus_tag LOCUS_16820 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P14165:citrate synthase 697 1587 gene locus_tag LOCUS_16830 697 1587 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_16830 1737 2342 gene locus_tag LOCUS_16840 1737 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3182 2373 gene locus_tag LOCUS_16850 3182 2373 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268341.1 protein_id gnl|my_center|LOCUS_16850 4190 3246 gene locus_tag LOCUS_16860 4190 3246 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_16860 4318 5547 gene locus_tag LOCUS_16870 4318 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_16870 6649 5552 gene locus_tag LOCUS_16880 6649 5552 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_16880 6735 7691 gene locus_tag LOCUS_16890 6735 7691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707380.1 protein_id gnl|my_center|LOCUS_16890 7822 8856 gene locus_tag LOCUS_16900 7822 8856 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969005.1 protein_id gnl|my_center|LOCUS_16900 8864 10480 gene locus_tag LOCUS_16910 8864 10480 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_16910 10473 11276 gene locus_tag LOCUS_16920 10473 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 11523 12734 gene locus_tag LOCUS_16930 gene fabB 11523 12734 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_16930 12902 17791 gene locus_tag LOCUS_16940 12902 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 18578 17922 gene locus_tag LOCUS_16950 18578 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 19037 18609 gene locus_tag LOCUS_16960 19037 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 22281 19285 gene locus_tag LOCUS_16970 22281 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 24329 22359 gene locus_tag LOCUS_16980 gene recD 24329 22359 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH01 protein_id gnl|my_center|LOCUS_16980 28276 24326 gene locus_tag LOCUS_16990 gene recB 28276 24326 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB6 protein_id gnl|my_center|LOCUS_16990 32013 28273 gene locus_tag LOCUS_17000 gene recC 32013 28273 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP4 protein_id gnl|my_center|LOCUS_17000 32212 32886 gene locus_tag LOCUS_17010 32212 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 33235 33660 gene locus_tag LOCUS_17020 33235 33660 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316399.1 protein_id gnl|my_center|LOCUS_17020 34320 33799 gene locus_tag LOCUS_17030 34320 33799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704763.1 protein_id gnl|my_center|LOCUS_17030 34556 35572 gene locus_tag LOCUS_17040 34556 35572 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_17040 36817 35639 gene locus_tag LOCUS_17050 36817 35639 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_17050 37692 36820 gene locus_tag LOCUS_17060 37692 36820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_17060 38076 39257 gene locus_tag LOCUS_17070 gene nptA 38076 39257 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_17070 39271 39492 gene locus_tag LOCUS_17080 39271 39492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 39940 39560 gene locus_tag LOCUS_17090 39940 39560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_17090 41185 40061 gene locus_tag LOCUS_17100 41185 40061 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_17100 41327 41584 gene locus_tag LOCUS_17110 41327 41584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 42780 41542 gene locus_tag LOCUS_17120 gene flgL 42780 41542 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_17120 45805 42827 gene locus_tag LOCUS_17130 45805 42827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 46965 45805 gene locus_tag LOCUS_17140 gene flgJ 46965 45805 CDS product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706636.1 protein_id gnl|my_center|LOCUS_17140 47422 47036 gene locus_tag LOCUS_17150 gene pcaC 47422 47036 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence026 <1 501 gene locus_tag LOCUS_17160 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWT7:4-hydroxyphenylacetate 3-monooxygenase oxygenase component 1363 416 gene locus_tag LOCUS_17170 1363 416 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808741.1 protein_id gnl|my_center|LOCUS_17170 1523 2314 gene locus_tag LOCUS_17180 1523 2314 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189420.1 protein_id gnl|my_center|LOCUS_17180 2458 3495 gene locus_tag LOCUS_17190 2458 3495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_17190 3646 4614 gene locus_tag LOCUS_17200 gene panE-2 3646 4614 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196629.1 protein_id gnl|my_center|LOCUS_17200 4796 5617 gene locus_tag LOCUS_17210 4796 5617 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_17210 6949 5693 gene locus_tag LOCUS_17220 6949 5693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_17220 8254 7235 gene locus_tag LOCUS_17230 8254 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 10302 8629 gene locus_tag LOCUS_17240 10302 8629 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_17240 11491 10313 gene locus_tag LOCUS_17250 gene fadA 11491 10313 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNI0 protein_id gnl|my_center|LOCUS_17250 13691 11502 gene locus_tag LOCUS_17260 gene fadB 13691 11502 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_17260 15056 13764 gene locus_tag LOCUS_17270 15056 13764 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_17270 15604 15053 gene locus_tag LOCUS_17280 15604 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 16758 15640 gene locus_tag LOCUS_17290 16758 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 18662 16872 gene locus_tag LOCUS_17300 18662 16872 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821527.1 protein_id gnl|my_center|LOCUS_17300 18855 19964 gene locus_tag LOCUS_17310 18855 19964 CDS product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064415.1 protein_id gnl|my_center|LOCUS_17310 19992 20630 gene locus_tag LOCUS_17320 19992 20630 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064417.1 protein_id gnl|my_center|LOCUS_17320 21284 20715 gene locus_tag LOCUS_17330 21284 20715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_17330 22205 21366 gene locus_tag LOCUS_17340 gene surE 22205 21366 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L02 protein_id gnl|my_center|LOCUS_17340 22978 22202 gene locus_tag LOCUS_17350 22978 22202 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_17350 24484 23102 gene locus_tag LOCUS_17360 24484 23102 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114059.1 protein_id gnl|my_center|LOCUS_17360 25803 24481 gene locus_tag LOCUS_17370 gene acd 25803 24481 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_17370 26903 25854 gene locus_tag LOCUS_17380 26903 25854 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_17380 27028 27963 gene locus_tag LOCUS_17390 27028 27963 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_17390 28188 30779 gene locus_tag LOCUS_17400 gene mutS 28188 30779 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP5 protein_id gnl|my_center|LOCUS_17400 30969 31292 gene locus_tag LOCUS_17410 30969 31292 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314327.1 protein_id gnl|my_center|LOCUS_17410 32528 31563 gene locus_tag LOCUS_17420 gene rpoS 32528 31563 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDD3 protein_id gnl|my_center|LOCUS_17420 33429 32620 gene locus_tag LOCUS_17430 33429 32620 CDS product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 protein_id gnl|my_center|LOCUS_17430 34598 33681 gene locus_tag LOCUS_17440 34598 33681 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_17440 35293 34628 gene locus_tag LOCUS_17450 gene pcm 35293 34628 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L4 protein_id gnl|my_center|LOCUS_17450 36047 35307 gene locus_tag LOCUS_17460 gene surE 36047 35307 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY05 protein_id gnl|my_center|LOCUS_17460 37102 36044 gene locus_tag LOCUS_17470 gene truD 37102 36044 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_17470 37729 37253 gene locus_tag LOCUS_17480 gene ispF 37729 37253 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_17480 38451 37726 gene locus_tag LOCUS_17490 gene ispD 38451 37726 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_17490 38741 38448 gene locus_tag LOCUS_17500 gene ftsB 38741 38448 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_17500 40102 38810 gene locus_tag LOCUS_17510 gene eno 40102 38810 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_17510 41806 40178 gene locus_tag LOCUS_17520 gene pyrG 41806 40178 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_17520 42146 43096 gene locus_tag LOCUS_17530 42146 43096 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 protein_id gnl|my_center|LOCUS_17530 44173 43265 gene locus_tag LOCUS_17540 44173 43265 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 protein_id gnl|my_center|LOCUS_17540 44333 44959 gene locus_tag LOCUS_17550 44333 44959 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_17550 45033 45272 gene locus_tag LOCUS_17560 45033 45272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence027 320 763 gene locus_tag LOCUS_17570 320 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_17570 753 1007 gene locus_tag LOCUS_17580 753 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1078 1275 gene locus_tag LOCUS_17590 1078 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3499 1367 gene locus_tag LOCUS_17600 gene mnmC 3499 1367 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_17600 4161 3592 gene locus_tag LOCUS_17610 gene ppiA 4161 3592 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B03 protein_id gnl|my_center|LOCUS_17610 4970 4251 gene locus_tag LOCUS_17620 4970 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5292 4993 gene locus_tag LOCUS_17630 gene yciL 5292 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_17630 5901 5296 gene locus_tag LOCUS_17640 gene yciB 5901 5296 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NVM4 protein_id gnl|my_center|LOCUS_17640 5940 6824 gene locus_tag LOCUS_17650 5940 6824 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_17650 6929 7552 gene locus_tag LOCUS_17660 6929 7552 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_17660 7787 8839 gene locus_tag LOCUS_17670 7787 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8937 10151 gene locus_tag LOCUS_17680 gene trpS-1 8937 10151 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_17680 10317 11189 gene locus_tag LOCUS_17690 10317 11189 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_17690 11182 12144 gene locus_tag LOCUS_17700 11182 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 12141 12995 gene locus_tag LOCUS_17710 12141 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 13958 13017 gene locus_tag LOCUS_17720 13958 13017 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_17720 15041 14286 gene locus_tag LOCUS_17730 15041 14286 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_17730 15809 15135 gene locus_tag LOCUS_17740 gene gph2 15809 15135 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_17740 16534 15806 gene locus_tag LOCUS_17750 gene ubiG 16534 15806 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_17750 17872 16568 gene locus_tag LOCUS_17760 17872 16568 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766740.1 protein_id gnl|my_center|LOCUS_17760 18348 21095 gene locus_tag LOCUS_17770 gene gyrA 18348 21095 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T6 protein_id gnl|my_center|LOCUS_17770 21154 22236 gene locus_tag LOCUS_17780 gene serC 21154 22236 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_17780 22302 23393 gene locus_tag LOCUS_17790 22302 23393 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_17790 23519 24631 gene locus_tag LOCUS_17800 gene hisC2 23519 24631 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_17800 24628 26877 gene locus_tag LOCUS_17810 gene aroA 24628 26877 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_17810 26870 27553 gene locus_tag LOCUS_17820 gene cmk 26870 27553 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_17820 27712 29397 gene locus_tag LOCUS_17830 gene rpsA 27712 29397 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_17830 29868 30179 gene locus_tag LOCUS_17840 gene ihfB 29868 30179 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_17840 30203 30487 gene locus_tag LOCUS_17850 30203 30487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 30497 31681 gene locus_tag LOCUS_17860 gene lapB 30497 31681 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_17860 31678 32418 gene locus_tag LOCUS_17870 gene pyrF 31678 32418 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM26 protein_id gnl|my_center|LOCUS_17870 32711 32636 gene locus_tag LOCUS_t00220 32711 32636 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 33434 32853 gene locus_tag LOCUS_17880 gene dcd 33434 32853 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKF9 protein_id gnl|my_center|LOCUS_17880 34240 33458 gene locus_tag LOCUS_17890 34240 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_17890 34937 34266 gene locus_tag LOCUS_17900 gene purN 34937 34266 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ50 protein_id gnl|my_center|LOCUS_17900 35986 34934 gene locus_tag LOCUS_17910 gene purM 35986 34934 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI8 protein_id gnl|my_center|LOCUS_17910 36332 37357 gene locus_tag LOCUS_17920 36332 37357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_17920 37357 38058 gene locus_tag LOCUS_17930 37357 38058 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268586.1 protein_id gnl|my_center|LOCUS_17930 39380 38196 gene locus_tag LOCUS_17940 gene aspC 39380 38196 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_17940 39509 41539 gene locus_tag LOCUS_17950 gene uvrB 39509 41539 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C9 protein_id gnl|my_center|LOCUS_17950 41669 41745 gene locus_tag LOCUS_t00230 41669 41745 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42537 43733 gene locus_tag LOCUS_17960 42537 43733 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_17960 43923 45221 gene locus_tag LOCUS_17970 gene hom 43923 45221 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_17970 >Feature sequence028 606 1310 gene locus_tag LOCUS_17980 606 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1438 2124 gene locus_tag LOCUS_17990 1438 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_17990 2124 2759 gene locus_tag LOCUS_18000 2124 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_18000 2756 3271 gene locus_tag LOCUS_18010 2756 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3281 4039 gene locus_tag LOCUS_18020 3281 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4127 4795 gene locus_tag LOCUS_18030 4127 4795 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_18030 4921 5901 gene locus_tag LOCUS_18040 4921 5901 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_18040 7640 6012 gene locus_tag LOCUS_18050 7640 6012 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_18050 8361 7705 gene locus_tag LOCUS_18060 8361 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8547 8720 gene locus_tag LOCUS_18070 8547 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 8828 9889 gene locus_tag LOCUS_18080 8828 9889 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_18080 10239 9988 gene locus_tag LOCUS_18090 gene minE 10239 9988 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_18090 10963 10241 gene locus_tag LOCUS_18100 gene minD 10963 10241 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_18100 11777 11070 gene locus_tag LOCUS_18110 gene minC 11777 11070 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW11 protein_id gnl|my_center|LOCUS_18110 12129 11779 gene locus_tag LOCUS_18120 12129 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12298 13341 gene locus_tag LOCUS_18130 gene dinB 12298 13341 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM4 protein_id gnl|my_center|LOCUS_18130 13998 13414 gene locus_tag LOCUS_18140 13998 13414 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_18140 15151 13949 gene locus_tag LOCUS_18150 15151 13949 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_18150 15729 15283 gene locus_tag LOCUS_18160 15729 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 16229 15984 gene locus_tag LOCUS_18170 16229 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 17609 16449 gene locus_tag LOCUS_18180 17609 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_18180 17716 17916 gene locus_tag LOCUS_18190 17716 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 18037 18549 gene locus_tag LOCUS_18200 18037 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 19109 19357 gene locus_tag LOCUS_18210 19109 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 19488 19922 gene locus_tag LOCUS_18220 19488 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20436 21158 gene locus_tag LOCUS_18230 20436 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 21505 22680 gene locus_tag LOCUS_18240 21505 22680 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_18240 22723 23025 gene locus_tag LOCUS_18250 22723 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 23193 25409 gene locus_tag LOCUS_18260 gene gidA 23193 25409 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_18260 26995 25427 gene locus_tag LOCUS_18270 26995 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 28393 27008 gene locus_tag LOCUS_18280 28393 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 29695 28925 gene locus_tag LOCUS_18290 29695 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 30669 29692 gene locus_tag LOCUS_18300 30669 29692 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_18300 31833 30691 gene locus_tag LOCUS_18310 31833 30691 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_18310 33686 31830 gene locus_tag LOCUS_18320 gene pbpA 33686 31830 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_18320 34161 33694 gene locus_tag LOCUS_18330 gene rlmH 34161 33694 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_18330 34514 34158 gene locus_tag LOCUS_18340 gene rsfS 34514 34158 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ08 protein_id gnl|my_center|LOCUS_18340 35175 34522 gene locus_tag LOCUS_18350 gene nadD 35175 34522 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8H7 protein_id gnl|my_center|LOCUS_18350 36431 35175 gene locus_tag LOCUS_18360 gene proA 36431 35175 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_18360 36629 37567 gene locus_tag LOCUS_18370 36629 37567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 37551 38531 gene locus_tag LOCUS_18380 37551 38531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 38822 38565 gene locus_tag LOCUS_18390 38822 38565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 39016 40038 gene locus_tag LOCUS_18400 39016 40038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_18400 40035 40523 gene locus_tag LOCUS_18410 40035 40523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 40851 40555 gene locus_tag LOCUS_18420 40851 40555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 41098 41871 gene locus_tag LOCUS_18430 41098 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 43474 41930 gene locus_tag LOCUS_18440 gene phoA 43474 41930 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_18440 <44765 43476 gene locus_tag LOCUS_18450 <44765 43476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037727.1:alkaline phosphatase >Feature sequence029 1011 226 gene locus_tag LOCUS_18460 1011 226 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_18460 2255 1272 gene locus_tag LOCUS_18470 2255 1272 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881150.1 protein_id gnl|my_center|LOCUS_18470 3225 2260 gene locus_tag LOCUS_18480 3225 2260 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533084.1 protein_id gnl|my_center|LOCUS_18480 4112 3252 gene locus_tag LOCUS_18490 4112 3252 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533085.1 protein_id gnl|my_center|LOCUS_18490 4831 4115 gene locus_tag LOCUS_18500 4831 4115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_18500 5544 4828 gene locus_tag LOCUS_18510 5544 4828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533087.1 protein_id gnl|my_center|LOCUS_18510 6455 5562 gene locus_tag LOCUS_18520 6455 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7792 6515 gene locus_tag LOCUS_18530 7792 6515 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_18530 8036 9721 gene locus_tag LOCUS_18540 gene mphR 8036 9721 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_18540 10977 9826 gene locus_tag LOCUS_18550 10977 9826 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_18550 11672 13888 gene locus_tag LOCUS_18560 11672 13888 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973965.1 protein_id gnl|my_center|LOCUS_18560 14156 13902 gene locus_tag LOCUS_18570 14156 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 14137 15447 gene locus_tag LOCUS_18580 14137 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224244.1 protein_id gnl|my_center|LOCUS_18580 16488 15601 gene locus_tag LOCUS_18590 16488 15601 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_18590 17090 16485 gene locus_tag LOCUS_18600 17090 16485 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_18600 17626 17156 gene locus_tag LOCUS_18610 17626 17156 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_18610 18868 17816 gene locus_tag LOCUS_18620 18868 17816 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_18620 19183 19947 gene locus_tag LOCUS_18630 gene fad 19183 19947 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312496.1 protein_id gnl|my_center|LOCUS_18630 20069 20848 gene locus_tag LOCUS_18640 20069 20848 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_18640 20859 22637 gene locus_tag LOCUS_18650 gene mmgC 20859 22637 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_18650 22720 24594 gene locus_tag LOCUS_18660 22720 24594 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090569.1 protein_id gnl|my_center|LOCUS_18660 25735 24683 gene locus_tag LOCUS_18670 25735 24683 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070761.1 protein_id gnl|my_center|LOCUS_18670 25876 26877 gene locus_tag LOCUS_18680 25876 26877 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 protein_id gnl|my_center|LOCUS_18680 28073 27135 gene locus_tag LOCUS_18690 gene rlrB 28073 27135 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906179.1 protein_id gnl|my_center|LOCUS_18690 28223 30151 gene locus_tag LOCUS_18700 28223 30151 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086995.1 protein_id gnl|my_center|LOCUS_18700 31309 30248 gene locus_tag LOCUS_18710 gene mphP 31309 30248 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_18710 31674 31312 gene locus_tag LOCUS_18720 gene mphO 31674 31312 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_18720 33296 31797 gene locus_tag LOCUS_18730 gene mphN 33296 31797 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_18730 33703 33434 gene locus_tag LOCUS_18740 gene mphM 33703 33434 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_18740 34697 33714 gene locus_tag LOCUS_18750 gene mphL 34697 33714 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_18750 35050 34721 gene locus_tag LOCUS_18760 gene mphK 35050 34721 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_18760 35789 35325 gene locus_tag LOCUS_18770 35789 35325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_18770 36028 36924 gene locus_tag LOCUS_18780 gene catR 36028 36924 CDS product transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_18780 38187 36913 gene locus_tag LOCUS_18790 38187 36913 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_18790 39012 38665 gene locus_tag LOCUS_18800 39012 38665 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_18800 39353 39069 gene locus_tag LOCUS_18810 39353 39069 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_18810 40275 39799 gene locus_tag LOCUS_18820 40275 39799 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_18820 41572 40544 gene locus_tag LOCUS_18830 41572 40544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 42649 41684 gene locus_tag LOCUS_18840 gene lipA 42649 41684 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_18840 >Feature sequence030 108 992 gene locus_tag LOCUS_18850 gene nadK 108 992 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 protein_id gnl|my_center|LOCUS_18850 995 1951 gene locus_tag LOCUS_18860 995 1951 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104727.1 protein_id gnl|my_center|LOCUS_18860 1951 2796 gene locus_tag LOCUS_18870 1951 2796 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_18870 2818 3081 gene locus_tag LOCUS_18880 2818 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_18880 3086 3928 gene locus_tag LOCUS_18890 3086 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245163.1 protein_id gnl|my_center|LOCUS_18890 4026 6671 gene locus_tag LOCUS_18900 gene pepN 4026 6671 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_18900 6683 8062 gene locus_tag LOCUS_18910 6683 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267182.1 protein_id gnl|my_center|LOCUS_18910 8329 9519 gene locus_tag LOCUS_18920 8329 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_18920 9522 12002 gene locus_tag LOCUS_18930 9522 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_18930 12715 12630 gene locus_tag LOCUS_t00240 12715 12630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12928 12843 gene locus_tag LOCUS_t00250 12928 12843 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13050 12964 gene locus_tag LOCUS_t00260 13050 12964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13225 14295 gene locus_tag LOCUS_18940 gene queA 13225 14295 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZC32 protein_id gnl|my_center|LOCUS_18940 14292 15473 gene locus_tag LOCUS_18950 gene tgt 14292 15473 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_18950 15640 15996 gene locus_tag LOCUS_18960 15640 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 16070 17929 gene locus_tag LOCUS_18970 gene secD 16070 17929 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_18970 17929 18843 gene locus_tag LOCUS_18980 gene secF 17929 18843 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI2 protein_id gnl|my_center|LOCUS_18980 18974 19807 gene locus_tag LOCUS_18990 gene rlmJ 18974 19807 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF9 protein_id gnl|my_center|LOCUS_18990 20735 19830 gene locus_tag LOCUS_19000 20735 19830 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_19000 20856 21569 gene locus_tag LOCUS_19010 20856 21569 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097244.1 protein_id gnl|my_center|LOCUS_19010 21585 21785 gene locus_tag LOCUS_19020 21585 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 21968 23458 gene locus_tag LOCUS_19030 21968 23458 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_19030 23731 23579 gene locus_tag LOCUS_19040 23731 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 24344 23775 gene locus_tag LOCUS_19050 24344 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 24605 24859 gene locus_tag LOCUS_19060 24605 24859 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070459.1 protein_id gnl|my_center|LOCUS_19060 24892 25221 gene locus_tag LOCUS_19070 24892 25221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_19070 25826 25284 gene locus_tag LOCUS_19080 25826 25284 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_19080 26296 25898 gene locus_tag LOCUS_19090 26296 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 26572 27183 gene locus_tag LOCUS_19100 26572 27183 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_19100 27258 27488 gene locus_tag LOCUS_19110 27258 27488 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_19110 27576 28799 gene locus_tag LOCUS_19120 gene purT 27576 28799 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP3 protein_id gnl|my_center|LOCUS_19120 30437 28857 gene locus_tag LOCUS_19130 30437 28857 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052610.1 protein_id gnl|my_center|LOCUS_19130 30846 31835 gene locus_tag LOCUS_19140 30846 31835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 32386 31838 gene locus_tag LOCUS_19150 gene yaeQ 32386 31838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_19150 32620 32904 gene locus_tag LOCUS_19160 32620 32904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 33211 33804 gene locus_tag LOCUS_19170 33211 33804 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 protein_id gnl|my_center|LOCUS_19170 33939 35984 gene locus_tag LOCUS_19180 33939 35984 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 protein_id gnl|my_center|LOCUS_19180 36499 37260 gene locus_tag LOCUS_19190 36499 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 37571 37834 gene locus_tag LOCUS_19200 37571 37834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 37976 38584 gene locus_tag LOCUS_19210 37976 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_19210 38775 41174 gene locus_tag LOCUS_19220 gene metE 38775 41174 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Z9 protein_id gnl|my_center|LOCUS_19220 >Feature sequence031 15 2273 gene locus_tag LOCUS_19230 15 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_19230 5991 2287 gene locus_tag LOCUS_19240 5991 2287 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJB4 protein_id gnl|my_center|LOCUS_19240 6484 7566 gene locus_tag LOCUS_19250 6484 7566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230918.2 protein_id gnl|my_center|LOCUS_19250 7691 8221 gene locus_tag LOCUS_19260 7691 8221 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_19260 8218 9510 gene locus_tag LOCUS_19270 8218 9510 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_19270 9579 10973 gene locus_tag LOCUS_19280 9579 10973 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128510.1 protein_id gnl|my_center|LOCUS_19280 10970 11647 gene locus_tag LOCUS_19290 10970 11647 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_19290 11974 15423 gene locus_tag LOCUS_19300 11974 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 16365 15634 gene locus_tag LOCUS_19310 16365 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 17662 16511 gene locus_tag LOCUS_19320 17662 16511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226914.1 protein_id gnl|my_center|LOCUS_19320 19182 18043 gene locus_tag LOCUS_19330 19182 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 20257 19352 gene locus_tag LOCUS_19340 20257 19352 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 protein_id gnl|my_center|LOCUS_19340 20382 20888 gene locus_tag LOCUS_19350 20382 20888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817239.1 protein_id gnl|my_center|LOCUS_19350 21014 21649 gene locus_tag LOCUS_19360 21014 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 22478 21708 gene locus_tag LOCUS_19370 22478 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 23477 22626 gene locus_tag LOCUS_19380 23477 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 24967 23585 gene locus_tag LOCUS_19390 24967 23585 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_19390 26189 25104 gene locus_tag LOCUS_19400 26189 25104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 protein_id gnl|my_center|LOCUS_19400 27435 26335 gene locus_tag LOCUS_19410 27435 26335 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193214.1 protein_id gnl|my_center|LOCUS_19410 28034 27558 gene locus_tag LOCUS_19420 28034 27558 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0C0 protein_id gnl|my_center|LOCUS_19420 28845 28090 gene locus_tag LOCUS_19430 28845 28090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_19430 29798 29088 gene locus_tag LOCUS_19440 gene arsH 29798 29088 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_19440 30852 29833 gene locus_tag LOCUS_19450 30852 29833 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_19450 31328 30861 gene locus_tag LOCUS_19460 gene arsC2 31328 30861 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_19460 31733 31356 gene locus_tag LOCUS_19470 gene arsR 31733 31356 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_19470 31872 33041 gene locus_tag LOCUS_19480 gene selD 31872 33041 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKE7 protein_id gnl|my_center|LOCUS_19480 33038 34219 gene locus_tag LOCUS_19490 gene selU 33038 34219 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F6 protein_id gnl|my_center|LOCUS_19490 34224 35429 gene locus_tag LOCUS_19500 34224 35429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 protein_id gnl|my_center|LOCUS_19500 35665 40705 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccggctacgcggggaacgc >Feature sequence032 758 105 gene locus_tag LOCUS_19510 gene fabG 758 105 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940395.1 protein_id gnl|my_center|LOCUS_19510 903 1910 gene locus_tag LOCUS_19520 903 1910 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974512.1 protein_id gnl|my_center|LOCUS_19520 1907 3235 gene locus_tag LOCUS_19530 1907 3235 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974511.1 protein_id gnl|my_center|LOCUS_19530 4026 3262 gene locus_tag LOCUS_19540 4026 3262 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974503.1 protein_id gnl|my_center|LOCUS_19540 4879 4142 gene locus_tag LOCUS_19550 4879 4142 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_19550 5660 5076 gene locus_tag LOCUS_19560 5660 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6305 5673 gene locus_tag LOCUS_19570 6305 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 11368 6533 gene locus_tag LOCUS_19580 gene gdhB 11368 6533 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_19580 11591 12550 gene locus_tag LOCUS_19590 11591 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_19590 12564 13583 gene locus_tag LOCUS_19600 12564 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 protein_id gnl|my_center|LOCUS_19600 13585 14244 gene locus_tag LOCUS_19610 13585 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 14241 15305 gene locus_tag LOCUS_19620 14241 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_19620 15305 17413 gene locus_tag LOCUS_19630 gene batB 15305 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_19630 17407 19257 gene locus_tag LOCUS_19640 17407 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_19640 19955 19245 gene locus_tag LOCUS_19650 19955 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 protein_id gnl|my_center|LOCUS_19650 22206 20131 gene locus_tag LOCUS_19660 gene ligA 22206 20131 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF3 protein_id gnl|my_center|LOCUS_19660 23640 22288 gene locus_tag LOCUS_19670 23640 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 27256 23744 gene locus_tag LOCUS_19680 gene smc 27256 23744 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_19680 28023 27349 gene locus_tag LOCUS_19690 28023 27349 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_19690 28932 29621 gene locus_tag LOCUS_19700 28932 29621 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_19700 30487 29630 gene locus_tag LOCUS_19710 30487 29630 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480150.1 protein_id gnl|my_center|LOCUS_19710 30983 31885 gene locus_tag LOCUS_19720 30983 31885 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087597.1 protein_id gnl|my_center|LOCUS_19720 32171 32908 gene locus_tag LOCUS_19730 32171 32908 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_19730 34218 33040 gene locus_tag LOCUS_19740 gene fadA 34218 33040 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA1 protein_id gnl|my_center|LOCUS_19740 36425 34239 gene locus_tag LOCUS_19750 gene fadB 36425 34239 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_19750 37000 37791 gene locus_tag LOCUS_19760 37000 37791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 38407 37874 gene locus_tag LOCUS_19770 38407 37874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 40326 38404 gene locus_tag LOCUS_19780 40326 38404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence033 817 131 gene locus_tag LOCUS_19790 817 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1100 2200 gene locus_tag LOCUS_19800 1100 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088024.1 protein_id gnl|my_center|LOCUS_19800 2257 2793 gene locus_tag LOCUS_19810 2257 2793 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_19810 4922 2871 gene locus_tag LOCUS_19820 gene pta 4922 2871 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_19820 6100 4919 gene locus_tag LOCUS_19830 gene ackA 6100 4919 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37877 protein_id gnl|my_center|LOCUS_19830 7213 6233 gene locus_tag LOCUS_19840 7213 6233 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_19840 8634 7909 gene locus_tag LOCUS_19850 8634 7909 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_19850 11183 8631 gene locus_tag LOCUS_19860 11183 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 11607 12377 gene locus_tag LOCUS_19870 11607 12377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_19870 12374 13129 gene locus_tag LOCUS_19880 12374 13129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_19880 13166 14410 gene locus_tag LOCUS_19890 13166 14410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566398.1 protein_id gnl|my_center|LOCUS_19890 14539 15426 gene locus_tag LOCUS_19900 14539 15426 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 protein_id gnl|my_center|LOCUS_19900 15428 16420 gene locus_tag LOCUS_19910 15428 16420 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813861.1 protein_id gnl|my_center|LOCUS_19910 16509 18161 gene locus_tag LOCUS_19920 16509 18161 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_19920 18184 18366 gene locus_tag LOCUS_19930 18184 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 19099 18482 gene locus_tag LOCUS_19940 19099 18482 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_19940 19363 19965 gene locus_tag LOCUS_19950 19363 19965 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_19950 20181 20561 gene locus_tag LOCUS_19960 20181 20561 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919505.1 protein_id gnl|my_center|LOCUS_19960 20918 21475 gene locus_tag LOCUS_19970 20918 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 21952 21548 gene locus_tag LOCUS_19980 gene gloA 21952 21548 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210948.1 protein_id gnl|my_center|LOCUS_19980 22650 22015 gene locus_tag LOCUS_19990 gene nth 22650 22015 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JHJ2 protein_id gnl|my_center|LOCUS_19990 22880 26965 gene locus_tag LOCUS_20000 22880 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 27027 27401 gene locus_tag LOCUS_20010 27027 27401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_20010 27511 31464 gene locus_tag LOCUS_20020 27511 31464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 31622 32029 gene locus_tag LOCUS_20030 31622 32029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 32188 32403 gene locus_tag LOCUS_20040 32188 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_20040 32940 32512 gene locus_tag LOCUS_20050 gene aroQ 32940 32512 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWV4 protein_id gnl|my_center|LOCUS_20050 33246 33079 gene locus_tag LOCUS_20060 33246 33079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 34213 33269 gene locus_tag LOCUS_20070 gene mdcF 34213 33269 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_20070 34417 35166 gene locus_tag LOCUS_20080 34417 35166 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_20080 35541 35347 gene locus_tag LOCUS_20090 gene bfd 35541 35347 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 protein_id gnl|my_center|LOCUS_20090 37208 36177 gene locus_tag LOCUS_20100 gene dapD 37208 36177 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_20100 37613 37260 gene locus_tag LOCUS_20110 37613 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 <40458 37765 gene locus_tag LOCUS_20120 <40458 37765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P883:histidine kinase >Feature sequence034 332 156 gene locus_tag LOCUS_20130 332 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 787 332 gene locus_tag LOCUS_20140 787 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1352 1933 gene locus_tag LOCUS_20150 gene rnfA 1352 1933 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_20150 1956 2573 gene locus_tag LOCUS_20160 1956 2573 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_20160 2570 4888 gene locus_tag LOCUS_20170 2570 4888 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB8 protein_id gnl|my_center|LOCUS_20170 4888 5955 gene locus_tag LOCUS_20180 4888 5955 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM66 protein_id gnl|my_center|LOCUS_20180 5955 6623 gene locus_tag LOCUS_20190 5955 6623 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_20190 6625 7338 gene locus_tag LOCUS_20200 6625 7338 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_20200 7762 8775 gene locus_tag LOCUS_20210 7762 8775 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_20210 8843 10039 gene locus_tag LOCUS_20220 8843 10039 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_20220 10042 11208 gene locus_tag LOCUS_20230 10042 11208 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_20230 11226 12023 gene locus_tag LOCUS_20240 gene aapP 11226 12023 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_20240 12277 13137 gene locus_tag LOCUS_20250 12277 13137 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 protein_id gnl|my_center|LOCUS_20250 15591 13282 gene locus_tag LOCUS_20260 15591 13282 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_20260 16001 16567 gene locus_tag LOCUS_20270 16001 16567 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_20270 16575 17744 gene locus_tag LOCUS_20280 gene ntrA 16575 17744 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887239.1 protein_id gnl|my_center|LOCUS_20280 18239 19624 gene locus_tag LOCUS_20290 18239 19624 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_20290 19749 20753 gene locus_tag LOCUS_20300 19749 20753 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_20300 20784 21623 gene locus_tag LOCUS_20310 20784 21623 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_20310 21747 22880 gene locus_tag LOCUS_20320 21747 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_20320 24800 23034 gene locus_tag LOCUS_20330 24800 23034 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_20330 26427 24961 gene locus_tag LOCUS_20340 26427 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 27231 28538 gene locus_tag LOCUS_20350 27231 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 28883 28665 gene locus_tag LOCUS_20360 28883 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 30376 29321 gene locus_tag LOCUS_20370 30376 29321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 31592 31005 gene locus_tag LOCUS_20380 31592 31005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 32382 31594 gene locus_tag LOCUS_20390 gene yaaA 32382 31594 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_20390 32788 33282 gene locus_tag LOCUS_20400 gene purE 32788 33282 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_20400 33398 34468 gene locus_tag LOCUS_20410 gene purK 33398 34468 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_20410 34481 35035 gene locus_tag LOCUS_20420 gene yaiL 34481 35035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_20420 35141 35461 gene locus_tag LOCUS_20430 35141 35461 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749F2 protein_id gnl|my_center|LOCUS_20430 36299 35535 gene locus_tag LOCUS_20440 36299 35535 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RH6 protein_id gnl|my_center|LOCUS_20440 36370 36612 gene locus_tag LOCUS_20450 36370 36612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 37231 36587 gene locus_tag LOCUS_20460 37231 36587 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_20460 37411 38571 gene locus_tag LOCUS_20470 37411 38571 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 protein_id gnl|my_center|LOCUS_20470 38552 39289 gene locus_tag LOCUS_20480 gene cobB 38552 39289 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83RR8 protein_id gnl|my_center|LOCUS_20480 >Feature sequence035 229 1446 gene locus_tag LOCUS_20490 229 1446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730732.1 protein_id gnl|my_center|LOCUS_20490 1528 1758 gene locus_tag LOCUS_20500 1528 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1815 3842 gene locus_tag LOCUS_20510 gene rep 1815 3842 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 protein_id gnl|my_center|LOCUS_20510 5272 3932 gene locus_tag LOCUS_20520 5272 3932 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 protein_id gnl|my_center|LOCUS_20520 5885 8836 gene locus_tag LOCUS_20530 gene iroN 5885 8836 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035378.1 protein_id gnl|my_center|LOCUS_20530 9307 9867 gene locus_tag LOCUS_20540 9307 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 9851 10306 gene locus_tag LOCUS_20550 9851 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 10575 10742 gene locus_tag LOCUS_20560 10575 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10959 10666 gene locus_tag LOCUS_20570 10959 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 12125 11235 gene locus_tag LOCUS_20580 12125 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_20580 13511 12273 gene locus_tag LOCUS_20590 13511 12273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 protein_id gnl|my_center|LOCUS_20590 15264 13636 gene locus_tag LOCUS_20600 15264 13636 CDS product glucose-methanol-choline (GMC) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524564.1 protein_id gnl|my_center|LOCUS_20600 15205 15408 gene locus_tag LOCUS_20610 15205 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 15587 16531 gene locus_tag LOCUS_20620 15587 16531 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267512.1 protein_id gnl|my_center|LOCUS_20620 18080 16674 gene locus_tag LOCUS_20630 18080 16674 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_20630 18301 20106 gene locus_tag LOCUS_20640 18301 20106 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_20640 20107 20829 gene locus_tag LOCUS_20650 20107 20829 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 protein_id gnl|my_center|LOCUS_20650 22070 20925 gene locus_tag LOCUS_20660 22070 20925 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_20660 22529 22074 gene locus_tag LOCUS_20670 22529 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 23234 22626 gene locus_tag LOCUS_20680 23234 22626 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ9 protein_id gnl|my_center|LOCUS_20680 23718 23251 gene locus_tag LOCUS_20690 23718 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_20690 24338 23718 gene locus_tag LOCUS_20700 24338 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_20700 25489 24335 gene locus_tag LOCUS_20710 gene metX 25489 24335 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57714 protein_id gnl|my_center|LOCUS_20710 26315 25554 gene locus_tag LOCUS_20720 gene tatC 26315 25554 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_20720 26734 26312 gene locus_tag LOCUS_20730 gene tatB 26734 26312 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB4 protein_id gnl|my_center|LOCUS_20730 27003 26734 gene locus_tag LOCUS_20740 gene tatA 27003 26734 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF9 protein_id gnl|my_center|LOCUS_20740 27357 27025 gene locus_tag LOCUS_20750 gene hitA 27357 27025 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_20750 27726 27394 gene locus_tag LOCUS_20760 gene hisE 27726 27394 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_20760 28151 27768 gene locus_tag LOCUS_20770 gene hisI 28151 27768 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_20770 30018 28381 gene locus_tag LOCUS_20780 gene ubiB 30018 28381 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_20780 30726 30022 gene locus_tag LOCUS_20790 30726 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_20790 31487 30726 gene locus_tag LOCUS_20800 gene ubiE 31487 30726 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_20800 33370 31592 gene locus_tag LOCUS_20810 33370 31592 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 protein_id gnl|my_center|LOCUS_20810 34110 33520 gene locus_tag LOCUS_20820 34110 33520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_20820 34986 34168 gene locus_tag LOCUS_20830 gene proC 34986 34168 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ76 protein_id gnl|my_center|LOCUS_20830 35724 35020 gene locus_tag LOCUS_20840 35724 35020 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707388.1 protein_id gnl|my_center|LOCUS_20840 35873 36907 gene locus_tag LOCUS_20850 gene pilT 35873 36907 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_20850 >Feature sequence036 1972 191 gene locus_tag LOCUS_20860 1972 191 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_20860 2263 2000 gene locus_tag LOCUS_20870 2263 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_20870 2584 3945 gene locus_tag LOCUS_20880 2584 3945 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765682.1 protein_id gnl|my_center|LOCUS_20880 5958 4009 gene locus_tag LOCUS_20890 5958 4009 CDS product NAD 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44569 protein_id gnl|my_center|LOCUS_20890 6183 7106 gene locus_tag LOCUS_20900 gene pagO 6183 7106 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_20900 7222 7758 gene locus_tag LOCUS_20910 7222 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 7791 8999 gene locus_tag LOCUS_20920 7791 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 10653 9127 gene locus_tag LOCUS_20930 10653 9127 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_20930 11936 10650 gene locus_tag LOCUS_20940 11936 10650 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A51 protein_id gnl|my_center|LOCUS_20940 14003 12081 gene locus_tag LOCUS_20950 14003 12081 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 protein_id gnl|my_center|LOCUS_20950 14868 14545 gene locus_tag LOCUS_20960 gene glpE 14868 14545 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A49 protein_id gnl|my_center|LOCUS_20960 15693 14890 gene locus_tag LOCUS_20970 gene apaH 15693 14890 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_20970 16298 15921 gene locus_tag LOCUS_20980 gene apaG 16298 15921 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_20980 17127 16285 gene locus_tag LOCUS_20990 gene rsmA 17127 16285 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A46 protein_id gnl|my_center|LOCUS_20990 18128 17124 gene locus_tag LOCUS_21000 gene pdxA1 18128 17124 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_21000 19405 18125 gene locus_tag LOCUS_21010 gene surA 19405 18125 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_21010 21833 19395 gene locus_tag LOCUS_21020 gene lptD 21833 19395 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 protein_id gnl|my_center|LOCUS_21020 21984 23003 gene locus_tag LOCUS_21030 21984 23003 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_21030 23000 23692 gene locus_tag LOCUS_21040 23000 23692 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_21040 23692 24486 gene locus_tag LOCUS_21050 gene djlA 23692 24486 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_21050 25065 24625 gene locus_tag LOCUS_21060 25065 24625 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_21060 25806 25090 gene locus_tag LOCUS_21070 25806 25090 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_21070 25831 26280 gene locus_tag LOCUS_21080 25831 26280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 26455 27216 gene locus_tag LOCUS_21090 26455 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 27244 28131 gene locus_tag LOCUS_21100 27244 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 28136 30028 gene locus_tag LOCUS_21110 gene xcpQ 28136 30028 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_21110 30703 30113 gene locus_tag LOCUS_21120 30703 30113 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV74 protein_id gnl|my_center|LOCUS_21120 31409 30825 gene locus_tag LOCUS_21130 31409 30825 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_21130 31710 32486 gene locus_tag LOCUS_21140 31710 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 32651 34162 gene locus_tag LOCUS_21150 32651 34162 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_21150 34784 36721 gene locus_tag LOCUS_21160 34784 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence037 208 492 gene locus_tag LOCUS_21170 208 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 4016 897 gene locus_tag LOCUS_21180 gene czcA 4016 897 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_21180 5203 4013 gene locus_tag LOCUS_21190 5203 4013 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_21190 6585 5200 gene locus_tag LOCUS_21200 6585 5200 CDS product RND transporter NodT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_21200 7430 6939 gene locus_tag LOCUS_21210 7430 6939 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200951.1 protein_id gnl|my_center|LOCUS_21210 7661 7479 gene locus_tag LOCUS_21220 7661 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 8318 7755 gene locus_tag LOCUS_21230 8318 7755 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_21230 8575 8336 gene locus_tag LOCUS_21240 8575 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 8528 9322 gene locus_tag LOCUS_21250 8528 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9480 10607 gene locus_tag LOCUS_21260 gene dapE 9480 10607 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_21260 10604 11611 gene locus_tag LOCUS_21270 gene rrmA 10604 11611 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 protein_id gnl|my_center|LOCUS_21270 11712 12152 gene locus_tag LOCUS_21280 gene holC 11712 12152 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_21280 12149 12991 gene locus_tag LOCUS_21290 12149 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 13182 16163 gene locus_tag LOCUS_21300 gene valS 13182 16163 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP73 protein_id gnl|my_center|LOCUS_21300 16328 16690 gene locus_tag LOCUS_21310 16328 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 16687 17106 gene locus_tag LOCUS_21320 16687 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 18369 17434 gene locus_tag LOCUS_21330 18369 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 18976 19422 gene locus_tag LOCUS_21340 18976 19422 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_21340 21074 19707 gene locus_tag LOCUS_21350 21074 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_21350 22534 21206 gene locus_tag LOCUS_21360 22534 21206 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_21360 22857 22528 gene locus_tag LOCUS_21370 22857 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 23186 23839 gene locus_tag LOCUS_21380 23186 23839 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_21380 25283 23799 gene locus_tag LOCUS_21390 25283 23799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 25600 25292 gene locus_tag LOCUS_21400 25600 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 25599 26228 gene locus_tag LOCUS_21410 25599 26228 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 protein_id gnl|my_center|LOCUS_21410 26866 26396 gene locus_tag LOCUS_21420 26866 26396 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_21420 27303 28337 gene locus_tag LOCUS_21430 gene rlmF 27303 28337 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_21430 29834 28380 gene locus_tag LOCUS_21440 29834 28380 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUX5 protein_id gnl|my_center|LOCUS_21440 31329 30061 gene locus_tag LOCUS_21450 31329 30061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 protein_id gnl|my_center|LOCUS_21450 32039 31512 gene locus_tag LOCUS_21460 32039 31512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 32256 33632 gene locus_tag LOCUS_21470 32256 33632 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707804.1 protein_id gnl|my_center|LOCUS_21470 35085 33685 gene locus_tag LOCUS_21480 35085 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 36343 35087 gene locus_tag LOCUS_21490 36343 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence038 285 210 gene locus_tag LOCUS_t00270 285 210 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 372 299 gene locus_tag LOCUS_t00280 372 299 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 530 447 gene locus_tag LOCUS_t00290 530 447 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1290 631 gene locus_tag LOCUS_21500 1290 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_21500 1682 1263 gene locus_tag LOCUS_21510 1682 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1728 1964 gene locus_tag LOCUS_21520 1728 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2913 1957 gene locus_tag LOCUS_21530 gene birA 2913 1957 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_21530 5353 3113 gene locus_tag LOCUS_21540 5353 3113 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_21540 5764 5483 gene locus_tag LOCUS_21550 5764 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7032 5905 gene locus_tag LOCUS_21560 7032 5905 CDS product calcium-gated potassium channel mthK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877130.1 protein_id gnl|my_center|LOCUS_21560 7200 8207 gene locus_tag LOCUS_21570 7200 8207 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_21570 8998 9540 gene locus_tag LOCUS_21580 gene fldA 8998 9540 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJU0 protein_id gnl|my_center|LOCUS_21580 11260 9887 gene locus_tag LOCUS_21590 gene clpX 11260 9887 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_21590 12188 11319 gene locus_tag LOCUS_21600 12188 11319 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXU3 protein_id gnl|my_center|LOCUS_21600 12670 12185 gene locus_tag LOCUS_21610 12670 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 13030 12692 gene locus_tag LOCUS_21620 gene nifW 13030 12692 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS27 protein_id gnl|my_center|LOCUS_21620 13678 13130 gene locus_tag LOCUS_21630 13678 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 14475 13684 gene locus_tag LOCUS_21640 gene cysE 14475 13684 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_21640 15653 14448 gene locus_tag LOCUS_21650 15653 14448 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_21650 16888 15680 gene locus_tag LOCUS_21660 16888 15680 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_21660 17808 16891 gene locus_tag LOCUS_21670 17808 16891 CDS product nitrogen fixation protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EB3 protein_id gnl|my_center|LOCUS_21670 18199 17876 gene locus_tag LOCUS_21680 18199 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53211 protein_id gnl|my_center|LOCUS_21680 19306 18902 gene locus_tag LOCUS_21690 19306 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 19536 19303 gene locus_tag LOCUS_21700 19536 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 19937 19635 gene locus_tag LOCUS_21710 19937 19635 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_21710 20338 20126 gene locus_tag LOCUS_21720 20338 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 20880 20413 gene locus_tag LOCUS_21730 20880 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_21730 21393 20917 gene locus_tag LOCUS_21740 21393 20917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 22858 21422 gene locus_tag LOCUS_21750 gene nifN 22858 21422 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26507 protein_id gnl|my_center|LOCUS_21750 24281 22869 gene locus_tag LOCUS_21760 gene nifE 24281 22869 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55673 protein_id gnl|my_center|LOCUS_21760 25217 24672 gene locus_tag LOCUS_21770 25217 24672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 25515 25751 gene locus_tag LOCUS_21780 25515 25751 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_21780 25748 28048 gene locus_tag LOCUS_21790 25748 28048 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH5 protein_id gnl|my_center|LOCUS_21790 28676 28065 gene locus_tag LOCUS_21800 28676 28065 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_21800 28837 29262 gene locus_tag LOCUS_21810 28837 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 29305 30270 gene locus_tag LOCUS_21820 29305 30270 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_21820 31126 30242 gene locus_tag LOCUS_21830 31126 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_21830 31574 31783 gene locus_tag LOCUS_21840 gene cspA 31574 31783 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_21840 31917 32393 gene locus_tag LOCUS_21850 31917 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 33345 32554 gene locus_tag LOCUS_21860 gene hyi 33345 32554 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_21860 34177 33329 gene locus_tag LOCUS_21870 34177 33329 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_21870 34348 35178 gene locus_tag LOCUS_21880 34348 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707806.1 protein_id gnl|my_center|LOCUS_21880 36255 35236 gene locus_tag LOCUS_21890 36255 35236 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence039 2757 1870 gene locus_tag LOCUS_21900 gene pilK 2757 1870 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_21900 4836 2782 gene locus_tag LOCUS_21910 gene pilJ 4836 2782 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_21910 5428 4904 gene locus_tag LOCUS_21920 gene pilI 5428 4904 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_21920 5796 5431 gene locus_tag LOCUS_21930 gene pilH 5796 5431 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_21930 6213 5830 gene locus_tag LOCUS_21940 gene pilG 6213 5830 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_21940 6405 7352 gene locus_tag LOCUS_21950 gene gshB 6405 7352 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_21950 7483 8361 gene locus_tag LOCUS_21960 gene tonB3 7483 8361 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_21960 8361 8918 gene locus_tag LOCUS_21970 8361 8918 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP8 protein_id gnl|my_center|LOCUS_21970 8918 9370 gene locus_tag LOCUS_21980 8918 9370 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_21980 9385 9879 gene locus_tag LOCUS_21990 gene pyrR 9385 9879 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_21990 9942 10949 gene locus_tag LOCUS_22000 gene pyrB 9942 10949 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_22000 10946 12172 gene locus_tag LOCUS_22010 gene pyrC' 10946 12172 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_22010 12273 15089 gene locus_tag LOCUS_22020 gene cyaA 12273 15089 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 protein_id gnl|my_center|LOCUS_22020 15391 16647 gene locus_tag LOCUS_22030 gene lysA 15391 16647 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_22030 16644 17474 gene locus_tag LOCUS_22040 gene dapF 16644 17474 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_22040 17525 18199 gene locus_tag LOCUS_22050 17525 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_22050 18214 18930 gene locus_tag LOCUS_22060 18214 18930 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_22060 19240 18962 gene locus_tag LOCUS_22070 19240 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 21453 19345 gene locus_tag LOCUS_22080 21453 19345 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969665.1 protein_id gnl|my_center|LOCUS_22080 21800 23647 gene locus_tag LOCUS_22090 21800 23647 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_22090 25665 23767 gene locus_tag LOCUS_22100 gene speA 25665 23767 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 protein_id gnl|my_center|LOCUS_22100 25922 26791 gene locus_tag LOCUS_22110 gene speE 25922 26791 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_22110 27331 26927 gene locus_tag LOCUS_22120 27331 26927 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_22120 28237 27515 gene locus_tag LOCUS_22130 28237 27515 CDS product polar amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_22130 28450 28647 gene locus_tag LOCUS_22140 28450 28647 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 protein_id gnl|my_center|LOCUS_22140 28663 28986 gene locus_tag LOCUS_22150 28663 28986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 29048 29644 gene locus_tag LOCUS_22160 29048 29644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_22160 29727 31721 gene locus_tag LOCUS_22170 29727 31721 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_22170 31932 32426 gene locus_tag LOCUS_22180 gene coaD 31932 32426 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_22180 32438 32695 gene locus_tag LOCUS_22190 32438 32695 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_22190 32930 34744 gene locus_tag LOCUS_22200 32930 34744 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_22200 34989 34792 gene locus_tag LOCUS_22210 34989 34792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 35462 35055 gene locus_tag LOCUS_22220 35462 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence040 385 212 gene locus_tag LOCUS_22230 385 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 433 600 gene locus_tag LOCUS_22240 433 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1619 705 gene locus_tag LOCUS_22250 1619 705 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 protein_id gnl|my_center|LOCUS_22250 1788 2321 gene locus_tag LOCUS_22260 1788 2321 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_22260 3486 2686 gene locus_tag LOCUS_22270 3486 2686 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883283.1 protein_id gnl|my_center|LOCUS_22270 4883 3486 gene locus_tag LOCUS_22280 4883 3486 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389009.1 protein_id gnl|my_center|LOCUS_22280 5838 5143 gene locus_tag LOCUS_22290 5838 5143 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_22290 5998 7323 gene locus_tag LOCUS_22300 5998 7323 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066639.1 protein_id gnl|my_center|LOCUS_22300 7037 6964 gene locus_tag LOCUS_t00300 7037 6964 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7702 8793 gene locus_tag LOCUS_22310 gene potF 7702 8793 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM59 protein_id gnl|my_center|LOCUS_22310 8880 10046 gene locus_tag LOCUS_22320 8880 10046 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM7 protein_id gnl|my_center|LOCUS_22320 10057 10998 gene locus_tag LOCUS_22330 10057 10998 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_22330 10998 11804 gene locus_tag LOCUS_22340 10998 11804 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_22340 11886 12623 gene locus_tag LOCUS_22350 11886 12623 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388052.1 protein_id gnl|my_center|LOCUS_22350 13019 12864 gene locus_tag LOCUS_22360 13019 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 13096 13563 gene locus_tag LOCUS_22370 13096 13563 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387782.1 protein_id gnl|my_center|LOCUS_22370 13610 14158 gene locus_tag LOCUS_22380 gene btuE 13610 14158 CDS product thioredoxin/glutathione peroxidase BtuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FZL1 protein_id gnl|my_center|LOCUS_22380 14353 15777 gene locus_tag LOCUS_22390 14353 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 15770 16504 gene locus_tag LOCUS_22400 15770 16504 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208506.1 protein_id gnl|my_center|LOCUS_22400 16611 17858 gene locus_tag LOCUS_22410 16611 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18283 20457 gene locus_tag LOCUS_22420 gene glnN 18283 20457 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_22420 21208 20762 gene locus_tag LOCUS_22430 21208 20762 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_22430 21489 21205 gene locus_tag LOCUS_22440 21489 21205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 21615 22028 gene locus_tag LOCUS_22450 21615 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261531.1 protein_id gnl|my_center|LOCUS_22450 22039 22518 gene locus_tag LOCUS_22460 22039 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709523.1 protein_id gnl|my_center|LOCUS_22460 22986 22528 gene locus_tag LOCUS_22470 22986 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 23059 23859 gene locus_tag LOCUS_22480 23059 23859 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532447.1 protein_id gnl|my_center|LOCUS_22480 24398 23925 gene locus_tag LOCUS_22490 24398 23925 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_22490 24532 25827 gene locus_tag LOCUS_22500 24532 25827 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_22500 25939 26109 gene locus_tag LOCUS_22510 25939 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 26106 26987 gene locus_tag LOCUS_22520 26106 26987 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_22520 28584 27076 gene locus_tag LOCUS_22530 28584 27076 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_22530 29736 28795 gene locus_tag LOCUS_22540 29736 28795 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 protein_id gnl|my_center|LOCUS_22540 30080 29790 gene locus_tag LOCUS_22550 30080 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 30802 30227 gene locus_tag LOCUS_22560 30802 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 31342 30848 gene locus_tag LOCUS_22570 gene lrp 31342 30848 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038732.1 protein_id gnl|my_center|LOCUS_22570 31741 32997 gene locus_tag LOCUS_22580 gene dadA 31741 32997 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3P0 protein_id gnl|my_center|LOCUS_22580 33278 33679 gene locus_tag LOCUS_22590 33278 33679 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_22590 33710 34798 gene locus_tag LOCUS_22600 gene alr 33710 34798 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4R0 protein_id gnl|my_center|LOCUS_22600 35006 35167 gene locus_tag LOCUS_22610 35006 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence041 1805 366 gene locus_tag LOCUS_22620 1805 366 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391103.1 protein_id gnl|my_center|LOCUS_22620 2092 2286 gene locus_tag LOCUS_22630 2092 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2443 3162 gene locus_tag LOCUS_22640 2443 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_22640 3972 3184 gene locus_tag LOCUS_22650 3972 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 4174 4758 gene locus_tag LOCUS_22660 4174 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_22660 4949 5515 gene locus_tag LOCUS_22670 4949 5515 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 protein_id gnl|my_center|LOCUS_22670 5610 5924 gene locus_tag LOCUS_22680 5610 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_22680 7450 5933 gene locus_tag LOCUS_22690 gene ilvA1 7450 5933 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_22690 7587 8261 gene locus_tag LOCUS_22700 gene rpiA 7587 8261 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_22700 8261 11041 gene locus_tag LOCUS_22710 8261 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 11206 12216 gene locus_tag LOCUS_22720 gene hemB 11206 12216 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_22720 12226 14325 gene locus_tag LOCUS_22730 gene ppk 12226 14325 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_22730 15892 14387 gene locus_tag LOCUS_22740 gene ppx 15892 14387 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_22740 16052 16378 gene locus_tag LOCUS_22750 gene trxA 16052 16378 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJX4 protein_id gnl|my_center|LOCUS_22750 16551 17813 gene locus_tag LOCUS_22760 gene rho 16551 17813 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_22760 18508 20865 gene locus_tag LOCUS_22770 18508 20865 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_22770 22229 21129 gene locus_tag LOCUS_22780 22229 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 protein_id gnl|my_center|LOCUS_22780 24349 22304 gene locus_tag LOCUS_22790 gene viuA 24349 22304 CDS product vibriobactin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6R1 protein_id gnl|my_center|LOCUS_22790 24511 25386 gene locus_tag LOCUS_22800 24511 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 25774 27372 gene locus_tag LOCUS_22810 gene gshA 25774 27372 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_22810 27870 27463 gene locus_tag LOCUS_22820 27870 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 28047 28559 gene locus_tag LOCUS_22830 28047 28559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 28739 29215 gene locus_tag LOCUS_22840 gene algQ 28739 29215 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_22840 29380 30351 gene locus_tag LOCUS_22850 29380 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 30882 30421 gene locus_tag LOCUS_22860 30882 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 31024 31803 gene locus_tag LOCUS_22870 gene parA 31024 31803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_22870 32369 31842 gene locus_tag LOCUS_22880 32369 31842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 32350 34314 gene locus_tag LOCUS_22890 32350 34314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence042 1100 1786 gene locus_tag LOCUS_22900 1100 1786 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_22900 1961 2536 gene locus_tag LOCUS_22910 1961 2536 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 protein_id gnl|my_center|LOCUS_22910 2655 2915 gene locus_tag LOCUS_22920 2655 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3246 3806 gene locus_tag LOCUS_22930 3246 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3879 4505 gene locus_tag LOCUS_22940 gene gmk 3879 4505 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_22940 5449 4508 gene locus_tag LOCUS_22950 5449 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5694 5924 gene locus_tag LOCUS_22960 5694 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5960 8077 gene locus_tag LOCUS_22970 gene spoT 5960 8077 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_22970 8947 8099 gene locus_tag LOCUS_22980 8947 8099 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_22980 9229 10125 gene locus_tag LOCUS_22990 9229 10125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 protein_id gnl|my_center|LOCUS_22990 10138 12216 gene locus_tag LOCUS_23000 gene recG 10138 12216 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZZ8 protein_id gnl|my_center|LOCUS_23000 12236 13702 gene locus_tag LOCUS_23010 12236 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_23010 14421 13837 gene locus_tag LOCUS_23020 14421 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_23020 14700 14428 gene locus_tag LOCUS_23030 gene hup 14700 14428 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_23030 15264 14950 gene locus_tag LOCUS_23040 15264 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15432 15268 gene locus_tag LOCUS_23050 gene rubA2 15432 15268 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_23050 16167 17072 gene locus_tag LOCUS_23060 gene ubiA 16167 17072 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB4 protein_id gnl|my_center|LOCUS_23060 17182 17880 gene locus_tag LOCUS_23070 gene phoB 17182 17880 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_23070 17886 19193 gene locus_tag LOCUS_23080 gene phoR 17886 19193 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_23080 20076 19174 gene locus_tag LOCUS_23090 20076 19174 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 protein_id gnl|my_center|LOCUS_23090 20831 20112 gene locus_tag LOCUS_23100 gene cysZ 20831 20112 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_23100 20906 21613 gene locus_tag LOCUS_23110 gene trmH 20906 21613 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KR25 protein_id gnl|my_center|LOCUS_23110 22723 22403 gene locus_tag LOCUS_23120 22723 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_23120 22916 22841 gene locus_tag LOCUS_t00310 22916 22841 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23778 23023 gene locus_tag LOCUS_23130 gene phoU 23778 23023 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_23130 24595 23792 gene locus_tag LOCUS_23140 gene pstB 24595 23792 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_23140 25895 24621 gene locus_tag LOCUS_23150 25895 24621 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_23150 27261 25888 gene locus_tag LOCUS_23160 27261 25888 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_23160 28409 27369 gene locus_tag LOCUS_23170 28409 27369 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_23170 28702 29103 gene locus_tag LOCUS_23180 28702 29103 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 protein_id gnl|my_center|LOCUS_23180 31393 29213 gene locus_tag LOCUS_23190 gene uvrD 31393 29213 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_23190 31508 32428 gene locus_tag LOCUS_23200 31508 32428 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401299.1 protein_id gnl|my_center|LOCUS_23200 32541 32729 gene locus_tag LOCUS_23210 32541 32729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 <34147 33158 gene locus_tag LOCUS_23220 <34147 33158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490371.1:ammonium transporter >Feature sequence043 1468 5 gene locus_tag LOCUS_23230 gene pepA 1468 5 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_23230 1681 2751 gene locus_tag LOCUS_23240 1681 2751 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_23240 2748 3812 gene locus_tag LOCUS_23250 2748 3812 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_23250 4288 3839 gene locus_tag LOCUS_23260 4288 3839 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_23260 4532 5170 gene locus_tag LOCUS_23270 gene pdxH 4532 5170 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED71 protein_id gnl|my_center|LOCUS_23270 5348 5272 gene locus_tag LOCUS_t00320 5348 5272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5997 6617 gene locus_tag LOCUS_23280 5997 6617 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_23280 6962 6714 gene locus_tag LOCUS_23290 6962 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 7213 7137 gene locus_tag LOCUS_t00330 7213 7137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7300 7225 gene locus_tag LOCUS_t00340 7300 7225 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8261 7428 gene locus_tag LOCUS_23300 8261 7428 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS58 protein_id gnl|my_center|LOCUS_23300 8697 10154 gene locus_tag LOCUS_23310 gene zwf 8697 10154 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_23310 10166 10867 gene locus_tag LOCUS_23320 gene pgl 10166 10867 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_23320 11110 12780 gene locus_tag LOCUS_23330 11110 12780 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_23330 14072 12861 gene locus_tag LOCUS_23340 14072 12861 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_23340 14895 14065 gene locus_tag LOCUS_23350 14895 14065 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 protein_id gnl|my_center|LOCUS_23350 15844 14918 gene locus_tag LOCUS_23360 15844 14918 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_23360 16213 17070 gene locus_tag LOCUS_23370 gene pheA 16213 17070 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_23370 18698 17076 gene locus_tag LOCUS_23380 gene algA 18698 17076 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_23380 19798 18866 gene locus_tag LOCUS_23390 19798 18866 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_23390 20421 19801 gene locus_tag LOCUS_23400 20421 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23400 20797 20423 gene locus_tag LOCUS_23410 20797 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23410 21002 21502 gene locus_tag LOCUS_23420 21002 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_23420 21499 21981 gene locus_tag LOCUS_23430 21499 21981 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_23430 22315 22100 gene locus_tag LOCUS_23440 22315 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 22272 24182 gene locus_tag LOCUS_23450 gene thiC 22272 24182 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_23450 24175 25380 gene locus_tag LOCUS_23460 gene thiO 24175 25380 CDS product thiamine biosynthesis oxidoreductase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205267.1 protein_id gnl|my_center|LOCUS_23460 25380 25586 gene locus_tag LOCUS_23470 25380 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 25590 26459 gene locus_tag LOCUS_23480 gene thiG 25590 26459 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5C4 protein_id gnl|my_center|LOCUS_23480 26456 28147 gene locus_tag LOCUS_23490 26456 28147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 28250 30154 gene locus_tag LOCUS_23500 gene htpG 28250 30154 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_23500 30337 30912 gene locus_tag LOCUS_23510 30337 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 30916 31395 gene locus_tag LOCUS_23520 30916 31395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 31559 31807 gene locus_tag LOCUS_23530 31559 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 32320 31877 gene locus_tag LOCUS_23540 32320 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 32975 32373 gene locus_tag LOCUS_23550 gene lexA 32975 32373 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q327V0 protein_id gnl|my_center|LOCUS_23550 >Feature sequence044 733 3279 gene locus_tag LOCUS_23560 733 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3612 3331 gene locus_tag LOCUS_23570 3612 3331 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_23570 3903 5777 gene locus_tag LOCUS_23580 gene deaD 3903 5777 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK4 protein_id gnl|my_center|LOCUS_23580 7266 5866 gene locus_tag LOCUS_23590 7266 5866 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_23590 7352 8203 gene locus_tag LOCUS_23600 7352 8203 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 protein_id gnl|my_center|LOCUS_23600 8364 8957 gene locus_tag LOCUS_23610 8364 8957 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_23610 9215 9970 gene locus_tag LOCUS_23620 9215 9970 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_23620 10152 11273 gene locus_tag LOCUS_23630 10152 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267183.1 protein_id gnl|my_center|LOCUS_23630 11275 13713 gene locus_tag LOCUS_23640 11275 13713 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_23640 13717 14259 gene locus_tag LOCUS_23650 13717 14259 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_23650 14398 15678 gene locus_tag LOCUS_23660 gene hisD 14398 15678 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHG5 protein_id gnl|my_center|LOCUS_23660 15678 16481 gene locus_tag LOCUS_23670 gene fabG 15678 16481 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_23670 16616 17071 gene locus_tag LOCUS_23680 16616 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 17116 18141 gene locus_tag LOCUS_23690 gene fahA 17116 18141 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_23690 18138 19088 gene locus_tag LOCUS_23700 18138 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926514.1 protein_id gnl|my_center|LOCUS_23700 19538 20593 gene locus_tag LOCUS_23710 19538 20593 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 protein_id gnl|my_center|LOCUS_23710 21223 20687 gene locus_tag LOCUS_23720 21223 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 22715 21411 gene locus_tag LOCUS_23730 22715 21411 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_23730 24307 22781 gene locus_tag LOCUS_23740 gene phnE 24307 22781 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_23740 25075 24311 gene locus_tag LOCUS_23750 gene phnC 25075 24311 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG34 protein_id gnl|my_center|LOCUS_23750 25944 25084 gene locus_tag LOCUS_23760 gene phnD 25944 25084 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_23760 26909 26091 gene locus_tag LOCUS_23770 gene xth 26909 26091 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 protein_id gnl|my_center|LOCUS_23770 27873 27022 gene locus_tag LOCUS_23780 27873 27022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 28328 27870 gene locus_tag LOCUS_23790 28328 27870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881139.1 protein_id gnl|my_center|LOCUS_23790 28515 29138 gene locus_tag LOCUS_23800 28515 29138 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815944.1 protein_id gnl|my_center|LOCUS_23800 29184 30179 gene locus_tag LOCUS_23810 29184 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 31487 30357 gene locus_tag LOCUS_23820 31487 30357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_23820 31872 31498 gene locus_tag LOCUS_23830 31872 31498 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089166.1 protein_id gnl|my_center|LOCUS_23830 32816 31884 gene locus_tag LOCUS_23840 32816 31884 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089167.1 protein_id gnl|my_center|LOCUS_23840 32940 33179 gene locus_tag LOCUS_23850 32940 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence045 1320 382 gene locus_tag LOCUS_23860 1320 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_23860 3119 1719 gene locus_tag LOCUS_23870 3119 1719 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976107.1 protein_id gnl|my_center|LOCUS_23870 3476 3958 gene locus_tag LOCUS_23880 3476 3958 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_23880 3972 5000 gene locus_tag LOCUS_23890 3972 5000 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 protein_id gnl|my_center|LOCUS_23890 4984 6153 gene locus_tag LOCUS_23900 4984 6153 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891989.1 protein_id gnl|my_center|LOCUS_23900 6198 6797 gene locus_tag LOCUS_23910 6198 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6797 7798 gene locus_tag LOCUS_23920 6797 7798 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_23920 7883 8179 gene locus_tag LOCUS_23930 7883 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8179 9555 gene locus_tag LOCUS_23940 8179 9555 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_23940 10070 10861 gene locus_tag LOCUS_23950 10070 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 11297 11938 gene locus_tag LOCUS_23960 gene tpm 11297 11938 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_23960 12442 11960 gene locus_tag LOCUS_23970 12442 11960 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369893.1 protein_id gnl|my_center|LOCUS_23970 13508 12747 gene locus_tag LOCUS_23980 13508 12747 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_23980 14525 13521 gene locus_tag LOCUS_23990 gene panE-2 14525 13521 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196629.1 protein_id gnl|my_center|LOCUS_23990 15440 14625 gene locus_tag LOCUS_24000 15440 14625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040242.1 protein_id gnl|my_center|LOCUS_24000 17239 15437 gene locus_tag LOCUS_24010 17239 15437 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530467.1 protein_id gnl|my_center|LOCUS_24010 18273 17236 gene locus_tag LOCUS_24020 18273 17236 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195812.1 protein_id gnl|my_center|LOCUS_24020 19543 18398 gene locus_tag LOCUS_24030 19543 18398 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889522.1 protein_id gnl|my_center|LOCUS_24030 20226 21395 gene locus_tag LOCUS_24040 gene gatA 20226 21395 CDS product Glu-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_24040 21413 22558 gene locus_tag LOCUS_24050 21413 22558 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369891.1 protein_id gnl|my_center|LOCUS_24050 22580 22942 gene locus_tag LOCUS_24060 22580 22942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 protein_id gnl|my_center|LOCUS_24060 22953 23480 gene locus_tag LOCUS_24070 22953 23480 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_24070 23542 24846 gene locus_tag LOCUS_24080 23542 24846 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369889.1 protein_id gnl|my_center|LOCUS_24080 24853 25335 gene locus_tag LOCUS_24090 24853 25335 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 protein_id gnl|my_center|LOCUS_24090 25368 26123 gene locus_tag LOCUS_24100 25368 26123 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206908.1 protein_id gnl|my_center|LOCUS_24100 26287 27246 gene locus_tag LOCUS_24110 26287 27246 CDS product vanillate O-demethylase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703349.1 protein_id gnl|my_center|LOCUS_24110 27256 27780 gene locus_tag LOCUS_24120 27256 27780 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703350.1 protein_id gnl|my_center|LOCUS_24120 27984 28157 gene locus_tag LOCUS_24130 27984 28157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 28173 29207 gene locus_tag LOCUS_24140 28173 29207 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266703.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24140 29265 30254 gene locus_tag LOCUS_24150 29265 30254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088115.1 protein_id gnl|my_center|LOCUS_24150 30369 31544 gene locus_tag LOCUS_24160 gene lldD 30369 31544 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_24160 32137 31592 gene locus_tag LOCUS_24170 32137 31592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 32387 32590 gene locus_tag LOCUS_24180 32387 32590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence046 <1 2400 gene locus_tag LOCUS_24190 <1 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083059.1:flagellar biosynthesis protein FlhA 2482 3846 gene locus_tag LOCUS_24200 gene flhF 2482 3846 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_24200 3848 4669 gene locus_tag LOCUS_24210 3848 4669 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 protein_id gnl|my_center|LOCUS_24210 4673 5410 gene locus_tag LOCUS_24220 gene fliA 4673 5410 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V7 protein_id gnl|my_center|LOCUS_24220 5746 6132 gene locus_tag LOCUS_24230 gene cheY 5746 6132 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_24230 6148 6921 gene locus_tag LOCUS_24240 6148 6921 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_24240 6934 9189 gene locus_tag LOCUS_24250 gene cheA-2 6934 9189 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103790.1 protein_id gnl|my_center|LOCUS_24250 9249 10403 gene locus_tag LOCUS_24260 gene cheB1 9249 10403 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_24260 10756 11544 gene locus_tag LOCUS_24270 10756 11544 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766970.1 protein_id gnl|my_center|LOCUS_24270 11537 11887 gene locus_tag LOCUS_24280 11537 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 11893 12843 gene locus_tag LOCUS_24290 11893 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 12982 13464 gene locus_tag LOCUS_24300 12982 13464 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083098.1 protein_id gnl|my_center|LOCUS_24300 13483 13872 gene locus_tag LOCUS_24310 13483 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 14036 14269 gene locus_tag LOCUS_24320 14036 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 14474 14280 gene locus_tag LOCUS_24330 14474 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 14931 14449 gene locus_tag LOCUS_24340 gene bcp 14931 14449 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094791.1 protein_id gnl|my_center|LOCUS_24340 15467 14973 gene locus_tag LOCUS_24350 15467 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 16597 15467 gene locus_tag LOCUS_24360 16597 15467 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 protein_id gnl|my_center|LOCUS_24360 19051 16772 gene locus_tag LOCUS_24370 gene nrdA 19051 16772 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH95 protein_id gnl|my_center|LOCUS_24370 19796 20536 gene locus_tag LOCUS_24380 19796 20536 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_24380 20676 22220 gene locus_tag LOCUS_24390 20676 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 23183 22260 gene locus_tag LOCUS_24400 23183 22260 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_24400 23693 24766 gene locus_tag LOCUS_24410 23693 24766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_24410 25677 24769 gene locus_tag LOCUS_24420 gene argF 25677 24769 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ1 protein_id gnl|my_center|LOCUS_24420 26869 25700 gene locus_tag LOCUS_24430 gene argD 26869 25700 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_24430 27335 27652 gene locus_tag LOCUS_24440 27335 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 28599 27694 gene locus_tag LOCUS_24450 gene rimK 28599 27694 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_24450 29042 28605 gene locus_tag LOCUS_24460 gene rimK2 29042 28605 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_24460 29346 29017 gene locus_tag LOCUS_24470 29346 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368901.1 protein_id gnl|my_center|LOCUS_24470 29478 30377 gene locus_tag LOCUS_24480 gene hdtR 29478 30377 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_24480 30377 31348 gene locus_tag LOCUS_24490 gene qor 30377 31348 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_24490 32161 31463 gene locus_tag LOCUS_24500 gene queE 32161 31463 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_24500 32829 32158 gene locus_tag LOCUS_24510 32829 32158 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence047 341 1597 gene locus_tag LOCUS_24520 341 1597 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 protein_id gnl|my_center|LOCUS_24520 1659 2003 gene locus_tag LOCUS_24530 1659 2003 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_24530 2010 3446 gene locus_tag LOCUS_24540 2010 3446 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_24540 4517 3453 gene locus_tag LOCUS_24550 4517 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 6481 4646 gene locus_tag LOCUS_24560 gene ilvD 6481 4646 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_24560 7221 8906 gene locus_tag LOCUS_24570 gene argS 7221 8906 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_24570 8974 9552 gene locus_tag LOCUS_24580 8974 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_24580 9595 10494 gene locus_tag LOCUS_24590 9595 10494 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_24590 11686 10658 gene locus_tag LOCUS_24600 11686 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 12000 12800 gene locus_tag LOCUS_24610 12000 12800 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112902.1 protein_id gnl|my_center|LOCUS_24610 13169 14047 gene locus_tag LOCUS_24620 13169 14047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130104.1 protein_id gnl|my_center|LOCUS_24620 14094 15152 gene locus_tag LOCUS_24630 14094 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112897.1 protein_id gnl|my_center|LOCUS_24630 15174 15944 gene locus_tag LOCUS_24640 15174 15944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112898.1 protein_id gnl|my_center|LOCUS_24640 15957 16721 gene locus_tag LOCUS_24650 15957 16721 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112899.1 protein_id gnl|my_center|LOCUS_24650 16767 17735 gene locus_tag LOCUS_24660 16767 17735 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195443.1 protein_id gnl|my_center|LOCUS_24660 17746 18903 gene locus_tag LOCUS_24670 17746 18903 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926295.1 protein_id gnl|my_center|LOCUS_24670 18900 19232 gene locus_tag LOCUS_24680 18900 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112908.1 protein_id gnl|my_center|LOCUS_24680 19233 19454 gene locus_tag LOCUS_24690 19233 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112909.1 protein_id gnl|my_center|LOCUS_24690 19482 20507 gene locus_tag LOCUS_24700 19482 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112910.1 protein_id gnl|my_center|LOCUS_24700 20522 20977 gene locus_tag LOCUS_24710 20522 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112911.1 protein_id gnl|my_center|LOCUS_24710 20990 21961 gene locus_tag LOCUS_24720 20990 21961 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112912.1 protein_id gnl|my_center|LOCUS_24720 22237 22764 gene locus_tag LOCUS_24730 22237 22764 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 protein_id gnl|my_center|LOCUS_24730 22781 23632 gene locus_tag LOCUS_24740 gene catD 22781 23632 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 protein_id gnl|my_center|LOCUS_24740 23629 24426 gene locus_tag LOCUS_24750 gene pecR 23629 24426 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 protein_id gnl|my_center|LOCUS_24750 24446 25237 gene locus_tag LOCUS_24760 gene nadX 24446 25237 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGA5 protein_id gnl|my_center|LOCUS_24760 25346 26824 gene locus_tag LOCUS_24770 gene betB 25346 26824 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 protein_id gnl|my_center|LOCUS_24770 26859 28493 gene locus_tag LOCUS_24780 26859 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 protein_id gnl|my_center|LOCUS_24780 28507 29943 gene locus_tag LOCUS_24790 gene aspA 28507 29943 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U16 protein_id gnl|my_center|LOCUS_24790 30140 30925 gene locus_tag LOCUS_24800 30140 30925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_24800 31011 32123 gene locus_tag LOCUS_24810 31011 32123 CDS product depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550372.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence048 1225 1150 gene locus_tag LOCUS_t00350 1225 1150 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1609 1331 gene locus_tag LOCUS_24820 1609 1331 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_24820 2692 1637 gene locus_tag LOCUS_24830 gene mutY 2692 1637 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_24830 5140 2705 gene locus_tag LOCUS_24840 5140 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 5903 5262 gene locus_tag LOCUS_24850 5903 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_24850 6488 6090 gene locus_tag LOCUS_24860 6488 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 6621 7211 gene locus_tag LOCUS_24870 gene hisB 6621 7211 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_24870 7238 7882 gene locus_tag LOCUS_24880 gene hisH1 7238 7882 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_24880 7918 8658 gene locus_tag LOCUS_24890 gene hisA 7918 8658 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLQ1 protein_id gnl|my_center|LOCUS_24890 8683 9450 gene locus_tag LOCUS_24900 gene hisF 8683 9450 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_24900 9544 11790 gene locus_tag LOCUS_24910 9544 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_24910 13084 11855 gene locus_tag LOCUS_24920 gene serA 13084 11855 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_24920 13262 14698 gene locus_tag LOCUS_24930 13262 14698 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_24930 17299 14777 gene locus_tag LOCUS_24940 gene mcrA 17299 14777 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_24940 17460 18524 gene locus_tag LOCUS_24950 gene pilM 17460 18524 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_24950 18524 19075 gene locus_tag LOCUS_24960 gene pilN 18524 19075 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_24960 19077 19712 gene locus_tag LOCUS_24970 gene pilO 19077 19712 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_24970 19702 20250 gene locus_tag LOCUS_24980 19702 20250 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_24980 20252 22351 gene locus_tag LOCUS_24990 gene pilQ 20252 22351 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_24990 22391 22876 gene locus_tag LOCUS_25000 gene aroK 22391 22876 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34003 protein_id gnl|my_center|LOCUS_25000 22873 23958 gene locus_tag LOCUS_25010 gene aroB 22873 23958 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_25010 23980 25314 gene locus_tag LOCUS_25020 23980 25314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 25496 29944 gene locus_tag LOCUS_25030 gene gltB 25496 29944 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_25030 29995 31413 gene locus_tag LOCUS_25040 gene gltD 29995 31413 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence049 483 115 gene locus_tag LOCUS_25050 483 115 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_25050 941 507 gene locus_tag LOCUS_25060 gene dtd 941 507 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ2 protein_id gnl|my_center|LOCUS_25060 1082 1651 gene locus_tag LOCUS_25070 1082 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3164 1983 gene locus_tag LOCUS_25080 3164 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3323 3168 gene locus_tag LOCUS_25090 3323 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 6139 3545 gene locus_tag LOCUS_25100 6139 3545 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103443.1 protein_id gnl|my_center|LOCUS_25100 6663 6331 gene locus_tag LOCUS_25110 6663 6331 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_25110 10515 6745 gene locus_tag LOCUS_25120 10515 6745 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920227.1 protein_id gnl|my_center|LOCUS_25120 11285 10638 gene locus_tag LOCUS_25130 11285 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 11547 14132 gene locus_tag LOCUS_25140 gene leuS 11547 14132 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE6 protein_id gnl|my_center|LOCUS_25140 14147 14644 gene locus_tag LOCUS_25150 14147 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 14641 15663 gene locus_tag LOCUS_25160 gene holA 14641 15663 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_25160 15911 16504 gene locus_tag LOCUS_25170 15911 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_25170 17402 16566 gene locus_tag LOCUS_25180 17402 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 17807 17430 gene locus_tag LOCUS_25190 17807 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 18201 18941 gene locus_tag LOCUS_25200 18201 18941 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_25200 19308 19120 gene locus_tag LOCUS_25210 19308 19120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 19840 19460 gene locus_tag LOCUS_25220 19840 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 20468 19833 gene locus_tag LOCUS_25230 gene ubiX 20468 19833 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYS1 protein_id gnl|my_center|LOCUS_25230 21799 20465 gene locus_tag LOCUS_25240 gene mpl 21799 20465 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_25240 22039 23007 gene locus_tag LOCUS_25250 gene fbp 22039 23007 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8C3 protein_id gnl|my_center|LOCUS_25250 24931 23030 gene locus_tag LOCUS_25260 24931 23030 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_25260 25830 24928 gene locus_tag LOCUS_25270 25830 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 28089 25849 gene locus_tag LOCUS_25280 28089 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_25280 28246 28776 gene locus_tag LOCUS_25290 gene ppa1 28246 28776 CDS product inorganic pyrophosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M7 protein_id gnl|my_center|LOCUS_25290 29467 29006 gene locus_tag LOCUS_25300 29467 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 29692 30609 gene locus_tag LOCUS_25310 29692 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 30606 31622 gene locus_tag LOCUS_25320 gene rsmC 30606 31622 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Y4 protein_id gnl|my_center|LOCUS_25320 >Feature sequence050 2273 402 gene locus_tag LOCUS_25330 2273 402 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083866.1 protein_id gnl|my_center|LOCUS_25330 3361 2585 gene locus_tag LOCUS_25340 gene mhpD 3361 2585 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y325 protein_id gnl|my_center|LOCUS_25340 4328 3381 gene locus_tag LOCUS_25350 4328 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_25350 5149 4367 gene locus_tag LOCUS_25360 gene hcaB 5149 4367 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6C8 protein_id gnl|my_center|LOCUS_25360 5703 5164 gene locus_tag LOCUS_25370 5703 5164 CDS product 3-phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808137.1 protein_id gnl|my_center|LOCUS_25370 7085 5703 gene locus_tag LOCUS_25380 gene hcaE 7085 5703 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABR5 protein_id gnl|my_center|LOCUS_25380 7445 7098 gene locus_tag LOCUS_25390 gene hcaC 7445 7098 CDS product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ2 protein_id gnl|my_center|LOCUS_25390 8307 7465 gene locus_tag LOCUS_25400 8307 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 8597 8313 gene locus_tag LOCUS_25410 8597 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 9427 8609 gene locus_tag LOCUS_25420 9427 8609 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229072.1 protein_id gnl|my_center|LOCUS_25420 10568 9588 gene locus_tag LOCUS_25430 10568 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 11180 11878 gene locus_tag LOCUS_25440 11180 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 11958 12494 gene locus_tag LOCUS_25450 11958 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103233.1 protein_id gnl|my_center|LOCUS_25450 13110 12529 gene locus_tag LOCUS_25460 13110 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_25460 13228 13905 gene locus_tag LOCUS_25470 13228 13905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 protein_id gnl|my_center|LOCUS_25470 13907 15112 gene locus_tag LOCUS_25480 13907 15112 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_25480 15360 15578 gene locus_tag LOCUS_25490 15360 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 15717 15544 gene locus_tag LOCUS_25500 15717 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 16223 15714 gene locus_tag LOCUS_25510 16223 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 16339 17559 gene locus_tag LOCUS_25520 16339 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 17549 19741 gene locus_tag LOCUS_25530 gene phuR 17549 19741 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_25530 21019 19829 gene locus_tag LOCUS_25540 21019 19829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_25540 23390 21024 gene locus_tag LOCUS_25550 23390 21024 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_25550 23647 23384 gene locus_tag LOCUS_25560 23647 23384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25560 24081 23551 gene locus_tag LOCUS_25570 24081 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 24636 25331 gene locus_tag LOCUS_25580 24636 25331 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886716.1 protein_id gnl|my_center|LOCUS_25580 26403 25426 gene locus_tag LOCUS_25590 26403 25426 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089162.1 protein_id gnl|my_center|LOCUS_25590 27072 26608 gene locus_tag LOCUS_25600 27072 26608 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_25600 27325 27074 gene locus_tag LOCUS_25610 27325 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 27870 27322 gene locus_tag LOCUS_25620 gene moaC 27870 27322 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E942 protein_id gnl|my_center|LOCUS_25620 28399 27854 gene locus_tag LOCUS_25630 gene moaB2 28399 27854 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_25630 29024 28413 gene locus_tag LOCUS_25640 gene mobA 29024 28413 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_25640 30013 29027 gene locus_tag LOCUS_25650 gene moaA 30013 29027 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 protein_id gnl|my_center|LOCUS_25650 31290 30274 gene locus_tag LOCUS_25660 31290 30274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence051 3112 1625 gene locus_tag LOCUS_25670 gene guaB 3112 1625 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_25670 4138 3263 gene locus_tag LOCUS_25680 4138 3263 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_25680 6242 4230 gene locus_tag LOCUS_25690 6242 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 6953 6474 gene locus_tag LOCUS_25700 6953 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_25700 7215 8564 gene locus_tag LOCUS_25710 gene xseA 7215 8564 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04994 protein_id gnl|my_center|LOCUS_25710 8701 9570 gene locus_tag LOCUS_25720 8701 9570 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_25720 10455 9574 gene locus_tag LOCUS_25730 gene tesB 10455 9574 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_25730 10673 11776 gene locus_tag LOCUS_25740 gene trmA 10673 11776 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KN8 protein_id gnl|my_center|LOCUS_25740 11776 13332 gene locus_tag LOCUS_25750 11776 13332 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266456.1 protein_id gnl|my_center|LOCUS_25750 15527 13431 gene locus_tag LOCUS_25760 15527 13431 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 protein_id gnl|my_center|LOCUS_25760 17800 16022 gene locus_tag LOCUS_25770 17800 16022 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_25770 19355 18405 gene locus_tag LOCUS_25780 19355 18405 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881615.1 protein_id gnl|my_center|LOCUS_25780 19812 19384 gene locus_tag LOCUS_25790 gene exaB 19812 19384 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_25790 20362 21510 gene locus_tag LOCUS_25800 20362 21510 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706377.1 protein_id gnl|my_center|LOCUS_25800 21552 22532 gene locus_tag LOCUS_25810 21552 22532 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_25810 22536 23300 gene locus_tag LOCUS_25820 22536 23300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088930.1 protein_id gnl|my_center|LOCUS_25820 23297 24100 gene locus_tag LOCUS_25830 23297 24100 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H04 protein_id gnl|my_center|LOCUS_25830 24641 24288 gene locus_tag LOCUS_25840 24641 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 24954 25484 gene locus_tag LOCUS_25850 24954 25484 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_25850 25688 26650 gene locus_tag LOCUS_25860 gene vanB 25688 26650 CDS product vanillate O-demethylase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 protein_id gnl|my_center|LOCUS_25860 26694 27788 gene locus_tag LOCUS_25870 gene vanA 26694 27788 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085177.1 protein_id gnl|my_center|LOCUS_25870 28054 29100 gene locus_tag LOCUS_25880 28054 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 29655 30095 gene locus_tag LOCUS_25890 29655 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 30391 30263 gene locus_tag LOCUS_25900 30391 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence052 268 2340 gene locus_tag LOCUS_25910 268 2340 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_25910 2849 2472 gene locus_tag LOCUS_25920 2849 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3676 3077 gene locus_tag LOCUS_25930 3676 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4571 3858 gene locus_tag LOCUS_25940 4571 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 5763 4690 gene locus_tag LOCUS_25950 5763 4690 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_25950 5829 7703 gene locus_tag LOCUS_25960 gene atmA 5829 7703 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_25960 7798 8595 gene locus_tag LOCUS_25970 gene xni 7798 8595 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE3 protein_id gnl|my_center|LOCUS_25970 8761 9177 gene locus_tag LOCUS_25980 8761 9177 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208636.1 protein_id gnl|my_center|LOCUS_25980 9174 9791 gene locus_tag LOCUS_25990 9174 9791 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_25990 9991 9812 gene locus_tag LOCUS_26000 9991 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 11423 11887 gene locus_tag LOCUS_26010 11423 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 14613 12220 gene locus_tag LOCUS_26020 14613 12220 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_26020 14779 15048 gene locus_tag LOCUS_26030 14779 15048 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367696.1 protein_id gnl|my_center|LOCUS_26030 15331 17487 gene locus_tag LOCUS_26040 gene dnaX 15331 17487 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_26040 17533 17859 gene locus_tag LOCUS_26050 17533 17859 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YZ4 protein_id gnl|my_center|LOCUS_26050 17859 18407 gene locus_tag LOCUS_26060 17859 18407 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458897.1 protein_id gnl|my_center|LOCUS_26060 18459 19604 gene locus_tag LOCUS_26070 gene rnd 18459 19604 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_26070 19638 19922 gene locus_tag LOCUS_26080 19638 19922 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK58 protein_id gnl|my_center|LOCUS_26080 19919 20359 gene locus_tag LOCUS_26090 19919 20359 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_26090 20363 20737 gene locus_tag LOCUS_26100 20363 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 21104 23308 gene locus_tag LOCUS_26110 21104 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 24015 23443 gene locus_tag LOCUS_26120 24015 23443 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_26120 25342 24161 gene locus_tag LOCUS_26130 25342 24161 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_26130 27425 25815 gene locus_tag LOCUS_26140 27425 25815 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_26140 27699 29090 gene locus_tag LOCUS_26150 27699 29090 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_26150 29344 30174 gene locus_tag LOCUS_26160 29344 30174 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence053 560 228 gene locus_tag LOCUS_26170 560 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1417 557 gene locus_tag LOCUS_26180 1417 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1629 1877 gene locus_tag LOCUS_26190 1629 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2823 1903 gene locus_tag LOCUS_26200 gene apbE 2823 1903 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_26200 3575 3057 gene locus_tag LOCUS_26210 3575 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 4734 3622 gene locus_tag LOCUS_26220 4734 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 4958 4725 gene locus_tag LOCUS_26230 4958 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5569 5282 gene locus_tag LOCUS_26240 5569 5282 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721533.1 protein_id gnl|my_center|LOCUS_26240 6676 5804 gene locus_tag LOCUS_26250 6676 5804 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_26250 6780 7901 gene locus_tag LOCUS_26260 gene frmA 6780 7901 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_26260 8067 8900 gene locus_tag LOCUS_26270 gene frmB 8067 8900 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_26270 9604 8999 gene locus_tag LOCUS_26280 9604 8999 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074102.1 protein_id gnl|my_center|LOCUS_26280 10468 9749 gene locus_tag LOCUS_26290 gene mtnC 10468 9749 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_26290 11160 10465 gene locus_tag LOCUS_26300 11160 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 11804 11157 gene locus_tag LOCUS_26310 gene mtnB 11804 11157 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_26310 12826 11822 gene locus_tag LOCUS_26320 gene mtnA 12826 11822 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_26320 14655 12997 gene locus_tag LOCUS_26330 gene pgi 14655 12997 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_26330 15184 14804 gene locus_tag LOCUS_26340 gene panD 15184 14804 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_26340 16189 15302 gene locus_tag LOCUS_26350 gene panC 16189 15302 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_26350 16995 16189 gene locus_tag LOCUS_26360 gene panB 16995 16189 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_26360 17698 17162 gene locus_tag LOCUS_26370 gene folK 17698 17162 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_26370 19047 17695 gene locus_tag LOCUS_26380 gene pcnB 19047 17695 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_26380 22437 21034 gene locus_tag LOCUS_26390 gene cbrB 22437 21034 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_26390 25355 22434 gene locus_tag LOCUS_26400 gene cbrA 25355 22434 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_26400 26420 25452 gene locus_tag LOCUS_26410 gene gluQ 26420 25452 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUC7 protein_id gnl|my_center|LOCUS_26410 26911 26477 gene locus_tag LOCUS_26420 gene dksA 26911 26477 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P8 protein_id gnl|my_center|LOCUS_26420 27216 28373 gene locus_tag LOCUS_26430 27216 28373 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV76 protein_id gnl|my_center|LOCUS_26430 >Feature sequence054 2373 1894 gene locus_tag LOCUS_26440 2373 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4148 2637 gene locus_tag LOCUS_26450 4148 2637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_26450 4465 5085 gene locus_tag LOCUS_26460 4465 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 5504 5097 gene locus_tag LOCUS_26470 5504 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6031 5573 gene locus_tag LOCUS_26480 6031 5573 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 protein_id gnl|my_center|LOCUS_26480 6780 6502 gene locus_tag LOCUS_26490 6780 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6883 7560 gene locus_tag LOCUS_26500 6883 7560 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_26500 7557 8018 gene locus_tag LOCUS_26510 7557 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 8082 8450 gene locus_tag LOCUS_26520 8082 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 8447 9340 gene locus_tag LOCUS_26530 8447 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 9344 9580 gene locus_tag LOCUS_26540 9344 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9570 11654 gene locus_tag LOCUS_26550 9570 11654 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_26550 11725 12828 gene locus_tag LOCUS_26560 11725 12828 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_26560 12866 13543 gene locus_tag LOCUS_26570 12866 13543 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI9 protein_id gnl|my_center|LOCUS_26570 16682 13563 gene locus_tag LOCUS_26580 16682 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 17950 16988 gene locus_tag LOCUS_26590 gene trxB 17950 16988 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JME7 protein_id gnl|my_center|LOCUS_26590 18530 19909 gene locus_tag LOCUS_26600 18530 19909 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406748.1 protein_id gnl|my_center|LOCUS_26600 20266 20829 gene locus_tag LOCUS_26610 20266 20829 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_26610 22467 20905 gene locus_tag LOCUS_26620 22467 20905 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_26620 25445 22587 gene locus_tag LOCUS_26630 25445 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 25740 26522 gene locus_tag LOCUS_26640 gene truC 25740 26522 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD4 protein_id gnl|my_center|LOCUS_26640 >Feature sequence055 460 1716 gene locus_tag LOCUS_26650 gene nhaD 460 1716 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 protein_id gnl|my_center|LOCUS_26650 2436 1801 gene locus_tag LOCUS_26660 2436 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4089 2578 gene locus_tag LOCUS_26670 gene tilS 4089 2578 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP61 protein_id gnl|my_center|LOCUS_26670 7598 4098 gene locus_tag LOCUS_26680 gene dnaE 7598 4098 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_26680 8439 7723 gene locus_tag LOCUS_26690 8439 7723 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_26690 9347 8520 gene locus_tag LOCUS_26700 9347 8520 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_26700 9671 10717 gene locus_tag LOCUS_26710 9671 10717 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_26710 10807 11412 gene locus_tag LOCUS_26720 10807 11412 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 protein_id gnl|my_center|LOCUS_26720 11778 11572 gene locus_tag LOCUS_26730 11778 11572 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422769.1 protein_id gnl|my_center|LOCUS_26730 12642 13718 gene locus_tag LOCUS_26740 12642 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 15494 13812 gene locus_tag LOCUS_26750 15494 13812 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_26750 17501 15729 gene locus_tag LOCUS_26760 17501 15729 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_26760 19720 17582 gene locus_tag LOCUS_26770 gene fadB 19720 17582 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_26770 21120 19942 gene locus_tag LOCUS_26780 21120 19942 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_26780 21334 21185 gene locus_tag LOCUS_26790 21334 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 21333 22328 gene locus_tag LOCUS_26800 gene oruR 21333 22328 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_26800 22805 22536 gene locus_tag LOCUS_26810 gene fliQ 22805 22536 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_26810 23644 22841 gene locus_tag LOCUS_26820 gene fliP 23644 22841 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_26820 24264 23641 gene locus_tag LOCUS_26830 24264 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 24742 24272 gene locus_tag LOCUS_26840 24742 24272 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YW6 protein_id gnl|my_center|LOCUS_26840 25793 24825 gene locus_tag LOCUS_26850 gene fliM 25793 24825 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_26850 26336 25803 gene locus_tag LOCUS_26860 26336 25803 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence056 1542 334 gene locus_tag LOCUS_26870 1542 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3491 1830 gene locus_tag LOCUS_26880 3491 1830 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_26880 3676 7821 gene locus_tag LOCUS_26890 gene morA 3676 7821 CDS product motility regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_26890 7930 9192 gene locus_tag LOCUS_26900 gene glyA 7930 9192 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_26900 9411 9767 gene locus_tag LOCUS_26910 9411 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119194.1 protein_id gnl|my_center|LOCUS_26910 9883 10368 gene locus_tag LOCUS_26920 gene nrdR 9883 10368 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_26920 10365 11504 gene locus_tag LOCUS_26930 gene ribD 10365 11504 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_26930 11575 12228 gene locus_tag LOCUS_26940 gene ribC 11575 12228 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_26940 12295 13410 gene locus_tag LOCUS_26950 gene ribB 12295 13410 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_26950 13441 13917 gene locus_tag LOCUS_26960 gene ribH1 13441 13917 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q6 protein_id gnl|my_center|LOCUS_26960 13923 14411 gene locus_tag LOCUS_26970 gene nusB 13923 14411 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_26970 14408 15382 gene locus_tag LOCUS_26980 gene thiL 14408 15382 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q4 protein_id gnl|my_center|LOCUS_26980 15433 16134 gene locus_tag LOCUS_26990 gene yggE 15433 16134 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 protein_id gnl|my_center|LOCUS_26990 16149 16451 gene locus_tag LOCUS_27000 16149 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 16448 16927 gene locus_tag LOCUS_27010 16448 16927 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RM9 protein_id gnl|my_center|LOCUS_27010 18151 16928 gene locus_tag LOCUS_27020 18151 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 19226 18123 gene locus_tag LOCUS_27030 gene mauG 19226 18123 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_27030 20183 19278 gene locus_tag LOCUS_27040 20183 19278 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163350.1 protein_id gnl|my_center|LOCUS_27040 20489 22558 gene locus_tag LOCUS_27050 20489 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 22847 23275 gene locus_tag LOCUS_27060 22847 23275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_27060 24461 23325 gene locus_tag LOCUS_27070 24461 23325 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705269.1 protein_id gnl|my_center|LOCUS_27070 24632 24973 gene locus_tag LOCUS_27080 24632 24973 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707324.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence057 1660 1142 gene locus_tag LOCUS_27090 1660 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2709 1657 gene locus_tag LOCUS_27100 2709 1657 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_27100 3190 3387 gene locus_tag LOCUS_27110 3190 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3380 4384 gene locus_tag LOCUS_27120 3380 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 5675 4581 gene locus_tag LOCUS_27130 5675 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 6128 7345 gene locus_tag LOCUS_27140 gene pobA 6128 7345 CDS product p-hydroxybenzoate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20586 protein_id gnl|my_center|LOCUS_27140 7913 7464 gene locus_tag LOCUS_27150 7913 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 9315 7939 gene locus_tag LOCUS_27160 gene fumC1 9315 7939 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51404 protein_id gnl|my_center|LOCUS_27160 9747 9376 gene locus_tag LOCUS_27170 9747 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 9970 10530 gene locus_tag LOCUS_27180 9970 10530 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL05 protein_id gnl|my_center|LOCUS_27180 11865 10642 gene locus_tag LOCUS_27190 11865 10642 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514626.1 protein_id gnl|my_center|LOCUS_27190 13805 12042 gene locus_tag LOCUS_27200 13805 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 15267 14251 gene locus_tag LOCUS_27210 gene glk 15267 14251 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8Q0 protein_id gnl|my_center|LOCUS_27210 17156 15264 gene locus_tag LOCUS_27220 gene edd 17156 15264 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_27220 17575 18114 gene locus_tag LOCUS_27230 gene hnoX 17575 18114 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_27230 18086 20371 gene locus_tag LOCUS_27240 18086 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 20489 21445 gene locus_tag LOCUS_27250 20489 21445 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_27250 21518 22678 gene locus_tag LOCUS_27260 gene metK 21518 22678 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_27260 22806 24188 gene locus_tag LOCUS_27270 gene ahcY 22806 24188 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_27270 >Feature sequence058 777 127 gene locus_tag LOCUS_27280 gene msrQ 777 127 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_27280 1815 793 gene locus_tag LOCUS_27290 gene msrP 1815 793 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_27290 2676 1876 gene locus_tag LOCUS_27300 gene pssA 2676 1876 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_27300 3671 2793 gene locus_tag LOCUS_27310 gene ilvY 3671 2793 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_27310 3843 5333 gene locus_tag LOCUS_27320 gene ilvC 3843 5333 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_27320 6343 5498 gene locus_tag LOCUS_27330 gene pcaH 6343 5498 CDS product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_27330 6737 6336 gene locus_tag LOCUS_27340 gene ligA 6737 6336 CDS product protocatechuate 4,5-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036041.1 protein_id gnl|my_center|LOCUS_27340 6980 7849 gene locus_tag LOCUS_27350 6980 7849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_27350 8650 7850 gene locus_tag LOCUS_27360 8650 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_27360 12693 8647 gene locus_tag LOCUS_27370 12693 8647 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_27370 14165 12714 gene locus_tag LOCUS_27380 gene cafA 14165 12714 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_27380 14837 14265 gene locus_tag LOCUS_27390 14837 14265 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_27390 15313 14834 gene locus_tag LOCUS_27400 gene mreD 15313 14834 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_27400 16155 15310 gene locus_tag LOCUS_27410 gene mreC 16155 15310 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_27410 17312 16275 gene locus_tag LOCUS_27420 17312 16275 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_27420 17441 17728 gene locus_tag LOCUS_27430 gene gatC 17441 17728 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_27430 17846 19300 gene locus_tag LOCUS_27440 gene gatA 17846 19300 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_27440 19312 20781 gene locus_tag LOCUS_27450 gene gatB 19312 20781 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_27450 21107 21349 gene locus_tag LOCUS_27460 21107 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 21349 22140 gene locus_tag LOCUS_27470 gene map 21349 22140 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_27470 22745 22323 gene locus_tag LOCUS_27480 gene sspB 22745 22323 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_27480 23371 22745 gene locus_tag LOCUS_27490 gene sspA 23371 22745 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_27490 24173 23463 gene locus_tag LOCUS_27500 24173 23463 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence059 292 5124 gene locus_tag LOCUS_27510 292 5124 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_27510 5240 7510 gene locus_tag LOCUS_27520 5240 7510 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105204.1 protein_id gnl|my_center|LOCUS_27520 8787 7786 gene locus_tag LOCUS_27530 8787 7786 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764856.1 protein_id gnl|my_center|LOCUS_27530 9085 10122 gene locus_tag LOCUS_27540 gene pyrC 9085 10122 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J46 protein_id gnl|my_center|LOCUS_27540 10137 10814 gene locus_tag LOCUS_27550 gene rnt 10137 10814 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30014 protein_id gnl|my_center|LOCUS_27550 10916 11281 gene locus_tag LOCUS_27560 10916 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 protein_id gnl|my_center|LOCUS_27560 11300 11803 gene locus_tag LOCUS_27570 11300 11803 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 protein_id gnl|my_center|LOCUS_27570 12759 11938 gene locus_tag LOCUS_27580 gene cheR1 12759 11938 CDS product chemotaxis protein methyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87131 protein_id gnl|my_center|LOCUS_27580 13790 12867 gene locus_tag LOCUS_27590 13790 12867 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771567.1 protein_id gnl|my_center|LOCUS_27590 14087 14617 gene locus_tag LOCUS_27600 14087 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 14780 15094 gene locus_tag LOCUS_27610 14780 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 15108 15608 gene locus_tag LOCUS_27620 15108 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 15653 16432 gene locus_tag LOCUS_27630 15653 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 17781 16519 gene locus_tag LOCUS_27640 gene copB 17781 16519 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035821.1 protein_id gnl|my_center|LOCUS_27640 19607 17778 gene locus_tag LOCUS_27650 gene copA 19607 17778 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_27650 19756 20436 gene locus_tag LOCUS_27660 gene copR 19756 20436 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_27660 20429 21892 gene locus_tag LOCUS_27670 20429 21892 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 protein_id gnl|my_center|LOCUS_27670 21951 22026 gene locus_tag LOCUS_t00360 21951 22026 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22756 22313 gene locus_tag LOCUS_27680 22756 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 23217 22756 gene locus_tag LOCUS_27690 23217 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence060 439 1683 gene locus_tag LOCUS_27700 439 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1683 2339 gene locus_tag LOCUS_27710 1683 2339 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_27710 3009 2431 gene locus_tag LOCUS_27720 gene thiJ 3009 2431 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_27720 3194 5209 gene locus_tag LOCUS_27730 gene tynA 3194 5209 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH2 protein_id gnl|my_center|LOCUS_27730 5317 6147 gene locus_tag LOCUS_27740 5317 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 6941 6075 gene locus_tag LOCUS_27750 6941 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7536 9467 gene locus_tag LOCUS_27760 gene thrS 7536 9467 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND4 protein_id gnl|my_center|LOCUS_27760 9674 10012 gene locus_tag LOCUS_27770 9674 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 10182 10376 gene locus_tag LOCUS_27780 gene rpmI 10182 10376 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A163 protein_id gnl|my_center|LOCUS_27780 10393 10746 gene locus_tag LOCUS_27790 gene rplT 10393 10746 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A2 protein_id gnl|my_center|LOCUS_27790 10915 11919 gene locus_tag LOCUS_27800 gene pheS 10915 11919 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_27800 11946 14336 gene locus_tag LOCUS_27810 gene pheT 11946 14336 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_27810 14338 14643 gene locus_tag LOCUS_27820 gene ihfA 14338 14643 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_27820 14621 14980 gene locus_tag LOCUS_27830 14621 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_27830 15050 15126 gene locus_tag LOCUS_t00370 15050 15126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15505 16830 gene locus_tag LOCUS_27840 15505 16830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105438.1 protein_id gnl|my_center|LOCUS_27840 17309 19108 gene locus_tag LOCUS_27850 17309 19108 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 protein_id gnl|my_center|LOCUS_27850 >Feature sequence061 99 23 gene locus_tag LOCUS_t00380 99 23 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1749 211 gene locus_tag LOCUS_27860 1749 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27860 1839 2063 gene locus_tag LOCUS_27870 1839 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 3183 2176 gene locus_tag LOCUS_27880 3183 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_27880 3700 4659 gene locus_tag LOCUS_27890 gene xylS 3700 4659 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_27890 5498 4788 gene locus_tag LOCUS_27900 5498 4788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_27900 6259 5498 gene locus_tag LOCUS_27910 6259 5498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_27910 7218 6256 gene locus_tag LOCUS_27920 7218 6256 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_27920 8097 7234 gene locus_tag LOCUS_27930 8097 7234 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_27930 9362 8190 gene locus_tag LOCUS_27940 9362 8190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088819.1 protein_id gnl|my_center|LOCUS_27940 10610 9837 gene locus_tag LOCUS_27950 10610 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 11923 10607 gene locus_tag LOCUS_27960 11923 10607 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_27960 13460 12192 gene locus_tag LOCUS_27970 13460 12192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_27970 14768 13599 gene locus_tag LOCUS_27980 gene benE 14768 13599 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_27980 15183 14791 gene locus_tag LOCUS_27990 15183 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246697.1 protein_id gnl|my_center|LOCUS_27990 15639 17606 gene locus_tag LOCUS_28000 15639 17606 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_28000 17907 18794 gene locus_tag LOCUS_28010 17907 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_28010 18805 19353 gene locus_tag LOCUS_28020 18805 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 19382 20929 gene locus_tag LOCUS_28030 19382 20929 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_28030 20956 22449 gene locus_tag LOCUS_28040 20956 22449 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence062 934 320 gene locus_tag LOCUS_28050 934 320 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267492.1 protein_id gnl|my_center|LOCUS_28050 2043 994 gene locus_tag LOCUS_28060 gene potD 2043 994 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y1Z9 protein_id gnl|my_center|LOCUS_28060 2828 2043 gene locus_tag LOCUS_28070 2828 2043 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580299.1 protein_id gnl|my_center|LOCUS_28070 3708 2812 gene locus_tag LOCUS_28080 gene potB 3708 2812 CDS product spermidine/putrescine transport system permease protein PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45170 protein_id gnl|my_center|LOCUS_28080 4798 3698 gene locus_tag LOCUS_28090 gene potA 4798 3698 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7H7 protein_id gnl|my_center|LOCUS_28090 6201 5035 gene locus_tag LOCUS_28100 6201 5035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096927.1 protein_id gnl|my_center|LOCUS_28100 6391 7347 gene locus_tag LOCUS_28110 6391 7347 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 protein_id gnl|my_center|LOCUS_28110 7961 8875 gene locus_tag LOCUS_28120 gene pqqB 7961 8875 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C3 protein_id gnl|my_center|LOCUS_28120 9053 9832 gene locus_tag LOCUS_28130 gene pqqC 9053 9832 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_28130 9829 10101 gene locus_tag LOCUS_28140 gene pqqD 9829 10101 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWB4 protein_id gnl|my_center|LOCUS_28140 10094 11269 gene locus_tag LOCUS_28150 gene pqqE 10094 11269 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A84 protein_id gnl|my_center|LOCUS_28150 11266 13278 gene locus_tag LOCUS_28160 11266 13278 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269166.1 protein_id gnl|my_center|LOCUS_28160 15325 13361 gene locus_tag LOCUS_28170 15325 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 16215 15664 gene locus_tag LOCUS_28180 16215 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 16496 17143 gene locus_tag LOCUS_28190 16496 17143 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_28190 17707 17246 gene locus_tag LOCUS_28200 17707 17246 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_28200 18753 17947 gene locus_tag LOCUS_28210 gene bioD 18753 17947 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MN32 protein_id gnl|my_center|LOCUS_28210 19652 18759 gene locus_tag LOCUS_28220 gene bioC 19652 18759 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC8 protein_id gnl|my_center|LOCUS_28220 20500 19649 gene locus_tag LOCUS_28230 gene bioH 20500 19649 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8N6 protein_id gnl|my_center|LOCUS_28230 21759 20497 gene locus_tag LOCUS_28240 gene bioF 21759 20497 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_28240 >Feature sequence063 282 959 gene locus_tag LOCUS_28250 gene ung2 282 959 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_28250 1400 1525 gene locus_tag LOCUS_28260 1400 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1628 2650 gene locus_tag LOCUS_28270 gene pyrD 1628 2650 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_28270 2992 2795 gene locus_tag LOCUS_28280 gene rmf 2992 2795 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF9 protein_id gnl|my_center|LOCUS_28280 3171 5384 gene locus_tag LOCUS_28290 gene rlmL 3171 5384 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_28290 5835 7064 gene locus_tag LOCUS_28300 5835 7064 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_28300 7440 7135 gene locus_tag LOCUS_28310 7440 7135 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_28310 7738 8901 gene locus_tag LOCUS_28320 7738 8901 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_28320 8882 9550 gene locus_tag LOCUS_28330 8882 9550 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460474.1 protein_id gnl|my_center|LOCUS_28330 9688 10017 gene locus_tag LOCUS_28340 9688 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 11719 10073 gene locus_tag LOCUS_28350 gene pgm 11719 10073 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_28350 11964 13085 gene locus_tag LOCUS_28360 11964 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 13482 14879 gene locus_tag LOCUS_28370 13482 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 15200 14994 gene locus_tag LOCUS_28380 15200 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 15419 15865 gene locus_tag LOCUS_28390 15419 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 18646 16121 gene locus_tag LOCUS_28400 18646 16121 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336961.1 protein_id gnl|my_center|LOCUS_28400 21957 18856 gene locus_tag LOCUS_28410 21957 18856 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_28410 <22590 21959 gene locus_tag LOCUS_28420 <22590 21959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532914.1:hemolysin secretion protein D >Feature sequence064 <1 903 gene locus_tag LOCUS_28430 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JS70:adenosylmethionine-8-amino-7-oxononanoate aminotransferase 2735 948 gene locus_tag LOCUS_28440 gene ercS 2735 948 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_28440 3882 2719 gene locus_tag LOCUS_28450 3882 2719 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_28450 4272 5246 gene locus_tag LOCUS_28460 4272 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 7478 5337 gene locus_tag LOCUS_28470 gene nosR 7478 5337 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL3 protein_id gnl|my_center|LOCUS_28470 7953 9071 gene locus_tag LOCUS_28480 7953 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_28480 9428 10588 gene locus_tag LOCUS_28490 9428 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_28490 10585 13209 gene locus_tag LOCUS_28500 gene ercS' 10585 13209 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 protein_id gnl|my_center|LOCUS_28500 13347 14276 gene locus_tag LOCUS_28510 13347 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_28510 14416 15630 gene locus_tag LOCUS_28520 14416 15630 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263664.1 protein_id gnl|my_center|LOCUS_28520 15812 18061 gene locus_tag LOCUS_28530 15812 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_28530 18940 18128 gene locus_tag LOCUS_28540 gene agmR 18940 18128 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_28540 >Feature sequence065 2470 464 gene locus_tag LOCUS_28550 2470 464 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_28550 3668 2481 gene locus_tag LOCUS_28560 3668 2481 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_28560 4805 3702 gene locus_tag LOCUS_28570 4805 3702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089164.1 protein_id gnl|my_center|LOCUS_28570 5803 4967 gene locus_tag LOCUS_28580 5803 4967 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 protein_id gnl|my_center|LOCUS_28580 8772 5800 gene locus_tag LOCUS_28590 8772 5800 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808635.1 protein_id gnl|my_center|LOCUS_28590 9710 8847 gene locus_tag LOCUS_28600 9710 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 10688 9753 gene locus_tag LOCUS_28610 10688 9753 CDS product putative 2,3-dihydroxybiphenyl-1,2-dioxygenase or glyoxalase/bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703311.1 protein_id gnl|my_center|LOCUS_28610 11959 11018 gene locus_tag LOCUS_28620 gene nodD1 11959 11018 CDS product nodulation protein D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55359 protein_id gnl|my_center|LOCUS_28620 12068 13114 gene locus_tag LOCUS_28630 gene vanA 12068 13114 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085177.1 protein_id gnl|my_center|LOCUS_28630 13336 14307 gene locus_tag LOCUS_28640 gene vanB 13336 14307 CDS product vanillate O-demethylase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 protein_id gnl|my_center|LOCUS_28640 16298 14526 gene locus_tag LOCUS_28650 16298 14526 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_28650 16722 17618 gene locus_tag LOCUS_28660 16722 17618 CDS product iron-dependent extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_28660 17676 18557 gene locus_tag LOCUS_28670 gene mhpC 17676 18557 CDS product 2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227514.1 protein_id gnl|my_center|LOCUS_28670 18559 19101 gene locus_tag LOCUS_28680 gene hpaC 18559 19101 CDS product 4-hydroxyphenylacetate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 protein_id gnl|my_center|LOCUS_28680 19114 20304 gene locus_tag LOCUS_28690 19114 20304 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence066 222 1268 gene locus_tag LOCUS_28700 gene nagZ 222 1268 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0Q4 protein_id gnl|my_center|LOCUS_28700 1343 2089 gene locus_tag LOCUS_28710 1343 2089 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_28710 3035 2190 gene locus_tag LOCUS_28720 3035 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 6494 3039 gene locus_tag LOCUS_28730 gene mfd 6494 3039 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_28730 7098 8561 gene locus_tag LOCUS_28740 7098 8561 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_28740 8973 10307 gene locus_tag LOCUS_28750 gene nqrA 8973 10307 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y0 protein_id gnl|my_center|LOCUS_28750 10310 11521 gene locus_tag LOCUS_28760 gene nqrB 10310 11521 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_28760 11511 12308 gene locus_tag LOCUS_28770 gene nqrC 11511 12308 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_28770 12310 12972 gene locus_tag LOCUS_28780 gene nqrD 12310 12972 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_28780 12972 13586 gene locus_tag LOCUS_28790 gene nqrE 12972 13586 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_28790 13599 14831 gene locus_tag LOCUS_28800 gene nqrF 13599 14831 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_28800 15088 16269 gene locus_tag LOCUS_28810 gene oel1 15088 16269 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_28810 16484 17158 gene locus_tag LOCUS_28820 gene fabG 16484 17158 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_28820 17263 17631 gene locus_tag LOCUS_28830 17263 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 18611 19990 gene locus_tag LOCUS_28840 gene rkpJ 18611 19990 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968670.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence067 1 1611 gene locus_tag LOCUS_28850 gene mphR 1 1611 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_28850 3012 2056 gene locus_tag LOCUS_28860 3012 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_28860 4319 3387 gene locus_tag LOCUS_28870 4319 3387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_28870 6407 4425 gene locus_tag LOCUS_28880 gene topB 6407 4425 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 protein_id gnl|my_center|LOCUS_28880 6999 6478 gene locus_tag LOCUS_28890 6999 6478 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 protein_id gnl|my_center|LOCUS_28890 7314 7015 gene locus_tag LOCUS_28900 7314 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 8544 7429 gene locus_tag LOCUS_28910 8544 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 9855 8704 gene locus_tag LOCUS_28920 9855 8704 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277810.1 protein_id gnl|my_center|LOCUS_28920 9997 10401 gene locus_tag LOCUS_28930 9997 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 12529 10454 gene locus_tag LOCUS_28940 12529 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 13250 12603 gene locus_tag LOCUS_28950 13250 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 13288 15153 gene locus_tag LOCUS_28960 13288 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 15195 15452 gene locus_tag LOCUS_28970 15195 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 15521 18403 gene locus_tag LOCUS_28980 15521 18403 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence068 421 864 gene locus_tag LOCUS_28990 421 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_28990 920 1852 gene locus_tag LOCUS_29000 920 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_29000 2742 1879 gene locus_tag LOCUS_29010 2742 1879 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_29010 3522 3671 gene locus_tag LOCUS_29020 3522 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 4030 3830 gene locus_tag LOCUS_29030 4030 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 5025 4360 gene locus_tag LOCUS_29040 5025 4360 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036299.1 protein_id gnl|my_center|LOCUS_29040 5217 6767 gene locus_tag LOCUS_29050 gene leuA 5217 6767 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_29050 6773 7594 gene locus_tag LOCUS_29060 6773 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 7591 8046 gene locus_tag LOCUS_29070 gene b4373 7591 8046 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WJN3 protein_id gnl|my_center|LOCUS_29070 8085 8738 gene locus_tag LOCUS_29080 8085 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_29080 8812 9246 gene locus_tag LOCUS_29090 8812 9246 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_29090 9834 9286 gene locus_tag LOCUS_29100 9834 9286 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_29100 11084 9831 gene locus_tag LOCUS_29110 gene roxS 11084 9831 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_29110 11318 12220 gene locus_tag LOCUS_29120 11318 12220 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_29120 12385 13293 gene locus_tag LOCUS_29130 12385 13293 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_29130 14197 13340 gene locus_tag LOCUS_29140 gene hexR 14197 13340 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375897.1 protein_id gnl|my_center|LOCUS_29140 14513 16099 gene locus_tag LOCUS_29150 gene prfC 14513 16099 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_29150 16471 16905 gene locus_tag LOCUS_29160 gene rplM 16471 16905 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_29160 16907 17299 gene locus_tag LOCUS_29170 gene rpsI 16907 17299 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX3 protein_id gnl|my_center|LOCUS_29170 17523 18119 gene locus_tag LOCUS_29180 17523 18119 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_29180 >Feature sequence069 1749 226 gene locus_tag LOCUS_29190 gene comM 1749 226 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_29190 1978 4674 gene locus_tag LOCUS_29200 1978 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 5660 4797 gene locus_tag LOCUS_29210 5660 4797 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_29210 5762 6205 gene locus_tag LOCUS_29220 gene ytfH 5762 6205 CDS product putative HTH-type transcriptional regulator YtfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACN2 protein_id gnl|my_center|LOCUS_29220 6202 7341 gene locus_tag LOCUS_29230 6202 7341 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_29230 7632 8099 gene locus_tag LOCUS_29240 7632 8099 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_29240 8096 10498 gene locus_tag LOCUS_29250 8096 10498 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 protein_id gnl|my_center|LOCUS_29250 10479 11546 gene locus_tag LOCUS_29260 10479 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 protein_id gnl|my_center|LOCUS_29260 11590 12171 gene locus_tag LOCUS_29270 11590 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 protein_id gnl|my_center|LOCUS_29270 12250 13149 gene locus_tag LOCUS_29280 12250 13149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_29280 14400 13348 gene locus_tag LOCUS_29290 14400 13348 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_29290 14742 14476 gene locus_tag LOCUS_29300 14742 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29300 15175 16653 gene locus_tag LOCUS_29310 15175 16653 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538286.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence070 2330 1254 gene locus_tag LOCUS_29320 2330 1254 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_29320 2644 3240 gene locus_tag LOCUS_29330 2644 3240 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313420.1 protein_id gnl|my_center|LOCUS_29330 3389 3958 gene locus_tag LOCUS_29340 3389 3958 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_29340 4480 4079 gene locus_tag LOCUS_29350 4480 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 5109 4693 gene locus_tag LOCUS_29360 5109 4693 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886959.1 protein_id gnl|my_center|LOCUS_29360 7739 5184 gene locus_tag LOCUS_29370 gene actP 7739 5184 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206223.1 protein_id gnl|my_center|LOCUS_29370 8019 8216 gene locus_tag LOCUS_29380 8019 8216 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206222.1 protein_id gnl|my_center|LOCUS_29380 8329 8730 gene locus_tag LOCUS_29390 8329 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 8730 9044 gene locus_tag LOCUS_29400 gene glpE 8730 9044 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DV5 protein_id gnl|my_center|LOCUS_29400 9047 9433 gene locus_tag LOCUS_29410 9047 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 9578 10984 gene locus_tag LOCUS_29420 gene thrC 9578 10984 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103569.1 protein_id gnl|my_center|LOCUS_29420 11127 11606 gene locus_tag LOCUS_29430 11127 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121059.1 protein_id gnl|my_center|LOCUS_29430 11843 12316 gene locus_tag LOCUS_29440 gene brf2 11843 12316 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_29440 12328 12816 gene locus_tag LOCUS_29450 gene brf1 12328 12816 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_29450 12948 13196 gene locus_tag LOCUS_29460 12948 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265623.1 protein_id gnl|my_center|LOCUS_29460 14349 13321 gene locus_tag LOCUS_29470 gene alc 14349 13321 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVG8 protein_id gnl|my_center|LOCUS_29470 15293 14346 gene locus_tag LOCUS_29480 15293 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_29480 15549 16073 gene locus_tag LOCUS_29490 gene allA 15549 16073 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YX3 protein_id gnl|my_center|LOCUS_29490 16182 16337 gene locus_tag LOCUS_29500 16182 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence071 <1 789 gene locus_tag LOCUS_29510 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093182.1:D-Ala-D-Ala carboxypeptidase 795 1097 gene locus_tag LOCUS_29520 795 1097 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_29520 1097 1735 gene locus_tag LOCUS_29530 gene lipB 1097 1735 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_29530 1809 2795 gene locus_tag LOCUS_29540 gene lipA 1809 2795 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_29540 4454 3120 gene locus_tag LOCUS_29550 gene mltF 4454 3120 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 protein_id gnl|my_center|LOCUS_29550 4944 8870 gene locus_tag LOCUS_29560 gene purL 4944 8870 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_29560 9102 9572 gene locus_tag LOCUS_29570 9102 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 9735 10751 gene locus_tag LOCUS_29580 9735 10751 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 protein_id gnl|my_center|LOCUS_29580 10755 12287 gene locus_tag LOCUS_29590 10755 12287 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704334.1 protein_id gnl|my_center|LOCUS_29590 12583 12861 gene locus_tag LOCUS_29600 gene rpsP 12583 12861 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_29600 12865 13410 gene locus_tag LOCUS_29610 gene rimM 12865 13410 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V1 protein_id gnl|my_center|LOCUS_29610 13449 14228 gene locus_tag LOCUS_29620 gene trmD 13449 14228 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CY1 protein_id gnl|my_center|LOCUS_29620 14239 14592 gene locus_tag LOCUS_29630 gene rplS 14239 14592 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_29630 14741 15628 gene locus_tag LOCUS_29640 gene dsbC 14741 15628 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261230.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence072 1881 229 gene locus_tag LOCUS_29650 1881 229 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_29650 3080 2040 gene locus_tag LOCUS_29660 3080 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3250 3077 gene locus_tag LOCUS_29670 3250 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3489 3247 gene locus_tag LOCUS_29680 3489 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 4742 3450 gene locus_tag LOCUS_29690 4742 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040237.1 protein_id gnl|my_center|LOCUS_29690 5034 8048 gene locus_tag LOCUS_29700 5034 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 8062 8835 gene locus_tag LOCUS_29710 8062 8835 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_29710 9778 10047 gene locus_tag LOCUS_29720 9778 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 10062 10601 gene locus_tag LOCUS_29730 10062 10601 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_29730 10885 10613 gene locus_tag LOCUS_29740 10885 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 11878 11081 gene locus_tag LOCUS_29750 11878 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29750 11846 15772 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctgtgcggcagcgaac >Feature sequence073 601 1818 gene locus_tag LOCUS_29760 601 1818 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_29760 1856 2281 gene locus_tag LOCUS_29770 1856 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3459 2317 gene locus_tag LOCUS_29780 gene pdxB 3459 2317 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_29780 3829 6519 gene locus_tag LOCUS_29790 gene acnB 3829 6519 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V5 protein_id gnl|my_center|LOCUS_29790 7192 6647 gene locus_tag LOCUS_29800 7192 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462950.1 protein_id gnl|my_center|LOCUS_29800 8964 7195 gene locus_tag LOCUS_29810 8964 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 9526 9002 gene locus_tag LOCUS_29820 9526 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705550.1 protein_id gnl|my_center|LOCUS_29820 10901 9519 gene locus_tag LOCUS_29830 10901 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 12863 11082 gene locus_tag LOCUS_29840 gene aspS 12863 11082 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_29840 13100 12912 gene locus_tag LOCUS_29850 13100 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 13231 13743 gene locus_tag LOCUS_29860 13231 13743 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_29860 14554 13760 gene locus_tag LOCUS_29870 gene gloB 14554 13760 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_29870 15025 14567 gene locus_tag LOCUS_29880 15025 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence074 20 829 gene locus_tag LOCUS_29890 20 829 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 protein_id gnl|my_center|LOCUS_29890 914 2338 gene locus_tag LOCUS_29900 gene prr 914 2338 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHN7 protein_id gnl|my_center|LOCUS_29900 2572 3993 gene locus_tag LOCUS_29910 2572 3993 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_29910 4740 4003 gene locus_tag LOCUS_29920 4740 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 5043 5240 gene locus_tag LOCUS_29930 5043 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6583 5246 gene locus_tag LOCUS_29940 6583 5246 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_29940 8185 6725 gene locus_tag LOCUS_29950 gene gabD 8185 6725 CDS product succinate-semialdehyde dehydrogenase [NADP(+)] GabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25526 protein_id gnl|my_center|LOCUS_29950 8566 8264 gene locus_tag LOCUS_29960 8566 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 8542 9822 gene locus_tag LOCUS_29970 8542 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_29970 9892 9803 gene locus_tag LOCUS_t00390 9892 9803 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 10217 9996 gene locus_tag LOCUS_29980 10217 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 10441 11820 gene locus_tag LOCUS_29990 10441 11820 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_29990 11982 12329 gene locus_tag LOCUS_30000 11982 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529346.1 protein_id gnl|my_center|LOCUS_30000 12698 13789 gene locus_tag LOCUS_30010 12698 13789 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 protein_id gnl|my_center|LOCUS_30010 13898 14872 gene locus_tag LOCUS_30020 13898 14872 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence075 1336 404 gene locus_tag LOCUS_30030 1336 404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_30030 1504 2142 gene locus_tag LOCUS_30040 1504 2142 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706104.1 protein_id gnl|my_center|LOCUS_30040 2246 3292 gene locus_tag LOCUS_30050 2246 3292 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 protein_id gnl|my_center|LOCUS_30050 3366 4091 gene locus_tag LOCUS_30060 3366 4091 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196038.1 protein_id gnl|my_center|LOCUS_30060 4279 5202 gene locus_tag LOCUS_30070 4279 5202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_30070 5349 5888 gene locus_tag LOCUS_30080 5349 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 5885 7156 gene locus_tag LOCUS_30090 5885 7156 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_30090 7729 8565 gene locus_tag LOCUS_30100 7729 8565 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_30100 9433 8711 gene locus_tag LOCUS_30110 9433 8711 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 protein_id gnl|my_center|LOCUS_30110 9640 10671 gene locus_tag LOCUS_30120 9640 10671 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401095.1 protein_id gnl|my_center|LOCUS_30120 10673 11641 gene locus_tag LOCUS_30130 gene vanB 10673 11641 CDS product vanillate O-demethylase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 protein_id gnl|my_center|LOCUS_30130 11782 12837 gene locus_tag LOCUS_30140 11782 12837 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_30140 12957 14183 gene locus_tag LOCUS_30150 12957 14183 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence076 355 801 gene locus_tag LOCUS_30160 355 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 1339 779 gene locus_tag LOCUS_30170 1339 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1794 1354 gene locus_tag LOCUS_30180 1794 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2234 1866 gene locus_tag LOCUS_30190 2234 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_30190 2511 2215 gene locus_tag LOCUS_30200 2511 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2510 2680 gene locus_tag LOCUS_30210 2510 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 2868 3071 gene locus_tag LOCUS_30220 2868 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3171 3602 gene locus_tag LOCUS_30230 gene rpsF 3171 3602 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIS8 protein_id gnl|my_center|LOCUS_30230 3618 3848 gene locus_tag LOCUS_30240 gene rpsR 3618 3848 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_30240 3915 4778 gene locus_tag LOCUS_30250 3915 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_30250 4808 5254 gene locus_tag LOCUS_30260 gene rplI 4808 5254 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_30260 5452 6837 gene locus_tag LOCUS_30270 gene dnaB 5452 6837 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 protein_id gnl|my_center|LOCUS_30270 6910 7482 gene locus_tag LOCUS_30280 6910 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 7479 8045 gene locus_tag LOCUS_30290 7479 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 8124 8765 gene locus_tag LOCUS_30300 8124 8765 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_30300 8762 8992 gene locus_tag LOCUS_30310 8762 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9126 9734 gene locus_tag LOCUS_30320 9126 9734 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_30320 9797 10987 gene locus_tag LOCUS_30330 9797 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_30330 11198 11773 gene locus_tag LOCUS_30340 11198 11773 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKI2 protein_id gnl|my_center|LOCUS_30340 11865 12896 gene locus_tag LOCUS_30350 11865 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 14637 12904 gene locus_tag LOCUS_30360 14637 12904 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence077 1552 2127 gene locus_tag LOCUS_30370 1552 2127 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269052.1 protein_id gnl|my_center|LOCUS_30370 2794 2237 gene locus_tag LOCUS_30380 2794 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3802 3251 gene locus_tag LOCUS_30390 gene folE2 3802 3251 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_30390 4724 3855 gene locus_tag LOCUS_30400 gene murI 4724 3855 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NU33 protein_id gnl|my_center|LOCUS_30400 5452 4877 gene locus_tag LOCUS_30410 5452 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112773.1 protein_id gnl|my_center|LOCUS_30410 5923 6002 gene locus_tag LOCUS_t00400 5923 6002 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8068 6389 gene locus_tag LOCUS_30420 8068 6389 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_30420 8369 8061 gene locus_tag LOCUS_30430 gene hlyU 8369 8061 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006084975.1 protein_id gnl|my_center|LOCUS_30430 8483 9340 gene locus_tag LOCUS_30440 8483 9340 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_30440 10380 9418 gene locus_tag LOCUS_30450 10380 9418 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I94 protein_id gnl|my_center|LOCUS_30450 10551 10742 gene locus_tag LOCUS_30460 10551 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 11442 10861 gene locus_tag LOCUS_30470 11442 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 11541 11840 gene locus_tag LOCUS_30480 gene bolA 11541 11840 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_30480 12276 13571 gene locus_tag LOCUS_30490 12276 13571 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267709.1 protein_id gnl|my_center|LOCUS_30490 14255 13680 gene locus_tag LOCUS_30500 14255 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence078 181 1380 gene locus_tag LOCUS_30510 181 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_30510 1399 1608 gene locus_tag LOCUS_30520 1399 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2256 1630 gene locus_tag LOCUS_30530 gene ychE 2256 1630 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_30530 2839 2342 gene locus_tag LOCUS_30540 2839 2342 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB0 protein_id gnl|my_center|LOCUS_30540 4589 3201 gene locus_tag LOCUS_30550 gene dctM 4589 3201 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_30550 5122 4589 gene locus_tag LOCUS_30560 gene dctQ 5122 4589 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS0 protein_id gnl|my_center|LOCUS_30560 6859 5504 gene locus_tag LOCUS_30570 gene dctD 6859 5504 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 protein_id gnl|my_center|LOCUS_30570 8736 6856 gene locus_tag LOCUS_30580 8736 6856 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477467.1 protein_id gnl|my_center|LOCUS_30580 9108 10094 gene locus_tag LOCUS_30590 gene dctP 9108 10094 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_30590 10218 11135 gene locus_tag LOCUS_30600 10218 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 11372 11959 gene locus_tag LOCUS_30610 11372 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 13226 11967 gene locus_tag LOCUS_30620 13226 11967 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_30620 13811 13239 gene locus_tag LOCUS_30630 13811 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence079 1494 118 gene locus_tag LOCUS_30640 1494 118 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z0 protein_id gnl|my_center|LOCUS_30640 2422 1496 gene locus_tag LOCUS_30650 2422 1496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266555.1 protein_id gnl|my_center|LOCUS_30650 3542 2427 gene locus_tag LOCUS_30660 3542 2427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112631.1 protein_id gnl|my_center|LOCUS_30660 5101 3539 gene locus_tag LOCUS_30670 5101 3539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 protein_id gnl|my_center|LOCUS_30670 5405 6946 gene locus_tag LOCUS_30680 5405 6946 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_30680 6939 9383 gene locus_tag LOCUS_30690 gene xdhB 6939 9383 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_30690 9383 10357 gene locus_tag LOCUS_30700 9383 10357 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_30700 10357 10869 gene locus_tag LOCUS_30710 10357 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703663.1 protein_id gnl|my_center|LOCUS_30710 10892 11242 gene locus_tag LOCUS_30720 gene hiuH 10892 11242 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7Q6 protein_id gnl|my_center|LOCUS_30720 11245 12609 gene locus_tag LOCUS_30730 11245 12609 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence080 2350 980 gene locus_tag LOCUS_30740 2350 980 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_30740 3136 2522 gene locus_tag LOCUS_30750 3136 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3354 4205 gene locus_tag LOCUS_30760 gene purU1 3354 4205 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_30760 4406 7228 gene locus_tag LOCUS_30770 4406 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 7269 9143 gene locus_tag LOCUS_30780 7269 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_30780 9177 10538 gene locus_tag LOCUS_30790 9177 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_30790 11161 10664 gene locus_tag LOCUS_30800 11161 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 12199 11219 gene locus_tag LOCUS_30810 gene srkA 12199 11219 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_30810 12871 12230 gene locus_tag LOCUS_30820 12871 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence081 1379 567 gene locus_tag LOCUS_30830 1379 567 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_30830 1916 1455 gene locus_tag LOCUS_30840 1916 1455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_30840 2490 1993 gene locus_tag LOCUS_30850 2490 1993 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_30850 2744 2493 gene locus_tag LOCUS_30860 gene moaD 2744 2493 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSH6 protein_id gnl|my_center|LOCUS_30860 3199 2741 gene locus_tag LOCUS_30870 gene moaC 3199 2741 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E942 protein_id gnl|my_center|LOCUS_30870 3889 3344 gene locus_tag LOCUS_30880 3889 3344 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_30880 4512 3895 gene locus_tag LOCUS_30890 gene mobA 4512 3895 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_30890 5534 4545 gene locus_tag LOCUS_30900 gene moaA 5534 4545 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY0 protein_id gnl|my_center|LOCUS_30900 7249 5813 gene locus_tag LOCUS_30910 gene pykA 7249 5813 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 protein_id gnl|my_center|LOCUS_30910 7763 9121 gene locus_tag LOCUS_30920 7763 9121 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_30920 9192 9368 gene locus_tag LOCUS_30930 9192 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 9608 10999 gene locus_tag LOCUS_30940 gene eutB 9608 10999 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_30940 11001 11828 gene locus_tag LOCUS_30950 gene eutC 11001 11828 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX02 protein_id gnl|my_center|LOCUS_30950 11874 12077 gene locus_tag LOCUS_30960 11874 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 12301 12047 gene locus_tag LOCUS_30970 12301 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 12626 13279 gene locus_tag LOCUS_30980 12626 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence082 202 1464 gene locus_tag LOCUS_30990 gene fliI 202 1464 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_30990 1519 1986 gene locus_tag LOCUS_31000 1519 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2186 2482 gene locus_tag LOCUS_31010 2186 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2568 2930 gene locus_tag LOCUS_31020 gene cheY 2568 2930 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_31020 2935 5163 gene locus_tag LOCUS_31030 2935 5163 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_31030 5173 5667 gene locus_tag LOCUS_31040 5173 5667 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_31040 5707 7671 gene locus_tag LOCUS_31050 gene aer2 5707 7671 CDS product aerotaxis transducer Aer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112650.1 protein_id gnl|my_center|LOCUS_31050 7675 8541 gene locus_tag LOCUS_31060 gene cheR 7675 8541 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 protein_id gnl|my_center|LOCUS_31060 8538 9191 gene locus_tag LOCUS_31070 gene cheD1 8538 9191 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_31070 9246 10292 gene locus_tag LOCUS_31080 gene cheB1 9246 10292 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_31080 10438 10743 gene locus_tag LOCUS_31090 10438 10743 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_31090 10754 12478 gene locus_tag LOCUS_31100 10754 12478 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_31100 12482 12841 gene locus_tag LOCUS_31110 12482 12841 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766990.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence083 2263 167 gene locus_tag LOCUS_31120 2263 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5683 2774 gene locus_tag LOCUS_31130 5683 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 6950 5916 gene locus_tag LOCUS_31140 6950 5916 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 protein_id gnl|my_center|LOCUS_31140 9603 7093 gene locus_tag LOCUS_31150 9603 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_31150 10448 9600 gene locus_tag LOCUS_31160 10448 9600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_31160 10342 11016 gene locus_tag LOCUS_31170 10342 11016 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_31170 11088 11897 gene locus_tag LOCUS_31180 gene suhB 11088 11897 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_31180 12629 12123 gene locus_tag LOCUS_31190 12629 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970314.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence084 1 1803 gene locus_tag LOCUS_31200 1 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 2714 1920 gene locus_tag LOCUS_31210 gene speD 2714 1920 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_31210 3221 2787 gene locus_tag LOCUS_31220 3221 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_31220 3589 4227 gene locus_tag LOCUS_31230 gene vfr 3589 4227 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_31230 5126 4320 gene locus_tag LOCUS_31240 gene trpC 5126 4320 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_31240 6202 5156 gene locus_tag LOCUS_31250 gene trpD 6202 5156 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_31250 6803 6216 gene locus_tag LOCUS_31260 gene trpG 6803 6216 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_31260 8366 6882 gene locus_tag LOCUS_31270 8366 6882 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_31270 9269 8592 gene locus_tag LOCUS_31280 9269 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_31280 9726 10088 gene locus_tag LOCUS_31290 9726 10088 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_31290 12105 10300 gene locus_tag LOCUS_31300 12105 10300 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_31300 12776 12516 gene locus_tag LOCUS_31310 12776 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence085 2028 640 gene locus_tag LOCUS_31320 2028 640 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_31320 2569 2018 gene locus_tag LOCUS_31330 2569 2018 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_31330 3728 2679 gene locus_tag LOCUS_31340 3728 2679 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_31340 4026 7517 gene locus_tag LOCUS_31350 4026 7517 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_31350 8275 7661 gene locus_tag LOCUS_31360 8275 7661 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_31360 8787 9809 gene locus_tag LOCUS_31370 8787 9809 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_31370 11016 10021 gene locus_tag LOCUS_31380 11016 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 11333 11037 gene locus_tag LOCUS_31390 11333 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 11879 11508 gene locus_tag LOCUS_31400 11879 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 12186 11932 gene locus_tag LOCUS_31410 12186 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_31410 12439 12266 gene locus_tag LOCUS_31420 12439 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31420 >Feature sequence086 1023 82 gene locus_tag LOCUS_31430 1023 82 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_31430 2324 1176 gene locus_tag LOCUS_31440 2324 1176 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 protein_id gnl|my_center|LOCUS_31440 3930 2647 gene locus_tag LOCUS_31450 3930 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 4442 3927 gene locus_tag LOCUS_31460 4442 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 5440 4445 gene locus_tag LOCUS_31470 gene dctP 5440 4445 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_31470 6308 5475 gene locus_tag LOCUS_31480 6308 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 7813 6416 gene locus_tag LOCUS_31490 7813 6416 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_31490 8088 8645 gene locus_tag LOCUS_31500 8088 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 8638 8901 gene locus_tag LOCUS_31510 8638 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 8898 10523 gene locus_tag LOCUS_31520 gene cydA 8898 10523 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_31520 10533 11669 gene locus_tag LOCUS_31530 gene cydB-2 10533 11669 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707369.1 protein_id gnl|my_center|LOCUS_31530 11836 12177 gene locus_tag LOCUS_31540 11836 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence087 908 138 gene locus_tag LOCUS_31550 908 138 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706428.1 protein_id gnl|my_center|LOCUS_31550 1368 2531 gene locus_tag LOCUS_31560 1368 2531 CDS product vanillate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225964.1 protein_id gnl|my_center|LOCUS_31560 2586 2906 gene locus_tag LOCUS_31570 2586 2906 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_31570 2916 4241 gene locus_tag LOCUS_31580 2916 4241 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_31580 4318 5403 gene locus_tag LOCUS_31590 4318 5403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_31590 6402 5509 gene locus_tag LOCUS_31600 6402 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_31600 8109 6658 gene locus_tag LOCUS_31610 gene vdh 8109 6658 CDS product salicylaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 protein_id gnl|my_center|LOCUS_31610 9123 8272 gene locus_tag LOCUS_31620 9123 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 10274 9252 gene locus_tag LOCUS_31630 gene mhpE 10274 9252 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q9 protein_id gnl|my_center|LOCUS_31630 11193 10294 gene locus_tag LOCUS_31640 gene mhpF 11193 10294 CDS product acetaldehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4S7 protein_id gnl|my_center|LOCUS_31640 12022 11234 gene locus_tag LOCUS_31650 12022 11234 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_31650 >Feature sequence088 71 1057 gene locus_tag LOCUS_31660 gene mphL 71 1057 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_31660 1069 1338 gene locus_tag LOCUS_31670 gene mphM 1069 1338 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_31670 1391 2890 gene locus_tag LOCUS_31680 gene mphN 1391 2890 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_31680 2875 3189 gene locus_tag LOCUS_31690 2875 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3084 3446 gene locus_tag LOCUS_31700 gene mphO 3084 3446 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_31700 3451 4512 gene locus_tag LOCUS_31710 gene mphP 3451 4512 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_31710 4577 5398 gene locus_tag LOCUS_31720 4577 5398 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_31720 5977 6912 gene locus_tag LOCUS_31730 5977 6912 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_31730 7092 8447 gene locus_tag LOCUS_31740 gene xylX 7092 8447 CDS product toluate 1,2-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113315.1 protein_id gnl|my_center|LOCUS_31740 8459 8950 gene locus_tag LOCUS_31750 8459 8950 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 protein_id gnl|my_center|LOCUS_31750 9147 10157 gene locus_tag LOCUS_31760 gene xylZ 9147 10157 CDS product toluate 1,2-dioxygenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_31760 10216 11001 gene locus_tag LOCUS_31770 gene benD 10216 11001 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705525.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence089 224 445 gene locus_tag LOCUS_31780 224 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1619 561 gene locus_tag LOCUS_31790 gene mhpE 1619 561 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q9 protein_id gnl|my_center|LOCUS_31790 2545 1616 gene locus_tag LOCUS_31800 2545 1616 CDS product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 protein_id gnl|my_center|LOCUS_31800 2775 2542 gene locus_tag LOCUS_31810 2775 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3594 2794 gene locus_tag LOCUS_31820 3594 2794 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_31820 4433 3591 gene locus_tag LOCUS_31830 4433 3591 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_31830 5906 4446 gene locus_tag LOCUS_31840 5906 4446 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_31840 6231 6701 gene locus_tag LOCUS_31850 6231 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_31850 7162 6716 gene locus_tag LOCUS_31860 gene copG 7162 6716 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118705.1 protein_id gnl|my_center|LOCUS_31860 8593 7223 gene locus_tag LOCUS_31870 8593 7223 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_31870 9505 8726 gene locus_tag LOCUS_31880 9505 8726 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_31880 10416 9505 gene locus_tag LOCUS_31890 10416 9505 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence090 <1 5717 gene locus_tag LOCUS_31900 <1 5717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein 5718 6770 gene locus_tag LOCUS_31910 gene chpB 5718 6770 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_31910 6745 7221 gene locus_tag LOCUS_31920 gene chpC 6745 7221 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_31920 7253 8275 gene locus_tag LOCUS_31930 7253 8275 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_31930 8272 8997 gene locus_tag LOCUS_31940 8272 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_31940 10301 9243 gene locus_tag LOCUS_31950 10301 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence091 <1 765 gene locus_tag LOCUS_31960 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112378.1:alkene reductase 1482 808 gene locus_tag LOCUS_31970 1482 808 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_31970 1627 2835 gene locus_tag LOCUS_31980 gene coaBC 1627 2835 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_31980 2883 3341 gene locus_tag LOCUS_31990 gene dut 2883 3341 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD3 protein_id gnl|my_center|LOCUS_31990 3464 4366 gene locus_tag LOCUS_32000 gene argB 3464 4366 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_32000 4378 4992 gene locus_tag LOCUS_32010 gene slmA 4378 4992 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_32010 5781 5071 gene locus_tag LOCUS_32020 5781 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_32020 6428 5781 gene locus_tag LOCUS_32030 gene pyrE 6428 5781 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_32030 6664 7437 gene locus_tag LOCUS_32040 gene xth 6664 7437 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_32040 8247 7531 gene locus_tag LOCUS_32050 gene rph 8247 7531 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_32050 8359 9234 gene locus_tag LOCUS_32060 8359 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence092 610 1404 gene locus_tag LOCUS_32070 610 1404 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_32070 1521 2312 gene locus_tag LOCUS_32080 1521 2312 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_32080 2354 3301 gene locus_tag LOCUS_32090 gene panE 2354 3301 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Q9 protein_id gnl|my_center|LOCUS_32090 3911 4141 gene locus_tag LOCUS_32100 3911 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32100 4283 4876 gene locus_tag LOCUS_32110 4283 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32110 5011 5277 gene locus_tag LOCUS_32120 5011 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32120 5684 7396 gene locus_tag LOCUS_32130 gene tanL 5684 7396 CDS product tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101979.1 protein_id gnl|my_center|LOCUS_32130 7911 8222 gene locus_tag LOCUS_32140 7911 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence093 4283 678 gene locus_tag LOCUS_32150 4283 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 5168 4368 gene locus_tag LOCUS_32160 5168 4368 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR1 protein_id gnl|my_center|LOCUS_32160 5626 5180 gene locus_tag LOCUS_32170 gene flgC 5626 5180 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_32170 6048 5629 gene locus_tag LOCUS_32180 6048 5629 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQQ9 protein_id gnl|my_center|LOCUS_32180 <8126 6336 gene locus_tag LOCUS_32190 <8126 6336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199580.1:alkaline phosphatase >Feature sequence094 1185 214 gene locus_tag LOCUS_32200 1185 214 CDS product ferredoxin:oxidoreductase FAD/NAD(P)-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 protein_id gnl|my_center|LOCUS_32200 1422 3200 gene locus_tag LOCUS_32210 1422 3200 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104293.1 protein_id gnl|my_center|LOCUS_32210 4115 3225 gene locus_tag LOCUS_32220 4115 3225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 protein_id gnl|my_center|LOCUS_32220 4346 5281 gene locus_tag LOCUS_32230 4346 5281 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_32230 7353 5614 gene locus_tag LOCUS_32240 gene mphR 7353 5614 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_32240 7656 7946 gene locus_tag LOCUS_32250 gene mphK 7656 7946 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence095 214 2685 gene locus_tag LOCUS_32260 214 2685 CDS product type I restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_32260 2685 3986 gene locus_tag LOCUS_32270 2685 3986 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_32270 4101 4343 gene locus_tag LOCUS_32280 4101 4343 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4V7 protein_id gnl|my_center|LOCUS_32280 4340 4603 gene locus_tag LOCUS_32290 4340 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence096 375 878 gene locus_tag LOCUS_32300 375 878 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_32300 1192 1938 gene locus_tag LOCUS_32310 gene flgF 1192 1938 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_32310 1967 2752 gene locus_tag LOCUS_32320 gene flgG 1967 2752 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_32320 2771 3508 gene locus_tag LOCUS_32330 gene flgH 2771 3508 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM39 protein_id gnl|my_center|LOCUS_32330 3708 5549 gene locus_tag LOCUS_32340 3708 5549 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383592.1 protein_id gnl|my_center|LOCUS_32340 5591 6721 gene locus_tag LOCUS_32350 gene flgI 5591 6721 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR7 protein_id gnl|my_center|LOCUS_32350 6718 7080 gene locus_tag LOCUS_32360 6718 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence097 <1 1023 gene locus_tag LOCUS_32370 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809837.1:3-phenylpropionate dioxygenase 1026 1496 gene locus_tag LOCUS_32380 1026 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 1504 1818 gene locus_tag LOCUS_32390 1504 1818 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_32390 1878 2840 gene locus_tag LOCUS_32400 1878 2840 CDS product TRAP ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_32400 2873 4804 gene locus_tag LOCUS_32410 2873 4804 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870207.1 protein_id gnl|my_center|LOCUS_32410 5378 5614 gene locus_tag LOCUS_32420 5378 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence098 448 927 gene locus_tag LOCUS_32430 448 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 2029 1013 gene locus_tag LOCUS_32440 gene add 2029 1013 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_32440 2635 2177 gene locus_tag LOCUS_32450 2635 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3636 2980 gene locus_tag LOCUS_32460 gene dhcB 3636 2980 CDS product dehydrocarnitine CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_32460 4373 3672 gene locus_tag LOCUS_32470 gene dhcA 4373 3672 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_32470 >Feature sequence099 529 56 gene locus_tag LOCUS_32480 gene secB 529 56 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_32480 957 544 gene locus_tag LOCUS_32490 957 544 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_32490 1306 2841 gene locus_tag LOCUS_32500 gene gpmI 1306 2841 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_32500 2845 3996 gene locus_tag LOCUS_32510 2845 3996 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_32510 4115 5443 gene locus_tag LOCUS_32520 4115 5443 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence100 1087 26 gene locus_tag LOCUS_32530 gene ydcT 1087 26 CDS product putative ABC transporter ATP-binding protein YdcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77795 protein_id gnl|my_center|LOCUS_32530 2330 1197 gene locus_tag LOCUS_32540 2330 1197 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047467.1 protein_id gnl|my_center|LOCUS_32540 2652 3653 gene locus_tag LOCUS_32550 2652 3653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976316.1 protein_id gnl|my_center|LOCUS_32550 3678 5120 gene locus_tag LOCUS_32560 3678 5120 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 protein_id gnl|my_center|LOCUS_32560 >Feature sequence101 645 1643 gene locus_tag LOCUS_32570 gene ascD 645 1643 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_32570 1735 2772 gene locus_tag LOCUS_32580 1735 2772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_32580 2854 3351 gene locus_tag LOCUS_32590 2854 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3360 4649 gene locus_tag LOCUS_32600 3360 4649 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_32600 5331 4720 gene locus_tag LOCUS_32610 5331 4720 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence102 1797 403 gene locus_tag LOCUS_32620 1797 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_32620 2957 1995 gene locus_tag LOCUS_32630 2957 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_32630 3298 3008 gene locus_tag LOCUS_32640 3298 3008 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020161.1 protein_id gnl|my_center|LOCUS_32640 3676 3413 gene locus_tag LOCUS_32650 3676 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 4306 3734 gene locus_tag LOCUS_32660 4306 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32660 5050 4337 gene locus_tag LOCUS_32670 5050 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32670 >Feature sequence103 1695 235 gene locus_tag LOCUS_32680 1695 235 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_32680 2871 1969 gene locus_tag LOCUS_32690 2871 1969 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704336.1 protein_id gnl|my_center|LOCUS_32690 2979 3551 gene locus_tag LOCUS_32700 2979 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 4615 3686 gene locus_tag LOCUS_32710 4615 3686 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978715.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence104 686 240 gene locus_tag LOCUS_32720 gene osmC 686 240 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_32720 1312 737 gene locus_tag LOCUS_32730 1312 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_32730 1851 1471 gene locus_tag LOCUS_32740 1851 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3018 1942 gene locus_tag LOCUS_32750 3018 1942 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_32750 4136 3015 gene locus_tag LOCUS_32760 4136 3015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968776.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence105 225 1151 gene locus_tag LOCUS_32770 225 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1285 1476 gene locus_tag LOCUS_32780 1285 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1931 2902 gene locus_tag LOCUS_32790 1931 2902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_32790 3023 3973 gene locus_tag LOCUS_32800 3023 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence106 193 381 gene locus_tag LOCUS_32810 193 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1850 633 gene locus_tag LOCUS_32820 gene argG 1850 633 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM3 protein_id gnl|my_center|LOCUS_32820 2712 2008 gene locus_tag LOCUS_32830 2712 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 4073 2757 gene locus_tag LOCUS_32840 4073 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence107 1661 2854 gene locus_tag LOCUS_32850 1661 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 protein_id gnl|my_center|LOCUS_32850 2998 3969 gene locus_tag LOCUS_32860 2998 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence108 70 1386 gene locus_tag LOCUS_32870 70 1386 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_32870 1534 2739 gene locus_tag LOCUS_32880 1534 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039340.1 protein_id gnl|my_center|LOCUS_32880 2736 3839 gene locus_tag LOCUS_32890 2736 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence109 72 545 gene locus_tag LOCUS_32900 72 545 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909686.1 protein_id gnl|my_center|LOCUS_32900 672 2366 gene locus_tag LOCUS_32910 gene pilB 672 2366 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_32910 2419 3648 gene locus_tag LOCUS_32920 2419 3648 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence110 2008 305 gene locus_tag LOCUS_32930 2008 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2427 2008 gene locus_tag LOCUS_32940 2427 2008 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_32940 <3653 2420 gene locus_tag LOCUS_32950 <3653 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932358.1:DNA methyltransferase >Feature sequence111 511 305 gene locus_tag LOCUS_32960 511 305 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 protein_id gnl|my_center|LOCUS_32960 889 3117 gene locus_tag LOCUS_32970 889 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence112 288 1157 gene locus_tag LOCUS_32980 288 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_32980 2018 1164 gene locus_tag LOCUS_32990 2018 1164 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104733.1 protein_id gnl|my_center|LOCUS_32990 2909 2130 gene locus_tag LOCUS_33000 2909 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence113 142 396 gene locus_tag LOCUS_33010 142 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_33010 393 1112 gene locus_tag LOCUS_33020 393 1112 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_33020 1447 1133 gene locus_tag LOCUS_33030 1447 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 1647 1925 gene locus_tag LOCUS_33040 1647 1925 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 protein_id gnl|my_center|LOCUS_33040 2036 3163 gene locus_tag LOCUS_33050 2036 3163 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence114 >Feature sequence115 343 471 gene locus_tag LOCUS_33060 343 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 704 1471 gene locus_tag LOCUS_33070 704 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 1468 3003 gene locus_tag LOCUS_33080 1468 3003 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence116 <1 2862 gene locus_tag LOCUS_33090 <1 2862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072046.1:invasin >Feature sequence117 69 1076 gene locus_tag LOCUS_33100 69 1076 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence118 129 542 gene locus_tag LOCUS_33110 129 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33110 532 954 gene locus_tag LOCUS_33120 532 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33120 936 1283 gene locus_tag LOCUS_33130 936 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence119 1767 583 gene locus_tag LOCUS_33140 1767 583 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence120 >Feature sequence121 39 1211 gene locus_tag LOCUS_33150 39 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence122 <1 1288 gene locus_tag LOCUS_33160 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYL3:regulatory protein NosR